Sequences
Gene information
- Gene CAN.G302.2
- Chromosome PGAv.1.6.scaffold302
- Start 890256
- Stop 890561
- Strand -
controller
GenesController Object
(
[name] => Genes
[helpers] => Array
(
[Session] =>
[Html] =>
[Form] =>
[Cache] =>
)
[uses] => Array
(
[0] => AdAnchorpoints
[1] => AdDuplicationTypes
[2] => AdGenes
[3] => AdMultiplicons
[4] => Annotation
[5] => AnnotationAllSpliceVariants
[6] => AnnotationExtra
[7] => AnnotationPagingGeneral
[8] => AnnotSource
[9] => BasicSearch
[10] => Configuration
[11] => DnaMotifsCns
[12] => DnaMotifsExperiments
[13] => DnaMotifsTfs
[14] => FunctionalClusters
[15] => FunctionalClustersData
[16] => FunctionalOntology
[17] => FunctionalOntologyHierarchy
[18] => GeneFamily
[19] => GeneFamilyTypes
[20] => GeneGo
[21] => GeneMapman
[22] => GeneProteinMotif
[23] => GfDatum
[24] => Msa
[25] => MetaProfiles
[26] => Orthologs
[27] => PhyloProfiles
[28] => Similarities
[29] => Trees
[30] => AdExperiments
[31] => FunctionalClustersExperiments
)
[components] => Array
(
[Session] =>
[DataUtils] =>
[FunctionalAnnotationUtils] =>
[GeneFamilies] =>
[Organism] =>
[Blast] =>
[WorkbenchUtils] =>
[AnnotationExtraDataProcessing] =>
[Colors] =>
[Coordinates] =>
[ExternalPrograms] =>
[FunctionalUtils] =>
[GeneList] =>
[GenomeBrowser] =>
[PhylogeneticUtils] =>
[Sequence] =>
[Statistics] =>
[RequestHandler] =>
)
[cacheAction] => Array
(
[stats/] => 86400
)
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[_responseClass:protected] => CakeResponse
[viewPath] => Genes
[layoutPath] =>
[viewVars] => Array
(
[sidebar] => gene_sidebar
[navigation_bar_info] => Array
(
[num_colinearity_runs] => 1
[num_colinearity_with_dating_runs] => 0
[num_functional_clusters_runs] => 6
[has_pan_genomes] =>
[has_blast_db] => 1
)
[sidebar_information] => Array
(
[type] => gene_id
[id] => CAN.G302.2
)
[gene_id] => CAN.G302.2
[gene_info] => Array
(
[gene_id] => CAN.G302.2
[species] => can
[transcript] => CAN.T302.2
[coord_cds] => complement(join(890256..890561))
[start] => 890256
[stop] => 890561
[coord_transcript] => complement(join(890256..890561))
[seq] => ATGGCACGTCAAATAGTGGCTCTTGCTCTAATCATTTTTGTTGTCTCCTTCAGAATGGCCTCCGCAATATCGAATGCCCCCGCATCTTCTTCTAGTGTTGCGGGAAGCCCAGTTGATAACAGCGTCATTGGTACCCTCGACGGAACGGTAGGAGGTGCTGCACCAGTTGGTGGACCAGTTCCTGAAGGTGCTTTCGCCAACCTATCTCCGGAATCACAATCTAGTGGCTCCATCATTACCCCTCAACTCCCCACCATTTTCTCTGTCGTCGTCTCAGCTGTTGTGGCTAGTTCCTTCCTCTTCTGA
[strand] => -
[chr] => PGAv.1.6.scaffold302
[type] => coding
[check_transcript] => eq
[check_protein] => eq
[transl_table] => 1
)
[title_for_layout] => Dicots PLAZA 5.0 : gene pages
)
[view] => sequences
[layout] => toolbox_layout
[autoRender] => 1
[autoLayout] => 1
[Components] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[viewClass] => View
[View] =>
[ext] => .ctp
[plugin] =>
[passedArgs] => Array
(
[0] => can
[1] => CAN.G302.2
)
[scaffold] =>
[methods] => Array
(
[1] => get_best_ortholog_descriptions
[2] => similarity_hits
[3] => sequences
[4] => gene_redirect
[5] => table
[6] => genes_table
[7] => index_reduced
[8] => index_reduced_download
[9] => index_reduced_extra
[10] => get_aasequence_features
[11] => get_dnasequence_features
[12] => parseGeneComment
[13] => colinear_gene_pairs
[14] => view
[15] => externalsources
[16] => plot_gene_structure
[17] => status
[18] => draw_gene_structure
[19] => tree_stats
[20] => stats
[21] => locate_gene
[22] => gene_duplication_analysis
[23] => from
)
[modelClass] => AdAnchorpoints
[modelKey] => gene
[validationErrors] =>
[_mergeParent:protected] => AppController
[_eventManager:protected] => CakeEventManager Object
(
[_listeners:protected] => Array
(
[Controller.initialize] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => GenesController Object
*RECURSION*
[1] => beforeFilter
)
[passParams] =>
)
)
)
[Controller.startup] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
)
)
[Controller.beforeRender] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => GenesController Object
*RECURSION*
[1] => beforeRender
)
[passParams] =>
)
)
)
[Controller.beforeRedirect] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => GenesController Object
*RECURSION*
[1] => beforeRedirect
)
[passParams] => 1
)
)
)
[Controller.shutdown] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => GenesController Object
*RECURSION*
[1] => afterFilter
)
[passParams] =>
)
)
)
)
[_isGlobal:protected] =>
)
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
*RECURSION*
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
*RECURSION*
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
*RECURSION*
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
*RECURSION*
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
*RECURSION*
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
*RECURSION*
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
*RECURSION*
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
*RECURSION*
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
*RECURSION*
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
*RECURSION*
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
*RECURSION*
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
*RECURSION*
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
*RECURSION*
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
*RECURSION*
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
*RECURSION*
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
*RECURSION*
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
*RECURSION*
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
*RECURSION*
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
*RECURSION*
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
*RECURSION*
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
*RECURSION*
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
*RECURSION*
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
*RECURSION*
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
)
[defaultPriority] => 10
)
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
(
[ajaxLayout] => ajax
[enabled] => 1
[request] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
[response] => CakeResponse Object
(
[_statusCodes:protected] => Array
(
[100] => Continue
[101] => Switching Protocols
[200] => OK
[201] => Created
[202] => Accepted
[203] => Non-Authoritative Information
[204] => No Content
[205] => Reset Content
[206] => Partial Content
[300] => Multiple Choices
[301] => Moved Permanently
[302] => Found
[303] => See Other
[304] => Not Modified
[305] => Use Proxy
[307] => Temporary Redirect
[400] => Bad Request
[401] => Unauthorized
[402] => Payment Required
[403] => Forbidden
[404] => Not Found
[405] => Method Not Allowed
[406] => Not Acceptable
[407] => Proxy Authentication Required
[408] => Request Time-out
[409] => Conflict
[410] => Gone
[411] => Length Required
[412] => Precondition Failed
[413] => Request Entity Too Large
[414] => Request-URI Too Large
[415] => Unsupported Media Type
[416] => Requested range not satisfiable
[417] => Expectation Failed
[429] => Too Many Requests
[500] => Internal Server Error
[501] => Not Implemented
[502] => Bad Gateway
[503] => Service Unavailable
[504] => Gateway Time-out
[505] => Unsupported Version
)
[_mimeTypes:protected] => Array
(
[html] => Array
(
[0] => text/html
[1] => */*
)
[json] => application/json
[xml] => Array
(
[0] => application/xml
[1] => text/xml
)
[rss] => application/rss+xml
[ai] => application/postscript
[bcpio] => application/x-bcpio
[bin] => application/octet-stream
[ccad] => application/clariscad
[cdf] => application/x-netcdf
[class] => application/octet-stream
[cpio] => application/x-cpio
[cpt] => application/mac-compactpro
[csh] => application/x-csh
[csv] => Array
(
[0] => text/csv
