IGR sequence: | igr3268#chr5#x1=16266119#l=7505 |
---|---|
Mature miRNA sequence: | AGGGAGCUCCCUUCAGUCCAAGCA |
encoded miRNA: | MIR69a |
Precursor location: | 2521 - 2692 (positive strand) |
precursor length: | 172 (62 basepairs) |
MIR position: | 1 - 24 (2521 - 2544) |
MIR length: | 24 (19 paired bases) |
miRNA location TIGR v3: | chr5:16268639>16268810 |
miRNA location TIGR v5: | chr5:16677697>16677868 |
Folding energy: | -74.90 |
BLAST hit against RFAM Atha miRNAs: | ath-MIR319b |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** **** AGGGAGCUCC CUUCAGUCCA AGCAUAGAGA AGUGAAGACU CAAUUUGUCU CUCGCAUCAU 60 ((((((((-- ((((-((((( --(((-(((( (((((-((-- ----(((-(( ((((--(((( UCAUUCAUUU ACCAUAUGAG AACAAAUUCU UUCAUUUGGU AUUUGGAUGA AUGAGUCGAG 120 (((((((--( ((((-((((( (________) )))))-)))) )--))))))) ))))--)))) AGUCAAUUAA AUCUCACAUA UUACUCCAUG AGUGGACCGA AGAAAGCUCU CU 172 ))-)))---- -))))))--- ))-)))-))) --)))))-)) ))--)))))) ))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|493_28731+28908_1-24
- gnl|BL_ORD_ID|493_28731-28908_155-178