>PAB00000248 ATGCCATGGATGTTGGTTGTGTACTTAGTCTTCATGTTTGTCCTCATTATTCTGCTCACAGCTCTCATTATCTTTGTGTTCCTTGTCACTGAAAAGGGCCATGGCCACAGCGTTCCAAGCAGAGTTTATAGGGAATACAGCCTCAACGACTTCTCTGGATGGTTACGCCACCGTGTAGAGAGTTCTGGCAGGTGGAATCATATCAGAAACTGCCTCAGCTCATCCACTTCATGCAGCAGGTTGAACCAGAGGTTCACCCTTGCCCAGGATTTCTTCAATTTCCCCATTAGCCCTTTGCAGTCTGGATGCTGTAAACCGCCAACAGAATGTGGATATACATTTGTGAATCCAACTTATTGGATAAGCCCCATAAACCAAGGTGCAGATTTTGATTGCTTGCTGTGGAGTAACGACCAGACACAGTTGTGCTACAGTTGCAGTTCCTGTAAAGCGGGCCTGTTGGAAAACCTGAAAGTAGATTGGAGAGTGGCCGATATTGTTCTGCTGGTCACTCTGGTAGCCCTCATTTGGGTGTACATAGTTGGATGCAGCGCCTTCCGCAAAGCCCAGACACAGGACCTCTTTAGTCGTTACAAGCAGGGCTATACTTGA >PAB00017691 ATGACAGTCAGCAACTGCATCGCAGGGGTACGGACTTTTGCAGAAATGGTTTTATCCGTCTTGATTATTGGATCTGGGATATGGCTGGCCTCCAAACAGGACACTGAATGCGTGAGGTTCCTACGCTGGCCTCTCATTACCATAGGAGTCATTCTGCTGCTGGTCTCTGCAGCAGGTTTTGTGGGTGCAGTCTGGAGAGTCCAATATCTGTCAGCCATGTATCTCATCTTCATGTTTGTGCTCATTATTGCGCTATTGGCCCTGGTGATATTTATCTTTGTGGTTGTAAACAAGGGAGGAGGATACACTGTTCTACGCAGAAACAATGATGAGTACCAGCTGAATGATTTTTCATGGTGGCTGAGGCATTATGTTGAGAATGCCAAACACTGGAATGAGATTAAAAGCTTCCTTAGTTCTTCTGAACTGTGCAGTCAGTTGGATCAAAGATACCCAAGTGCCCAGTATTTCTTCAATGCACATCTCAAGCCTCTGGAGTCAGGATGCTGCATACCTCCATCAGTTTGTGGTTACAGCTCTGTGAATCCAACTTATTGGATAAACCCAGTGAATCAAAATGCAGATATTGATTGTATGCTGTGGAGCAATGTCCAAATGCAGTTATGCTATAACTGCAATTCTTGCAAAGCCGGGCTTATGGACAATCTGAGAAAGAAATGGAAAACAGTAAACAACATTTTAATTGTGACACTTGTGTGTCTCATAGGGGTGTATCTCACAGGTTGCATTGCCTTCCGAAAAGCCCAAACAAAAGCCAAAAGAAAAGAACTTTTCGGGCTTTCCTGA >PAB00023263 ATGCCGAGCATCAGTAATGGCGTGGTGGGGTTCTTGAATTTTCTTGTATTTCTGCTGTCTATCCCGATCGTGGGCTCTGGCGTGTGGCTGGCGACGAGGCACGGGACAGAGTGCGAGAAGTTCATGACCGGGCCGGTTGTAATTCTCGGGCTTTTCGTAATGCTGGTTTCTTTGGCTGGATTCATAGGTGCTTGCTTCAGGGTTTCGTGTCTGCTCTGGATCTACTTGTTCGTGACGTTCCTGCTCATAATCCTGCTGTTTTTCTTCACGATCTTTGCGTTTGTGGTCACAAACAAAGGGGCGGGGAAGCTGGCGTCGGACAAGGGATACAGAGAGTACCATCTGGGGGATTACTCACACTGGCTGCAGAAACGGGTCCAGAACGGAGATAACTGGAGAAGAATAGAGAGCTGCATCCGTGACGCCAAGGTCTGCAGGGAGGGTGTAAATCGGTTCGCCGCCAATTTCTACGAGAATAATTTGTCCCCGATTCAGTCTGGGTGCTGCAAGCCACCCGCCTCGTGCGGATTCGGGTACGGCATCAACGGAACTGTAGACACGTCGGACGGTGACTGTACGGCGTGGAAGAACGAGGAGCGTCGGACGGTGACTGTACGGCGTGGAAGAACGAGGAGGATTTGCTGTGCTACGAGTGCGATTCCTGCAAGGCCGGGGTCCTGGCGAGCCTGA >PAB00023541 ATGCTGTTGTCGATACCCATAATCGGTACAGGAATATGGTTGTCAGGCAAGCAAGATAACGAGTGCGTCAAATTCTTACAGGGGCCCGTCATAGCCATCGGCGTACTGCTTTTTCTGGTTGGACTGTCAGGATTCATAGGGGCCTTCTGGAACATCCGATGTCTGTTGGTTTTGTACTTAGTCTTCATGTTTATCCTCCTTGTTCTGCTCATGGCCCTCGTTATCTTTGTATTCCGTGTCACCGATAAGGGCCACGGCCACACCCTTCCAAACAGAGCTTACAGGCAATACAATCTCTATGACTTCTCCAGTTGGTTACGCCGCCGTGTACAGAGCTCCGGCAGGTGGAATCATATCAGAAACTGCCTCAGCTCCTCCACTACGTGCAGCAGGTTGAAGCAGAGATTCACTTTTGCCCAGGACTTCTTCAACGGCCGAATTGGCCCTCTGGAGTCTGGATGCTGTACACCGCCGACAGAATGTGGATATGCATTTGTGACTCCGGTATTTTGGATAACTCCCGTCAGCCAAGATGTGGATTCTGATTGCCCGCTATGGAATAACGAGCAGACGCAGCTGTGCTACAGTTGCAATTCTTGTAAAGGGGGTCTGTTGGCAAGCCTTAAAAGAGAATGGAGGAAGGCCAATATTGTATTGTTGATCATTCTGGTGGCTCTCATTGGGCTCTACGTGGCTTTCATTTTGACGTATTTACTTCAACGGCGCTTACAGGGCTCTCAGCAGTCCAACAATATAAAGCTAAAGCATGTTGGGTAG >PAB00030828 ATGTCTCGTTTTAGCAATGTAACCATTGGGATCGTTAATGGCCTTACACTCTTAGTCTCGATTTTCATCCTGGGAGCGGGGATATGGCTGGCCACAAAGGGCAACTCAGTCTGCGCCAAGTTCCTGGAGTGGCCTGTGATAGTCATTGGTGCATTCCTGCTATTGGTGTCCTTGGCGGGATTCTATGGAGCTTGCTGCGGGGTCACATTGTTGCTGTGGGTGTATCTGTTCTTCATGGTTTTACTCATAATCCTGCTCTTCTGCTTCACGGTCTTCGCCTTCGTTGTCACCAACAAGGGCGCGGGGGAGGTGTTGTCGGACCGGGGATTCAAAGAATACCGCCTGGGCGACTATTCCCATTGGCTGCAGAACCGCGTTGATAATTCAGCCAACTGGCAGAAGATCAAGAGCTGCATTCAAGATGCCAATATCTGCAAGAGCCTCGCCGATCACAGCATAAACAAGGTCGCACAACAGTTTTATAGCCAGGATTTATCGCCTATTCAGTCGGGATGTTGTAAGCCGCCGACGTCTTGCAATTTCACGTATGTCGATGCTACCGTGTGGGCTGTTAATACGACTTCTTCTGTAAACACTACGAACACTGACTGTGGGCTTTGGAGCAATAATCAGAACCAGCTTTGCTATAACTGCAGTGCATGCAAAGCAGGTGTTTTGGCAACGTTGAAGCACGATTGGCGAAAGGTAGCCATTGTTAATGTTTTAGCGCTCGTCGCCCTTACCGTTTTCTACTCCATTGCTTGCTGTGCGTGGAGAAACAACAAGCAAGATGATAGTTATTATGGCTACTGGAAATGA >PAB00033914 ATGGCTCGTTTCAGCAATAACATTATTGGGATCGTCAATGCCATTACGTTCCTTCTGTCGATTGCCATTCTGGCAGGGGGGATATGGTTGAGCACAAAGGGAGACTCAGTCTGCGAGAAGTTCCTTCAATGGCCTGTTATAGGCATAGGCGCGTTCCTCACGGTGTTGTCCATAGCGGGATTCGTGGGCTCATGCTGCAGGATCACATGGGTACTGTGTGTATATCTGTTCTTCATGTTTTTAATCATAATCCTGATCTTCTGCATCACGGTCTTTGCCTTCGTGGTGACCAACAAGGGGGCGGGGCAGGTGGTGTCGAATCGGGGATACAAAGAATACCGGCTGGGGGACTATTCCAACTGGCTGCAGAAGCGCGTTAACAATTCCGGCAACTGGAAGAAGATCGAGAGCTGTATTCAAGATGCCAAGATCTGCAAGAGCCTCGCGGATCACAGCATAAACGAGCGCGCACAAGAGTTTTATAGCAATAATTTATCTCCTATTGAGTCGGGATGTTGCAAACCGCCGACGTCTTGTGGTTTCACGTTTGTCAATGCCACCATGTGGACTGTTAATGCGTCTTCATCTGCAAACAATACGAGTCCCGACTGTGGGCTTTGGAGCAACGATCAGAAACAGCTTTGCTATGGCTGTAGCGCATGCAAAGCGGGTATTTTGGCAGCGTGGAAGCGCGATTGGAAAAAGGTGGCCATTGTTCTTATAGTAGTGCTCGTTGCCCTTATTGTTGTCTACTCCGTTGCTTGTTGCGCGTGGAGAAACATCAGGCGAGATGACGGTTATCATGGCCATAATCATAACCGTTTGAAAACAAGTAATCCCAGGTTTTCCCACTGA >PAB00040018 ATGGCAGTCAGCAACACCATCACAGGGGCTCTGAATTTCGCAGCAATGGTTTTATCAGTCTTGATTATTGGATCCGGGATATGGCTGGCGTCCAAACAGGACACCGAATGCGTGAGGTTTCTACGCTGGCCTATCATTACCATAGGAGTCATTCTGCTGCTGGTCTCTGCAGCAGGTTTTGTGGGTTCACTCTGGAGAGTCCCATATCTGTTAGTCATATATCTCATTTTCATGTTTGTGCTCATTATTGTGCTGTTGGCCCTGGTGATATTTGCCTTTGTGGTTACAAACAAGGGAGGGGGACACGCTGTTGTAGGCAGAAACTATGATGAGTACCAACTCAACGATTTTTCAGGGTGGCTGAGGCATTATGTTGAGAATACCAAACAGTGGAATAAGATTAAAAGCTGCCTTAGTTCTTCTAAACTGTGCAGTCAGTTGGATCAGAGGTACCCAAGTGCCCAGTATTTCTTCAGTGCACATCTCAAGCCTCTGGAGTCAGGATGCTGCATACCTCCATCAGTTTGTGGTTACAGCTTTGTAAATCCAACTTATTGGATAAACCCAGTCAATCAAAATGCAGATATTGATTGTATGCTGTGGAGCAATGACCAGATGCAGCTATGCTATAACTGCAACTCTTGCAAAGCCGGGCTTCTGGGGAATCTGAAAAAGGAATGGAGAAAAATAAACATCATTTTAATTGTGACACTTGTGGCTCTCATATGGGTGTATCTCATAGGTTGCAGTGCCTTCCGAAATGCCCAAACAGAAGAACTTTTCAGGCGTTACAAGCAAGGCTTTTCTGGTATTCGTTGA >PAB00043982 ATGGCAGTCAGCAACAGCATCGCATGGGTACGGACATTTGCAGAAGTGGTTTTATCCGTCTTGATTATTGGATCTGGGATATGGCTGGCCTCCAAACAGGACATCGAATACGTGAGGCTCCTACCCTGGCTTCTCATTGCCATAGGAGTGATTCTGCTTCTGGTCTCTGCAGCAGGCTTTGTGGGTGCACTCTGGGGAGTCACAAAACTGTCAGTCACATATCTTATCTGCATGTTTGTGCTCATTATTGTGCTGTTAAGATTCCAAGATCAGTGTCCTGAAATCGACATCGAATGCGTGAGGTTCCTACCCTGGCTTCTCATTGCCACAGGAGTCATTCTGCTTCTGGTCTCTGCAGCAGGCTTTGTAGGGTGGATGAGGCATTGTGTTGAGAATACCAAACACTGGAATAAGATTAAAAGCTGGCTTAGTTCTTCTGAACTGTGCAGTCAGTTGGATCAAAGATACCCAAGTCCCCAGTATTTCTTCAATGCACATCTCAAGCCTCTGGAGTCAGGATGCTGCATACCTCCATCAGTTTGTGGTTACAGCTTTGTGAATCCAACTTATTGGATAAACTCAGTCAATCAAAATGCAGATATTGATTGTATGATGTGGAGCAATGACCAAATGCAGTTATGCTATAACTGCAATTCTTGCAAAGCCGGGTTTCTGGGGAATCTGAGAAAGGAATGGAGAACAGTAAAGATCATTTTAATTGTGACACTTGTGTATCTCATAGGGGTGTATCTCATAGGTTGCAATGCCTTCCGAAATGCCCAAACAAAAGCCGAAACAAAAGAACTTTTCGGGTATGACAAGCAAGGCTTTCCTGTTACGAAAAGCACTTGA >PAB00056251 ATGAGCACAGATTGCCAAAGATTCCTTCAATGGCCCGTCATACTCACGGGGGGCTTCATTATGGTGCTTTCTCTCTCAGGTTTCATAGGTGCATGTTACAGAGTATCGTGGCTTCTCTGGTTCTATCTGTTCTTCATGTTCATTATCATACTTTTGCTCTTGTTCTTCACAATCTTTGCCTTCATAGTCACCAGCGAGGGCGGAGGAAGGGCAGCGCCGGGCAGACAATACAACGAATACCGCCTCGGAGATTACTCTGTCTGGTTGCAGGACCGTGTGAAGAATCCAGACAACTGGAGAAAGATCAAGAACTGTATTATTTCCCATGACAACGTTTGCGCCAAACTGACTGCTGGCTACTATCTCTCACCCATTCAGTCTGGCTGTTGCAAGCCTCCATCGTCATGTGGTTTTGCGTACGTGAATGCAACCTACTGGATTTGGAATGGCTCTGGGACTGGGAATTTAATAAGCAGCGTTGATCCTGATTGCAATGCTTGGAGCAACGACCAGACCCGGCTTTGCTTTTACTGCAATTCGTGCAAAGCTGGCGTTTTGGAAAATCTGAAACGTGAGTGGCGTAAGGTATCCATTGTGAATATCGTGATGCTCATGTTTCTCATTGTGGTTTACAGTATTGGGTGCTCCGCCTTCAGAAACAGCAGGAAGACGGACACAGACTACAGCCATGGCAGAAACATGATGACCAAGCTCAATCCCACATCCCTTTGGTAA >PAB00061255 ATGAAGAGTGCCGTATCCGGGAATTTTCCAGGCGGTCGGGCAGCTTCCCGCAACAATGTCATCGGAATCCTGAACTTCATCACGTTCGTGCTGTCGATCCCGATCCTGGGAGGCGGGATATGGCTGGCCAACAGGGCAAGCACTGACTGCGAGAAGTTTCTTGAAAAGCCGGTGATAGCCATCGGGGTTTTCCTCATGGTGGTCTCCATCGCCGGCCTGATAGGGGCCTGCTGCAGGGTCTCATGGCTGCTGTGGGTGTATTTGTTGGCCATGTTCTTGCTTATAGTTCTGCTCTTCTGCTTCACGGTCTTCGCGTTCGTGGTGACCAACAAGGGCGTGGGGGAGGTGGTTTCGAACCGGGGATACAAGGAATACCGCCTGGGAGATTATTCCAACTGGCTTCAGAAGCGCGTTGAGAATACAGCCAACTGGAAAAGGATCAGGAGCTGCATTATAGATGCCAAGGTCTGCAAAAGCCTTGCAGACGAAAGCGTAAACAAGGCTGCAGATGCTTTCTACAAGGAAAATTTATCACCGATCCAGTCGGGCTGCTGCAAACCCCCGACCTCGTGCGGCTTCACCTACGTGAGTCCGATCGTGTGGAACGGGAACGGTACGGCGACCGACACGTCGAATACCGACTGTAACTCGTGGAGCAACAACCAGTCGCAGTTGTGCTATGACTGCAACTCGTGCAAGGCCGGGGTTCTTCAGAACCTGAAACACGACTGGCGAAAGGTGGCGGCTATCAATATAGTGATGCTAATCTTCCTCGTCATCGTCTACAGCGTCGGCTGCTGCGCCTTCAGGAACAACAGGCACGACAACAGTTATGGGAAGGGCTATCCCTAA >Pp3c21_1270 ATGGGGTGCAGTAATGTCGTAACTGGGGTGGTGAATTTCCTCATGTTGATGCTGTTGTTGCCGATAATCGGGTTCGGGGTTTGGTTGGCGAAGAAGCATGATTCTGAGTGCGTGCGGTTCCTGCAATGGCCGGTCATTGTTCTGGGAATGTTTGTTCTGGTGGTTTCAATGGCGGGACTCTTTGGGTCCTGGTGCGGGAACAGGCCTCTCATGTGGACTTACCTGTTCGTCATGTTTGTCCTTATTTTCCTGCTCTTCGTCTTGACACTTCTTGCATTCGTCGTCACCAATTCTGGAGCAGGACGAGTTGTGTCAGGGAAAGGATTCAAAGAGTATAAGCTTGGAGATTACTCCAACTGGTTGCAGAAGCGGGTGGATAACCCTTTATATTGGTCCAAGATTAAGAGCTGCTTAGCTGATGGTCAGTCTGGATGCTGCAAGCCAAAATCAGACTGCGGGTACACCTTTCAGAATGCCACAACCTGGCTCGGAAACTCATCAGGGAGTGCAAACGCTGACTGCCGAGCTTGGAGCAACACCCAAACCCAGCTGTGTTTTGATTGCAATTCATGCCGAGCTGGTGTGCTGCAGAATGTGAAGTCCAACTGGCGCAGAGTCGCAGTCGTCAACATAATTGTGCTTGTGTTCATAATATTCGTCTATTCCTGTGGATGCTGCGCTTTAAAAAGCTCTAAGCGAGAGCAAGATAATTTCAAGTACAGTTATTCCAAATTTTGTCAATTCAAATGA >Pp3c19_5840 