IGR sequence: | igr3459#chr5#x1=17123821#l=3126 |
---|---|
Mature miRNA sequence: | UGAGGGGAAUGAAGCCUGGU |
encoded miRNA: | MIR70b |
Precursor location: | 731 - 1081 (negative strand) |
precursor length: | 351 (117 basepairs) |
MIR position: | 332 - 351 (731 - 750) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr5:17124551<17124901 |
miRNA location TIGR v5: | chr5:17533609<17533959 |
Folding energy: | -101.80 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
ACCAGGCUUC CUUCCCCUCA ACUUUACUCG GUGAUCUGUU ACUCUUAUAU AUAUGCAUGC 60 (((((((((( -((((((((( (((((((,<< <<-<<<<<-- -<<<<--<<, ,[[[[-[[[[ AUGUCAAAAG AAAUUUCGAU UAUAUUAUUU CUCUUAAUCA GCAAGGUUUA ACAGAUAUAU 120 ,,{{{-{{{_ ___}}}-}}} ,,,,,,,{{{ {{{{{{{{{- {{{,,,,,,, ,((----((( UAAGGAAACA AUUUUAAUAG AUAUGCCUAA UGUGUUUUUG AUAUACACCA UAUUAUAUAC 180 ((((____)- ---))))))- ---)),,((( (((((---(( ((((_____) )))))-)))) AUUGCUGCGG AUUGAUGAUG AAAGACGCAU ACAUACAAAA AAAGAUGAUA UACACGGAUA 240 )))),}}}-} }}}}}-}}-} }}},,,]]]] -]]]](((-- ((((((((-- -(((--(((_ CACCAUUUAU GUUCAUCUUU CUUGGCUUAC UAGAGAAUUA GGUGAUCGGC UAACGAUUGG 300 ____)))--) )))))))))) -))),,,>>- ->>>>--->> >>>->>>>(( (-----(--( ********* ********** * UCUUGAAGAU UGAGAAGCAA AACGUGUAAG UUGAGGGGAA UGAAGCCUGG U 351 ((_____))) --)--))),, ,,,)))-))) )))))))))) -))))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2976_135091-135215_106-125
- gnl|BL_ORD_ID|2976_135091+135215_1-20
- gnl|BL_ORD_ID|1743_127054-127178_106-125
- gnl|BL_ORD_ID|1743_127054+127178_1-20