[1] => application/vnd.ms-excel
)
[dcr] => application/x-director
[dir] => application/x-director
[dms] => application/octet-stream
[doc] => application/msword
[docx] => application/vnd.openxmlformats-officedocument.wordprocessingml.document
[drw] => application/drafting
[dvi] => application/x-dvi
[dwg] => application/acad
[dxf] => application/dxf
[dxr] => application/x-director
[eot] => application/vnd.ms-fontobject
[eps] => application/postscript
[exe] => application/octet-stream
[ez] => application/andrew-inset
[flv] => video/x-flv
[gtar] => application/x-gtar
[gz] => application/x-gzip
[bz2] => application/x-bzip
[7z] => application/x-7z-compressed
[hdf] => application/x-hdf
[hqx] => application/mac-binhex40
[ico] => image/x-icon
[ips] => application/x-ipscript
[ipx] => application/x-ipix
[js] => application/javascript
[jsonapi] => application/vnd.api+json
[latex] => application/x-latex
[lha] => application/octet-stream
[lsp] => application/x-lisp
[lzh] => application/octet-stream
[man] => application/x-troff-man
[me] => application/x-troff-me
[mif] => application/vnd.mif
[ms] => application/x-troff-ms
[nc] => application/x-netcdf
[oda] => application/oda
[otf] => font/otf
[pdf] => application/pdf
[pgn] => application/x-chess-pgn
[pot] => application/vnd.ms-powerpoint
[pps] => application/vnd.ms-powerpoint
[ppt] => application/vnd.ms-powerpoint
[pptx] => application/vnd.openxmlformats-officedocument.presentationml.presentation
[ppz] => application/vnd.ms-powerpoint
[pre] => application/x-freelance
[prt] => application/pro_eng
[ps] => application/postscript
[roff] => application/x-troff
[scm] => application/x-lotusscreencam
[set] => application/set
[sh] => application/x-sh
[shar] => application/x-shar
[sit] => application/x-stuffit
[skd] => application/x-koan
[skm] => application/x-koan
[skp] => application/x-koan
[skt] => application/x-koan
[smi] => application/smil
[smil] => application/smil
[sol] => application/solids
[spl] => application/x-futuresplash
[src] => application/x-wais-source
[step] => application/STEP
[stl] => application/SLA
[stp] => application/STEP
[sv4cpio] => application/x-sv4cpio
[sv4crc] => application/x-sv4crc
[svg] => image/svg+xml
[svgz] => image/svg+xml
[swf] => application/x-shockwave-flash
[t] => application/x-troff
[tar] => application/x-tar
[tcl] => application/x-tcl
[tex] => application/x-tex
[texi] => application/x-texinfo
[texinfo] => application/x-texinfo
[tr] => application/x-troff
[tsp] => application/dsptype
[ttc] => font/ttf
[ttf] => font/ttf
[unv] => application/i-deas
[ustar] => application/x-ustar
[vcd] => application/x-cdlink
[vda] => application/vda
[xlc] => application/vnd.ms-excel
[xll] => application/vnd.ms-excel
[xlm] => application/vnd.ms-excel
[xls] => application/vnd.ms-excel
[xlsx] => application/vnd.openxmlformats-officedocument.spreadsheetml.sheet
[xlw] => application/vnd.ms-excel
[zip] => application/zip
[aif] => audio/x-aiff
[aifc] => audio/x-aiff
[aiff] => audio/x-aiff
[au] => audio/basic
[kar] => audio/midi
[mid] => audio/midi
[midi] => audio/midi
[mp2] => audio/mpeg
[mp3] => audio/mpeg
[mpga] => audio/mpeg
[ogg] => audio/ogg
[oga] => audio/ogg
[spx] => audio/ogg
[ra] => audio/x-realaudio
[ram] => audio/x-pn-realaudio
[rm] => audio/x-pn-realaudio
[rpm] => audio/x-pn-realaudio-plugin
[snd] => audio/basic
[tsi] => audio/TSP-audio
[wav] => audio/x-wav
[aac] => audio/aac
[asc] => text/plain
[c] => text/plain
[cc] => text/plain
[css] => text/css
[etx] => text/x-setext
[f] => text/plain
[f90] => text/plain
[h] => text/plain
[hh] => text/plain
[htm] => Array
(
[0] => text/html
[1] => */*
)
[ics] => text/calendar
[m] => text/plain
[rtf] => text/rtf
[rtx] => text/richtext
[sgm] => text/sgml
[sgml] => text/sgml
[tsv] => text/tab-separated-values
[tpl] => text/template
[txt] => text/plain
[text] => text/plain
[avi] => video/x-msvideo
[fli] => video/x-fli
[mov] => video/quicktime
[movie] => video/x-sgi-movie
[mpe] => video/mpeg
[mpeg] => video/mpeg
[mpg] => video/mpeg
[qt] => video/quicktime
[viv] => video/vnd.vivo
[vivo] => video/vnd.vivo
[ogv] => video/ogg
[webm] => video/webm
[mp4] => video/mp4
[m4v] => video/mp4
[f4v] => video/mp4
[f4p] => video/mp4
[m4a] => audio/mp4
[f4a] => audio/mp4
[f4b] => audio/mp4
[gif] => image/gif
[ief] => image/ief
[jpg] => image/jpeg
[jpeg] => image/jpeg
[jpe] => image/jpeg
[pbm] => image/x-portable-bitmap
[pgm] => image/x-portable-graymap
[png] => image/png
[pnm] => image/x-portable-anymap
[ppm] => image/x-portable-pixmap
[ras] => image/cmu-raster
[rgb] => image/x-rgb
[tif] => image/tiff
[tiff] => image/tiff
[xbm] => image/x-xbitmap
[xpm] => image/x-xpixmap
[xwd] => image/x-xwindowdump
[psd] => Array
(
[0] => application/photoshop
[1] => application/psd
[2] => image/psd
[3] => image/x-photoshop
[4] => image/photoshop
[5] => zz-application/zz-winassoc-psd
)
[ice] => x-conference/x-cooltalk
[iges] => model/iges
[igs] => model/iges
[mesh] => model/mesh
[msh] => model/mesh
[silo] => model/mesh
[vrml] => model/vrml
[wrl] => model/vrml
[mime] => www/mime
[pdb] => chemical/x-pdb
[xyz] => chemical/x-pdb
[javascript] => application/javascript
[form] => application/x-www-form-urlencoded
[file] => multipart/form-data
[xhtml] => Array
(
[0] => application/xhtml+xml
[1] => application/xhtml
[2] => text/xhtml
)
[xhtml-mobile] => application/vnd.wap.xhtml+xml
[atom] => application/atom+xml
[amf] => application/x-amf
[wap] => Array
(
[0] => text/vnd.wap.wml
[1] => text/vnd.wap.wmlscript
[2] => image/vnd.wap.wbmp
)
[wml] => text/vnd.wap.wml
[wmlscript] => text/vnd.wap.wmlscript
[wbmp] => image/vnd.wap.wbmp
[woff] => application/x-font-woff
[webp] => image/webp
[appcache] => text/cache-manifest
[manifest] => text/cache-manifest
[htc] => text/x-component
[rdf] => application/xml
[crx] => application/x-chrome-extension
[oex] => application/x-opera-extension
[xpi] => application/x-xpinstall
[safariextz] => application/octet-stream
[webapp] => application/x-web-app-manifest+json
[vcf] => text/x-vcard
[vtt] => text/vtt
[mkv] => video/x-matroska
[pkpass] => application/vnd.apple.pkpass
[ajax] => text/html
)
[_protocol:protected] => HTTP/1.1
[_status:protected] => 200
[_contentType:protected] => text/html
[_headers:protected] => Array
(
)
[_body:protected] =>
[_file:protected] =>
[_fileRange:protected] =>
[_charset:protected] => UTF-8
[_cacheDirectives:protected] => Array
(
)
[_cookies:protected] => Array
(
)
)
[ext] =>
[_renderType:protected] =>
[_inputTypeMap:protected] => Array
(
[json] => Array
(
[0] => json_decode
[1] => 1
)
[xml] => Array
(
[0] => Array
(
[0] => RequestHandlerComponent Object
*RECURSION*
[1] => convertXml
)
)
)
[_viewClassMap:protected] => Array
(
[json] => Json
[xml] => Xml
)
[_Collection:protected] => ComponentCollection Object
(
[_Controller:protected] => GenesController Object
*RECURSION*
[_enabled:protected] => Array
(
[Session] => Array
(
[0] => 10
[1] => 1
)
[DataUtils] => Array
(
[0] => 10
[1] => 2
)
[FunctionalAnnotationUtils] => Array
(
[0] => 10
[1] => 3
)
[GeneFamilies] => Array
(
[0] => 10
[1] => 4
)
[Organism] => Array
(
[0] => 10
[1] => 5
)
[Blast] => Array
(
[0] => 10
[1] => 6
)
[WorkbenchUtils] => Array
(
[0] => 10
[1] => 7
)
[AnnotationExtraDataProcessing] => Array
(
[0] => 10
[1] => 8
)
[Colors] => Array
(
[0] => 10
[1] => 9
)
[Coordinates] => Array
(
[0] => 10
[1] => 10
)
[ExternalPrograms] => Array
(
[0] => 10
[1] => 11
)
[FunctionalUtils] => Array
(
[0] => 10
[1] => 12
)
[GeneList] => Array
(
[0] => 10
[1] => 13
)
[GenomeBrowser] => Array
(
[0] => 10
[1] => 14
)
[PhylogeneticUtils] => Array
(
[0] => 10
[1] => 15
)
[Sequence] => Array
(
[0] => 10
[1] => 16
)
[Statistics] => Array
(
[0] => 10
[1] => 17
)
[RequestHandler] => Array
(
[0] => 10
[1] => 18
)
)
[_loaded:protected] => Array
(