ATGGCGTTCAGTAATGTGGTGATGATCGTGCTGAACTTCCTCTCAATGATATTGTCGTTGCCGATAATTGCTTTCGGGGTGTGGTTGGCGAAGAAGGGCGACACGGAGTGCGTGCGGTTCCTGCAATGGCCGATTATTGTGCTCGGAGTATTTGTGCTTGTGTTGTCGCTCTCGGGCTTGATTGGGTCTTGGTGCGGGAACAGGGTTTTGATGTATTCTTACCTGTTCATCATGTTTCTCCTCATTTTGCTACTCTTCGTCTTCACGATTTTCGCATTCGTCGTCACCAATTCTGGGGCGGGGAAAACTGTGTCCGGGAAAGGTTATAAGGAGTACAGGCTTGGGGATTACTCCAATTGGTTGCAGAAGCGGGTGGACAACCCAAAGTATTGGTCCAAAATTAAGAGCTGCCTAGTAGATGGCAAGGTGTGCAGCGACCTTACCAAGTATACGTCGGCTGCCAGCTTCAGCAAGGCGCCCCTCACTCCTCTCGAGTCTGGATGCTGTAAGCCACCAACAGAATGTGGGTTCACCTTCGATAACGCCACGACCTGGGTTGGCAAACCACCATCAACCGTTAGCAACATTGACTGTGGACAATGGAGCAACATCCAAACCAAGCTATGTTTCGACTGCAGTACTTGTCGAGCTGGGGTGCTGCAGAACGTGAAGTCCAACTGGCGTAGGGTCGCCGTGGTGAACATTATTGTGCTGGTGTTCATTATTTTCGTTTATTCATGTGGGTGCTGTGCTCTGAAAGCTTCTCGCAGAGAGCGGGCCAATCACAAGTACAGGTATGGGTATGCCTAG >Pp3c2_26590 ATGGGGTGTAGTAATTATCTCACCGGGTTTCTGAATCTTGCAACGCTCGTTTTGTCTATACCGATTATCGTCTTTGGAGTATGGCTCTCGAAGACACAAGATACAGTTTGTGTGCGCTTCTTGCAGTATCCAATCATAGCCATCGGAGTGTTTATACTGCTGATGTCGCTGGCTGGAATGATAGGCGCCTTTTGTGACAAGAAAATTCTCCTGTTGCTCTACCTCATCGTTATGTTCCTCCTAATTGTCCTTCTCTTCTGTTTCACTGTCTTCGCATTCGTGGTAACCCATTCTGGGGCTGGAAATGTGGTCTCCGGTAAAGGCTACAAGGAATACCGACTCGGTGATTATTCCAATTGGTTACAAAGAAAGGTGAACGATACTGCGTATTGGAGTAAGATTGAAAGCTGTATAGCCGATTCTAAGGTGTGTAATAATTTGGCTACCAAGTACACTTCCGTGGATGCTTTCAACAAAGCAGCTCTCACCCCTCTCGAGTCTGGGTGCTGCAAGCCACCCTCGGACTGCAACTTCATCTTCGGCAAGAATGCAACAGATTGGGTGGGAACTGGTTCCGCGGCCCCAGACACTGACTGTCGCAGTTGGAACAGTCAAGATTTGTGTCTGAAGTGTAACGCATGCAAGGCCGGGGTGTTGCAAAATGTTAAGTCGAACTGGCGGAGAGTTGCCATCGTCAACATCATTGTGCTAGTTATTCTCATCTTCGTTTATTCCTGCGGATGTTGCGCGTATAGGAACCCAGAAAGGGTTGGCTATCGCAAATCTTACGCGTAA >Pp3c7_23740 ATGGGGTGCAGCAATGGACTTACGGGGTTTCTGAATTTGTTAACTTTCTTACTTTCCTTACCGATCATTGCTCTTGGGGCATATCTCGCGAAGACGCATGATTCAACTTGTATGCGCTTCTTGCAGTATCCGATCATAGTTATTGGAGTGTTCATGCTGCTCATGTCCCTCGCTGGCATGATCGGCGCTTGGTGCGACAAGAAGTTTCTCCTACTGATCTACCTCTTCTTTATGTTTATCCTGATTGTTCTGCTCTTCTGCTTCACAATCTTCGCATTCGTGGTGACGAATTCCGGCGCCGGAAGTGCGGTCTCTGGGAAAGGATATAAGGAGTACCGACTTGGTGATTATTCTAATTGGTTGCAAAAGAGAGTCGACAATCCATCTACCTGGGAGAAGATCAGAAGCTGCATACAGGACTCTAAAGTGTGCAGCGACTTGGGCAAAAAGTACACCACAGAAACTGATTTTAACAAAGCCTCTCTTACTCCTCTCGAGTCTGGATGCTGCAAGCCGCCAACGGCATGCGGTTACAAATTCGTGACCCCCATAGAGTGGACGGGAACTAATTCGACTGCAGATGCGGACTGCGGAACTTGGAAAAACACCCCTCAAGAATGGTGTCTGGGTTGCAATTCCTGCCGAGCTGGAGTTTTACAGAATGTGAAGTCCAACTGGCGTAGGGTCGCCATTGGCAACATTATTGTGCTGGTTTTCCTCGTCATTGTGTATTCCTGTGGATGTTGTGCATACCGAAACAATAAGAGATATGACAAGGGCTATGCGTAA >Oropetium_20150105_02198 ATGCTCCTGCTCATCGTCGCGCTGCTCGGCCTCACCGTCTTCACGTTCGTCGTCACCAGCCGCGGCGCCGCGGAGGCCGTGTCGGGCGCCGGGTACAAGGAGTACCGCCTCGGGGACTACACCACCTGGCTGCGGCGCCACGTCGGGACCGGCAAGAACTGGGCCAGGATCCGCAGCTGCCTCGCCGACGCCGACGTGTGCAGGCGCCTCAAGGAGGACGACAGGGACGCCACGCCGGCAAAGTTCCTCCGCGGCGGCCTGTCACCCGTGGAGTCCGGATGCTGCAAACCGCCCACCGCCTGCAACTTCACGTACGGCGGCGGCACGGAGTGGACCAAGACGTCGAGCTTCGTCACGTCCGCGGCGGACCCGGACTGCGGCGCGTGGAGCAACGACTCGGACAAGCTCTGTTATGACTGCCAGTCATGCAAGGCCGGTGTGGTAGACGCGCTCAAGCAGGACTGGAAGCGTGCCGCCATCGTCAACATCGTGTTCCTTGTGCTTCTCATCGTCGTCTACTCCGTCGGGTGTTGCGCGTTCAGGAACAGCCGCCGCGACAACTACGCCTACTGCAGCGGCGGCGGATGGAAGCAGCAGGGTGGTGGATACGCTTGA >Oropetium_20150105_05846 ATGGCGTTCCGTCTGAGCAACAACCTGATCGGCATCCTGAACGCGATCACCTTCCTCCTCTCGGTGCCCATCCTCGGCGGGGGCATCTGGCTGGGCGCGCGCGGCGACGGCACGGAGTGCGAGCGCTACTTGTCCGCGCCGGTCATCGCGCTGGGCGTCTTCCTCATGGTGGTCTCCATCGCGGGGCTCGTCGGCGCGTGCTGCCGCGTCACCTGGCTGCTCTGGGTGTACCTGCTCGCCATGTTCGTCCTCATCGTCGTGCTCTTCTGCTTCACCGTCTTCGCCTTCGTCGTCACCAACAAGGGCGCCGGGGAGGCCGTGTCGGACCGAGGGTACAAGGAGTACAGGCTCGGGGACTACTCCAACTGGCTTCAGAAGAGGGTGGAGAACAACAAGAACTGGAACAGGATCAGGAGCTGCCTTCAGGACTCCAAGGTCTGCAAGAGCCTGCAGGAAGAGAACAAGACCTGGCAGCAGTTCCTATCCTCCGACCTATCCCCCATCCAGTCTGGCTGCTGCAAGCCCCCCACCAGCTGCGGCTACACGTACGTCGGCGGCACCGAGTGGACCAAAACCACCACCAACTCCACGGACCCGGACTGCCAGACCTGGAGCAGCGACGCCACGGGGCTCTGCTACAACTGCCAGTCGTGCAAGGCCGGCGTCGTGGCCACCATCAAGCGGGACTGGAAGCGCGTCGCCGTCGTCTGCATCGTCTTCCTCGTCTTCATCGTCATCGTCTACTCCGTCGGATGCTGCGCGTTCAGGAACAACCGCAGGGACAACGCCTACCATGGCGGGTGGAAGCAGGGCGGACGCGGAGGATACGCATGA >Oropetium_20150105_13866 ATGGCGCGGCTGGGTTGCAGCAACGCCGTCTTCGCGTCCTTCAACGTCCTCACCCTCCTCCTCGGCGCCGCCGTCCTCGCGGGCGGCATATACCTCGGCGCGCCGCACCGCGGCTCCGGCTCCGGCACCCTCACCGATTGCGAGCGGTTCCTCCGCACGCCGGCGCTCGTGCTCGGCGCCGCCGTGGTGGTCGTGTCCATGGCGGGGATCGCCGGCGCCTGCTGCCACGCGTCGCTCCTCCTCTGGCTCTACCTCTTCCTCGCGGCGCTGCTCATCCTCGCGGCGGTCTGCTTCACGGCGTTCGCGCTCGTCGTCACCAACGCCGGCGCCGGGCGCGCCGTGTCCGGGAGAGGGTTCAAGGAGTACCGGCTCGGTGACTACTCGAGCTGGCTGCGGCGCAGGGTGGAGGATGACCGGAACTGGGGCAGGATCAGGAGCTGCCTCGCTGGAGCCGGCGTGTGCCGCAGCTTGCACAGCAACCGGACTTTTGACGAGTTCGTCAACGGCAACCTCTCGCCGGTGCAGTCTGGATGCTGCAAGCCCCCTACCGACTGCAACTTCACTTACCTGAACGAGACGTACTGGGTCAAGCCCCCGGGCAGCAGCAGCAGCAACAGCAACTCATCATCATCATCATACAACCCGAACCCGGACTGCGATACGTGGTCGAACGACCAGTCCGAGCTCTGCTACGGATGCCAGTCCTGCAAGGCCGGCGTCCTGGGAAACCTCAAGAGCGGCTGGAAGAAGATCGCCGTCGCCGACGCCTCCTTCGTCGTGCTCCTCATCGTTGTCTACTCCCTCGGGTGCTGCGTGCTCCGGAACAACCGGCGCCACAGCTACGCCCTGGTTGGGAAGAAGTGA >Oropetium_20150105_16071 ATGGCGAGGCTGAGCCACGGGCTCCTCGGCGCCGTGAACCTGGTGACGCTCCTCCTGTCCCTGGCGCTGGTCGGCACGGGCGTCTACTTCCGCACGCGCGCCGCAACCGACTGCGACCGCGCGCTGCAGCTCCCCGTCCTCGCGCTCGGCTGCGCGGCGCTGGCCCTCTCCCTCGTCGGTCTCGTGGGATCCTGCGGGCGCTGCTCCTGCTGCACTGCCGCCGCCAGGCCGTTCCTCTGGGCGTACGTGACCGCCATGTTCGTGCTCACCGCCGCAGCGTTCGCGCTCACCGTGTTCGCGTTCGTGGTCACCACCCGCTGCTCCGGCACCGCGGCGTCCGGAGGCTACAGGGAGTACCGCCTCGATGACTTCTCCGGCTGGCTGCGGGCGCGGGTCGCCGCGCCGGAGACGTGGCGCCGCGTCGAGAGCTGCTTGGCCGAGGCGCGCGTGTGCGGCCGGTTCGACGATGCCCGCGACATCGGGCCCCTCGCGTTCGACTTCTACCGGCGCCACCTCTCGCCGATCCAGCCCCCGAGGTCCGCCCCGCCAGGAGACGACGACGGCGACTGCCGCGCGTGGAGCAACGACCGGCAGGTGCTCTGCTTCGCGTGCGACGCGTGCAGGGCCGGCGTGCTGGCGACGGTCAACAGGAAGTGGAAGGCGGCGGCCGTCTTCAGTGCCGCCCTCCTCGCGGTGCTCGTCGTCGTCTACACGATCGGGTGCTGCGCCTTGCGCAGCAATGGCAGTCGGTACCGCGACGGCGGTGGCGCTGAGCAAACCTGA >Oropetium_20150105_17584 ATGGCGGTGAGCAACAACATCACGGCGTGCATCAACTTCCTGGCCCTCCTATGCACGATCCCGGTCGCCGCGACGGGCCTATGGCTGTTAGCGAAGCAGGGGGAGGACTGCGCGCGGCTGGCGCGGTGGCCCGTCGCCGTGCTGGGCGGGCTCCTCCTGCTGGTTGCGCTGGCCGGGTTCCTCGGCGCGTACCGGAACCGGAAGGGCCTCCTGGCCTGCTACCTCTTCGCCATGGCGGCGCTCATCACGCTCCTCCTGGCGCTGCTCGTCTTCGCCTTCGCCGTCACCCGCGCCTCCGGCGGCCAGCCCGTGCTCGGCCGCGGGTACGAGGACTACCAGCTCGAGGGGTACTCCGCGTGGCTGCGAGGGTACGTCGCTGGCGACGACCCGGCAAGGTGGGAGGGGATCAGGGCCTGCATCGCCGCGTCCGGCACGTGCAGGAAGCTCGCGCAGGACGCCACGTTCATCGCGCCAGAGCAGTTCTACATGTCGCACCTCTCGCCCATCCAGTCCGGCTGCTGCAAGCCGCCGACGGTGTGCGGGTACAGCTACGTGAGCCCGACGGTGTGGACGAGCCCGGCGAACCCAGCGGCGGACGCGGACTGCGCGGCGTGGAGCAACGACCCCGCCCAGCTCTGCTACGCCTGCGCGTCCTGCAAGGCCGGCGTGCTCGGCGGCCTGCGCCACGAGTGGCGAAAGGCCAACGTCGCGCTGCTCGTCGCCACCGTCGCGCTCATCGTCGTCTACGTCATCGGCTGCAGCGCCTTCCGGAACGCGCAGACCGAGGACATGTTCCGCCGCTACAAGTGGGGAAACTGA >Oropetium_20150105_18917 ATGGCGGTGAGCAACAACATCACGGCGTGCATCACCCTCCTGGCGCTGATCTGCGCGGTGCCCGTCATCGCGTCGGGGATCTGGTTCGCGTCGGCGCAGGGGGAGGAGTGCGCGCGTCTGGCGCGGTGGCCCGTGGCCATCCTGGGCGGGCTCCTCCTCCTGGTGGCCCTCGCCGGCTTCGTCGGCGCGTACTGGAACCGGCGCCGCCTGCTGGCCTTCTACCTCTGCGCCATGGCCGTGCTCATCGTGCTCCTCATCGTGATGCTCGTCTGGGCCTTCGCCGTCACCCGCGGGTCGGGGGCCTACCCCGTGCTGGGCCGCGCCTACGACGACTACCACCTCGACGGGTTCTCCATGTGGCTGCGCGGGTACGTCTCCGACGACCCCGGCCAGTGGGAGAGGATCAAGGCCTGCCTCGCCGTCTCCAACACCTGCAAGAAGCTCGCGCAGCAGGGCGCCTTCCTCAACGCCGACCAGTTCTACCAGTCACACCTCTCGCCGCTACAGTCGGGCTGCTGCAAGCCGCCGTCGGTGTGTGGGTTCACCTACGTGAGCCCGACGGTGTGGACGAATCCTTCGCACCCGGCGGCGGACCCGGACTGCGGGCTGTGGAACAACAGCCCCGGGCAGCTCTGCTACGAGTGCGAGTCGTGCAAGGCCGGGCTCCTGGAGGCGCTGCGTGACCAGTGGCACAAGGCCAACATCGCGCTCGTCGTCGCCACCGTCGCGCTCGTCTTCCTCTACCTCGTCGGATGCAGCGCGTACAAGAACGCGCAGGCAGAGTCGCTCTTCCGCCGCTACAAGTGGTGA >Oropetium_20150105_15728 ATGGGTCGTTTCCGGAAGGGGGAGTACCGCCTCGGAGACTACTCCACCTGGCTGCAGCGGAGGGTGGAGAACGCCGAGAACTGGGCGAAGATCCGGAGCTGCCTTCAGGACGGGAAGGTCTGCGAGAAGCTCGGGGCCAGGAAGGAGACGCTCAGCCAGTTCGTCAACACCAACCTCTCCCCGATTCAGACAAGGCTTTGCTATGACTGCACATCATGTAAGGCAGGCGTGCTCGCCAACCTGAAGAACTCCTGGAAGAAGATCGCCACCATCAACATCGTTTTCCTGGTGTTTCTCATCGTTGTCTACTCCGTTGGGTGCTGCGCTTTCAGGAATAACAGGCAGGACAACTCATACCCAGCTTGGAAATAA >Oropetium_20150105_19154 ATGGCGATCGGCGGTGCGCTCCTCCTGCTCTCGCTCGCGGCTCTGGCCGGTGCGTGCTGCCGCGCGACGCCGCTCCTCTGGGCGTACGCGACAGCCATGTTCCTCCTCATCGTGGCCATGTTCGTGGCGACCGGCTTCGTGTTCGCCGTCACCAACAGCGCGGCCGCGGCCGCCGCGGCCGGGGCGGGGTTCGGCGAGTACCGGATCGGCGACTACTCGGAGTGGCTGCGCGACAGGGTCGGGGACTACGAGACGTGGCGGCGGATCGAGAGCTGCATGTCGGATGCCGGCGTGTGCGGCGGGTGGCTCGGCGGCGTCGAAGGCGGGGTCCGCGCCGGCGAGTTCTACCGGGCGTACCTGCCTCTCGTCCAGTCCGGCTGCTGCAAGCCTCCGGCGTACTGCGGGTTGGAGCCCGTAAACTCGACGTTCTGGATGCCCCCGGCGTCCGGTCCGGCGGCCGCTAAGGCGGACGCCGTCGACTGCCGCGCGTGGAGCAACGACCAGCCGGTGCTGTGCTTCCAGTGCAACGCGTGCAAGGCCGGCGTGCTGTCCACCGCCGAGAAAAACTGGAAGGCCGTGATCGTTTTCAACTTCGCCGTCCTGGTGGTCCTCACGCTCGTCTACTCCATCAGTTGCTGCGCCATCCGCAGCAACCACCGGCGCCAGCGATACTGA >Oropetium_20150105_21276 ATGGCGCTGAATTACATGAGCCTGGCCGCCATTAACTCTGTCGCCGCTCTTCTTTCCATCCCCTTGATCGCCGCCGGCATCTGGCTGTCCTCGCAGGCCGACAACGCCTGCGTCCAGATCCTCCAGTGGCCCCTCGTCGCCCTCGGCGTCGCCGTCCTTGCCGTGGGCCTTGCGGGCTCCGTGGGGGCCTTCTGGCGCCTGCCGTGGCTCCTCCTTGCCTACCTCGTCGCCATGCTCCTCCTCGTGGCCGCGCTCGCCAGCCTCGCCGTCTTCGTCTTCGCCGTCACCAGCGGCGCCTCCTCGGGACGAGTGCCGCCGGGCAGGTCCTACCTCGAGTACACCCTCGATGACTCCTCCTCCGCCTCCGACGGCTGGCTGCGCGGCCGCCTGGAAAGGAGATGGGACGGGATCAAGACGTGCCTCGCGGCCACGCCCACCTGCTCCCACCTCAACCGGACGTACGCCACGGCGCAGGAATTCTTCGCCGCCGCGTGGCTCAGCCCGCTGCAGTCGGGCTGCTGCAAGCCGCCGACGAGATGCGGCTACACCTTCGTCACCCCGACCTACTGGATCAGCCCCATCGACGCCGCCGCCGACCCCGACTGCGCCGCCTGGAGCAACGAGCAGGACAGGTTCTGCTACTCCTGCGCCTCATGCAAGGCCGCCCTGCTTCAGAACCTCCGCACCGAGTGGCGCCGGGCCAACATCATCGTCGCCGTCACCACCGTCCTGCTCCTCGCCGTCTACGTCATGGGCTGCTACGCTTTCCGCACAGCCAAGACAGACGACCTCTTTCGACGCTACCGCCAAGGATACACATCATAG >SMO116G0056 