IGR sequence: | igr3494#chr2#x1=16598245#l=6010 |
---|---|
Mature miRNA sequence: | GAUCAAUGCGAUCCCUUUGGA |
encoded miRNA: | MIR20a |
Precursor location: | 2332 - 2444 (negative strand) |
precursor length: | 113 (36 basepairs) |
MIR position: | 93 - 113 (2332 - 2352) |
MIR length: | 21 (18 paired bases) |
miRNA location TIGR v3: | chr2:16600576<16600688 |
miRNA location TIGR v5: | chr2:16659189<16659301 |
Folding energy: | -33.80 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCCAAAGAGA UAGCAUGAUC CAAAACCAAG CAAAUUUUUG UGAUUUAUUU GCCAAUUAUA 60 (((((((-(( (-(((((((( (,,,,,,,,, ,,,,<<<<<< <<<<<_____ ___>>>>>>> ******** ********** *** AAGAAAAUAU GGGGAGAAUU CACCUUAAUU AGGAUCAAUG CGAUCCCUUU GGA 113 >>>>,,,,,< <<<<-<____ >->>>>>,,, ,)))))-))) )-)))-)))) )))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2699_72476-72570_75-95
- gnl|BL_ORD_ID|2699_72476+72570_1-21
- gnl|BL_ORD_ID|2325_26142-26236_75-95
- gnl|BL_ORD_ID|2325_26142+26236_1-21