[Session] => SessionComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[DataUtils] => DataUtilsComponent Object
(
[name] => DataUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FunctionalUtils
[2] => GeneFamilies
[3] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
)
[FunctionalAnnotationUtils] => FunctionalAnnotationUtilsComponent Object
(
[name] => FunctionalAnnotationUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GeneFamilies] => GeneFamiliesComponent Object
(
[name] => GeneFamilies
[controller:GeneFamiliesComponent:private] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Organism] => OrganismComponent Object
(
[name] => Organism
[controller:OrganismComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => GenomeBrowser
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[GenomeBrowser] => Array
(
[class] => GenomeBrowser
[settings] => Array
(
)
)
)
)
[Blast] => BlastComponent Object
(
[name] => Blast
[controller] => GenesController Object
*RECURSION*
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[WorkbenchUtils] => WorkbenchUtilsComponent Object
(
[name] => WorkbenchUtils
[controller:WorkbenchUtilsComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
[1] => FormUtils
[2] => FunctionalUtils
[3] => GeneFamilies
[4] => WorkbenchSharedAccessRights
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
[FormUtils] => Array
(
[class] => FormUtils
[settings] => Array
(
)
)
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
[GeneFamilies] => Array
(
[class] => GeneFamilies
[settings] => Array
(
)
)
[WorkbenchSharedAccessRights] => Array
(
[class] => WorkbenchSharedAccessRights
[settings] => Array
(
)
)
)
)
[AnnotationExtraDataProcessing] => AnnotationExtraDataProcessingComponent Object
(
[name] => AnnotationExtraDataProcessing
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Colors] => ColorsComponent Object
(
[name] => Colors
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[Coordinates] => CoordinatesComponent Object
(
[name] => Coordinates
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[ExternalPrograms] => ExternalProgramsComponent Object
(
[name] => ExternalPrograms
[components] => Array
(
[0] => FastaUtils
)
[program_paths:ExternalProgramsComponent:private] => Array
(
[java] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => java/x86_64/21.0.2
)
[command] => java -Djava.awt.headless=true
)
[local_settings] => java -Djava.awt.headless=true
[db_connector] => mysql-connector-java-8.0.21.jar
)
[perl] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => perl
)
[command] => perl -w
)
[local_settings] => /usr/bin/perl
)
[bash] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
)
[command] =>
)
[local_settings] =>
)
[bedops] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => bedops/x86_64/2.4.37
)
[command] =>
)
[local_settings] =>
)
[blastdbcmd] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] => blastdbcmd
)
[local_settings] => /usr/local/blast/2.2.24/bin/blastdbcmd
)
[blast] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => blast
)
[command] =>
)
[local_settings] => /usr/local/blast/2.2.24/bin/
)
[muscle] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => muscle/x86_64/3.8.31
)
)
)
[mafft] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => mafft/x86_64/7.187
)
)
)
[phyml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => phyml/x86_64/20150219
)
)
)
[fasttree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => fasttree/x86_64/2.1.7
)
)
)
[raxml] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => raxml/x86_64/8.2.8
)
)
)
[iqtree] => Array
(
[cluster_settings] => Array
(
[modules] => Array
(
[0] => iqtree/x86_64/1.5.5
)
)
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FastaUtils] => Array
(
[class] => FastaUtils
[settings] => Array
(
)
)
)
)
[FunctionalUtils] => FunctionalUtilsComponent Object
(
[name] => FunctionalUtils
[controller:FunctionalUtilsComponent:private] => GenesController Object
*RECURSION*
[go_sources_grouping:FunctionalUtilsComponent:private] => Array
(
[all] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
[3] => from_family
[4] => from_family_enrichment
)
[title] => All
[title2] => GO data from all sources
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 4
[default_selection] => 1
)
[primary] => Array
(
[sources] => Array
(
[0] => primary
)
[title] => Primary
[title2] => GO data from primary sources only
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] => 1
[default] => 1
[order] => 1
[default_selection] =>
)
[ortho_projection] => Array
(
[sources] => Array
(
[0] => primary
[1] => from_tree
[2] => from_iortho
)
[title] => Primary and Orthology
[title2] => GO data from primary sources and orthology projection
[meta_profiles] => 1
[sources_selection] => 1
[gene_page_selection] =>
[default] => 1
[order] => 2
[default_selection] =>
)
[orthology_only] => Array
(
[sources] => Array
(
[0] => from_tree
[1] => from_iortho
)
[title] => Orthology
[title2] => GO data exclusively orthology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 3
[default_selection] =>
)
[homology_only] => Array
(
[sources] => Array
(
[0] => from_family
[1] => from_family_enrichment
)
[title] => Homology
[title2] => GO data exclusively from homology projection
[meta_profiles] =>
[sources_selection] =>
[gene_page_selection] => 1
[default] => 1
[order] => 5
[default_selection] =>
)
)
[go_provider_mapping:FunctionalUtilsComponent:private] => Array
(
[from_annotation] => Array
(
[title] => Genome Project
[order] => 1
)
[uniprot] => Array
(
[title] => UniProt
[order] => 2
)
[gene_ontology] => Array
(
[title] => Gene Ontology
[order] => 3
)
[goa] => Array
(
[title] => GOA Database
[order] => 4
)
[interproscan] => Array
(
[title] => InterPro
[order] => 5
)
[PLAZA_from_tree] => Array
(
[title] => PLAZA Tree-based Orthology
[order] => 6
)
[PLAZA_from_iortho] => Array
(
[title] => PLAZA Integrative Orthology
[order] => 7
)
[PLAZA_from_family_enrichment] => Array
(
[title] => PLAZA Homology (enrichment)
[order] => 8
)
[PLAZA_from_family] => Array
(
[title] => PLAZA Homology
[order] => 9
)
[PLAZA] => Array
(
[title] => PLAZA
[order] => 10
)
)
[go_sources_information:FunctionalUtilsComponent:private] => Array
(
[primary] => Array
(
[title] => Primary
)
[from_tree] => Array
(
[title] => Phylogeny
)
[from_family] => Array
(
[title] => Homology
)
[from_family_enrichment] => Array
(
[title] => Homology
)
[from_iortho] => Array
(
[title] => Orthology
)
)
[go_aspects:FunctionalUtilsComponent:private] => Array
(
[BP] => Biological Process
[MF] => Molecular Function
[CC] => Cellular Component
)
[interpro_types:FunctionalUtilsComponent:private] => Array
(
[Family] => Family
[Domain] => Domain
[Active_site] => Active site
[Repeat] => Repeat
[Binding_site] => Binding site
[Conserved_site] => Conserved site
[PTM] => PTM
)
[ontology_types:FunctionalUtilsComponent:private] => Array
(
[go] => Array
(
[title] => Gene Ontology
)
[interpro] => Array
(
[title] => InterPro
)
[mapman] => Array
(
[title] => MapMan
)
)
[publication_linkouts:FunctionalUtilsComponent:private] => Array
(
[PMID] => http://www.ncbi.nlm.nih.gov/pubmed/%PMID%
[TAIR] => http://www.arabidopsis.org/servlets/TairObject?id=%TAIRID%&type=%TAIRTYPE%
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[GeneList] => GeneListComponent Object
(
[name] => GeneList
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => FunctionalUtils
)
[tables_allowed_types] => Array
(
[species] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Species
[has_description] =>
[optional] =>
[controller] => organism
)
[interpro] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => InterPro
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => interpro
)
[go] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