ATGGGGCTTAGCAATTACCTCACAGGAATCCTGAATTTCTTGACGCTGGCGCTGGCAATCCCGGTCATCGGCGCTGGGATCTGGCTATCGCAGCGCCACGACACGGTTTGTATGCGATTCCTCCAGGGCCCGGTGATCGCCATTGGCGTCTTCATCCTCGTGGTGTCGCTGGCGGGATTCATCGGCAGCTGCTTCAGGGTGTCATGGCTGCTGTGGATCTATCTCTTCGTCATGTTCTTGCTCATCATGCTGCTGCTCGCCTTCACGATCTTCGCGTTCGCGGTCACCAACAGGGGCGCCGGCCACGCGCTGTCGGGCAAGGGCTACAAGGAGTACCGGCTCGGGGATTACTCCACCTGGCTGGAGCGCCGCGTCAAGAACACGGGCAACTGGAACAAGATCAAGAGCTGCCTCGCCGACGCCAAGGTCTGCCGCGATCTCGACAACGAGTATCCCACCGAGGCTGCATTCTCCGCCGCGCGGCTCACTCCTCTCGAGTCCGGGTGCTGCAAGCCCCCCACCGCGTGTGGGTTCGTCTACCAGAACGCTACGTCCTGGATCAACAGCGCCTCGCCAGCCGCCGACACGGATTGCTTCGCGTGGAACAACGCCGCCGACCGGCTGTGCTTCGATTGCAACTCGTGCCGCGCGGGCGTGCTGGAGAACATCCGCAAGGACTGGCGCAAGGTGGCCATCATCAACATCATCGTCTTCGTCTTCCTTGTCGTCGCCTACTCCGTCGGATGCTGCGCCTTCCGCAACGCCCGCCGCGACGAGTACTTCAGCAACAAGGCGCCGTACCGCTGA >SMO116G0294 ATGGGTCTGACGAGCAACTACCTCACGGGGATCCTGAATTTTGCGGCGATGATCCTCTCGCTGGCGGTGATTGGTGCGGGAATTTGGCTTGCGCACCGGCACGAGACGGTGTGCGTGAAATTCCTCCAGTTTCCCGTGATCGCGCTAGGGCTCTTCATCCTGCTCGTGTCCCTGGCGGGATTTATCGGCAGCTGCTTCCGGATCGCGTGGCTGCTGTGGATCTATCTCCTGGTTATGCTGCTGCTCATCCTAGCGCTGCTGGCATTCACGGCATTTGCGTTTGTGGTGACGAGCAGGGGCGGTGCCAGGCATTCTCTGGCTGGATTGGGCTACGAGGAGTATAGGCTCACGGATTACTCGCCCTGGCTCCAAGATCGCGTCAAGAATCCGGGGAATTGGGCAAAGATCAAGAGCTGCTTGATCGCTGCGAGGGTTTGCGTCGGCCTGGAAGAAGCTACATTCACCAATTACTCCCCATTGCAGTCTGGATGCTGCCGGCCTCCAGCGGCGTGTGGCTTCGCCAACGCCACAAGCTGGGCGGATCCCCAGAACCCTAATTCCGACCCGGATTGCTCGCGGTGGAACCAGGAGGATCTGTGCCTGGATTGCGATTCCTGCAAGGCGGGAGTGCTCGAGAACATCAAGCGCGACTGGCGCAAGGTCGCGTTCGTGAGCGCGGTGATGTTCTTCTTCCTGGTGATCGTCTATTCTGTGGGCTGCTGCGCGTTTCGAAACGCTCGCAAGAAAGAAGTTTTAGGGTTCTAG >SMO356G0341 ATGGGTGCTAGTAGCAATTACATTACTGCGATCATCAGTGTTTTCACGCTCTTGCTCTCCCTCCCAGTGATCGCCACTGGGATTTGGCTCCTCGCCTCCGCCAATAGCCACTGCGTCCAATCCGTCCAGTGGTTGGTGCTCGCCATCGGGATCCTTCTCCTCCTCCTCTCCATCGCCGGATCCATTGGCGGCTGCTTCAAGGTCCCATGGCTGCTCTGGATCTATCTCTTCCTTCTCTCCATTCTCATCCTACTGCTGCTCGCCGACACCATCTTCACCATGGCCGTGAGCAGTGGCACGCGCCATGGCCGCGCCCTCCCCGGCAAGGGATTCCGGGAGTACAGTCTCGGCGATTACTCCCCCTGGTTCAGGAAACAAGTCGGTGGCGCGAAGCGATGGAAGAAGATCGAGGGATGCTTAAAGGATCTGGACATTTGCCGGGATCTGGCGATGGCGTACCCAACAATCCAGAGCTTCGATGCCGCGCGGCTGTCTCCTGTGGAGTCTGGCTGCTGTAAGCCCCCTCTAGAATGTGATCTCGTCTTCCGCAATGCGACGTCCTGGGATCCGCCATCCCGCGGGAGGAGCAGCGCTAGTAATCCCGACTGCGCGAGGTGGAGCAACGATCCTACGCGCCTGTGCTTCGATTGCGATTCTTGCAAGGCGGGCGTGGTGGAGCAGGACATCCGAGGGGACTGGAAGACAGCGGCGATCGTCAACATCGTAGTTGTGGCAGTGCTCGTCCTGGTGTACGTTGTGGCATGCCGGGCATTCCGAAACGCGAAGAGATTACACGTAGAGAAGCATGTTGGGACAGCGACCTGA >SMO356G0702 ATGGGCGCCAGCAACTATGTCACCGGGATCATCAACTTCTGCACGTTGGTGCTCTCCATCCCGATCATCGGCGCTGGAATCTGGCTCGCCTCCAAGGGCGACACCGAGTGCGTGCGATTCCTCCAGTGGCCCGTGATCGCCATTGGCGTCTTCATCCTCGTCGTCTCCATCGCGGGATTCATCGGCGGCTGCTGCCGCGTCGCGTGGCTCCTCTGGTTCTACCTCTTCGCCATGTTCTTGCTCATCCTCCTCCTCCTCATCTTCACCGCGCTCGCCTTCGTCGTCACCAACAGGGGCGCCGGCCACGCGCTCTCCAATCGCGGCTACAAGGACTACCGCCTCGGGGACTACTCGACGTGGCTCCAGCGATATGTGGAGAAGCCCAGAAACTGGCGCCGGATCGGCAGCTGCCTCAGGGATTCCAGGGTCTGCAACGATCTCGACGGCGATTACAACACCCGGGACCGGTTCTACGCGGCCAATCTCTCGCCAATCCAGTCCGGATGCTGCAAGCCCCCCACCGATTGTAACTTCCAGTTCCAAAACGCCACCACCTGGCTTCCATCCCCGACCGCGGCTCCCGCGAACGCCACCGAGCGCGACTGCACGACCTGGAGCAACGATCGCAGCCAGCTCTGCTACAACTGCGATTCCTGCAAGGCCGGCCTCATCCAAAACATCAAGTCCAAATACAAGAGCGTCGCCATAGTCAATGCCGTTGTCCTCGTCTTGCTCGTCGTCGTCTACTCCATTGGCTGCTGCGCCTTTAGAAACGCCCGCAGGCAAGGGAACTATGGCCATGGTGGCTACTACTACGGCAAGGCTTAG >SMO364G0326 AGCATGAAGCTCAGCAATCTGGTGATGGGAACTCTCAACTTTGTCACGGTGGTGCTTAGCATCCCGATCATCGTCATCGGTATATGGCTGGCCACGAACAGGGACTCGGACTGCATGCACTTTCTCCAGCAGCCAACCATCAGCATTGGTGCTATCATCCTGGTGATATCCCTCGTGGGATTTCTCGGCTCCTGCTACAGGGTCTCGTGGCTGCTGTGGATCTACCTCTTTCTCATGCTGCTACTCATCCTTCTGCTCGTGTTCTTCACAGTGTTTACGTTCCTCGTCTCCAACCGCGGTGCCAGCCACGCCGTGGCCGGCACTGGCTTCTCCGAGTACCGGTTGGGAGACTACTCGGCCTGGCTGCAAAGCAAAGTTAGCAGCACAAGCAACTGGAGGAAGATCAAGAGCTGCCTCCAGGACTCAAACGTCTGCCGAGGCATGAACAGGTTCCACGACTCGGAGTCCTTTCAAAACGCTTCGCTCTCGCCGCTCGAGTCGGGCTGCTGCAAGCCTCCAATATCGTGCGGATACAGCTACGAGAACGCGACACTCTGGGACGAAGACGAAGAAGAATCGTCGTCCAACGTTTTCATCGGCGAAGATCCAGACTGCTCGACGTGGAGCAACAACCAGAACGAGCTTTGCTTCGACTGCAACTCTTGCCGAGCGGGGCTCCTGGCCAACATCAAGCGCGACTGGCACAAAGTCGCCATCGTCAACCTGGTGGTGCTCGTGTTCCTAATCGTGGTTTATTCGGTTGGATGCTGCGCCTTCTACAACGCCAAGAGAGAAGGCTACTTCAACAGGCGGTGGATCTTCTGA >Solyc08g076850.2 ATGGCACTAAGTAATAATGTGATAGGGTGTATTAACTTTGTAGCCATGTTACTTTCAATTCCAGTGATTGGTGCTGGAATTTGGCTAGCAATGGAACCTGACAATTCTTGTGTCAAAATTCTACAATGGCCAGTAATTATATTAGGAGTTCTTATCTTAGTTGTAGCACTTGCTGGTTTTATTGGTGGATTTTGGAGAATTCCAGCATTATTAATTTTCTACCTTATTGCTATGCTTATTTTAATAATATTGCTAGCATGTTTGGTTGTATTTATTTATATGGTTACTATTAGAGGTTCTGGTCATATGGAACCAAGTAGAACATATTTGGAATATCATCTTGAAGATTATTCTGGTTGGCTTAGAAGAAGAGTTCAAAGTTCATTCAAATGGGATAGAATTAGAACTTGTCTTAGCTCTACATCAATGTGTGCTCAATTGAATCAAAGTTATAAGATGGCTCAAGATTTTTTTAATGCACCTTTAAGTCCTTTGCAGTCAGGGTGTTGTAAGCCACCAACACAATGTGGTTACACATTTGTGAACCCAACATATTGGATTAGTCCAATAAATAATGCAGCAGACATGGATTGTTTAAATTGGAACAATGACCAAACACAACTTTGTTATTCTTGTGATTCTTGCAAAGCTGGATTATTGGCTAATTTGAAGAAAGAATGGAGAAGGGCTGATATTATTTTGCTTATAACTCTTGTTGGATTAATTTGGGTTTATTTGATTGGGTGTTGTGCTTTTAGAAATGCCAAAACTGAAGAAATATTCCGCAAGTACAAACAAGGATATGCTGATAATTAA >Solyc07g025510.2 ATGTCTCTAAGCAATAACATTACAGCTTTCTTGAATTTTGTGGCATTTATGTGCTCCATCCCTATAATCGCGGCCGGTACATGGCTAGCCTCAAAGCCGGACAACGAGTGTATCCACTGGCTCCGATGGCCGGTTGTTTTCATGGGTCTCGCCGTTATGCTTGTCTCGTTAGCTGGATTCGTCGGTGCTTATTGGAAAAAAGAGGGATTATTGGGTGTTTATTTGGTTTGTATGGCGATTCTCATCATCTTCTTGCTCGTGCTCCTTGTTCTTGCTTTTGTAGTCACGCGCCCAAACGGCGCTTATTCTGTACCCGGTAAAGGTTATAGCGAGTACAGGCTTGCAGGTTTCTCCTCCTGGTTGAGGAATCGGATTACCGATGGTCATAGTTGGGGAAATATAAGGGCCTGTTTGGCTGTTTCTGATATTTGTCCTAAGCTTAATACTCACATTATTACTGCTGATCAATTCTTTGCTGCTCATCTATCTCCTATCAAGTCAGGATGTTGTAAACCTCCAACAATTTGTGGATATCAGTATGTGAACCCAACTGTGTGGAATAACCCAACAAACGCAATAGCAGATGCAGATTGCTCCATTTGGAACAACGACCAAAACCAGCTTTGCTACAACTGTGATGCGTGCAAAGCCGGTTTGCTAGGAAATCTGAGAAAAGAATGGAGGAAAGCAAATCTCGTTCTCATTTTAACTGTGGTGGTTCTTATTTGGGTATATCTTATTGCTTGTAGTGCTTACAGAAATGCCCAAACTGAACAACTTTTCGAACGTTACAAACAGGGTTGGGCTTGA >Solyc07g006280.2 ATGGTGCGGTGTAGTAACAATTTAGTGGGGATTCTGAATATAGTGACACTTTTGCTGTCGATCCCAATTATAGGAGGAGGGATATGGTTGTCAAAACAAGCAAATACAGAGTGTGAGAGGTTTCTTGAAAAGCCAGTAATAGCAATAGGTGTTTTTATATTGCTTGTTTCATTGGCTGGTATAATTGGATCTTGCTGTAGAGTTACTTGGTTACTTTGGGTTTATCTACTTGTTATGTTTTTGTTGATTTTGTTGCTTTTCTGTTTCACAATCTTTGCTTTTGTGGTGACTAATAAGGGTGCTGGTGAAACAATTTCTGGTAGAGGGTATAAGGAGTATAGATTTGGGGATTACTCTAATTGGTTGCAGAAAAGAGTTGATAAGCATTGGAATAGAATTCATAGTTGTTTGCAGGATAGTAAGATTTGTGATACTTTGATTCAGGAATCAAATACTAAAGCTGATGATTTCTTCAAGAAACATCTATCTGCTCTTCAGTCTGGTTGCTGCAAGCCATCAAATGACTGTAACTTCCAGTACGTGAGCCCAACAAACTGGACAAGATCATCGACCTCATCCACTACCAATCCAGACTGTGCTACATGGAGCAACGAGTCAAATTTATTGTGCTATGGCTGCCAATCCTGCAAAGCTGGGCTGCTAGACAACATCAAAAGTGACTGGAAGAGGGTAGCTGTGCTCAACATCATTTTCCTCATCTTCCTCATCATCGTCTACTCTATCGGATGTTGTGCTTTCAGGAACAACCGAGAGGACAATGCTTGGAAGCGTTATCCTTAA >Solyc03g059390.2 ATGTCTTCGAGTAATAACATAACAGCTTTCTTGAACTTCTTGGCATTCATGTGTTCTATCCCTATAATCGCATCAGGCACTTGGCTGGCTTCAAATCCAGACAACGAATGTATCCACTGGCTCCGATGGCCAGTCGTGTTCATTGGAATTGCCATCATGTTGGTTTCTTTGACTGGCTTTATTGGAGCTTACTGGAAAAAAGAAGGTCTTTTAGGTGTCTACTTGGTGTGTATGGCCCTTCTTATTGTCCTTCTCCTCGTGCTCCTCGTACTTGCCTTTGTGGTTACGGGTCCAACCGGGGCTTATATGGTGCCTGGAAGAGCTTACAGTGATTATAGGCTTGAAGGGTTTTCTTACTGGTTGAGGGATCATATTGTTGGCCCGGATAATTGGGGCAATATTAGGGCATGTTTAGCTGATTCTGCTATTTGTTCTAAGCTTAACAATCACTATGTTACCGCGGAACAGTTCTTTGCTGTTGATCTATCACCTATCCAGTCTGGATGTTGTAAACCTCCAACAATTTGTGGATACCAGTATATGAACCCAACCTTGTGGATTAACCCAACAAATGCAATAGTAGATGTTGATTGCTCTATCTGGAACAATGATCCTAACCAATTATGCTACAACTGTGATTCTTGCAAAGGTGGCCTACTTGGAAATCTGAGGAAAGAATGGAAGAAATCTAATCTCATTCTCATCATAACTTTGGTCATTCTCATATCAGTTTATCTCATTGGTTGTTGTGCTTATAAGAATACTCTAACTAAATCAAATTCCAAGGGTAAAAAATAG >Solyc03g114480.2 ATGGTACGAGTAAGCAATTTCATAATTACGTTTCTTAATTGTGTGACTCTATTGGTTTCTCTGGTAGCCATAGGGTTTTCAATCTGGCTTAATTTCAACCACAGCGCTACGCTTTGCCAGAAAGTGTTGCAGAAGCCTTTACTGATACTGGGAGTGTGTCTACTGGTTGTTTCGATTTTGGGATTGATTGGATCCTTGTGCCGAGTCTCGTTTATCCTCTGGATATATTTGTTTTTGTTGTTTTTGCTTATTGTGGGATTGCTCTGTTTCACGTTGTTCGCAATTTTGGTAACAAATAAAAATGTGAGCAAAGCTTTATCTGGAAGAGGTTATAAGGAAATCAAATCTGGAGATTACACCAACTGGTTGCAGAAGTATGTGGTAAATGAAGAGAATTGGGGGGAGATTAAGAGTTGTTTGGTTGATACCAAATTCTGTCAGCATATACCTACTGGCAAAGGGGCTGATTTTTACAAATACAGACTATCTCCTATTCAGTCGAGTTGTTGCAAGCCACCCACTTACTGTGGCCTGGTGTTCCACAATGCTACTTACTGGACCATGCCTAAAGCAGGGCCAGCGGTAGCAGACGATGACTGCAAGATTTGGAGCAATGTACAGAGCGAGCTCTGCTTCAACTGTCAATCATGTAAGACATCATTCCTTGACCACATCAAGAGAGATTGGAAGACATGTTCCCTCGTTAATCTTGGCCTCTTACTTCTCGTCCTCTTTGTTTATGGTGTTGGCTGCTGCGCATTCAGGAACACAAAATCAAAAGGGAAAGAATAG >Solyc06g069320.2 ATGGTTCGTGTTAGCAATTTCGTTATTTCACTTGTTAACGTATTAACCTTTATGGTTGCAATGATGGCTTTAGGATTTGGACTTTGGTTTAAAGCTGATGAAGCTAAAAGCCTTTGTCAAAAATCATTATATATGCCTTTGCTTATATTTGGGGCTTCACTTCTTGTGCTTTCATTAATGGGATTAATTGGATCTTGTTGCAGAGCTTCGTTTTTTCTGTGGATTTATTTGTTTTTTCTGTTTATGTTCATCGTTGGTATGATTTGCTTATCGATTTTCACTATTTTGGTGACGAATAAAAGTGTTGCTAAAGCATTGTCTGGTAAAGGTGGAAATGATGCTAAATTTGGAGATTGGGGAAATTGGTTGGAGAAACATGTTGTGAATGATCAAAATTGGGATGATATTAAGAGTTGTATGGCAACTTTCAGATATTGTCAAATGATTCCTCGAGGCAAACCTGCTGATTTCTACAAATATAACCTCCCAGCTGCTCAGTCGAGTTGTTGCAAACCACCTACTTACTGCGGCTTTGAGTTCAAAAACGCAACATTCTGGACGATGCCTAAAACAGGGCCAGCAGTGCCAGACAGTGACTGCAAAACTTGGAACAATGCACAAAATGAGCTCTGTTTCAACTGTCGTTCATGCAAAGCATCATTCCTCGAAACAATTCAGAAAAATTGGAACAAAATGGCAATATTAAACTTTTGTGTATTTGTTTTTATAATTATTATTTACTCAATTGGCTGCTGTGCTTTGAGGAATAACAGATCAAAGGGATACGGGCCATACGCATAA >Solyc12g010570.1 