IGR sequence: | igr3883#chr5#x1=19112826#l=3251 |
---|---|
Mature miRNA sequence: | AUUGUGAAACUGAGGGAGUAUUAA |
encoded miRNA: | MIR32b |
Precursor location: | 1234 - 1460 (negative strand) |
precursor length: | 227 (67 basepairs) |
MIR position: | 204 - 227 (1234 - 1257) |
MIR length: | 24 (21 paired bases) |
miRNA location TIGR v3: | chr5:19114059<19114285 |
miRNA location TIGR v5: | chr5:19523117<19523343 |
Folding energy: | -51.50 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UAAGUACUCC UUUUGUUUUA CAAUAUAAGU UGUUUUAGCU AAAAACACAC AAGUUAAGAA 60 ::(((((((( (((-(((((( ((((((((-( ((((((-((( ((,,,,,,,< <<<<<,,[[- UAUUUACUUU UAAAAAGUUU AACCAAUUAU AAAAGAGACU GCAUUAUAGA AAUAAUCAUA 120 [[[[[-[[-- -----[[[[[ __________ _____]]]]] -------]]] ]]]]-]],,, AAAUAUUAAA AUUAUAUAAU UUGUAUAGAA ACUUGAAAAC AACUAAUAUU GUAAAAUAAA 180 ,,,,,,,,,, ,[[[[[[___ __]]]]]],> >>>>>,,,[[ [[______]] ]],,,,,,,, ******* ********** ******* AAAGUUAGUC CAAAACAAAU UAUAUUGUGA AACUGAGGGA GUAUUAA 227 ,,,,)))))- -)))))))-) )))))))))) )))-)))))) )))))::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3351_70999-71160_139-162
- gnl|BL_ORD_ID|2991_132743-132904_139-162
- gnl|BL_ORD_ID|2721_21472-21631_137-160
- gnl|BL_ORD_ID|2339_56253-56434_159-182
- gnl|BL_ORD_ID|2339_56253+56434_1-24
- gnl|BL_ORD_ID|1411_178096+178277_1-24
- gnl|BL_ORD_ID|1411_178096-178277_159-182