IGR sequence: | igr3576#chr3#x1=16853469#l=1311 |
---|---|
Mature miRNA sequence: | CUAUUAAAACAAGGAGGGAGUA |
encoded miRNA: | MIR3a |
Precursor location: | 954 - 1193 (negative strand) |
precursor length: | 240 (60 basepairs) |
MIR position: | 219 - 240 (954 - 975) |
MIR length: | 22 (17 paired bases) |
miRNA location TIGR v3: | chr3:16854422<16854661 |
miRNA location TIGR v5: | chr3:16857412<16857651 |
Folding energy: | -47.29 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UACUCCCUAC GUUUUUAAUA AUUGAUGUUU UAAGAUUUCU CACACAUAUU AUUGAAUCAA 60 ((((((((-( --(((((((( -((((((((( (((((,,,,, ,,,,,,,<<< <<<<______ ACUAAAAUAA CAAUAAUUAA UUAUCUACAC ACAAUUCAAC CAAUGAUAUA ACACUCUGCG 120 __________ >>>>>>>,,, ,,,,,,,,,, ,,,,,,,,,< <<<--<<<<< <,,,,,,,[_ GAAGAUAAAU AGUCAAAAAC AAUAAAAAUU AAUGAAUAUU GUAUUGACAA CUGAAACAUU 180 ___],,,,,, ,[[[[[--[[ [[[[______ ______]]]] ]]-]]]]],, ,,,,,,,,>> ** ********** ********** AUAUAAUUUG GAACAAACGU UUUUCUCUAA AACAUCAACU AUUAAAACAA GGAGGGAGUA 240 >>>>--->>> >,,,,,,,,, ,,,)))-))) ))))))))-) )))))))--- )-))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2316_117121-117358_217-238
- gnl|BL_ORD_ID|2316_117121+117358_1-22
- gnl|BL_ORD_ID|244_104817+105054_1-22
- gnl|BL_ORD_ID|244_104817-105054_217-238