ATGTTGCGTTTGAGTAACAATTTAGTTGGAATTGTTAACATAATAACATTTATTATTTCAATTCCAATTCTAGGTGGAGGAATTTGGTTATCAAAACAAGCAAATACAGAATGTGAAAGATTTCTTGAAAAACCAATTATAGCACTTGGAATATTTGTTATGTTAATTTCATTAGCTGGTTTAATTGGTTCATGTTGTAGAGTTTCATTTTTTTTATGGATTTATCTTGTTATAATGTTTTTATTAATTATTTTGATTTTTTGTTTTACAATTTTTGCATTTGTTGTTACTAATAAAGGGGCTGGTCATGTTTTATCTGATAGAGGGTATAAAGAATATAGGCTTGGTGATTATTCTAATTGGTTACAAAAAAGAGTTAATAATCATTGGGGTAAAATTGAGAGCTGTTTGAAGGATACTAAAATATGCAAAACATTGATGGATCATAATGGTGATGTGGATAATAAAGTTGAAGAGTTTTACAAAAAACATCTATCTGCTCTTCAGTCTGGTTGCTGCAAACCATCAAACGACTGCAACTTCACCTACGTGAGCCCGACTAACTGGACCAAGAGTTCAACGTCATCATCCTTCACCAATCCTGACTGTAACCTATGGAGCAACGATCCGAATGTGTTGTGTTACAGCTGTGAATCTTGCAAAGCAGGGCTGTTAGACAATATCAAGAGTGACTGGAAAAGAGTGGCTGTACTCAATATCATATTCCTTGTTTTCCTCATTCTTGTTTACTCTGTTGGATGTTGTGCTTTTAGAAACAATAGGCGTCTTGATTCATATAAGCGTTATCCTTAA >Mapoly0006s0186 ATGAAGTTCAGTAATACGCTTATTGTGATATGGAATACTATTACTCTTCTGGGCTCGGCTGTAATTATCGGAGCCGGCATTTGGTTGGCCACGAAGCATGAAAATACCACCTGCATCAAATTTTTGCAGTGGCCGATTATCATTCTCGGGATCTTCGTGCTCGTGGTTTCGATATTCGGGTTCGTTGGCGCGTGCTCGAAAAATGTGTGCTTCTTATGGATCTATCTCGCGGTGACGTTCATCCTCATTCTGCTGCTCGTCATTTTCACCATCTTCGCTTTCGTAGTCACCAACAAAGGTGCAGGGGAAGCGCTATCCAATAAAGGATTCAAGGAGTACAGACTCGGGGACTATTCAAACTGGCTGCAGAAGCGCGTGGAGAAGCAGAGCAACTGGGACAAGATCCAGAGCTGCTTGGCCGATGCCAAGGTCTGCAACGATATGAACAACGACTATCCTACAGAAGCTGCCTTCAACGCCGCCAATCTTACCCCACTAGAGTCTGGCTGTTGCAAGCCGCCCGTGGAGTGTAACTTCCAATTCGTCAATGCAACGGCATGGACCGCGCCGACTCCAATAACCTCGAACAATACCGACTGTACTAAGTGGAGTGACGATCCAAAGATTCTTTGCTTCGAATGTGATTCGTGCAAGGCTGGAGTTCTACAGAATGTTAAAAAGGACTGGCGCAAAGTGGCGACAGTGTTAATTGTCACTTTGGTCATCATGATCATCGTGTACACTATTGGTTGCTGTGCATTCAGAAATGCTCGCAGGGGCGGTTCTTACACGAAGCAAGGTTATGGACCATAG >PH01001907G0360 ATGGCGGTGAGCAACAACATCACGGCGTGCGTGACGCTCATGGCGCTCATCTGCGCGGTCCCCGTCATCGCGTCGGGCGTCTGGTTCGCGTCCGCGCAGGGGGAGGAGTGCGCGCGCCTGGCGCGGTGGCCCGTGGCCATCCTGGGCGGGCTCCTCCTCCTGGTCGCGCTCGCCGGCTTCGTCGGCGCGTACTGGAACCGCCGCCGCCTCCTCGCCTTCTACCTCTTCGCCATGGCAGGGCTCATCGTGCTCCTCATCGCGCTCCTCGTCTTCGCCTTTGCCGTCACCCGCGGCTCCGGGGCCTACCCGGTGCTCGGCCGCGCCTACGACGAGTACCGCCTCGACGGCTTCTCCATGTGGCTGCGGGGGGGGCTACGTCTCCGACGACCCCGGCCGGTGGGAGCGCATCAAGGCCTGCCTCGCCGTCTCCGACACATGCAAGAAGCTCGCGCGCCAAGGCGCTTCCGTCACCGCCGACCAGTTCTACCAGTACAACCTCTCGCCGCTCCAGGATCTATCAATCTCTCTAGGCCTCTAGAAGTACTACTAGAAGAGGAGAGGAATCAAATGGCAACTTTCATTTCAGTAGGGCGCATGGAAAAGCAAGAGTGCCTTATCGGCATCGTTCACGGTCACTGTGGTGTGGGCCCATCTCGCTTTACCCGGGCACTTCAGAGCTTGGTTCTTGGAATCGAGCGACTGCAGCGTGGGTATAATCATCTGGGTGTCCTCATCTGCGCGGAGTTTGTCTGTGAGAGTGTATGCAGCCGCGTATCCCGGGCTGGTCTCTCTCAGATGTTCATATGGAGTATCTCTATGAAGGATCTATTTGTCGTGATCTTCAAAACGTCCGGTTGCTGCAAGCCGCCGTCGGTGTGCGGGTACAGCTACGTGAGCCCGACGGTGTGGACGAACCCGGCGCGCCCGGCGGCCGACCCGGACTGCGGCCTGTGGAGCAACGACCCCGCGCAGCTCTGCTACGAGTGCCAGTCCTGCCGCGCCGGCCTCCTCGAGGCGCTGCGCGACCAGTGGCACAAGGCCAACATCGCCCTCGTCGTCGCCACCGTTGCGCTCGTCTTCCTCTACCTCGTCGGCTGCAGCGCCTACAAGAACGCGCAGGCCGAGGCCCTCTTCCGTCGCTACAAGTGGTGA >PH01000379G0610 ATGGCGTTCCGGCTGAGCAACAACCTGATCGGCGTGCTGAACGCGATCACGTTCCTCCTCTCCATCCCCATCCTTGGGGCCGGCATCTGGCTGGGCGCCCGCGCCGACGGCACCGAGTGCGAGCGCTACCTCTCGGCGCCCGTCATCGCGCTGGGGGTCTTCCTCATGGTGGTCTCCGTGGCCGGGCTCGTCGGGGCCTGCTGCCGCGTGACGTGGCTCCTCTGGGTCTACCTCCTCGCCATGTTCGTCGTCATCGTCGTGCTCCTCTGCTTCACCGTCTTCGCCTTCGTTGTCACCAACAAGGGCGCCGGCGAGGCGGTCTCCGACCGTGGGTACAAGGAGTACAGGCTCGGGGATTACTCCAACTGGCTGCAGAAGAGGGTGGAGAACACCAAGCGCTGGAACAAAATCAGGAGCTGCCTCCGGGACTCCAAGGTCTGCAAGAGCCTGCAGGACAAGAAGGAGACCTGGGACCAGTTCATCCGCACCGACCTCTCCCCCATCGAGTCCGGATGCTGCAAGCCTCCAACCAGCTGCGGCTTCACCTTCACCAATAGCATGCAGTGGACGACGGCAGCCACCAACTCGACGGACCCGGACTGCCGCACATGGAGCAACGACGCCAATGCGCTCTGCTACGACTGCCAGTCGTGCAAGGCCGGCGTGGTGGCCACGATCAACCGGGACTGGAAGCGCGTCGCCATCGTCAACATCGTCTTCCTCGTCTTCATCATCATCGTCTACTCCGTCGGCTGCTGTGCGTTCAGGAACAACCGCAGGGACAACGCCTACCGCGGCGGGTGGAAGGGCGGGCACGCTTGA >PH01000481G0070 ATGGTGCGGTGCAGCAACGGGCTCCTGGGCCTGCTCAACGCCGGCGTGCTGGTCCTCGCCGTGGTCGTCCTCGGCGGCGGCATCTGGCTCAACCACCGTGCCTCCACCACCGACTGCGAGCGCTTCCTCGAGCGCCCTGTCATCGCGCTCGGGGTCCTCCTCCTCGCGCTCTCCCTGGCCGGCCTCGCCGGCGCGCTCTGCCGCGCCTCCTTCCTGCTCTGGCTCTACCTCCTCGCGCTCTTCCTCCTCATCGCCCTCCTCTTCGTCCTCACTGTCTTCGCCTTCGTCGTCACCAACCGCGGCGCCGGATGGGCCGTCTCCGGGAGGGGGTACAAGGAGTACCGCCTCGGGGACTACTCCACGTGGCTGCAGAGGAGGGTGGAGAACTCCCAGAACTGGGCCAAGATCCGGAGCTGCCTCCAGGACGGCAAGGTCTGCCAGAAGCTCGGGGACAAGAAGGAGACGCTGAGCCTGTTCGTCAACAACCACCTCTCCCCGATCCAGTCTGGATGCTGCAAGCCCCCAACTGGGTGCAACTTCACCTACCAGAGTGAGACCGTCTGGATCAAACCTGCTGACTTCAACACTACTGATGACCCCGATTGCAACACATGGTCGAATGATCAGACTGCCCTCTGCTACGATTGCCAGTCATGCAAGGCTGGCGTGCTCGCTAACCTGAAGAATGACTGGAAGAAGATCGCCACCGTCAACATCATCTTCCTGATCTTCCTCATCATCGTCTACTCCGTTGGGTGCTGCGCTTTCAGGAACAACAGGCAGGACAACTCGTACCCGGTTTGGAAA >PH01003890G0130 ATGGCGCCCCGGTGCAGCAACGCCGTATTCGCGGCCTTCAACGTCGTCACCCTCCTCCTGGGCGCGGCTGTCCTCGCGGCGGGCATCTACGCCGGCGCCCCGCACCGCGGCGGCGCCACCGACTGCGAGCGCTTCGTCCGCACGCCGGCCCTCATCCTCGGCGCCGCCATTATGGTGGTCTCCCTCACCGGGCTCGCCGGCGCCTGCTGCAGGGCCTCCGCCCTCCTCTGGCTCTACCTCTGCCTCATGGGGCTCCTCATCCTCGCCGCGCTCTGCTTCGCCGCCTTCGCGCTCGCCGTCACCAACGCCGGCGCGGGGCAGGCCGTGTCAGGCAGAGGGTTCAGGGAGTACCGGCTCGGCGACTACTCTAGCTGGCTGCGGCGGCGGGTGGAGGACAGCGGCAACTGGGCCAAGATCACGAGCTGCCTCGTGGAGGCCAACGTGTGTCGGAGCTTGCAGAGCAACCAGACGCTCGATGACTTCGTCAACGCCAATCTCTCGCCGGTGCAGTTTCCATTGCATAAGTTTGCTCATACTTTGTCCTGCAAGGGACAAGTTCTTCAGTTACATATGCCTAACGTTTCCAAGTGCATTAATCTCAATCCACCAATTGTTCCTTCATCACAAGGTGATCTGAAATCAGTTTATCCAGAGGAAAGCTTATGTCGAGAAATACTAGTCTTCAGATTTAATTGGTCCATTTTCTTCATCAACCCCACTTCTGGATGCTGCAAGCCCCCAACTTCATGTAACTTCACATATCTGAACGAGACCTACTGGATTAAGCCCCCTGGCTCCAGCAACTCCTCCGACCCTGACTGCGACGCCTGGTCAAACGACCAATCTGAGCTCTGCTACGGCTGCCAGTCCTGCAAGGCCGGCGTCCTGGGGAACCTCAAGAATAGCTGGAAGAAGATTGCATTCATCAACGCTGCGTTCATCGTGCTCCTCATCGTCGTCTACACCCTCGGTTGTTGCGCTCTTCGGAACAACCGGCGGCACAAGTACACCCTGGTTGGGAAATGA >PH01006279G0060 ATGGCGATCGCCGGCGCGTGCTGCCGCGCCACGCCGCTTCTCTGGGCCTACGTGACCGTCATGTTCCTGCTCGTCGTCGGCATGTTCCTCGTCACCGCCTTCACGTTCACCGTCACCAACAAGGGCGCCGCCACCGCCGTGTCCGGGCGCGGCTACGGGGAGTACCGGATCGGGGACTACTCGGACTGGCTGCAGAACAGGATCAGGGACTACGAGACGTGGCGGCGGATCGAGAGCTGCATGACCTACGCGGGCGTGTGCGGCGTCGCCGCCGGGATCAACGCCGGCGAGTTCTACCGGCTGCATCTGCCGCTCGTCCAGTCCGGTTGCTGCAAGCCACCGGCGTACTGCGGGTACCAGCCCGTGAACGCGACGTTCTGGGTGGCCCCCGCGGCTGGCCTGGACACGGCGGACGTCGACTGCCTGGCGTGGAGCAACGACCAGAGGGTGCTGTGCTTCCGGTGCAACGCGTGCAAGGCTGGTGTGCTGGCCACCGCCAAGAACAACTGGAAGGCCGTGGCCGCCCTCAACGTCGCTGTCCTCGCACTCCTCATCTTCGCCTACTCCCTCGGCTGCTGGGCCATGCGCAACAACGACCGGCGCCGCCGCGGTGGCTACGGCCGGTACTGA >PH01001002G0480 ATGGCGGTGAGCAACAACATCACGGCGTGCCTCAACTTCCTGGCCCTGGTCTGCGCTGTCCCCGTCGTCGTCACCGGCATCTGGTTCGCCTCCAAGCAAGGGGAGGAGTGCGCGCGCCTGGCGCGCTGGCCGGTCGCCATCCTGGGGGGCCTCCTCCTCCTCGTCGCCCTCGCCGGCTTCGTCGGCGCCTACTGGAACCGCCAGGGCCTCCTCGCCGCCTACCTCTTCGCCATGGCGGCGCTCATCACGCTCCTCCTCGCCCTCCTCGTCTTCGCCTTCGCCGTCACCCGCGGGTCCGGGGCCTACCCGGTGCTCGGCCGCGCCTACGACGACTACCGCCTCGACGGCTTCTCCATGTGGCTGCGCGGCTACGTCGCCGATCAGGGCCTGCCTCGCCGCCTCCGACACCTGCAGGAAGCTCGCGCAGGAGAGCGCCTTCATCACCCCCGAGCAGTTCTACCAGTCCGAGCTCTCACCGCTCCAGTAGTGTCCGGGTGCTGCAAGCCGCCGACGGTGTGCGGGTACGCGTACGTGAGCCCGACAGTGTGGACGAACCCGGCAAACCCGGCGGCCGACCCGGACTGCGGCGCGTGGAGCAACGACCCCAGCCAGCTCTGCTATGGCTGTGGCTCCTGCAAGGCCGGCATGCTGGGCACGTTGCGCGACCAATGGCGCAAGGCCAACGTCGCGCTCGTCGTCGCTACCGTCGCGCTCATCTTTGTCTATGTCATCGGCTGCAGCGCCTTCAAGAACGCCCAGACCGAGGACCTCTTCCGCCGCTACAAGTGGGGCAACGTCTGA >PH01003474G0060 ATGGCGCCCCGGTGCAGCAACACCGTCTTCGCAGCCTTCAACGTCGTCACCCTCCTCCTGGGCGCGGCCGTCTTCGCGGCGGGCATCTACGCCGGCGCCCCGCACCGCGGCGGCGCCACCGACTGCGAGCGCTTCGTCCGCATGCCGGCCCTCGTCCTCGGCGCCGCCATCATGGTGGCCTCCATCGCCGGGCTCGCTGGCGCCTGCTGCAGGGCCTCCGCCCTCCTCTGGCTCTACCTCTGCCTCACTGGGCTCCTCATCCTCGCTGCGCTCTGCTTCGCCGCCTTCGCGCTCGTCGTCACCAACGCCGGCGCAGGGCAAGCTGTGTCGGGCAGAGGGTTCAGGGAGTACCGGCTCGGCGACTACTCGAGCTGGCTGCGGCGGAGGGTGGAGGACGGCGGCAACTGGGCCAAGATCAGGAGCTGCCTCGTGGATGCCAACGTGTGCCGGAGCTTGCAGAGCAACCGGACGCTCGACGAGTTCGTCCATGCAAATCTCTCGCCGGTGCAGTCTGGATGCTGCAAGCCCCCAACTTCATGCAACTTCACATATCTGTACGAGACCTACTGGATCAAGCCCCCTGGCACCAGCAACTCCTCTGATCCCGACTGCGGCACGTGGTCGAACGACCAATCCGAGCTCTGCTACGGCTGCCAGTCCTGCAAGGCCGGCGTCCTGGGGAACCTCAAGAACAGCTGGAAGAAGATTGCATTCATTAACGCTGCTTTCATCGTGCTCCTTATCGTTGTCTACACCCTCGGTTGCTGCGCTCTTCGAAACAACCGGCACAAGTACACCCTGGTTGGGAAATGA >PH01111037G0010 TCTGGATGCTGCAAGCCCCCAACTGGGTGCAACTTCATCTACCAGAGTGAGACCGTCTGGATCAAACCTGCTGGCTTCAACACCACTGATGACCCCGACTGCAACACATGGTCGAATGACCAGAATGCCCTCTGCTATGACTGCCAGTCATGCAAGGCTGGCCTGCTTGCTAACCTGAGGAATGACTGGAAGAAGATCGCCACCGTCAACATCATCTTCCTGATCTTCCTCATCATCGTCTACTCTGTTGGGTGCTGCGCTTTCAGGAACAACAGGCAGGACAACTCGCACCCGGCTTGGAAATGA >PH01005903G0040 ATGGTGCGGTGCAGCAACGGGCTCCTGGGCCTGCTCAACGCCGGCGTGCTGGTCCTCGCCGTGGTCGTCCTCGGCGGCGGCATCTGGCTCAGCCACCGCGCCTCCGCCACCAACTGCGAGCGCTTCCTCGAGCGCCCCGTCATCGCGCTCGGGGTCCTCCTCCTCGCGCTCTCCCTGGCCGGCCTCGCCGGCGCGCTCTGCCGCGCCTCCTGCCTGCTCTGGCTCTACCTCCTCGCGCTCTTCCTCCTCATCGCCCTCCTCTTCGTCTTCACCGTCTTCACCTTCGTCGTCACCAACCGCGGCGCCGGGTGGGTCGCCTCCGGGAGGGGGTACAAGGAGTACCGCCTCGGGGACTACTCCACGTGGTTGCAGAGGAGGGTGGAGAACTCCCAGAACTGGGCCAAGATCCGGAGCTGCCTCCAGGACGGCAAGGTCTGCCAGAAGCTTGGTGCCAAGAAGGAGACGCTGAGCCAGTTCGTCAACAACAACCTCTCCCCGATCCAG >PH01000798G0650 