IGR sequence: | igr3289#chr5#x1=16380038#l=5991 |
---|---|
Mature miRNA sequence: | UGAGGGGAAUGAAGCCUGGU |
encoded miRNA: | MIR70b |
Precursor location: | 3654 - 3794 (positive strand) |
precursor length: | 141 (40 basepairs) |
MIR position: | 1 - 20 (3654 - 3673) |
MIR length: | 20 (15 paired bases) |
miRNA location TIGR v3: | chr5:16383691>16383831 |
miRNA location TIGR v5: | chr5:16792749>16792889 |
Folding energy: | -45.00 |
BLAST hit against RFAM Atha miRNAs: | ath-MIR166e |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** UGAGGGGAAU GAAGCCUGGU CCGACGUCAU UAACCGUAAA AUGAUCAUUC AUGUAUAGAC 60 :((((((((( (--(-((((- -(((-(((-( ((((,,,,,, ,,,,,,<<<< <<________ UAAUGAAUAA AGAAGAGACA UAUAUAUAUA AUCAAAUAUA GAUCUAAGUU AAGGGCCUCG 120 __>>>>>>,, ,,,,,<<<-- <<<<<_____ _____>>>>> -->>>,,))) ))-)))-))) UGCCAGACAA CAUUCCCCUC A 141 --))))-)-- )))))))))) :
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2976_135091-135215_106-125
- gnl|BL_ORD_ID|2976_135091+135215_1-20
- gnl|BL_ORD_ID|1743_127054-127178_106-125
- gnl|BL_ORD_ID|1743_127054+127178_1-20