IGR sequence: | igr3883#chr5#x1=19112826#l=3251 |
---|---|
Mature miRNA sequence: | AUUGUGAAACUGAGGGAGUAUUAAU |
encoded miRNA: | MIR32a |
Precursor location: | 1233 - 1460 (negative strand) |
precursor length: | 228 (67 basepairs) |
MIR position: | 204 - 228 (1233 - 1257) |
MIR length: | 25 (21 paired bases) |
miRNA location TIGR v3: | chr5:19114058<19114285 |
miRNA location TIGR v5: | chr5:19523116<19523343 |
Folding energy: | -51.50 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UAAGUACUCC UUUUGUUUUA CAAUAUAAGU UGUUUUAGCU AAAAACACAC AAGUUAAGAA 60 ::(((((((( (((-(((((( ((((((((-( ((((((-((( ((,,,,,,,< <<<<<,,[[- UAUUUACUUU UAAAAAGUUU AACCAAUUAU AAAAGAGACU GCAUUAUAGA AAUAAUCAUA 120 [[[[[-[[-- -----[[[[[ __________ _____]]]]] -------]]] ]]]]-]],,, AAAUAUUAAA AUUAUAUAAU UUGUAUAGAA ACUUGAAAAC AACUAAUAUU GUAAAAUAAA 180 ,,,,,,,,,, ,[[[[[[___ __]]]]]],> >>>>>,,,[[ [[______]] ]],,,,,,,, ******* ********** ******** AAAGUUAGUC CAAAACAAAU UAUAUUGUGA AACUGAGGGA GUAUUAAU 228 ,,,,)))))- -)))))))-) )))))))))) )))-)))))) ))))):::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2398_451-614_140-164
- gnl|BL_ORD_ID|2398_451+615_1-25
- gnl|BL_ORD_ID|2306_12886+13050_1-25
- gnl|BL_ORD_ID|2306_12886-13049_140-164
- gnl|BL_ORD_ID|1732_66933+67096_1-25
- gnl|BL_ORD_ID|982_101113-101179_43-67
- gnl|BL_ORD_ID|882_68592+68756_1-25
- gnl|BL_ORD_ID|882_68592-68755_140-164