ATGGCGTTCCGGCTGAGCAACAACGTCATCGGGGCGATCAACCTGGTCACGCTCCTGCTCTCCGTCCCCGTCCTCGGGGCCGGCATCTGGCTGGGCACCCGCGGCGACGGCACCGAGTGCGACCGCTACCTCTCGTCCCCCGTCATCGCGCTCGGCGCCGTCCTCATGGCCGTCTCCCTCGCCGGCCTCGTCGGCGCCTGCTGCCGCGTCACCTGGCTGCTCTGGTTCTACCTCCTCTCCATGTTCGCCCTCATCGTCGCGCTCCTCTGCTTCACCTCCTTCGCCTTCGCTGTCACCAACAGGGGCGCCGGGGAGGCCGTCTCCGGCCGCGGGTACAAGGAGTACCGCCTCGGGGACTACTCCACCTGGTTGCAGCGGCACGTAGAGAGCGGCAAGAACTGGAACAGGATCAGGAGCTGCCTCGCCGACGCCAACGTGTGCAGGAGCCTGCAGAACAGGAATGCTACGTGGGCGCAGTTCGTGACCGCCGACCTGTCGCCGATCCAGTCCGGCTGCTGCAAGCCGCCCACGAGCTGCAACTTCACCTACGCCGGCGACGGCACGCAGTGGACCAAGACGACGAGCCTCGGGTCCGCCGACCCGGACTGCAACGCGTGGAGCAACGACGCCGGCGCGCTCTGCTACGGCTGCCAGTCGTGCAAGGCCGGCGTGGTGGCCACGCTCAAGCGGGACTGGAAGCGCGTGGCCGTCGTCAACGCCGTCTTCCTCGCCTTCATCGTAGTCGTCTACTCCGTCGGGTGCTGCGCGTTCAGGAACAGCCGCCGGGACAACGCCTACCGCAGCGGCGGCGGGTGGAAGCAGGGCGGATACGCG >Seita.9G580500 ATGGCTCTCAACCACATGGGCGTCGCCGCCATCAACCTCGTTGCCGCGCTGCTCTCCATCCCCGTCATCGCCGCCGGCATCTGGCTCTCGACGCAGGCCGACAACGCCTGCGTCCAGATCCTCCAGTGGCCCGTCGTCGCCCTCGGCGTCGCCGTCCTCGCCGTCGGCCTCGCGGGCTTCGTGGGGGCCTTCTGGCGCCTCCCCTGGCTCCTCCTCGCCTACCTCGTCGCCATGCTCGCCCTCGTCCTCGCGCTCGCCGGCCTCGCCGTCTTCGTCTTCGCGGTCACCGCCGGCTCCTCAGGCCGCCCGGTCCCCGGCCGGGCCTTCCTCGAGTACGACCTCGACGACTACTCGGGCTGGCTGCGACGCCGCCTGGACGCGCCAGGCCGCTGGGACCGGATCAAGGCCTGCCTGGCCGCCACGCCCACCTGCTCCGACCTCAACCAGACCTCCTCCTACGACACGCCGCAGGGCTTCTTCACGGCCGCCTGGCTCAGCCCTCTGCAGTCGGGCTGCTGCAAGCCCCCCACCAGGTGCGGCTACACCTTCGTCACCCCGACCTACTGGATCAGCCCCATCAGCGCCGCCGCCGACCCCGACTGCGCCGCCTGGAGCAACGAGCAGGCCAAGTTCTGCTACTCCTGCGCCTCCTGCAAGGCCGGCCTGCTCCAGAACCTGCGCAGGGAGTGGCGCCGCGCCGACATCATCCTCGCCGTCGACGCTGCCGCGCTCCTCGCCGTCTACGCCATGGGCTGCTACGCCTTCCGCACCGCAAAGACCGACGAGCTCTTCCGCCGCTACAGGAAAGTTCTTTCACCTTCACCGCCTCGAAAACTCATAAAGTAG >Seita.6G165800 ATGGCGATCCGGATGAGCAACAACGTGATCTGCGCGCTGAACCTGGTAACGCTGCTGCTCTCGGTGCCCGTCCTCGCCGCGGGCGTCTGGCTCCGGTCCCGCGCCGACGGCACCGAGTGCGACCACTTCCTCTCCACGCCGGTCATCGCGCTGGGCGCCGCGCTCGCGGCCGTCTCCCTCGCGGGCCTCGCCGGCGCCTGCTGCCGCGCCAACTGGCTGCTCTGGCTCTACCTCCTCGCCACGCTCGCCCTCGTCGCCGCGCTGCTCTGCTTCACCGCCTTCGCATTCGCCGTCACCGCCAGCAGGCCGGGCGCGGCCGGGGACGAGCAGCCCGGCCGCCTCGGGGGCGGCTACTCCACCTGGCTGCGGCGCCACGTCGAGGGCCGCAGGAGCTGGGCCCGGATCAAGAGCTGCCTGGCCGACGCCGGCGTATGCAAGCGCCTGGAGGAGGACGGCGACAAGAAGGAGGCGGCGGCGGGGACGCTGGCCCGGCTCGTCGGACGCGGCGGCCTGTCGCCGGTCGAGTACGGATGCTGCAGGCCGCCCGCGAGCTGCAACTTCACGTACGCGGGGGGCACGGAGTGGACCAAGCCCAGGCCGAGGGGCGGCGCGCCGCCGGCGGCCGACCCGGATTGCGGGAAGTGGGACAACGACGACGACAAGCTCTGCTTCGGGTGCCGGTCGTGCAAGGCCGGCGTGGAGGGCGCGCTCAGGCGGGACTGGAAGCGCGCCGCCATCGTCAACGCCGTCTTCCTCGCCTTCATCGTCGCCGTCTACGCCGTCGCATGCTGCGCCTTCAGGAACAGCCGCCGGGACAACTTCGCCTACCACAGCAGCCGCGAATGGAAACAGGGCGGAGACGCCTAA >Seita.6G098200 ATGGCGCGGCCGCGTTGCAGCAACGCCGTCTTCGCGTCCTTCAACGTCCTCACCCTCCTCCTCGGCGCGGCCGTGCTCGCGTGGGGCATCTACGCCGGCCGCGGTGCCACCGACTGCGAGCGCTTACTCCGCACGCCGGCCCTGCTCCTCGGCGCTGCCATCATGGCCGTCTCCGCGGCCGGCATCGCGGGCGCCTGCTGCCGCGCGTCGCTCCTCCTCTGGATCTACCTTTTCCTCGCCGCACTGCTCATCCTCGTCGTGCTCTGCTTCGCCGCCTTCGCGCTCGCCGTCACAAACGCCGGCGCCGGGCGGGCCGTGTCCGGGAGAGGGTTCAAGGAGTACCGGCTCGGGGACTACTCCAGCTGGCTCAGGCGGAGGGTGGAGGACGGACGCACGTGGGGAAGGATCAGGAGCTGCCTTACGGAGGCCGGCGTGTGCCGGAGCCTGCAGAGCAACCGGACATTCGACGAGTTCGTCAACGACAACCTCTCGCCGCTGCAATCTGGATGCTGCAAGCCCCCAACTGAATGCAACTTCGCATACCTGAACGAGACCTACTGGACCAAGCCCTCTGGCCCCAGCAACTCTTCCAACCCTGACTGCGACACCTGGTCGAACGACCAGTCTGAGCTCTGCTACGGCTGCCAGTCTTGCAAGGCCGGCGTCCTGGGTAACCTCAAGAACAGCTGGAAGAAGATTGCCATCATCAATGCGGCGTTCATCGTTCTCCTCATCGTCGTCTACTCCCTTGGGTGCTGCGTGCTTCGGAACAACCGGCGGCACAAGTACACTCTAGTTGGGAAGTAG >Seita.4G193600 ATGGTGCGGTGCAGCAACGGCCTCCTGGGCCTCCTGAACGCGGGCGTGCTGGTCCTGGCCGTCGTCGCGCTTGGCGGCGGCGCGTGGCTGAGCCACCGGGCTTCCACCGACTGCGAGCGGTTCCTCGAGCGGCCCGTCATCGCGCTGGGCGTCCTCCTCCTCGCGCTCTCCCTCGCGGGCCTGGCGGGGGCGCTCTGCCGCGCCTCCTGCCTCCTCTGGCTCTACCTCCTCGCGCTCTTCCTCCTCATCGTGCTCCTCTTCGCCTTCACCATCTTCGCCTTCGTCGTCACCAACCGCGGCGCAGGGTGGGTCGTCTCCGGCAGGGGGTACAAGGAGTACCGCCTCGGGGACTACTCCACCTGGCTGCAGCGGAGGGTCGAGAACGCAGGGAATTGGGCCAAGGTCAGGAGCTGCCTCCAGGACGGCAAGGTCTGCCAGAAGCTTGCGGACAGGAAGGAGACGGTCACCCAGTTCGTCAACAGCAACCTCTCCCCGATCCAGTCTGGATGCTGCAAGCCACCCACCGGCTGCAACTTCACCTACCAGAGTGAGACCGTCTGGATCAAACCCACTGGCTTCAACACTACCACCGACGACCCCGACTGCACCACATGGTCGAACGACCAGACCGCCCTCTGCTACGACTGCATGGCGTGCAAGGCAGGTGTGCTCGCCAACCTGAAGAACGACTGGAAGAAGATTGCAACCATCAACATTGTCTTCTTGATCTTCCTCATCGTCATCTACTCTGTCGGGTGCTGTGCGTTCAGGAACAACCGGCAGGACAACTCGTACCCGGCCTGGAAGTGA >Seita.4G234400 ATGGCGGTGAGCAACAACATCACGGCGTGCATCAACTTCCTGGTGCTCCTCTGCACGGTCCCCATCGCCGCGACGGGCGTGTGGCTCGCCTCCCGCCACGGCGGCGACGGCTGCGCGCGCCTCGCCCGCTGGCCCGTCGCGGCGCTCGGCGCGCTCCTCCTCCTCGTCGCCCTCGCGGGCTTCCTCGGCGCCTACCGCAACCGCAGGGGCCTCCTCGCCTGCTACCTCTTCGCCATGGCGGGGCTCATCACGCTGCTCCTCGCCCTCATCGTCCTCGCCTTCGCCGTCACCCACGGCTCCGGCGCCTACCCGGTCCCCGGCAGGGCGTACGACGACTACCGCCTCGAGGGTTACTCGCCCTGGCTGCGACGGTACGTCGCCGGCGACCCGGAGCGGTGGGAGGGGATCCGGGCATGCGTCGCCGGCTCCGGGACGTGCAGGAAGCTCGCCACGGATAGATCCTTCATCGTGCCCGAGCAGTTCTACATGACCCACCTCTCGCCCATCCAGTCGGGGTGCTGCAAGCCGCCGACGGTGTGCGGGTACGCGTATGTGGGCCCGACGGCGTGGGCGGGCGCGGCGAACCCGGCGGCGGACGCGGACTGCGCGGCGTGGAGCAACGACCCGGCCCTGCTCTGCTACGGCTGCGCCTCCTGCAAGGCCGGCGTGCTGGGGGAGCTCCGGCAGCAGTGGCGCAAGGCCAACGTCGCGCTGCTCGTCGCCGCCGTCGCGCTCGTCTTCGTCTACCTCGTCGGGTGCTGCGCCTTCCGCAACGCCCAGACCGAGGACATGTTCCGACGGTACAAGTGGGGCAACAACTACTGA >Seita.4G121000 ATGGCGGCGAGGTTGAGCCACGGCCTCCTGGGCGCGCTGAACGTGGTGACGCTCCTCCTGTCCCTGCCGGTGCTGTGCGCGGGCGTCTACTTCCGCATGCGCGCCGCCACCGAGTGCGAGCGCGCCCTGCAGCTCCCCGTCGTCGCCTTCGGCTGCGCCCTGCTGCTGCTCTCCCTCGTCGGCCTCGCCGGCGCTTGCGGCCGCCGCGGCGCCGCCACGCCGTTCCTATGGGCCTACGTGGTTTTCATGTTCCTGCTCGTCGTCGTCGTATTCGCCTTCACCGTGTTCGCGTTCGTGGTCGTTGCCAGCCGGGGCGCCGCGTCCGGCCGGCACGGGTACCGGGAGTACCGCCTTGGGGACTACTCCGGCTGGCTGCAGGCGCAGGTCGCCGCGCCGGAGACGTGGCGGCGCGTCGAGAGCTGCCTCTCCGAGGCGCGTGTCTGCGGCGTCCGGCCGTTTGACGGCGCCGTGGGGCGAGACGCCATGGAATTCTACAAGCAACACCTCTCGCCCATCCAGTCTGGTTGCTGCAAGCCGCCGACGCGGTGCGGGTTCCGGCACGTGAACGCCACGTTCTGGGCGGCCCCGAAGTCGGGGTCGTCTCCATCAGCGGCGCCGGCCGGCGACGGTGACTGCCGGGCATGGAGCAACGACGTGCAGGTGCTGTGCTTCGAGTGCGAGGCGTGCAAGGCCGGCGTGCTGGAGACTGTCAAGACCAAGTGGAAGGCGGTCGCGATCGTGAACGTTGCCCTCCTCGTGCTCCTCATCGTCGTCTACACGCTCGGGTGCTGCGCCCTGCGCGGCAACGGCGGCAGCCGGTACTCCAAACGCTGCGGTGCTGACGAAACCTGA >Seita.2G211100 ATGTCATTCCGTCAACATCCGCCGCACCATTTTCCTCTCCAACTCCCCCTACCCAAAAGCCCACGAACTTTCCCAGGCTCCTTCCGCACACCCAACACGCGGCCAAGCACCCGGCGGCACCCCTACAAATACGCCCCCGCCCACCACGTTCCCGATCGAAAACCATCAAACCCCACCGTGCCCATCCCCCGAAAACCCCACAAACCACCGAGCCCCAGAACGATATCCTCCGATCCCCCAAACCACCGCCTCCCAGTCTCAACCATGGCGTTCCGGCTGAGCAACAACCTGATCGGGATCCTGAACGCGGTGACCTTCCTTCTCTCCATCCCGATCCTGGGCGCGGGCATTTGGCTGGGCCACCGCGCCGACGGCACCGAGTGCGAGCGCTACCTCTCGGCGCCCGTAATCGCGCTGGGGGTCTTCCTCCTCGTCGTCTCCATCGCGGGGCTCGTCGGCGCCTGCTGCCGCGTCACCTGGCTGCTCTGGGTCTACCTCCTCGCTATGTTCGTCCTCATCGTCGCCCTCTTCTGCTTCACCGTCTTCGCCTTCGTCGTCACCAACCGGGGCGCCGGGGAGGCCGTGTCGGGCCGGGGGTACAAGGAGTACAGGCTTGGGGACTACTCCAACTGGCTGCAGAAGCGGGTGGAGAACCACAAGAACTGGAACAGGATCAGGAGCTGCCTCCAGGGCTCCAAGGTCTGCAAGAACCTGCAGGACAAGAAGGAGTCGGTCACCGACTTCATGCGTTCCGACCTCTCCCCGATCGAGTCTGGGTGCTGCAAGCCCCCCACCAGCTGCGGCTTCACCTACGTCAGCGGCACGGACTGGACCAAGACCACCGCCACCAACTCGTCGTCGGACCCGGACTGCAACACCTGGAGCAACGATGCGCTCTGCTACGACTGCCAGTCGTGCAAGGCCGGCGTGGTGGCCACCGTCAAGCGGGACTGGAAGCGCACCGCCATCGTCTGCATCGTCTTCCTCGTCTTCATCATCATCGTCTACTCCATCGGATGCTGCGCTTTCAGGAATAACCGCAGGGACAACGCCTACCACGGCGGCTGGAAGGGCGGGTACGCCTGA >Seita.1G305300 ATGGTGAGTCTCTCCAATGGCGTCCTGGCCGCCCTGAACTTCATCACCCTCCTCGTCTCCGTGGCGCTCATCGGCGCGGGCGCCTACGTCCTCGCGCAGCCGGCGACCGAGTGCCAGCGCCTGGTGCGGGTGCCCGCCATGGCGCTGGGCGCGGCGTTCCTCCTGCTCTCGCTCATGGCGATCGCCGGCGCGTGCTGCCGCGCCACGCCGCTCCTCTGGGCCTACGTGGTCGCCATGCTCCTGATCCTCACCGGCATGTTCGTGGCCACCGCGTTCGCGTTCGCCGTCACCAACAGGGGCGCCGCCGCCGCCGTGTCCGCGGCCGGGTACGGCGGGTACCGCGTCGGGAACTACTCCGACTGGCTGCGGGACAGGGTCAGGGACTACGAGACGTGGCGCCGGATCAAGAGCTGCATCGCGGACGCGGGCGTGTGCGGCGGCGGCTGGGTTGCCGGCGTCCAGGGCGGGGTCAACGCCGGCGAGCTCTACCAGCGGTACCTGCCGCTCGTTCAGTCGGGATGCTGCAAGCCGCCGGCGTACTGCGGGTTCGAGCGCGTGAACGCGACGTTCTGGGCGGCGGCGGCGGCTGGCGCGAGCACGGCCGTCGACTGCCGGGCGTGGAGCAACGACCAGCGGGTGCTGTGCCTCCAGTGCAACGCGTGCAAGGCCGCCGTGGTGACCACCGCCATCCACAACTGGAAGGCCGTGGCCGCGCTCAACGTCGCCGTCCTGGTGCTCCTCTGCCTCTCCTACTTGCTCGGCTGCTGCGCGATCCGCAACAACAGCTACCGCCGTGAGGCGTCGTCGCCGGCTTGCCGCGGGTCACCGCCACGACCCACCACCATCGTCGCCATCACCTGCGGCCCTGTCGTCGTCGACTTGGAGTCGCCCACGACCCCGGCGCGCCACCGCGTCCAGACCTGCACGCCGTGGCCATCTCGAAGGCTTTGA >Seita.1G033800 ATGGCGGTGAGCAACAACATCACGGCGTGCGTGACGCTACTGGCCCTGATCTGCGCGGTGCCCGTGATCGCCTCGGGGATCTGGTTCGCGTCGGCGCAGGGGGACGAGTGCGCGCGCCTGGCGCGGTGGCCCGTCGCCATCCTCGGCGGCCTGCTCCTCCTCGCCGCCCTCGCGGGCTTCGTCGGCGCCTACTGGAACCGCCGCCGCCTCCTCGCCTTCTACCTCTTCGCCATGGCCGCGCTCATCGTGCTCCTCATCGCGCTCCTCGTCTTCGCCTTCGCCGTCACCCGGGGCTCGGGGGCGTACCCGGTCCTGGGCCGCGCCTACGACGACTACCACCTCGACGGCTTCTCCATGTGGCTCCGGGGGTACGTCTCCGACGACCCGGGGAGGTGGGAGAAGATCAAGGCGTGCCTCGTCGTCTCCGACACCTGCAAGAAGCTCGCGCGGCAGGCCGCCTTCGTCAACGCCGAGCAGTTCTACCAGTCGCACCTCTCGCCGCTACAGGTAATTGCTTCAGCTCACTGCCACTCTCGAGTCCTGTCCTGTCCTGTCCACACATTTTCCGTTCGGCTGGCTGCAAAGCAGCCACCTGCTGCTGCGGCAGAGAGCCAGCTGCTGCTGCGGCAGAGAGCCGTGCTGCAGCTGCTTGCTCGCTGCAAAGCCGAAGCAGCCAGCACCTCCTTATTACTGTTGATTGAGCTCATGAGATTAATTTATCGAAAATTTCTTATTAGTACTTTAAAAATTAAAATGCAGTACAAGCTGTGA >Seita.1G033900 ATGTGTGTGCAGTCCGGCTGCTGCAAGCCGCCGTCGGTGTGCGGGTTCAGCTACGTGAGCCCGACGGTGTGGACGGCTCCGGCGCGGCCGGCGGCGGACCCGGACTGCGGGCTGTGGAGCAACGACCCCGCCCAGCTCTGCTACGAGTGCGAGTCCTGCAAGGCGGGGCTCCTGGAGGCGCTCCGCGACCAGTGGCACAAGGCCAACATCGCGCTCGTCGTCGCCACCGTCTGCCTCCTCCTCCTCTACCTCATCGGCTGCAGCGCCTACAAGAACGCCCAGGCCGCCGCCTTCTTCAGCCGCTACAAGTGA >Spipo21G0024000 