[evidence] => Array
(
)
[source] => Array
(
)
[source-group] => Array
(
)
)
[expand_entries] => Array
(
[0] => all
[1] => query
)
[title] => GO
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => go
)
[mapman] => Array
(
[exclusive] =>
[modifiers] => Array
(
[hierarchy] => Array
(
[0] => single_value
[1] => boolean
)
)
[title] => MapMan
[has_description] => 1
[optional] => 1
[expansion] => 1
[controller] => mapman
)
[gf] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Family
[has_description] =>
[optional] => 1
[controller] => gene_families
)
[genetype] => Array
(
[exclusive] => 1
[modifiers] => Array
(
)
[title] => Gene Type
[has_description] =>
[optional] => 1
)
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[FunctionalUtils] => Array
(
[class] => FunctionalUtils
[settings] => Array
(
)
)
)
)
[GenomeBrowser] => GenomeBrowserComponent Object
(
[name] => GenomeBrowser
[controller:GenomeBrowserComponent:private] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => PhylogeneticUtils
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[PhylogeneticUtils] => Array
(
[class] => PhylogeneticUtils
[settings] => Array
(
)
)
)
)
[PhylogeneticUtils] => PhylogeneticUtilsComponent Object
(
[name] => PhylogeneticUtils
[controller] => GenesController Object
*RECURSION*
[components] => Array
(
[0] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
)
[Sequence] => SequenceComponent Object
(
[name] => Sequence
[components] => Array
(
[0] => Blast
[1] => Coordinates
[2] => ExternalPrograms
)
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[_componentMap:protected] => Array
(
[Blast] => Array
(
[class] => Blast
[settings] => Array
(
)
)
[Coordinates] => Array
(
[class] => Coordinates
[settings] => Array
(
)
)
[ExternalPrograms] => Array
(
[class] => ExternalPrograms
[settings] => Array
(
)
)
)
[controller] => GenesController Object
*RECURSION*
)
[Statistics] => StatisticsComponent Object
(
[_Collection:protected] => ComponentCollection Object
*RECURSION*
[settings] => Array
(
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
)
[RequestHandler] => RequestHandlerComponent Object
*RECURSION*
)
[defaultPriority] => 10
)
[settings] => Array
(
[checkHttpCache] => 1
)
[components] => Array
(
)
[_componentMap:protected] => Array
(
)
[params] => CakeRequest Object
(
[params] => Array
(
[plugin] =>
[controller] => genes
[action] => sequences
[named] => Array
(
)
[pass] => Array
(
[0] => can
[1] => CAN.G302.2
)
[isAjax] =>
)
[data] => Array
(
)
[query] => Array
(
)
[url] => genes/sequences/can/CAN.G302.2
[base] => /plaza.dev/_dev_instances/feedback
[webroot] => /plaza.dev/_dev_instances/feedback/
[here] => /plaza.dev/_dev_instances/feedback/genes/sequences/can/CAN.G302.2
[_detectors:protected] => Array
(
[get] => Array
(
[env] => REQUEST_METHOD
[value] => GET
)
[patch] => Array
(
[env] => REQUEST_METHOD
[value] => PATCH
)
[post] => Array
(
[env] => REQUEST_METHOD
[value] => POST
)
[put] => Array
(
[env] => REQUEST_METHOD
[value] => PUT
)
[delete] => Array
(
[env] => REQUEST_METHOD
[value] => DELETE
)
[head] => Array
(
[env] => REQUEST_METHOD
[value] => HEAD
)
[options] => Array
(
[env] => REQUEST_METHOD
[value] => OPTIONS
)
[ssl] => Array
(
[env] => HTTPS
[value] => 1
)
[ajax] => Array
(
[env] => HTTP_X_REQUESTED_WITH
[value] => XMLHttpRequest
)
[flash] => Array
(
[env] => HTTP_USER_AGENT
[pattern] => /^(Shockwave|Adobe) Flash/
)
[mobile] => Array
(
[env] => HTTP_USER_AGENT
[options] => Array
(
[0] => Android
[1] => AvantGo
[2] => BB10
[3] => BlackBerry
[4] => DoCoMo
[5] => Fennec
[6] => iPod
[7] => iPhone
[8] => iPad
[9] => J2ME
[10] => MIDP
[11] => NetFront
[12] => Nokia
[13] => Opera Mini
[14] => Opera Mobi
[15] => PalmOS
[16] => PalmSource
[17] => portalmmm
[18] => Plucker
[19] => ReqwirelessWeb
[20] => SonyEricsson
[21] => Symbian
[22] => UP\.Browser
[23] => webOS
[24] => Windows CE
[25] => Windows Phone OS
[26] => Xiino
)
)
[requested] => Array
(
[param] => requested
[value] => 1
)
[json] => Array
(
[accept] => Array
(
[0] => application/json
)
[param] => ext
[value] => json
)
[xml] => Array
(
[accept] => Array
(
[0] => application/xml
[1] => text/xml
)
[param] => ext
[value] => xml
)
)
[_input:protected] =>
)
)
[Annotation] => Annotation Object
(
[name] => Annotation
[useTable] => annotation
[primaryKey] => gene_id
[cacheQueries] =>
[cacheSources] =>
[belongsTo] => Array
(
[AnnotSource] => Array
(
[foreignKey] => species
[className] => AnnotSource
[conditions] =>
[fields] =>
[order] =>
[counterCache] =>
)
)
[hasMany] => Array
(
[GfDatum] => Array
(
[foreignKey] => gene_id
[className] => GfDatum
[conditions] =>
[fields] =>
[order] =>
[limit] =>
[offset] =>
[dependent] =>
[exclusive] =>
[finderQuery] =>
[counterQuery] =>
)
)
[useDbConfig] => default
[id] =>
[data] => Array
(
)
[schemaName] => db_plaza_public_dicots_05
[table] => annotation
[_schema:protected] => Array
(
[gene_id] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 50
[key] => primary
[collate] => latin1_swedish_ci
[charset] => latin1
)
[species] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 21
[key] => index
[collate] => latin1_swedish_ci
[charset] => latin1
)
[transcript] => Array
(
[type] => string
[null] => 1
[default] =>
[length] => 100
[key] => index
[collate] => latin1_swedish_ci
[charset] => latin1
)
[coord_cds] => Array
(
[type] => text
[null] => 1
[default] =>
[length] =>
[collate] => latin1_swedish_ci
[charset] => latin1
)
[start] => Array
(
[type] => integer
[null] =>
[default] => 0
[length] =>
[unsigned] =>
)
[stop] => Array
(
[type] => integer
[null] =>
[default] => 0
[length] =>
[unsigned] =>
)
[coord_transcript] => Array
(
[type] => text
[null] => 1
[default] =>
[length] =>
[collate] => latin1_swedish_ci
[charset] => latin1
)
[seq] => Array
(
[type] => text
[null] =>
[default] =>
[length] =>
[collate] => latin1_swedish_ci
[charset] => latin1
)
[strand] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 1
[collate] => latin1_swedish_ci
[charset] => latin1
)
[chr] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 100
[key] => index
[collate] => latin1_swedish_ci
[charset] => latin1
)
[type] => Array
(
[type] => enum('coding','rna','te','pseudo')
[null] =>
[default] => coding
[length] => 6
[key] => index
[collate] => latin1_swedish_ci
[charset] => latin1
)
[check_transcript] => Array
(
[type] => enum('none','ne','eq')
[null] =>
[default] => none
[length] => 4
[key] => index
[collate] => latin1_swedish_ci
[charset] => latin1
)
[check_protein] => Array
(
[type] => enum('none','ne','eq')
[null] =>
[default] => none
[length] => 4
[key] => index
[collate] => latin1_swedish_ci
[charset] => latin1
)
[transl_table] => Array
(
[type] => tinyinteger
[null] =>
[default] => 1
[length] =>
[unsigned] =>
)
)
[validate] => Array
(
)
[validationErrors] => Array
(
)
[validationDomain] =>
[tablePrefix] =>
[plugin] =>
[alias] => Annotation
[tableToModel] => Array
(
[annotation] => Annotation
)
[hasOne] => Array
(
)
[hasAndBelongsToMany] => Array
(
)
[actsAs] =>
[Behaviors] => BehaviorCollection Object
(
[modelName] => Annotation
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[whitelist] => Array
(
)
[findQueryType] =>
[recursive] => 1
[order] =>
[virtualFields] => Array
(
)
[_associationKeys:protected] => Array
(
[belongsTo] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => counterCache
)
[hasOne] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => dependent
)
[hasMany] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => limit
[6] => offset
[7] => dependent
[8] => exclusive
[9] => finderQuery
[10] => counterQuery
)
[hasAndBelongsToMany] => Array
(
[0] => className
[1] => joinTable
[2] => with
[3] => foreignKey
[4] => associationForeignKey
[5] => conditions
[6] => fields
