IGR sequence: | igr3576#chr3#x1=16853469#l=1311 |
---|---|
Mature miRNA sequence: | UACUCCCUCCUUGUUUUAAUAG |
encoded miRNA: | MIR3 |
Precursor location: | 954 - 1193 (positive strand) |
precursor length: | 240 (80 basepairs) |
MIR position: | 1 - 22 (954 - 975) |
MIR length: | 22 (18 paired bases) |
miRNA location TIGR v3: | chr3:16854422>16854661 |
miRNA location TIGR v5: | chr3:16857412>16857651 |
Folding energy: | -62.40 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** UACUCCCUCC UUGUUUUAAU AGUUGAUGUU UUAGAGAAAA ACGUUUGUUC CAAAUUAUAU 60 ((((((((-( ---((((((( (((((((((( ((-((((,<< <<<<<<<<__ ______>>>- AAUGUUUCAG UUGUCAAUAC AAUAUUCAUU AAUUUUUAUU GUUUUUGACU AUUUAUCUUC 120 >>>>>>>,,, ,,<<<<<-<< <<<<______ ______>>>> >>-->>>>>, ,,,,,<<<-- CGCAGAGUGU UAUAUCAUUG GUUGAAUUGU GUGUAGAUAA UUAAUUAUUG UUAUUUUAGU 180 <<<<,[[[[_ _____]]]], [[[[[[[[[- ----[[[[[[ [________] ]]]]]]---- UUGAUUCAAU AAUAUGUGUG AGAAAUCUUA AAACAUCAAU UAUUAAAAAC GUAGGGAGUA 240 -]]]]]]]]] ,,,,>>>>-- >>>,,))))) )))))))))) ))))))))-- )-))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2316_117121-117358_217-238
- gnl|BL_ORD_ID|2316_117121+117358_1-22
- gnl|BL_ORD_ID|244_104817+105054_1-22
- gnl|BL_ORD_ID|244_104817-105054_217-238