ATGGCGGCGAGCAACACCATCACGGCACTGGTTAACCTGGTGGCGATGCTGTGCTCCATCCCCGTCATAGGGGCGGGGATATGGCTGGCCTCCAAGCACGGCAGCGAGTGCGTCCACCTTGCCCGGTGGCCGGTGGTCATACTGGGGATCGTCCTCCTCCTCGTTTCCCTCGCCGGCTTCGTCGGCGCCTACTGGCGGTGGCAGCGCCTCCTCGCCTCCTACCTCCTCGCCATGGCCGCCCTCATCGTCCTCCTCCTCATCCTCCTAACCTTCGTCTTCGTCGTCACCCGCCCCGACGGCTCTTACGCCGTCCCCGGCAGGGCCTTCAAGGAGTACCGCCTCGCCGGCTTCTCCCCCTGGCTGAGGGATCACATCACCTCTTCCCCCCACTGGACCCAGATCCGCCGCTGCCTCAGCGCCTCCAACGTCTGTGCCAAGCTCTCCCAGCAGCAGTACCTTACTCCGGACCACTTCTTCCAGGCCGACCTCTCCCCCCTGCAGTCGGGATGCTGTAAGCCGCCGACGGCGTGCGGGTACGGCTACGTGAATCCGACGCTGTGGATAAATCCGGCGAACGCGGCGGCGGACAGGGACTGCTACGCGTGGAGCAACAACGAGGAGGAGCTCTGCTACAGCTGCGGCTCCTGCCGGGCCGGCCTTCTGGGGAGCCTCAGGGAGGAGTGGAGGAAGGCCAGCGTCGTGCTCGTCGCCACCGCCGTCGCCCTGCTCTGCGTGTACGTTGCCGCCTGCAGCGCATTTAGGAACGCACAGACGGAGGACCTCCACCGGCGCTACAAGCAAGGCTACGTGTAG >Spipo28G0014500 ATGGCGCGGTGCAGCAACAGTCTTGTGGGGGTGCTCAACTTTTTGACATTCCTGCTGTCGATCCCGATCTTGGGGGCGGGGATATGGCTGAGCACGAGGGGAACCAGCGAGTGCGAGCGGTTCCTGGAGAAGCCGGTGATCGCGCTGGGGGTCTTCCTCATGGTGGTGTCCCTCGCGGGGCTGATTGGGGCGTGCTGCGGCGTGACCTGGCTTCTGTGGATTTACCTCTTCGTCATGTTCCTGCTCATCGTTCTTGTCTTCTGTTTCACCATCTTCGCCTTCGTCGTGACTAACAAGGGGGCGGGCCGAGTGGTCTCCGGGACGGGATTTAAAGAGTATCGGCTCGGGGACTACTCCAACTGGCTGCAGAAGCGGGTCAACGACGATAAGAACTGGAAAAAGATCAGGAGCTGCCTCGTGGACGGCAAGGTGTGCCAGACCCTGCAAGCTAAAACCGAACTCCAGGCCGCGTTTTTCCAAGAAAATCTCTCTGCCATCCAGTCTGGATGCTGCAAGCCCCCGATCGAGTGTGGGTTCAGCTACGTGAGGCCGACGGTGTGGGATGGAACCTCCAATTCCACCAACTCCGACTGCACAACGTGGAAAAACGACCCGAACGTTCTCTGCTACGACTGCAAGTCCTGCAAGGCGGGCTTCCTCGCCAACCTGAAGAGGGACTGGAAGAAGGTCGCCGTGGTCAACATCATCTTCCTCATCTTCCTCATCGTCGTCTACTCCATCGGATGCTGCGCCTTCAGGAACAACCGGGCGGAAAATCACGCCTACAAGAACGAGCCGAGGTGGAGGCCGTAG >Spipo12G0012700 ATGGGGCGGGGGTGTTTCTGCGGGTGGAGCAACGCGGTGGTGGGGGTGCTGAACGCGGGGATGATGGCGGTGTCCTTGGTGGTGCTGGGCTTCTGGGGTTGGACAGCCGGCGGCGAGCCCTCCACCGCTTGCGACCGGTTCCTCCAGGCGCCGCTGCTCCTGCTGGGGGCCTCGCTCTTCACCGTCTCCCTCCTCGGCCTCATCGGCGCCTGCTGCCGCGCCTCCTGCATCTTGTGGCTCTACCTCGTCGTCACCTTCTTCCTCATCCTCGCCGTCTCCTGCTTCACCGCCTTCGCATTCGTCGTCACGAACAAGGGCGCCGCCGCCGCCGTCTCCGGCCGCGGCGTCGGCGAGTTCCGCCTCGGCGACTACTCCGGCTGGCTGCGGCGGACGGTGACCCACGTAGGCCACTGGGAGAAGATCGAGAGCTGCCTCAAGGACGCCAAGGTCTGTGGCGGCCGTCTCCACGCCCTCCCCTTGGACCCCTCCGCCTTCTACAAGACCACTCTGTCTCCTATCCAGTCTGGGTGCTGCAACCCGCCGGCGGGGTGTCGTCGCAAGGCCCGGCAATCCGCCGTCCTCTCCGACGACGGCGACTGCGAGCGGTGGCGCGACGAGCCGGAGGCACTCTGTTTCGGGTGCAATTCCTGCAAGGCCGGCGTCCTCGCGAACCTCCAGGCGGAGTGGAGGTCCCTCGCCATCTTCAACCTCGCCCTTCTCGCCCTGCTCGTCATCGTCTACTCCGTCGGTTGCTGCGCCGTCCGCAGCGGCCGGCGCGACAGCTACAAACGCTACTGGAGAAGCCAACGGGCAACGTGA >Spipo12G0051100 ATGGCGCGGGTGAGCAACAACGTGATTGGGATCCTCAATGTGGTGAGCCTCTTGGCGTCGATCCCGGTGCTGGGGGCGGGGATATGGCTGTCGGTGAGAGGCGGTGGCGGCACCGACTGCGAGAGATTCTTGGAGAGGCCGGCGATGGCGCTGGGGGCCTTTTTCATCGTGGTCTCCCTCGCGGGGCTCGTCGGGGCCTGCTGGGGGGTGGCGTGGCTTCTCTGGATGTATCTGCTGGTGATGTTCCTCCTCGTCGTTCTCGTCTTCTGCTTCACCGTCTTCGCCTTCGTCGTCACCAACAAGGGCGCCGGAGAGGCGGTCTCGGGCCGCGGCTACAAGGAGTACCGTCTCGGCGATTACTCCAACTGGCTCCAGAAGCGGGTCAACAGTCCCAAGAACTGGGCGAAGATCAGCAGCTGCCTGCGTGAGAGCAAGGTCTGCCGGAGCATGCAGCAGGGAAACCAGACCATCGATCAGTTCATCCGCCATAACCTCTCCCCCATCCAGTCCGGGTGCTGCAAGCCTCCCACCGAGTGCGGCTTCGCCTACGAGAGCCCGACCAGCTGGCGGAGCGAGAACCTCACCGCCGCCTCCTCCTCCTCCAACCCCGACTGCGCCGCCTGGAGCAACGACCAGGCCCAGCTCTGCTACGGCTGCCGCTCCTGCAAGGCCGGCGTCCTGGCCAACCTCAAGAGCGACTGGAAGAAGGTCGCCGTGGTCAACATCGTCTTCCTCCTCCTCCTCCTCCTCGTCTACTCCGTAGGCTGCTGCGCCTTCAGGAACTCTCGCCTCGCCAAGCCCCGATCGTCGTCGCCCTGA >Sobic.010G173700 ATGGCGGTGAGCAACAACATCACGGCGTGCATCAACTTCCTGGTCCTCCTCTGCACCATCCCCATCGCGGCGACAGGTCTCTGGCTCGCCTCGCGTCACGGCGGGGAGGACTGCCTCAGGCTGTTCCGGTGGCCCGTCGCCATTCTGGGCGCGCTGCTCCTCCTCGTCGCGCTGGCCGGGTTCGCGGGCGCGTACTGGAACCGGAGGGGCCTGCTGGCCTGCTACCTCTTCGCCATGGCGGCGCTCGTCACGCTGCTCCTGGCGCTCCTCGTCTTCGCCTTCGCCGTCGTCGCGCACGGCGACGGCGCCTACCACCCCGTCGCCGGCAGCGGCAGGGCATACGACGACTACCGCCTCCAGGGGTACTCCTCCTGGCTAAGAGGGTACGTCGCCGGCGACGACCCCCGGAGGTGGGACGGCATCCGGGCTTGCGTCGCCGCGTCGGGCACCTGTAGGAAGCTCGCCGTCGATAGCTCGTTCATCGTGCCTGAGCAGTTCTACATGTCGCACCTCTCGCCCATCCAGTCCGGGTGCTGCAAGCCGCCGACGGTGTGCGGGTACGCGTACGTGAGCCCGACGGCGTGGACGAGCCCGGCGAACCCGGCGGCGGACGCGGACTGCGCGGCGTGGAGCAACGACCCGGACCAGCTCTGCTACGGCTGCGGCTCCTGCAAGGCCGGCGTGCTGGGGGCGGTGCGCCAGCAGTGGCGCAAGGCCAACGTGGCGCTGCTCGTCGCCACCGTCGCGCTCATCTTCGTCTACGTCATCGGATGCTGCGCCTTCCGCAACGCGCAGACCGAGGACCTCTTCCGACGCTACAAATGGCGAAACTGA >Sobic.010G114500 ATGGCGAGGCTGAGCCACGGCTTCCTGGGCGCTCTGAACCTGGTGACGCTCCTCCTGTCCCTGCCGGTGCTGTGCGCGGGCGTGTTCTTCCTCACGCGCGCCACCACCACGGAGTGCGAGCGCGCCCTGCAGATCCCCGTCGTCGCGTTCGGCTGCGCGCTGCTGCTGCTCTCGCTCGTCGGCCTCGCCGGCGCCTGCGGGCGCCGCGACGCCGCCGCGCCGTTCCTCTGGGTGTACGTGGTCTTCTTGTTCCTGCTCGTCGTCGCCGTGTTCGCGTTCACCGTGTTCGCGTTCGTGGTCACCAGCCAGGGCGCCGTGCCGTCCGGGCGCGGGTACTACAGGGAGCACCGCCTCGGGGACTACTCCGACTGGCTGCAGGCGCGGATCGCCGAGCCGGAGACGTGGCGGCAAGTCGAGAGCTGCCTCTCTGAGGCGCGCGTGTGCGGCGGCCGCCTCCGTGGTGCCATGGGGCAGGGCGCCATGGAATTCTACAGGCAACACCTGTCGCCAATCCAGTCCGGCTGCTGCAAGCCGCCGACGTGGTGCGGGTTCCGGTACGTGAACGGCATGTTCTGGGAGGCCCCGAGACCGGGGTCGTCGTTGTCGTCTCCGGCGGCAGCCAGCGACGGTGACTGCCGGGCATGGAGCAACGACCAGCAGGTGCTTTGCTTCGAGTGCGACGCGTGCAAGGCCGGCGTGCTGGAGACTGTGAAGAAGAAGTGGAAGACAGTGGCCATCGTCAACGTCTCCCTCCTCGCGTTCCTCATCCTTGTCTACACGATCGGGTGCTGCGCCTTGCGCAGCAGAGGTGGCAGTAGTCGTTCCCGCAATGGCGGTGGCCCTGACCAAACATGA >Sobic.010G212700 ATGGTGCGGTGCAGCAACGGCCTGCTGGGCCTCCTGAACGCGGGGGTTCTGGTCCTCGCGGTCGTCGCGCTGGGGGGCGGCGCGTGGCTCAGCCACCGCGCGTCCACCACCGACTGCGAGCGGTTCCTGGAGCGGCCCGTCATCGCGCTGGGGGTGCTCCTCCTCGTGCTCTCCCTCGCGGGACTCGCGGGCGCGCTCTGCCGCGCCTCCTGCCTCCTCTGGCTCTACCTCCTCGCGCTCTTCCTCCTCATCCTGCTCCTCTTCGCCTTCACCGTCTTCGCCTTCGTCGTCACCAACCGCGGCGCCGGGTGGGTCGTCTCCGGCAGGGGGTACAAGGAGTACCGCCTTGGGGACTACTCCACCTGGCTGCAGAGGAGGGTCGAGAACTCGCAGAACTGGGCCAAGATCCGCAGCTGCCTCCAGGACGGCAAGGTGTGCGAGAAGCTCGCGGCCAGGAAGGAGACGGTCGCCCAGTTCGTCAACAGCAACCTCTCCCCGATCCAGTCTGGATGCTGCAAGCCACCGACAGGTTGCAACTTCACCTACCAGAGCGAGACTGTCTGGATCAAGCCCGCTGGCTTCAACACTACAAGTACAACTGACGACCCCGACTGCACCACATGGTCGAACGACCAGACCGTGCTCTGCTACGACTGCATGGCCTGCAAGGCAGGCGTGCTCGCCAACCTGAAGAACGACTGGAAGAAGATCGCCACCGTCAATATCATCTTCCTGATCTTCCTCATCGTCGTCTACTCCGTTGGGTGCTGCGCGTTCAGGAACAATCGGCAGGACAACTCGTACCCGGCCTGGAAATGA >Sobic.002G207300 ATGGCGTTCCGGCTGAGCAACAACCTGATCGGGATCCTAAACTTCATCACCTTCCTGCTCTCGATCCCGATCCTGGGCGCGGGGATCTGGCTGGGCCAGCGCGCGGACGGCACCGAGTGCGAGCGGTACCTCTCCGCTCCGGTCATCGCGGTCGGGGTGTTCCTCCTCGTGGTCTCGCTCGCGGGGCTCGTCGGCGCCTGCTGCCGCGTCACCTGGCTGCTCTGGGTCTACCTCCTCGCCATGTTCGTCCTCATCCTCGTCCTCTTCTGCTTCACCGTCTTCGCCTTCGTCGTCACCAATAAGGGCGCCGGGGAGGCCGTCTCCGGGAGAGGGTACAAGGAGTACAGGCTTGGGGATTACTCCAACTGGCTGCAGAAAAGGGTCGAGAACACCAAGAACTGGGACAAGATCAGGAGCTGCCTTGAGGATTCTAAGGTCTGCAAGAAACTGCAGGACAAGAACGAGACCTTCACGCAGTTCATATCTTCCGACCTCTCCCCCATCGAGTCTGGCTGCTGCAAGCCCCCCACCATCTGCGGCTACACCTACGTCAGCGGCACCAACTGGACGACGCCCGCCAACGCGACGGCGGACCCGGACTGCCAGACCTGGAGCAACTCGGCGCTCTGCTACAACTGCCAGTCGTGCAAGGCCGGCGTGGTGGCCACGGTGAAGCGGGACTGGAAGCGCGTCGCCATCGTCTGCATCGTCTTCCTCGTCTTCATCATCATCGTCTACTCCGTCGGCTGCTGCGCCTTCAGGAACAACCGCAGGGACAACGCCTACCGCGGCGGCTGGAAGGGCGGATACGCCTGA >Sobic.001G543600 ATGGCGCTCAACTACATGGGCGTCGCCGCCATCAACTTGGTGGGCGCGCTGCTTTCCATCCCCGTGATCGCCGCGGGCATCTGGCTGTCGACGCAGGCCGACAACGCCTGCGTCCAGATCCTCCAGTGGCCAGTGATTGGCCTCGGCGTGGCTGTCCTCGCGGTCGGGCTCGCGGGCTTCGTGGCCGCCTTCTGGCGCCTGCCGTGGCTCCTCCTCGTCTACCTCGTCGCCATGTTGGTCGTCGTCGTGGCGCTGGCCTGCCTTGTCGTCTTGGTGTTGGCGGTGACCACGGGGTCGTCGGGCCACCGGGTGCCGAGCCGGGAGTTCCTCGAGTACGACCTGGACGACTACTCGGGCTGGCTGCGCGCCCGCCTGGACGCACGCTGGGACCGGATCAAGGCCTGCCTGGCCGCCACGCCCACCTGCAGCGACTTCAACGGGACGTACGCCACGGCGCAGGACCTGTTCACGGCGCCGCCCAACAGCATGAGCCCTCTGCAGTCGGGCTGCTGCAAGCCTCCCACGAGCTGCGGCTACACCTTGGTGACCCCGACGTACTGGATCAGCCCCATCAGCGCCACCGCCGACCCCGACTGCGCCGCCTGGAGCAACGAGGAGGCCAAGTTCTGCTACTCCTGCTCCTCCTGCAAGGCCGGCCTGCTGCAGAACCTCCGCACGGAGTGGCGCCGCGCCGACATCATCCTCGCAGTCGCCACTGTCGCGCTGCTCGGTGTCTACGCCATGGGCTGCTACGCGTTCCGCACGGCCAAGACCGACCAACTCTTTCGACGCTACAGGCAGGGCTACACTACACATGAGTAG >Sobic.004G093700 ATGGCGGTGAGCAACAACATCACGGCGTGCGTGACGCTGCTGGCGCTAATCTGCGCGGTGCCCGTGATCGCGTCAGGGATCTGGTTCGCGTCGGCGCAGGGCGAGGAGTGCGCGCGCCTGGCGCGGTGGCCCGTGGCGATCCTGGGCGGCCTGCTCCTCCTGGCGGCGCTGGCGGGCTTCGTCGGCGCGTACTGGAACCGGCGGCGCCTCCTGGCGTTCTACCTCTTCGCGATGGCGTCGCTCGTCGTGCTGCTCATCGCGCTGCTCGTCTTCGCCTTCGCCGTCACCCGGGGATCCGGCGCGTACCCGGTGCTCGGCCGCGCCTACGACGACTACCACCTCGACGGCTTCTCCATGTGGCTCAGAGGCTACGTCTCGGATGACCCTGGACGGTGGGAGAAGATCAGGGCCTGCCTCGCTGTCTCTGATACCTGCAAGAAGCTCGCCAGACAGGCTGCGTTCACCAACGCCGAGCAGTTCTATCAGTCCCACCTCTCCCCGTTACAGTCTGGTTGCTGCAAGCCGCCGTCGGTGTGCGGGTTCAGCTACGTGAGCCCGACGGTGTGGACGGCGGCGGCGCGGCCGGCGGCGGACCCGGACTGCGGGCTGTGGAGCAACGACCCGGGGCAGCTGTGCTACGAGTGCGAGTCCTGCAAGGCGGGCCTCCTGGAGACGCTCCGGGACCAGTGGCACAAGGCCAACATCGCGCTCGTCGTCGCCACCGTCGCCCTCGTCATCCTCTACCTCGTCGGCTGCAGCGCCTACAAGAACGCGCAGGCCGCCGCCATCTTCAGCCGCTACAAGTACTAG >Sobic.004G251900 ATGGTGAGCCTCTCCAACGGCGTCCTGGGCGCCCTGAACTTTATCTCCCTCGTCGCCTCCGTGGCGCTCATCGGCGCGGGCGCCTACGTCCTGGCGCAACCGGCGACCGAGTGCCAGCGCCTGGTGCGGGTGCCCGCCATGGCGCTGGGCGCCGCGTTCCTCCTGCTGTCGCTCCTGGCGCTGGCCGGCGCGTGCTGCCGCGCCACGCCGCTCCTCTGGGTGTACGTCGTTGCCATCTTCGTGATCCTCATCGGCATGTTCGTGGCCACCGCGTTCGCGTTCGCCGTCACCAACAGGGGCGCCGCCGCCGCCGTGTCCGGGGCCGGGTACGGGGAGTACCGGATCGGGGACTACTCCGGCTGGCTGCAGGACAGGGTCGCGGACTACGAGACGTGGCAGCGGATCCAGAGCTGCATCGCGGACGCGGGCGTGTGCGGCGGCGGCTGGGTCCACGGCGGGATCAACGCCGGCGAGCTGTACCGGCGGTACCTGCCGCTCGTTCAGTCTGGCTGCTGCAAGCCGCCGGCGTACTGCGGGTTCCAGTCCGTCAACGCGACGTTCTGGGCAACCCCCTCGTCGGGCGCGGCCACGGCGGCGGACGCCATCGACTGCCGCGCGTGGAGCAACGACCAGCGCGTGCTGTGCTTCCAGTGCGACGCGTGCAAGGCCGGCGTGGTGGCCACCGCAAGGCTCCACTGGAGAGCCGTGGCCGCGCTCAACGTCGTCGTTCTGGTGCTCCTCATGCTCGTCTACTCGCTCGGCTGCTGTGCCATCCGCAACAACCACAACCGCCGGTACTACTACTGA >Sobic.007G094300 