[7] => order
[8] => limit
[9] => offset
[10] => unique
[11] => finderQuery
)
)
[_associations:protected] => Array
(
[0] => belongsTo
[1] => hasOne
[2] => hasMany
[3] => hasAndBelongsToMany
)
[__backAssociation] => Array
(
)
[__backInnerAssociation] => Array
(
)
[__backOriginalAssociation] => Array
(
)
[__backContainableAssociation] => Array
(
)
[__safeUpdateMode] =>
[useConsistentAfterFind] => 1
[_insertID:protected] =>
[_sourceConfigured:protected] => 1
[findMethods] => Array
(
[all] => 1
[first] => 1
[count] => 1
[neighbors] => 1
[list] => 1
[threaded] => 1
)
[_eventManager:protected] => CakeEventManager Object
(
[_listeners:protected] => Array
(
[Model.beforeFind] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Annotation
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Annotation Object
*RECURSION*
[1] => beforeFind
)
[passParams] => 1
)
)
)
[Model.afterFind] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Annotation
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Annotation Object
*RECURSION*
[1] => afterFind
)
[passParams] => 1
)
)
)
[Model.beforeValidate] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Annotation
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Annotation Object
*RECURSION*
[1] => beforeValidate
)
[passParams] => 1
)
)
)
[Model.afterValidate] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Annotation
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Annotation Object
*RECURSION*
[1] => afterValidate
)
[passParams] =>
)
)
)
[Model.beforeSave] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Annotation
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Annotation Object
*RECURSION*
[1] => beforeSave
)
[passParams] => 1
)
)
)
[Model.afterSave] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Annotation
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Annotation Object
*RECURSION*
[1] => afterSave
)
[passParams] => 1
)
)
)
[Model.beforeDelete] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Annotation
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Annotation Object
*RECURSION*
[1] => beforeDelete
)
[passParams] => 1
)
)
)
[Model.afterDelete] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Annotation
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Annotation Object
*RECURSION*
[1] => afterDelete
)
[passParams] =>
)
)
)
)
[_isGlobal:protected] =>
)
[_validator:protected] =>
)
[AdExperiments] => AdExperiments Object
(
[name] => AdExperiments
[useTable] => ad_experiments
[primaryKey] => exp_id
[useDbConfig] => default
[id] =>
[data] => Array
(
)
[schemaName] => db_plaza_public_dicots_05
[table] => ad_experiments
[_schema:protected] => Array
(
[exp_id] => Array
(
[type] => smallinteger
[null] =>
[default] => 0
[length] =>
[unsigned] => 1
[key] => primary
)
[description] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 255
[collate] => latin1_swedish_ci
[charset] => latin1
)
[description_advanced] => Array
(
[type] => text
[null] => 1
[default] =>
[length] =>
[collate] => latin1_swedish_ci
[charset] => latin1
)
[organisms] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 512
[collate] => latin1_swedish_ci
[charset] => latin1
)
[to_show] => Array
(
[type] => enum('true','false')
[null] =>
[default] => false
[length] => 5
[collate] => latin1_swedish_ci
[charset] => latin1
)
)
[validate] => Array
(
)
[validationErrors] => Array
(
)
[validationDomain] =>
[tablePrefix] =>
[plugin] =>
[alias] => AdExperiments
[tableToModel] => Array
(
[ad_experiments] => AdExperiments
)
[cacheQueries] =>
[belongsTo] => Array
(
)
[hasOne] => Array
(
)
[hasMany] => Array
(
)
[hasAndBelongsToMany] => Array
(
)
[actsAs] =>
[Behaviors] => BehaviorCollection Object
(
[modelName] => AdExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[whitelist] => Array
(
)
[cacheSources] => 1
[findQueryType] =>
[recursive] => 1
[order] =>
[virtualFields] => Array
(
)
[_associationKeys:protected] => Array
(
[belongsTo] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => counterCache
)
[hasOne] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => dependent
)
[hasMany] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => limit
[6] => offset
[7] => dependent
[8] => exclusive
[9] => finderQuery
[10] => counterQuery
)
[hasAndBelongsToMany] => Array
(
[0] => className
[1] => joinTable
[2] => with
[3] => foreignKey
[4] => associationForeignKey
[5] => conditions
[6] => fields
[7] => order
[8] => limit
[9] => offset
[10] => unique
[11] => finderQuery
)
)
[_associations:protected] => Array
(
[0] => belongsTo
[1] => hasOne
[2] => hasMany
[3] => hasAndBelongsToMany
)
[__backAssociation] => Array
(
)
[__backInnerAssociation] => Array
(
)
[__backOriginalAssociation] => Array
(
)
[__backContainableAssociation] => Array
(
)
[__safeUpdateMode] =>
[useConsistentAfterFind] => 1
[_insertID:protected] =>
[_sourceConfigured:protected] => 1
[findMethods] => Array
(
[all] => 1
[first] => 1
[count] => 1
[neighbors] => 1
[list] => 1
[threaded] => 1
)
[_eventManager:protected] => CakeEventManager Object
(
[_listeners:protected] => Array
(
[Model.beforeFind] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AdExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AdExperiments Object
*RECURSION*
[1] => beforeFind
)
[passParams] => 1
)
)
)
[Model.afterFind] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AdExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AdExperiments Object
*RECURSION*
[1] => afterFind
)
[passParams] => 1
)
)
)
[Model.beforeValidate] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AdExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AdExperiments Object
*RECURSION*
[1] => beforeValidate
)
[passParams] => 1
)
)
)
[Model.afterValidate] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AdExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AdExperiments Object
*RECURSION*
[1] => afterValidate
)
[passParams] =>
)
)
)
[Model.beforeSave] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AdExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AdExperiments Object
*RECURSION*
[1] => beforeSave
)
[passParams] => 1
)
)
)
[Model.afterSave] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AdExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AdExperiments Object
*RECURSION*
[1] => afterSave
)
[passParams] => 1
)
)
)
[Model.beforeDelete] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AdExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AdExperiments Object
*RECURSION*
[1] => beforeDelete
)
[passParams] => 1
)
)
)
[Model.afterDelete] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AdExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AdExperiments Object
*RECURSION*
[1] => afterDelete
)
[passParams] =>
)
)
)
)
[_isGlobal:protected] =>
)
[_validator:protected] =>
)
[FunctionalClustersExperiments] => FunctionalClustersExperiments Object
(
[name] => FunctionalClustersExperiments
[useTable] => functional_clusters_experiments
[useDbConfig] => default
[id] =>
[data] => Array
(
)
[schemaName] => db_plaza_public_dicots_05
[table] => functional_clusters_experiments
[primaryKey] => id
[_schema:protected] => Array
(
[exp_id] => Array
(
[type] => tinyinteger
[null] =>
[default] =>
[length] =>
[unsigned] =>
[key] => primary
)
[data_type] => Array
(
[type] => enum('GO','InterPro','MapMan')
[null] =>
[default] =>
[length] => 8
[key] => index
[collate] => latin1_swedish_ci
[charset] => latin1
)
[extra] => Array
(
[type] => string
[null] => 1
[default] =>
[length] => 30
[collate] => latin1_swedish_ci
[charset] => latin1
)
[min_genes_cluster] => Array
(
[type] => integer
[null] => 1
[default] =>
[length] =>
[unsigned] =>
)
[max_genes_cluster] => Array
(
[type] => integer
[null] => 1
[default] =>
[length] =>
[unsigned] =>
)
