IGR sequence: | igr3459#chr5#x1=17123821#l=3126 |
---|---|
Mature miRNA sequence: | ACCAGGCUUCAUUCCCCUCA |
encoded miRNA: | MIR70c |
Precursor location: | 731 - 1081 (positive strand) |
precursor length: | 351 (113 basepairs) |
MIR position: | 1 - 20 (731 - 750) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr5:17124551>17124901 |
miRNA location TIGR v5: | chr5:17533609>17533959 |
Folding energy: | -102.72 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ACCAGGCUUC AUUCCCCUCA ACUUACACGU UUUGCUUCUC AAUCUUCAAG ACCAAUCGUU 60 (((((((((( -((((((((( ((((((,,<< <<<<______ ______>>>> >>,,,,,,,, AGCCGAUCAC CUAAUUCUCU AGUAAGCCAA GAAAGAUGAA CAUAAAUGGU GUAUCCGUGU 120 ,,,,<<<<-- ------<<<< -<<<,,,,[[ [[[[[[[[[- -[[[-[[[[_ ____]]]]-] AUAUCAUCUU UUUUUGUAUG UAUGCGUCUU UCAUCAUCAA UCCGCAGCAA UGUAUAUAAU 180 ]]-]]]]]]] ]]]][[[[[[ [[[[[[[,,, ,,,,,,,,,, ,,,,{{{{{{ -{{---{{{{ AUGGUGUAUA UCAAAAACAC AUUAGGCAUA UCUAUUAAAA UUGUUUCCUU AAUAUAUCUG 240 {-{{{{{{{- ----{{{{{- --{{{{____ }}}}------ -}}}}}---- -}}}}}}}}} UUAAACCUUG CUGAUUAAGA GAAAUAAUAU AAUCGAAAUU UCUUUUGACA UGCAUGCAUA 300 }}}-}}-}}} }}},{{{{{{ {{{{{_____ _______}}} }}}}}}}},] ]]]]]]]]]] UAUAUAAGAG UAACAGAUCA CCGAGUAAAG UUGAGGGGAA GGAAGCCUGG U 351 ]]>>>->>>> ----->>>>, ,,,,))-))) )))))))))) -))))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2976_135091-135215_106-125
- gnl|BL_ORD_ID|2976_135091+135215_1-20
- gnl|BL_ORD_ID|1743_127054-127178_106-125
- gnl|BL_ORD_ID|1743_127054+127178_1-20