ATGGCGCGTCCTCGTTGCAGCAACGCCGTCTTCGCGTCCTTCAACGTCCTCACCCTCCTCCTCGGCGCGGCCGTGCTCGCGTGGGGCATCTACGCGGGCGCGCCCCACCGCGGCGGCGGCGCCACCGACTGCCAGCGCTTCCTCCGCACGCCGGCCCTGGTCCTGGGCGCGGCCGTCATGGTCGTCTCCATGGCCGGCATCGCGGGCGCGTGCTGCCGCGCGTCGCTGCTCCTCTGGCTCTACCTCTTCCTAGCGGCGCTGCTCATCCTCGCCACGCTCTGCTTCGCCGTCTTCGCGCTCGTCGTCACCAACGCCGGGGCCGGCCAGGCCGGCCGGTTCAAGGAGTACCGGCTCGGGGACTACTCCAGCTGGCTCAGGCGGAGGGTGGAGGACGACCGCACCTGGGGAAGGATCAGGAGCTGCCTCGCGGAAGCCGGCGTGTGCCGGAGCTTGCAGAGCAACCGGACGTTCAATGAGTTCGTCAACGGCAACCTCTCGCCGGTGCAGTCTGGATGCTGCAAGCCCCCAACTGAATGCAACTTCGCATACCTGAACGAGACCTACTGGATGAAGCCCTCAGGTCCTAGCAACTCGTCCAACCCTGACTGTGACGCCTGGTCCAACGACCAGTCTGAGCTCTGCTACGCCTGCCAGTCTTGCAAGGCCGGCGTCCTGGGTAACCTCAAGAACAGCTGGAAGAAGATCGCCATCATCAACGCTGCGTTCATCGCGCTCCTCATCGTCGTCTACTCCCTCGGATGCTGCGTGCTTCGGAACAACCGACGGCACAAGTACGCCCTGGTTGGGAAGTAG >Sobic.007G143400 ATGGCGATCCGGATGAGCAACAACGTGATCCGCGCGCTGACCCTGGTGACGCTGCTGCTCTCGGTGCCCATCATCGTCACGGGCGTCTGGCTGCGGTCGCGCGCCGACGGCACCGAGTGCGACCACTTCCTCCTGTCCACGCCGGCCATCGCGCTGGGGACGGTGCTCATGGCCGTCTCCCTCTTGGGCCTCGCCGGCGCCTGCTGCCGCGCCACCTGGCTGCTCTGGCTCTACCTCCTCGCCATGCTGGCCCTCATCGTCGCGCTGCTCTGCTTCACCGTCTTCGCCTTCGTCGTCACCAGCACGGGCGGCGCTGGGGAGGCCGTGTCCGGCGCCGGGTTCAGGGAGTACCGCCTCGGCGACTACTCCACCTGGCTGCGGCGCCACGTCGAGGGCCGCAAGAACTGGGCCAGGATCCGGAGCTGCCTCGCCGACGCGCACGTCTGCAGGCGCTTCCTGGAGGCGGAGGAGGAGGAGGAGGAGAGCAAGGACGCGAACGCGGCGGGTGGTCTGGCGCGGCTCGGCGGCCTCTCCCCGGTCGAGTCCGGGTGCTGCAAGCCGCCCGCGAGCTGCAACTTCACGTACGCCGGCGGCGGCACGGAGTGGACGACCAAGACGAAGGCGGCGGCAGGGGCAGGATCCGCGCCCGCCGCCGGCGCCGACCCGGACTGCGGCAAGTGGAGCAACGACGAGGACGACCTCTGCTACGGGTGCCAGTCGTGCAAGGCCGGCGTGGTGGACGCGCTCAGGCGGGACTGGAAGCGGGCCGCCATTGTTAACGTCGTCATCCTCGCCTTCGTCGTCGTCGTTTTTTCCGTCGGTTGTTGTGCCTTCAGGAACAGTCGCCGGGACAACTACGCCTACCACAGCGGCCGCGGATGGAAACGAAGCGGTGACGCTTAA >Potri.015G055700 ATGGCTCGCATTAGCAATGGTGTGTTTACATTTATAAACTCGTTGATCTTGATCCTAGGCCTTGTCTCTATCGCCGCTTCTGCTTATCTAATGATGCATCACTCTTCCTCCTTGTGTCAAAAAGCCCTACAACTCCCTTTATTTTTACTGGGTGTCTCTTTATTTGTGGTGTCATTGCTAGGGCTAATGGGATCACTCTGTGAGAAGACTTTTTGGATCAAGATTCATTCTTGCTTCAACTTTTTGTTGATTGTCGGGCTCATATGTTTCACTGTTTTTGCATTCATTGTCACAAATAAGGGTGCAGGCAAGGCCTTGTCAAGGATAGGGTACAGGGAGTACAGGCTCGGAGATTACTCAAATTGGTTGAAGAATCACTTTGTGAATCAGAATAATTGGGATGAGATCAGGAGTTGTTTGATGGACGCTCATGTTTGCCAGAGTCTTGATATTCATTCTGATGTTAATCAACAGGTTGCGGATTTTTACAAGACCAAATTGTCTCCTGTACAGTCTGGTTGCTGCAAGCCCCCAGCAGACTGTGGATTCGAATATAAGAATGCAACATTCTGGATAGTGCCCGAGTCTGGCCCAGCAGTGCAAGACTCTGACTGTACCACATGGAGCAATAACCAAAACAAGCATTGCTACGACTGCAATTCATGTAAAGCTGGATTTCTCGCCAACATTAAGAAAGAATGGAGGATTTTGGCCATCGTCCTCATCTTTATCACCGTTTTTCTCATCATCTTATACTCCCTTGGTTGCTGTGCCATCAGGAGCATCCATCAATCCCATTCCAAATACTCCAAATTTGGTCCTTAA >Potri.018G099800 ATGTTTCGTTTAAGCAACAACTTGGTAGGAATCCTGAATTTCATAACCTTCCTGCTCTCAATCCCCATCCTGTGGGCAGGGATATGGTTAAAAAACAAAGGGACATCAGAATGTGATAAGTTCTTCGACACCCCAGTTATTATCTTGGGTATCTTTCTCTTACTAGTCTCTCTAGCTGGCCTAATTGGCGCGTGTTGTCGCGTGTCATGGCTTCTCTGGGCTTACCTCCTAGTCATGTTTCTCCTCATCGTCTTGCTCTTCTGCTTCACGATTTTCGCTTTTGTCGTGACCAATAAAGGTGCCGGTCAAGTTTTGTCCGGGAAGGGGTATAAGGAGTATAAGTTGGGAGATTATTCAAATTGGTTGCAGAAGAGAGTGGGCAATCAGAAGAACTGGAGGAAGATCAAGAGTTGTTTGATTGATGCTAAAGTTTGCAGTGATTTTAACCAGAAATTCGCGAATGATACTGTTGAAGTCTTGTATACCCGCCATCTGTCTGCTCTTCAGGCTGGCTGCTGTAAGCCATCAGATAGCTGTGGCTTTCTTTATAAATCACCGATTAACTGGGAGAAGACGCCTACAAATTCCACCTCCGATCCTGACTGTAATGCATGGGATAATCAAACAGATGTTCTCTGCTTTAACTGCAACTCTTGCAAAGCTGGATTGCTGGACAACCTCAGGAGGGATTGGAAGAAGGTGGCTGTTATCAACATTATTTTTCTCGTATTCCTCATCATTGTGTACTCCGTCGGATGCTGTGCTTTTAGGAACAACAGAAGGGACAACAATGCTTACTCTGCTGGATGGAAGCACCCTTAA >Potri.001G141400 ATGGCACTGAGCAGTAATGTTATTGGTGCTATAAACTTTGTTGCCATGCTTCTCTCCATTCCGATTATCGGTGCTGGGATCTGGCTAGCAATGGAACCAGACAACTCTTGTGTCAAGATTCTACAATGGCCTGTCATTATTTTGGGAATACTAATCTTAATAGTAGCTCTTGCAGGCTTCGTGGGAGGTTTTTGGAGAATCCCATGGCTCCTTATTTCTTATCTCATTGCCATGCTCATCCTTATAATATTGCTTGCATGTCTAGTGGTTTTCATCTACATGGTCACTGTTAGGGGTTCGGGTCACCTTGAACCCAGCAGAGCCTACTTGGAGTATCGTCTTGATGACTTTTCAGGTTGGCTTCGCCGGAGGGTTCAGAGTTCATATAAGTGGGATCGGATAAGAGGCTGCCTTAGCTCAACCAATATGTGTGCTGAGTTGAACCAGAGTTATCGCATGGCTCAAGATTTCTTCAACGCTCATATTAGCCCCTTACAGTCAGGATGCTGTAAGCCCCCAACCCAATGTGGGTATACATTTGTGAATCCAACGTATTGGATTAGTCCCATTAACAACGCTGCAGATATGGACTGCCTGCAATGGAACAATGACCAAAATCAACTTTGCTACAATTGCGATTCATGCAAGGCCGGGTTGCTGGCTAATTTGAAAGAGGAATGGAGAAGGGCAGATATCATATTGCTCATTACTCTTGTTGCCTTAATATGCGTATACTTGGTAGGCTGTTGTGCCTTTAGGAATGCCAAGACAGAAGATTTGTTCCGCAGATACAAGCAAGGTTATACATAG >Potri.003G093000 ATGGCACTAAGCAATAATGTTATTGGTGCTATCAACTTTGTCGCCATGCTTCTCTCCATCCCAGTCATAGGTGCTGGGATTTGGCTAGCAACGGAACCAGACAACTCTTGTGTCAAGATCCTACAATGGCCTGTCATTATCTTGGGAATGCTGATCCTGAAAGTAGCTCTTGCAGGCTTTGTAGGAGGTTTCTGGAGAATCCCTTGGCTCCTTATCTTTTATCTCATTGCCATGCTCATCCTTATAATATTGCTCGCATGTCTAACGGTTTTTATATACATGGTGACTGTTAGAGGCTCAGGCCACCTTGCACCGAGTAGAGCCTACTTGGAATATCGTCTTGATGATTTTTCAGGTTGGCTTCGCCGAAGGGTTCATAGTTCATATAAGTGGGATCGGATAAGAGGTTGCCTTAGCTCCTCTAATACGTGTGCTGAGTTGAACCAGAGTTATCACATGGCTCAAGATTTCTTCAATGCTCATATTAGCCCCTTGCAGTCAGGATGCTGTAAGCCCCCGACCGAATGTGGGTATACATTTGTGAACCCAACATATTGGATTAGTCCAATAAACATTGCTGCAGATATGGACTGCCTGAAATGGAACAATGACCAAAATCAACTTTGCTACAATTGCGATTCATGCAAGGCCGGATTATTGGCTAATTTGAAAAGGGAATGGAGAAGGGCAGACGTCATACTGCTCATTACTCTCATTGCCTTAATATGCGTATACTTGATTGGTTGCTGTGCCTTTAGGAATGCCAAAACAGAAGACTTGTTTCGCAGATACAAACAAGGTTACACATAA >Potri.006G177900 ATGTTTCGTCTAAGCAATAACTTGGTAGGAATCCTGAACTTCATTACATTCCTGCTCTCAATCCCCATCCTGTGGGCAGGGATCTGGTTAAGAAACAAAGGAGCATCCGAATGTGAGAAATTCCTCGACACTCCAGTTATAGTTCTTGGTGTCTTCCTCTTAGTTGTCTCACTAGCCGGTCTAATTGGCGCGTGTTGTGGCGTTTCATGGCTCCTCTGGGTTTACCTCGTAGTCATGTTTCTCCTCATTGTCGTACTCTTCTGCTTCACGATTTTAACTTTTGTGGTGACCAACAAAGGTGCTGGTAAAGTTTTGTCTGATAAAGGGTATAAAGAGTATAGGCTGGGTGATTATTCGAATTGGTTGCAGAAGAGAGTGACCAGTGGGAAGAATTGGAGCAAGATTAAGAGTTGCTTGATCGATGCTAAGATTTGTACTGATTTTCAACAGAGATATTTGAATGATTCTCTCACCGTTCTCTATACTCGCCATTTATCTGCTCTTCAGGCTGGCTGCTGTAAGCCACCGGATAGCTGTGGCTTTAATTATCAAAATCCGACTACTTGGGACAAGACTACAAATGTCACCTCCGATCCTGACTGTAATGCGTGGGATAATCAATCAAATGTTCTCTGCTTTAACTGCAACTCTTGCAAGGCTGGGCTGCTGGACAACCTCAAGAGTGATTGGAAGAAGGTGGCTATTATCAACATTATATTCCTTGTATTCCTCATCATTGTGTACTCCATTGGATGCTGTGCATTCAGGAACAACAGAAGCGAAAATGCTTACTTTTCTGGATGGAAGCACACTTAA >Potri.006G150400 ATGGGAGTAGCCAACAACATCACAGCCGTCCTAAACTTCATAGCCTTTCTCTGCTCAATCCCTATAATAGCCGCTGGCATTTGGCTAGCCTCCAAACCAGAGAATGAATGCATCCACCTTTTCCGGTGGCCTGTAGTTCTCCTTGGATTCCTTATCCTCTTGGTCTCACTTGCTGGTTTTGTGGGTGCCTACTGGTATAAGGAAACACTTTTAGCATTCTATCTCTGCTGCATGGCCATTCTCATAGGACTTCTCTTGATCCTTCTGGTCTTCGCCTTTGTGGTCACGCGCGCCGATGGTGGCTATGATGTGCCTGGGAGGGGTTATAGAGAGTATAGGCTTCAAGGATTCTCTGCTTGGTTGAGGAATCATGTCGTTTATTCCAAGAATTGGGACAAGATTAGGCCTTGTCTTGCTGAGACTGATGTTTGTTCCAAGATGACTCAAAATTATATCACTGCTGACCAATTCTTCATGGCTCACATCTCTCCTCTCCAGTCAGGGTGCTGTAAGCCGCCAACAGTTTGTGGCTACAATTATGTGAACCCTACGCTGTGGTTAAACCCAGTGAACCCAGCGGCGGACCCAGACTGCTACTTGTGGAACAATGACCAGAACCAGCTGTGCTACAATTGCAACGCTTGCAAGGCTGGATTGCTGGGGAACCTGAGGAGAGAATGGAGGAAGACCAACGTAATCCTCATCGTGGCGGTGGTGGTGCTCATTTGGGTCTATGTCATTGCCTGCAGTGCTTTCAAAAATGCCCAAACTGAAGACCTTTTCCGGCGATACAAACAAGAGCCACACTCACCCTACTTTTCAGATGCTGGTTCTTGA >PEQU_41195 AGCAATAACCTAATCGGCATCCTCAACTTCCTCACCTTCCTCCTCTCGATCCCGATCCTCGGCGCCGGAATATGGCTCAGCACGCGCGCGAGCACCGACTGTGAGAAGTTTCTTGAACGGCCGGTGATTGCTCTAGGGGTTTTTCTCATGATCGTCTCCATCGCAGGCCTCGTCGGCGCTTGCTGCGGTGTTTCATGGCTTCTATGGCTTTATCTTCTCGTCATGTTTATCCTCATCTTGCTCGTCTTCTGCTTCACCATTTTTGCCTTTGTGGTGACCAACAAGGGCGCCGGCGAGGTGGTTTCTGGCCGCGGGTATAAGGAGTATCGTCTTGGAGATTACTCCAACTGGTTACAGAAACGGGTGTTGGATGAGGGAAATTGGTCTAAGATTCGGAGTTGTATTCGTGATAGCAAAGTCTGCAATAGTTTAAGCGAGAAGAACCAAACTTTTGATCAATTTGTCAACGATAATCTTACTCCTCTTCAG >PEQU_39634 ATTCAGTCTGGTTGCTGTAAGCCTCCCACCGCCTGTAACTTCACCTTTGTGAGCGAGACTGTGTGGAATAAGCCTCAGGGCTTCAGCAACTCCTCCATTGCTGACTGCAACACCTGGCAGAATGAACCTTCTGTTCTGTGCTACGACTGCCAGTCATGTAAGGCCGGCGTTCTCGCCAACCTCAAGAACGACTGGAAGAAGGTTGCCATCATCAACATCGTCTTCCTCATCTTTCTCGTTATAGTTTACTCGATTGGATGCTGTGCCTTCCGCAACAACAGGCGAAGCAACTATCAGGGATGGAAG >PEQU_03030 CAGTCTGGTTGCTGTAAGCCTCCCACCGCCTGTAACTTCACCTTTGTGAGCGAGACTGTGTGGAATAAGCCTCAGGGCTTCAGCATCTCCTCCATTGCCGACTGCAACACCTGGCAGAATGAACCTTCTGTTCTGTGCTACGACTGCCAGTCATGTAAGGCCGGCGTTCTCGCCAACCTCAAGAATGACTGGAAGAAGGTTGCCATCATCAACATCGTCTTCCTCATCTTTCTCGTTATAGTTTACTCGATTGGATGCTGCGCCTTCCGCAACAACAGGCGAAGCAACTATCAGGGATGGAAGGGAGGGAAC >PEQU_05221 ATGGTTCACATCAGCAACAGCCTCACAAGTTTTCTCAACTTTCTCACCCTCTTCATCTCCATCCCCATAATCGGCATCGCGCTCTGGCTCCATTATCAAACCGCCTCCGACTGCGAACAAACCCTCCTATGGCCGATTATCATCACCGGCCTCTTTTTAATGGTGGTGGCGTTACTCGGCCTCGTCGAATCTTGCTGCAATGCGTCGTGTTTTCTATGGACTTATCTCTTTGTCATGTTTGTGATGATTGTCGGGCTATTCTGTATCACCGTATTCTCCATTGTCGTCGCCAATAAAGGAGTTGGTGAGGCGGTCTCGGGGAAGGGATATAAAGAGTATAAGCTCGGGGATTATTCGAATTGGTTGCAGAACAGGGTGGGGGATTTCCAGTCTTGGAGAAGGATTAAGAGCTGTTTGATTGATGCTAGGGTTTGTGGAGGACTTCAGCTTTTGGTCTTTCAAAATTCTAATGATTTGTACTCTCCAGCCTTATCCTCCATTCAGTTAATCGTCCCGATCAACATGTCAGGTTGCTGTAAGCCGCCGTTATCTTGCGGGTACAAACAAGTGAATGCCACAACCTGGAAAGTCCCAAAATCAGGTCCCAATTCGAATGATGCTGATTGCAAAACATGGAGCAATGATCAGAACATTCTCTGCTTCGATTGCAGCTCGTGTAAAGCTGGTGTTCTTGCAAATATAAAGGTACAGTGGAGGAAAATTGCAATTTTCAATGTCTGTCTCCTTGTGTTTCTGATTGCCACTTACTCAATTGGATGCTGTGCTTTGAGAAATAGTTGTAAAGATGACCAATATTTGCGTTATAATTAG >PEQU_06133 