[max_cluster_size] => Array
(
[type] => integer
[null] => 1
[default] =>
[length] =>
[unsigned] =>
)
[e-value] => Array
(
[type] => float
[null] => 1
[default] =>
[length] =>
[unsigned] =>
)
[cluster_overlap] => Array
(
[type] => integer
[null] => 1
[default] =>
[length] =>
[unsigned] =>
)
[has_tandems] => Array
(
[type] => boolean
[null] => 1
[default] =>
[length] => 1
)
)
[validate] => Array
(
)
[validationErrors] => Array
(
)
[validationDomain] =>
[tablePrefix] =>
[plugin] =>
[alias] => FunctionalClustersExperiments
[tableToModel] => Array
(
[functional_clusters_experiments] => FunctionalClustersExperiments
)
[cacheQueries] =>
[belongsTo] => Array
(
)
[hasOne] => Array
(
)
[hasMany] => Array
(
)
[hasAndBelongsToMany] => Array
(
)
[actsAs] =>
[Behaviors] => BehaviorCollection Object
(
[modelName] => FunctionalClustersExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[whitelist] => Array
(
)
[cacheSources] => 1
[findQueryType] =>
[recursive] => 1
[order] =>
[virtualFields] => Array
(
)
[_associationKeys:protected] => Array
(
[belongsTo] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => counterCache
)
[hasOne] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => dependent
)
[hasMany] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => limit
[6] => offset
[7] => dependent
[8] => exclusive
[9] => finderQuery
[10] => counterQuery
)
[hasAndBelongsToMany] => Array
(
[0] => className
[1] => joinTable
[2] => with
[3] => foreignKey
[4] => associationForeignKey
[5] => conditions
[6] => fields
[7] => order
[8] => limit
[9] => offset
[10] => unique
[11] => finderQuery
)
)
[_associations:protected] => Array
(
[0] => belongsTo
[1] => hasOne
[2] => hasMany
[3] => hasAndBelongsToMany
)
[__backAssociation] => Array
(
)
[__backInnerAssociation] => Array
(
)
[__backOriginalAssociation] => Array
(
)
[__backContainableAssociation] => Array
(
)
[__safeUpdateMode] =>
[useConsistentAfterFind] => 1
[_insertID:protected] =>
[_sourceConfigured:protected] => 1
[findMethods] => Array
(
[all] => 1
[first] => 1
[count] => 1
[neighbors] => 1
[list] => 1
[threaded] => 1
)
[_eventManager:protected] => CakeEventManager Object
(
[_listeners:protected] => Array
(
[Model.beforeFind] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => FunctionalClustersExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => FunctionalClustersExperiments Object
*RECURSION*
[1] => beforeFind
)
[passParams] => 1
)
)
)
[Model.afterFind] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => FunctionalClustersExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => FunctionalClustersExperiments Object
*RECURSION*
[1] => afterFind
)
[passParams] => 1
)
)
)
[Model.beforeValidate] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => FunctionalClustersExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => FunctionalClustersExperiments Object
*RECURSION*
[1] => beforeValidate
)
[passParams] => 1
)
)
)
[Model.afterValidate] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => FunctionalClustersExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => FunctionalClustersExperiments Object
*RECURSION*
[1] => afterValidate
)
[passParams] =>
)
)
)
[Model.beforeSave] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => FunctionalClustersExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => FunctionalClustersExperiments Object
*RECURSION*
[1] => beforeSave
)
[passParams] => 1
)
)
)
[Model.afterSave] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => FunctionalClustersExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => FunctionalClustersExperiments Object
*RECURSION*
[1] => afterSave
)
[passParams] => 1
)
)
)
[Model.beforeDelete] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => FunctionalClustersExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => FunctionalClustersExperiments Object
*RECURSION*
[1] => beforeDelete
)
[passParams] => 1
)
)
)
[Model.afterDelete] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => FunctionalClustersExperiments
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => FunctionalClustersExperiments Object
*RECURSION*
[1] => afterDelete
)
[passParams] =>
)
)
)
)
[_isGlobal:protected] =>
)
[_validator:protected] =>
)
[Configuration] => Configuration Object
(
[name] => Configuration
[useTable] => configuration
[useDbConfig] => default
[id] =>
[data] => Array
(
)
[schemaName] => db_plaza_public_dicots_05
[table] => configuration
[primaryKey] => id
[_schema:protected] => Array
(
[method] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 100
[key] => primary
[collate] => latin1_swedish_ci
[charset] => latin1
)
[key] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 255
[key] => primary
[collate] => latin1_swedish_ci
[charset] => latin1
)
[value] => Array
(
[type] => text
[null] =>
[default] =>
[length] =>
[key] => primary
[collate] => latin1_swedish_ci
[charset] => latin1
)
[comment] => Array
(
[type] => text
[null] =>
[default] =>
[length] =>
[key] => primary
[collate] => latin1_swedish_ci
[charset] => latin1
)
)
[validate] => Array
(
)
[validationErrors] => Array
(
)
[validationDomain] =>
[tablePrefix] =>
[plugin] =>
[alias] => Configuration
[tableToModel] => Array
(
[configuration] => Configuration
)
[cacheQueries] =>
[belongsTo] => Array
(
)
[hasOne] => Array
(
)
[hasMany] => Array
(
)
[hasAndBelongsToMany] => Array
(
)
[actsAs] =>
[Behaviors] => BehaviorCollection Object
(
[modelName] => Configuration
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[whitelist] => Array
(
)
[cacheSources] => 1
[findQueryType] =>
[recursive] => 1
[order] =>
[virtualFields] => Array
(
)
[_associationKeys:protected] => Array
(
[belongsTo] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => counterCache
)
[hasOne] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => dependent
)
[hasMany] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => limit
[6] => offset
[7] => dependent
[8] => exclusive
[9] => finderQuery
[10] => counterQuery
)
[hasAndBelongsToMany] => Array
(
[0] => className
[1] => joinTable
[2] => with
[3] => foreignKey
[4] => associationForeignKey
[5] => conditions
[6] => fields
[7] => order
[8] => limit
[9] => offset
[10] => unique
[11] => finderQuery
)
)
[_associations:protected] => Array
(
[0] => belongsTo
[1] => hasOne
[2] => hasMany
[3] => hasAndBelongsToMany
)
[__backAssociation] => Array
(
)
[__backInnerAssociation] => Array
(
)
[__backOriginalAssociation] => Array
(
)
[__backContainableAssociation] => Array
(
)
[__safeUpdateMode] =>
[useConsistentAfterFind] => 1
[_insertID:protected] =>
[_sourceConfigured:protected] => 1
[findMethods] => Array
(
[all] => 1
[first] => 1
[count] => 1
[neighbors] => 1
[list] => 1
[threaded] => 1
)
[_eventManager:protected] => CakeEventManager Object
(
[_listeners:protected] => Array
(
[Model.beforeFind] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Configuration
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Configuration Object
*RECURSION*
[1] => beforeFind
)
[passParams] => 1
)
)
)
[Model.afterFind] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Configuration
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Configuration Object
*RECURSION*
[1] => afterFind
)
[passParams] => 1
)
)
)
[Model.beforeValidate] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Configuration
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Configuration Object
*RECURSION*
[1] => beforeValidate
)
[passParams] => 1
)
)
)
[Model.afterValidate] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Configuration
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Configuration Object
*RECURSION*
[1] => afterValidate
)
[passParams] =>
)
)
)
[Model.beforeSave] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Configuration
