IGR sequence: | igr3883#chr5#x1=19112826#l=3251 |
---|---|
Mature miRNA sequence: | AUUGUGAAACUGAGGGAGUAUUA |
encoded miRNA: | MIR32c |
Precursor location: | 1235 - 1458 (negative strand) |
precursor length: | 224 (67 basepairs) |
MIR position: | 202 - 224 (1235 - 1257) |
MIR length: | 23 (21 paired bases) |
miRNA location TIGR v3: | chr5:19114060<19114283 |
miRNA location TIGR v5: | chr5:19523118<19523341 |
Folding energy: | -51.20 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
AGUACUCCUU UUGUUUUACA AUAUAAGUUG UUUUAGCUAA AAACACACAA GUUAAGAAUA 60 (((((((((( (-(((((((( ((((((-((( ((((-((((( ,,,,,,,<<< <<<,,[[-[[ UUUACUUUUA AAAAGUUUAA CCAAUUAUAA AAGAGACUGC AUUAUAGAAA UAAUCAUAAA 120 [[[-[[---- ---[[[[[__ __________ ___]]]]]-- -----]]]]] ]]-]],,,,, AUAUUAAAAU UAUAUAAUUU GUAUAGAAAC UUGAAAACAA CUAAUAUUGU AAAAUAAAAA 180 ,,,,,,,,,[ [[[[[_____ ]]]]]],>>> >>>,,,[[[[ ______]]]] ,,,,,,,,,, ********* ********** **** AGUUAGUCCA AAACAAAUUA UAUUGUGAAA CUGAGGGAGU AUUA 224 ,,)))))--) ))))))-))) )))))))))) )-)))))))) ))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2590_58786-58914_107-129
- gnl|BL_ORD_ID|2590_58786+58914_1-23
- gnl|BL_ORD_ID|3319_91553-91707_133-155
- gnl|BL_ORD_ID|3319_91553+91707_1-23
- gnl|BL_ORD_ID|1324_89796-89949_132-154