IGR sequence: | igr3459#chr5#x1=17123821#l=3126 |
---|---|
Mature miRNA sequence: | GGGGAAUGAAGCCUGGUCCGA |
encoded miRNA: | MIR70d |
Precursor location: | 727 - 1085 (negative strand) |
precursor length: | 359 (117 basepairs) |
MIR position: | 339 - 359 (727 - 747) |
MIR length: | 21 (16 paired bases) |
miRNA location TIGR v3: | chr5:17124547<17124905 |
miRNA location TIGR v5: | chr5:17533605<17533963 |
Folding energy: | -102.20 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUAAACCAGG CUUCCUUCCC CUCAACUUUA CUCGGUGAUC UGUUACUCUU AUAUAUAUGC 60 ::::(((((( ((((-((((( (((((((((( (,<<<<-<<< <<---<<<<- -<<,,[[[[- AUGCAUGUCA AAAGAAAUUU CGAUUAUAUU AUUUCUCUUA AUCAGCAAGG UUUAACAGAU 120 [[[[,,{{{- {{{____}}} -}}},,,,,, ,{{{{{{{{{ {{{-{{{,,, ,,,,,((--- AUAUUAAGGA AACAAUUUUA AUAGAUAUGC CUAAUGUGUU UUUGAUAUAC ACCAUAUUAU 180 -(((((((__ __)----))) )))----)), ,((((((((- --((((((__ ___))))))- AUACAUUGCU GCGGAUUGAU GAUGAAAGAC GCAUACAUAC AAAAAAAGAU GAUAUACACG 240 )))))))),} }}-}}}}}}- }}-}}}},,, ]]]]-]]]]( ((--(((((( ((---(((-- GAUACACCAU UUAUGUUCAU CUUUCUUGGC UUACUAGAGA AUUAGGUGAU CGGCUAACGA 300 (((_____)) )--))))))) ))))-))),, ,>>-->>>>- -->>>>>->> >>(((----- ** ********** ********* UUGGUCUUGA AGAUUGAGAA GCAAAACGUG UAAGUUGAGG GGAAUGAAGC CUGGUCCGA 359 (--(((____ _)))--)--) )),,,,,))) -))))))))) ))))-))))) )))))::::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1343_7352-7418_47-67
- gnl|BL_ORD_ID|1343_7352+7418_1-21
- gnl|BL_ORD_ID|1337_41287+41353_1-21
- gnl|BL_ORD_ID|1337_41287-41353_47-67