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Configuration Object
*RECURSION*
[1] => beforeSave
)
[passParams] => 1
)
)
)
[Model.afterSave] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Configuration
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Configuration Object
*RECURSION*
[1] => afterSave
)
[passParams] => 1
)
)
)
[Model.beforeDelete] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Configuration
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Configuration Object
*RECURSION*
[1] => beforeDelete
)
[passParams] => 1
)
)
)
[Model.afterDelete] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => Configuration
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => Configuration Object
*RECURSION*
[1] => afterDelete
)
[passParams] =>
)
)
)
)
[_isGlobal:protected] =>
)
[_validator:protected] =>
)
[AnnotSource] => AnnotSource Object
(
[name] => AnnotSource
[useTable] => annot_sources
[primaryKey] => species
[displayField] => common_name
[useDbConfig] => default
[id] =>
[data] => Array
(
)
[schemaName] => db_plaza_public_dicots_05
[table] => annot_sources
[_schema:protected] => Array
(
[source] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 255
[collate] => latin1_swedish_ci
[charset] => latin1
)
[url] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 250
[collate] => latin1_swedish_ci
[charset] => latin1
)
[species] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 21
[key] => primary
[collate] => latin1_swedish_ci
[charset] => latin1
)
[common_name] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 100
[key] => index
[collate] => latin1_swedish_ci
[charset] => latin1
)
[eco_type] => Array
(
[type] => string
[null] => 1
[default] =>
[length] => 100
[collate] => latin1_swedish_ci
[charset] => latin1
)
[description] => Array
(
[type] => text
[null] =>
[default] =>
[length] =>
[collate] => latin1_swedish_ci
[charset] => latin1
)
[paper] => Array
(
[type] => text
[null] => 1
[default] =>
[length] =>
[collate] => latin1_swedish_ci
[charset] => latin1
)
[pubmed_id] => Array
(
[type] => integer
[null] => 1
[default] =>
[length] =>
[unsigned] =>
)
[tax_id] => Array
(
[type] => integer
[null] =>
[default] => 0
[length] =>
[unsigned] =>
)
[mitochondrion] => Array
(
[type] => string
[null] => 1
[default] =>
[length] => 15
[collate] => latin1_swedish_ci
[charset] => latin1
)
[chloroplast] => Array
(
[type] => string
[null] => 1
[default] =>
[length] => 15
[collate] => latin1_swedish_ci
[charset] => latin1
)
[disclaimer] => Array
(
[type] => text
[null] => 1
[default] =>
[length] =>
[collate] => latin1_swedish_ci
[charset] => latin1
)
)
[validate] => Array
(
)
[validationErrors] => Array
(
)
[validationDomain] =>
[tablePrefix] =>
[plugin] =>
[alias] => AnnotSource
[tableToModel] => Array
(
[annot_sources] => AnnotSource
)
[cacheQueries] =>
[belongsTo] => Array
(
)
[hasOne] => Array
(
)
[hasMany] => Array
(
)
[hasAndBelongsToMany] => Array
(
)
[actsAs] =>
[Behaviors] => BehaviorCollection Object
(
[modelName] => AnnotSource
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[whitelist] => Array
(
)
[cacheSources] => 1
[findQueryType] =>
[recursive] => 1
[order] =>
[virtualFields] => Array
(
)
[_associationKeys:protected] => Array
(
[belongsTo] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => counterCache
)
[hasOne] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => dependent
)
[hasMany] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => limit
[6] => offset
[7] => dependent
[8] => exclusive
[9] => finderQuery
[10] => counterQuery
)
[hasAndBelongsToMany] => Array
(
[0] => className
[1] => joinTable
[2] => with
[3] => foreignKey
[4] => associationForeignKey
[5] => conditions
[6] => fields
[7] => order
[8] => limit
[9] => offset
[10] => unique
[11] => finderQuery
)
)
[_associations:protected] => Array
(
[0] => belongsTo
[1] => hasOne
[2] => hasMany
[3] => hasAndBelongsToMany
)
[__backAssociation] => Array
(
)
[__backInnerAssociation] => Array
(
)
[__backOriginalAssociation] => Array
(
)
[__backContainableAssociation] => Array
(
)
[__safeUpdateMode] =>
[useConsistentAfterFind] => 1
[_insertID:protected] =>
[_sourceConfigured:protected] => 1
[findMethods] => Array
(
[all] => 1
[first] => 1
[count] => 1
[neighbors] => 1
[list] => 1
[threaded] => 1
)
[_eventManager:protected] => CakeEventManager Object
(
[_listeners:protected] => Array
(
[Model.beforeFind] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AnnotSource
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AnnotSource Object
*RECURSION*
[1] => beforeFind
)
[passParams] => 1
)
)
)
[Model.afterFind] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AnnotSource
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AnnotSource Object
*RECURSION*
[1] => afterFind
)
[passParams] => 1
)
)
)
[Model.beforeValidate] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AnnotSource
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AnnotSource Object
*RECURSION*
[1] => beforeValidate
)
[passParams] => 1
)
)
)
[Model.afterValidate] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AnnotSource
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AnnotSource Object
*RECURSION*
[1] => afterValidate
)
[passParams] =>
)
)
)
[Model.beforeSave] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AnnotSource
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AnnotSource Object
*RECURSION*
[1] => beforeSave
)
[passParams] => 1
)
)
)
[Model.afterSave] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AnnotSource
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AnnotSource Object
*RECURSION*
[1] => afterSave
)
[passParams] => 1
)
)
)
[Model.beforeDelete] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AnnotSource
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AnnotSource Object
*RECURSION*
[1] => beforeDelete
)
[passParams] => 1
)
)
)
[Model.afterDelete] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => AnnotSource
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => AnnotSource Object
*RECURSION*
[1] => afterDelete
)
[passParams] =>
)
)
)
)
[_isGlobal:protected] =>
)
[_validator:protected] =>
)
[Msa] => Msa Object
(
[name] => Msa
[useTable] => msa
[primaryKey] => msa_id
[useDbConfig] => default
[id] =>
[data] => Array
(
)
[schemaName] =>
[table] => msa
[_schema:protected] =>
[validate] => Array
(
)
[validationErrors] => Array
(
)
[validationDomain] =>
[plugin] =>
[alias] => Msa
[tableToModel] => Array
(
[msa] => Msa
)
[cacheQueries] =>
[belongsTo] => Array
(
)
[hasOne] => Array
(
)
[hasMany] => Array
(
)
[hasAndBelongsToMany] => Array
(
)
[actsAs] =>
[Behaviors] => BehaviorCollection Object
(
[modelName] => Msa
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[whitelist] => Array
(
)
[cacheSources] => 1
[findQueryType] =>
[recursive] => 1
[order] =>
[virtualFields] => Array
(
)
[_associationKeys:protected] => Array
(
[belongsTo] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => counterCache
)
[hasOne] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => dependent
)
[hasMany] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => limit
[6] => offset
[7] => dependent
[8] => exclusive
[9] => finderQuery
[10] => counterQuery
)
[hasAndBelongsToMany] => Array
(
[0] => className
[1] => joinTable
[2] => with
[3] => foreignKey
[4] => associationForeignKey
[5] => conditions
[6] => fields
[7] => order
[8] => limit
[9] => offset
[10] => unique
[11] => finderQuery
)
)
[_associations:protected] => Array
(
[0] => belongsTo
[1] => hasOne
[2] => hasMany
[3] => hasAndBelongsToMany
)
[__backAssociation] => Array
(
)
[__backInnerAssociation] => Array
(
)
[__backOriginalAssociation] => Array
(
)
[__backContainableAssociation] => Array
(
)
[__safeUpdateMode] =>
[useConsistentAfterFind] => 1
