IGR sequence: | igr3459#chr5#x1=17123821#l=3126 |
---|---|
Mature miRNA sequence: | UCGGACCAGGCUUCAUUCCCC |
encoded miRNA: | MIR70e |
Precursor location: | 727 - 1085 (positive strand) |
precursor length: | 359 (115 basepairs) |
MIR position: | 1 - 21 (727 - 747) |
MIR length: | 21 (18 paired bases) |
miRNA location TIGR v3: | chr5:17124547>17124905 |
miRNA location TIGR v5: | chr5:17533605>17533963 |
Folding energy: | -105.52 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** * UCGGACCAGG CUUCAUUCCC CUCAACUUAC ACGUUUUGCU UCUCAAUCUU CAAGACCAAU 60 ::(((((((( ((((-((((( (((((((((( ,,<<<<<<__ __________ >>>>>>,,,, CGUUAGCCGA UCACCUAAUU CUCUAGUAAG CCAAGAAAGA UGAACAUAAA UGGUGUAUCC 120 ,,,,,,,,<< <<-------- <<<<-<<<,, ,,[[[[[[[[ [[[--[[[-[ [[[_____]] GUGUAUAUCA UCUUUUUUUG UAUGUAUGCG UCUUUCAUCA UCAAUCCGCA GCAAUGUAUA 180 ]]-]]]-]]] ]]]]]]]][[ [[[[[[[[[[ [,,,,,,,,, ,,,,,,,,{{ {{{{-{{--- UAAUAUGGUG UAUAUCAAAA ACACAUUAGG CAUAUCUAUU AAAAUUGUUU CCUUAAUAUA 240 {{{{{-{{{{ {{{-----{{ {{{---{{{{ ____}}}}-- -----}}}}} -----}}}}} UCUGUUAAAC CUUGCUGAUU AAGAGAAAUA AUAUAAUCGA AAUUUCUUUU GACAUGCAUG 300 }}}}}}}-}} -}}}}}},{{ {{{{{{{{{_ __________ _}}}}}}}}} }},]]]]]]] CAUAUAUAUA AGAGUAACAG AUCACCGAGU AAAGUUGAGG GGAAGGAAGC CUGGUUUAA 359 ]]]]]]>>>- >>>>-----> >>>,,,,,)) -))))))))) ))))-))))) )))))))::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1343_7352-7418_47-67
- gnl|BL_ORD_ID|1343_7352+7418_1-21
- gnl|BL_ORD_ID|1337_41287+41353_1-21
- gnl|BL_ORD_ID|1337_41287-41353_47-67