[_insertID:protected] =>
[_sourceConfigured:protected] =>
[findMethods] => Array
(
[all] => 1
[first] => 1
[count] => 1
[neighbors] => 1
[list] => 1
[threaded] => 1
)
[_eventManager:protected] =>
[_validator:protected] =>
)
[Trees] => Trees Object
(
[name] => Trees
[useTable] => trees
[useDbConfig] => default
[id] =>
[data] => Array
(
)
[schemaName] =>
[table] => trees
[primaryKey] => id
[_schema:protected] =>
[validate] => Array
(
)
[validationErrors] => Array
(
)
[validationDomain] =>
[plugin] =>
[alias] => Trees
[tableToModel] => Array
(
[trees] => Trees
)
[cacheQueries] =>
[belongsTo] => Array
(
)
[hasOne] => Array
(
)
[hasMany] => Array
(
)
[hasAndBelongsToMany] => Array
(
)
[actsAs] =>
[Behaviors] => BehaviorCollection Object
(
[modelName] => Trees
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[whitelist] => Array
(
)
[cacheSources] => 1
[findQueryType] =>
[recursive] => 1
[order] =>
[virtualFields] => Array
(
)
[_associationKeys:protected] => Array
(
[belongsTo] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => counterCache
)
[hasOne] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => dependent
)
[hasMany] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => limit
[6] => offset
[7] => dependent
[8] => exclusive
[9] => finderQuery
[10] => counterQuery
)
[hasAndBelongsToMany] => Array
(
[0] => className
[1] => joinTable
[2] => with
[3] => foreignKey
[4] => associationForeignKey
[5] => conditions
[6] => fields
[7] => order
[8] => limit
[9] => offset
[10] => unique
[11] => finderQuery
)
)
[_associations:protected] => Array
(
[0] => belongsTo
[1] => hasOne
[2] => hasMany
[3] => hasAndBelongsToMany
)
[__backAssociation] => Array
(
)
[__backInnerAssociation] => Array
(
)
[__backOriginalAssociation] => Array
(
)
[__backContainableAssociation] => Array
(
)
[__safeUpdateMode] =>
[useConsistentAfterFind] => 1
[_insertID:protected] =>
[_sourceConfigured:protected] =>
[findMethods] => Array
(
[all] => 1
[first] => 1
[count] => 1
[neighbors] => 1
[list] => 1
[threaded] => 1
)
[_eventManager:protected] =>
[_validator:protected] =>
)
[GeneFamilyTypes] => GeneFamilyTypes Object
(
[name] => GeneFamilyTypes
[useTable] => gene_family_types
[primaryKey] => id
[displayField] => name
[useDbConfig] => default
[id] =>
[data] => Array
(
)
[schemaName] => db_plaza_public_dicots_05
[table] => gene_family_types
[_schema:protected] => Array
(
[id] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 10
[key] => primary
[collate] => latin1_swedish_ci
[comment] => unique identifier for this gene family type. foreign key to other GF tables
[charset] => latin1
)
[name] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 50
[collate] => latin1_swedish_ci
[comment] => description of gene family type
[charset] => latin1
)
[prefix] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 10
[collate] => latin1_swedish_ci
[comment] => prefix used for building the gf type. for compatibility reasons. shouldn't be used.
[charset] => latin1
)
[gene_type] => Array
(
[type] => enum('coding','rna','pseudo','te')
[null] =>
[default] => coding
[length] => 6
[collate] => latin1_swedish_ci
[comment] => should match type from table annotation
[charset] => latin1
)
[method] => Array
(
[type] => string
[null] =>
[default] =>
[length] => 500
[collate] => latin1_swedish_ci
[comment] => JSON style information of the building method+parameters used
[charset] => latin1
)
[ancestry] => Array
(
[type] => enum('homology','orthology','homeology','other')
[null] =>
[default] => homology
[length] => 9
[key] => index
[collate] => latin1_swedish_ci
[comment] => type of gene family content
[charset] => latin1
)
[parent_id] => Array
(
[type] => string
[null] => 1
[default] =>
[length] => 10
[collate] => latin1_swedish_ci
[comment] => link to the parent id if appropriate
[charset] => latin1
)
)
[validate] => Array
(
)
[validationErrors] => Array
(
)
[validationDomain] =>
[tablePrefix] =>
[plugin] =>
[alias] => GeneFamilyTypes
[tableToModel] => Array
(
[gene_family_types] => GeneFamilyTypes
)
[cacheQueries] =>
[belongsTo] => Array
(
)
[hasOne] => Array
(
)
[hasMany] => Array
(
)
[hasAndBelongsToMany] => Array
(
)
[actsAs] =>
[Behaviors] => BehaviorCollection Object
(
[modelName] => GeneFamilyTypes
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[whitelist] => Array
(
)
[cacheSources] => 1
[findQueryType] =>
[recursive] => 1
[order] =>
[virtualFields] => Array
(
)
[_associationKeys:protected] => Array
(
[belongsTo] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => counterCache
)
[hasOne] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => dependent
)
[hasMany] => Array
(
[0] => className
[1] => foreignKey
[2] => conditions
[3] => fields
[4] => order
[5] => limit
[6] => offset
[7] => dependent
[8] => exclusive
[9] => finderQuery
[10] => counterQuery
)
[hasAndBelongsToMany] => Array
(
[0] => className
[1] => joinTable
[2] => with
[3] => foreignKey
[4] => associationForeignKey
[5] => conditions
[6] => fields
[7] => order
[8] => limit
[9] => offset
[10] => unique
[11] => finderQuery
)
)
[_associations:protected] => Array
(
[0] => belongsTo
[1] => hasOne
[2] => hasMany
[3] => hasAndBelongsToMany
)
[__backAssociation] => Array
(
)
[__backInnerAssociation] => Array
(
)
[__backOriginalAssociation] => Array
(
)
[__backContainableAssociation] => Array
(
)
[__safeUpdateMode] =>
[useConsistentAfterFind] => 1
[_insertID:protected] =>
[_sourceConfigured:protected] => 1
[findMethods] => Array
(
[all] => 1
[first] => 1
[count] => 1
[neighbors] => 1
[list] => 1
[threaded] => 1
)
[_eventManager:protected] => CakeEventManager Object
(
[_listeners:protected] => Array
(
[Model.beforeFind] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => GeneFamilyTypes
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => GeneFamilyTypes Object
*RECURSION*
[1] => beforeFind
)
[passParams] => 1
)
)
)
[Model.afterFind] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => GeneFamilyTypes
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => GeneFamilyTypes Object
*RECURSION*
[1] => afterFind
)
[passParams] => 1
)
)
)
[Model.beforeValidate] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => GeneFamilyTypes
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => GeneFamilyTypes Object
*RECURSION*
[1] => beforeValidate
)
[passParams] => 1
)
)
)
[Model.afterValidate] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => GeneFamilyTypes
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => GeneFamilyTypes Object
*RECURSION*
[1] => afterValidate
)
[passParams] =>
)
)
)
[Model.beforeSave] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => GeneFamilyTypes
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => GeneFamilyTypes Object
*RECURSION*
[1] => beforeSave
)
[passParams] => 1
)
)
)
[Model.afterSave] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => GeneFamilyTypes
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => GeneFamilyTypes Object
*RECURSION*
[1] => afterSave
)
[passParams] => 1
)
)
)
[Model.beforeDelete] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => GeneFamilyTypes
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => GeneFamilyTypes Object
*RECURSION*
[1] => beforeDelete
)
[passParams] => 1
)
)
)
[Model.afterDelete] => Array
(
[10] => Array
(
[0] => Array
(
[callable] => Array
(
[0] => BehaviorCollection Object
(
[modelName] => GeneFamilyTypes
[_methods:protected] => Array
(
)
[_mappedMethods:protected] => Array
(
)
[_enabled:protected] => Array
(
)
[_loaded:protected] => Array
(
)
[defaultPriority] => 10
)
[1] => trigger
)
[passParams] =>
)
[1] => Array
(
[callable] => Array
(
[0] => GeneFamilyTypes Object
*RECURSION*
[1] => afterDelete
)
[passParams] =>
)
)
)
)
[_isGlobal:protected] =>
)
[_validator:protected] =>
)
)