ATGGGCCTAAGCAACAACCTAATCGCAATCCTCAACTTCATCGCCCTCCTTTCTTCCATCCCCATCATCGCCTCGGGCATCTGGCTCGCCTCCAAGCCCGACAGTGAGTGCATCCGTCTAGTCCGATGGCCTGTCATCATCCTCGGCGTTCTCATCCTCCTCGTCTCTCTAGCCGGCTTCGTCGGCGCTTACTGGAACCACCAGTGCCTTCTCGCGGCCTACCTATTCGTCATGGCAACCCTAATCGTTCTCCTCCTCGCTCTTCTCGTCTTCTCCTTCGTCGTCACCCACAACGATGGCGCGTATGATGTTCCAGATCGGGGGTACAAGGAGTATCGCCTCGCTGGATTCTCCGATTGGCTTCGGCATTACGTGGGTGATGATGGGCATTGGGTTCGGATCCGGGCTTGTCTCGCTCAATCGGATGTGTGCGGGAAGCTTGCACGGGATGATGCGTATTTCACCGCCGATCAGTTTTTTAGGGCCGATCTCTCCCCGATTCAGGTAAGGATCTCGCTACTGTTCTGTACATTGCCGGCTATCAGTACTCGTGTGTGCTCTTGTGTGTTTATGTTTTGGGTATCGGTTTTGGAATCAAAACTTTTCAACTTATTATATAATCATGTTAATATGTTGGTGCAGTCTGGATGTTGTAAGCCACCAACTGTGTGTGGGTATGCCTATGTGAATCCTACAGTTTGGGTTTCCCCTGCGAATGTTGGTGCAGACCCAGACTGCTATGCCTGGAGCAATGACCAGGCTCAGCTCTGTTATGGATGCAACTCGTGCAAAGCCGGGACGATCGGAAACCTGCGCGGTGAGTGGAGAAAGGCCAACATTGTTCTCATCGTTGCTGCAGTCGCCCTCATCTGGGTGTACATCATTGGCTGCAGTGCCTTGAAGAACGCACAGACGGAGGAACTTTTTCAACGATACAAGCAGGGATTTGCGTAA >Aco012097 ATGTTTAGGCTCAGCAACAACCTCATCGGGGTGCTCAACCTCCTCACCTTCCTCCTCTCCGTGCCCGTGCTCGGCGGCGGCGTGTGGCTCGCCACCCGCGGCGGCGGGTCCGGCACCGAGTGCGAGCGCTTCCTCACGGTGCCGCTCATCGTCCTCGGCGCCTTCCTCATGCTCGTCTCCCTCGCCGGCCTCGTCGGCGCCTGCTGCAGGGCCTCCCTCCTCCTCTGGCTCTACCTTGTCGCCATGTTCCTCCTCATCCTCCTCCTCTTCGCCTTCACCCTCTTCGCCTTCCTCGTCACCAACAAGGGCGCCGGCGAGGCCGTCTCCAACCGCGGGTTCAAGGAGTACCGCCTCGGCGACTACTCCCACTGGCTCCAGAAGCGCGTCGACAACTCCAAGAACTGGGCCAAGATCCGGAGCTGCTTGCAGGACTCTAAGATTTGCGAGCGGCTCCAGCAGGGCAACGAGACCTTCGATCAGTTCATCAGGGACAATCTCTCCCCGATTCAGTCTGGATGCTGCAAACCGCCCACCGAATGCGACTTCACCTATGTGAGTCCAACTGTGTGGACCGTGAACTCCACGACATTGACCTCGACCAACAACACCGACTGCTCGGCGTGGAACAACGACCCGTCGACCCTCTGCTATGGCTGCCAGTCCTGCAAGGCCGGCGTGCTCGCCAACATCAAGAAGGACTGGAAGAAGGTCGCCATCATAAATATTGTCGTCCTCGTCTTCCTCATCATGGTCTACTCGGTCGGATGCTGCGCATTCCGGAACATTCGGCGCGACAATGCGTACGGCTACGGTGGATGGAAAGGAAGATATCCTTAG >Aco008233 ATGGTGCGCGTGAGCAATGGCGTGCTCGGGGCCCTCAACGTGGCGGCGCTCGTCCTCTCCGTGGCGGTGCTCGGCGCCGGGCTCTGGCTCGGGCACCGCGCCGGCACCGACTGCGAGCGGTTCCTGCAGCGGCCGATCGTGGCGGTCGGCGCCTTCCTCCTCGTCTTCTCCCTCGCCGGGATCGCCGGGTCCTGCTGCCGCAGCTCCTGCCTCCTCTGGCTCTACCTGCTCGCCATGTTCCTCCTCATCCTCCTCCTCTTCTGCTTCACCCTCTTCGCCTTCCTCGTCACCAACAAGGGCGCCGGGTGGGTCGTATCGGGGAGGGGGTATAAAGAGTATCGCCTCGGGGATTACTCGCACTGGTTGCAGAAGAGGGTGGAGAACGACGCGAACTGGGCGAAGATCCGGAGCTGTTTGCAGGACGGGAAGGTGTGCGAGAGCCTCGGGAGGAGGAATCAGACGCTGGATCAGTTCATCAACGACAACTTGTCCCCGATTCAGTCCGGATGCTGCAAACCTCCGACAGCATGTAACTTCACCTACCAGACTGAGACAGTGTGGATTAAACCCATCGGGTTTAACTCCACCGATAATCCGGACTGCAACACCTGGTCGAATGATCAAACCGCGCTCTGCTACGATTGCCAATCTTGCAAGGCAGGGGTGCTCGCCAACCTCAAGAATGACTGGAAGAAGGTTGCCACCGTCAACATCATCATCCTCATTTTCCTCATTGTGGTCTATTCCATTGGGTGCTGTGCCTTCAGGAATAACAGACAGGATAATTCCTATCCTTATCCGGGCTGGAAATGA >Aco018869 ATGGCCCTCAGCAACACCATCATTGCCGCTATTAACTTCGCGGCGGTGCTCCTCTCCGTCCCCGTCATCGCCGCCGGGGTCTGGCTCTCCACGCAGGCTGACAACGCCTGCGTGAAGCTCATCCAATGGCCCATCATCGTCCTCGGCATCGTCGTCCTCGTCGTGGCCCTCGCGGGCTTCGTGGGCGCATTCTGGCGCATTCCGGGGCTCCTCCTCTTCTACCTCGCGGCCATGGTCATGCTCATCCTCGCTCTCGCGGGTCTTGTCGTATTCATCTTTGTCGTGACTAGCGGCGGCGGCGCGCACCTGGCGCCAAGCCGGATGTTCTTGGAGTATGAGCTCGACGACTACTCCGGTTGGCTGCGGCGGCAGGTGGAGGGGACGGAGAGGTGGAATCGGATCAAGGCGTGTTTGAGCTCGACCTCGACGTGCTCGGAGCTCAACCAGACGTATAATTTGGCGCAGGATTTCTTCAATGCCGAGCTTAGTCCTTTACAATCCGGATGCTGCAAGCCGCCAACGCGCTGCGGCTACACGTTCGTGAACCCGACGTACTGGATCAGCCCGATCGACACGGCTTCCGACGTCGACTGCGTGCTGTGGAGCAACGACCAGATGCAGCTGTGCTACTCCTGCTCCTCCTGCAAGGCCGGCCTGCTCGCCAACCTGCGGCGCGAGTGGCGCCGCGCCGACCTCCTCCTCGTGGCCGCCCTCATTGCGCTCATCACCGTCTACGCCATGGGCTGCTACGCCTTCCGCGCTGCCAAGACCGACGACATCTTCCGACGGTACAAGCAGGGATATACGTAG >Aco026877 ATGACTAACGATACATCCGGATGCTGCAAGCCGCCAACGCGCTGCGGCTACACGTTCGTGAACCCGACGTACTGGATCAGCCCGATCGACACGGCTTCCGACGTCGACTGCGTGCTGTGGAGCAACGACCAGATGCAGCTGTGCTACTCCTGCTCCTCCTGCAAGGCCGGCCTGCTCGCCAACCTGCGGCGCGAGTGGCGCCGCGCCGACCTCCTCCTCGTGGCCGCCCTCATTGCGCTCATCACCGTCTACGCCATGGGCTGCTACGCCTTCCGCGCTGCCAAGACCGACGACATCTTCCGACGGTACAAGCAGGGATATACGTAG >Aco003038 ATGGTTCGGGTTAGTAACGGGTTGCTGGGGTTTCTAAACATCCTAACGCTGGTGATCTCGTTCCCGGTGGTCGGGTCGGGCGTGTGGTTCCAGATCCATGGGGCGTCGGCGTGCGAGCGGGCGCTGCAGTGGCCCGTGATGGCGCTGGGGCTCTTCCTCCTCGCGGTGTCGTTAATGGGCCTGCTGGGGTCGTGTTGCCGCGTCTCGTTCCTGTTGTGGGTCTACCTCTTCGTGCTGTTCATCCTCATCCTCGCCATGTTTTGCTTCGCGGTGTTCGCGTTCGTGGTGACCAACCACGGGGCCGGGGAGGCGGTGTCGGGGAAGGGGTACAAGGAGTACCGGCTCGGGGATTACTCCCACTGGCTGCAGCGGAGGGTTGCGGATTGGAACACGTGGAAGCAGATCGAGAGCTGCATCGGCGACGCCAAGCTCTGCGGAGGGCTCGACGGCGAGGTCGGGTCCAAGGCCAACGAGTTCTACAAGCAGAATCTCTCGCCCATTCAGTCCGGTTGTTGCAAGCCTCCTACGTACTGTGGATTTGTATACAAGAATGCTACCTTCTGGGTGGCGCCGAAATCCGGTCTCAACACGCGCGACGCCGACTGCAAGGCGTGGAGCAACGACCAAGATAAGTTGTGCTACGGCTGCAACTCCTGCAAGGCCGGCGTGCTCGCGACGATCAAGAACAAGTGGAAGGTGGTGTCGATATTCAACGTCGCGCTCCTCGTCCTCCTCATCATCGTCTACTCGATAGGGTGCTGCGCCATCCGGAATAACCGGGCCGATAGCCACTACAAGCGTTACTACGGTTATCGCTGA >Aco015235 ATGGCGGTGAGCAACAACATCACGGCGTTCATCAACTTCATGGCCCTCCTCTGCTCAATCCCCATCATCGGCGCCGGGATCTGGCTCGCCTCGAAGCCCGACGCCGAGTGCCTGCGCCTCGCGCGGTGGCCCCTCATCATCCTCGGCACCCTCATCCTCCTCGTCTCCCTCGCCGGCTTCGTCGGCGCCTACTGGGGCCGCGAGTGCCTCCTCGCCGCGTACCTCTTCGCCATGGCGGCGCTCATCGCCCTCCTCCTCGTGCTCATCGTCTTCGCCTTCGCCGTCACGCGCCCCGACGGGTCCGTCCCCGTCCCCGGGCGCGGCTACGACGAGTATCGGCTCGGGGGCTTCTCCGCGTGGCTCCGCGGGTACGTGGTCGACCCCGGTCGGTGGGCGCGGATCCGGGCGTGCCTCGGCGAGTCCGGCGTGTGCCAGAGGCTGAGTCGCGACGCGCCCTACCTCACCGCCGACCAATTCGCCCAATCCCACCTCTCCCCCCTCCAGTCCGGTTGCTGCAAGCCGCCGACGGCATGCGGGTACATGTATGTGAACCCGACGGTGTGGGTGAACCCGAGCAACGCGGGGGCGGACCAGGATTGCGCGGCATGGAGCAACGACCAGAGCCAGTTGTGCTATGGCTGCGAGGCATGCAAGGCCGGCATGCTGGGCAACCTGCGCGAGGAGTGGCGCAAAGCAAACGTGGCGCTCATCGTCGCCGCTGTCGCCCTCATCTTCGTCTACGTGATCGGCTGCAGCGCATTCAAGAACGCACAGACCGAGGACCTCTTCCGCCGCTACAAGCAGGGCTTTGTCTAA >Aco006498 ATGCCGCGCGCGAGCGGAGCCGTGCTTGGGGCGCTGAACGTGGCGACGCTGCTACTGTCGATCCCGATCATCGGGGCTGGGATATGGCTGAGTCACCGCGGGTCCACGGATTGCGAGCGGTTCCTACAGCGCCCGGTGATCGCTCTCGGGGTCTTCATCCTCCTCGTCTCCATCGCCGGGATCGCCGGGGCATGCTGCCGCAACAACTGCCTCCTCTGGATCTACCTCCTCGTCATGTTCGTGCTCATCCTCCTCCTCTTCTGCTTCACCGTGTTCGCCTTCGTCGTTACCAACAAGGGCGCGGGGTCGGTCGTCTCCGGGAGAGGGTACAAGGAGTATCGGCTCGGCGACTACTCGCATTGGCTCCAGCGGAGGGTGGATAATGACAACAACTGGAGAAGGATCAGGAGCTGTCTCCAGGACGGGAAGGTGTGCCAGAGCCTGCAGGAGAAGAACCAGACGCTCAACGACTTCATCAACAGCAATCTCTCGCCAATTCAGTCCGGGTGCTGTAAACCTCCCACTGCATGCAACTTCACCTATGCGAGCGAGACGGTTTGGGTCAAACCAGCCGGCTTTAATTCTTCCGATGACCCTGACTGCAATACGTGGTCGAACGATCAAAGCATGCTCTGCTACGACTGCCAATCCTGCAAGGCGGGCGTGCTTGCGAACCTCAAGCATGACTGGAAGAAGATCGCCATCGTGAACATTGTCTTCCTTGTCTTCCTCATCGTAGTCTACTCCTTCGGTTGCCACACATTCAGGACCAACCGGAGGGACAACTCGTACCCAGGATACAAATATTAA >MAC01G0304 ATGGTTCGGTGCAGCAATAACATGATCGGGGTGCTCAACATCATCACCTTCGTGCTGTCGATCCCCATCCTGAGCGCCGGCATATGGCTAGGTAGGCGCGCCACCACGGACTGCGAGAAGTTCCTGCAGGGCCCCGTCATCGCCCTCGGCGTCTTCCTCCTTCTGGTCTCCCTCGCCGGCGTGGTCGGTGGCTGCTGCCGTAACTCCTGCCTTCTCTGGCTCTACCTCTTCGGCGCCGGCGAGGCCGTCTCCGGCCGCGGGTTCAAGGAGTACCGCCTCGGCGATTACTCCAACTGGCTCCAGAAGCGGGTCGAGAACAACAAGAACTGGAAGCGGTTCAAGAGCTGCCTCCAGGACGGCAAGGTCTGCCAGAGCCTCCAGCAGAACAACCAGACGTGGGAGCAGTTCATCAACGATAACCTCTCTCCCATCCAGTCTGGATGCTGCAAGCCTCCTACAGCTTGCAACTTCATCTATGTGAACGAAACCTTCTGGACTAAACCCGTTGGCTACAATTCATCGGATATTCCAGATCCAGACTGCAACACATGGCAGAACGACCAGTCGATGCTCTGCTACGATTGCCAGTCTTGCAAGGCTGGGGTCCTTGCCAACGTCAAGAACGACTGGAAGAAGGTTGCTGTTGTTAACATCATCTTCCTCATCTTCCTCATCGTCGTGTACTCTGTTGGATGCTGTGCCTTCAGGAACAACAGGCAGGACAATGCTTACCCGAGATACAAACCGTACCCTTGA >MAC02G2336 ATGGTTCAGATCAGCAACAGCCTTGTGGGCTTCCTCAACTTCCTAACCCTGCTCATCTCCTTCCCCATCCTCGGCGCCGGGCTGTGGTTCCGTCTCCATGCCGCGACGGAGTGCGAGAGGTTCCTGCAACTGCCTCTCCTCGTGTTGGGCGGGTTCCTCCTGGTGGTGTCGGTGCTGGGCCTGATCGGCGCCTGCTGCCGCGTGTCGTTCTTCATGTGGCTCTACCTCTTCGTGATGTTCCTGTTGATCCTCGCCATGATCGTCTTCACCATCTTCGCGTTCGTGGTGACGAACAAGGGCGTGGGGGAGGCGGTGTCGGGCGTGGGGTTCAAGGAGTACCGGCTCAGCGACTACTCGGGGTGGCTGCAGAAGAGGGTGGAGAACTGGGAGACGTGGAGGCAGATCGACGGCTGCTTGAAGGACGCACAAGTATGCGCCGGGTTTGAGGGCTTGGCTGGTCTCCAGGCCAGCCAGTTCTTCGCCAAAAACCTATCACCCTTACAGTCTGGGTGCTGCAAGCCCCCAACATTCTGTGGATTCCAGTACAAGAATGCTACTTTTTGGACAATTCCCACAACAGGGCTTAAATCGACAGATGCTGACTGCAAACTGTGGAGCAATGACCAGGACAAGCTGTGCTACGACTGTGGCTCATGCAAGGCAGGTGTGCTTGCAACCTTGAAGACCAAGTGGAAGGCGGTTTCCATCTTCAATGTTGCCCTCCTTGTGTTTCTCATCATAGTCTATTCAATTGGTTGTTGTGCTCTGCGAAACAATAGAGCTAAGAGGCACGGGGGTTACTATCCCTATGCTCGTTGA >MAC03G1865 ATGGGCGTGAGCAACAACATCACGGCCGTGCTCAACTTCGTGGGCCTGCTGTGCTCCGTGCCCGTGATCGGCGCCGGCATCTGGCTCGCCTCCAAGCAGGACAACGAGTGCGTCCGCCTCGCCCGGTGGCCCGTCATCATCCTCGGCGTGCTCCTCCTCCTCGTTTCCCTCGCCGGCTTCGTGGGCGCCTACTGGGACAAGCAGGGCTTGCTCGCTGCCTACCTCTTCTGTATGGCCGCCCTCATCGTCCTCCTCCTCATCTTCCTCGTCTTCGCATTCGCCGTCACCCGCCCCGACGGCTCCTATCCCGTCCCTGGTCGCGCCTACCACGAGTACCGCCTCGCCGGCTTCTCCGCCTGGCTCCGCCACTACATCACCGACCACTGGATTCAGATTCGCGCCTGCCTGAGCTCCTCCGACGTCTGCCAGAAGCTCGGCCGAGATCAGCCCTACCTCACCGCCGATCAGTTCTTCCAGACGGATCTCTCGCCTCTCCAGGCCAGATGCTGCAAACCACCGACGGTCTGTGGCTATGGGTACGTGAACCCGACACTGTGGATCAACCCGAGTAACCCCATGGCGGACGTGGACTGCGCCCTCTGGAGCAACGACCAGAGCCAGCTCTGCTACAACTGCAACTCCTGCAAGGCGGGGCTGCTGGGCAACCTGCGCAATGAGTGGCGCAAGGCCAACGTCGCGCTCATCATTGCCGCCGTCGTCCTCATCTGGATCTACATCATCGGCTGCTGCGCCTTCAAGAATGCCCAGACCGAGGACCTCTTCCGCCGCTACAAGCGAGGTTATACTTGA >MAC03G2025 ATGTTTATCCTCATCCTCCTCCTCTTCTTCTTCACCATCTTCGCCTTCGTCGTCACCAATAAGGGCGCCGGCCAGGTCGTGTCCGGCAGCGGCTACAAGGAGTACCGCCTCGGCGATTACTCCCACTGGCTTCAGAAGCGGGTGGAGAAAACCAAGAACTGGGCCAAGATCCGCACCTGCCTCTCCGACGCCAAGGTCTGCCGGAGCCTGCAGGAGGCCAGCCTGTCCCTCGACCAGTTCATCAAGGACAACCTCTCGCCCATCCAGTCTGGATGCTGCAAGCCTCCCTCAGAATGCCGCTTCGACTACGAGAACGCAACCGTGTGGAATAAGCCGGCCGCCGGCTTCGCCTCAAACAACACCGACTGCGAGACGTGGAACAACGATCAGTCGACCCTCTGCTACGACTGCAGCTCCTGCAAGGCCGGCGTCATTGCCAACATCAAGGACAAGTGGAAGAAGATCGCCATCCTCAACATCATCTTCCTCGTCTTCCTCGTCATCGTCTACTCCATCGGCTGCTGCGCCTTCAGGAACAACAGGCGGGACAACGCATGGAAAGGAGGATACCCTTAG >MAC05G2763 ATGGTAAAGATCAGCAACAGCCTGATAGGCATCTTAAACTTCGTGACACTGCTCGTCTCCTTCCCGGTCATCGGCATTGCGGTGTGGTTCCGTGTGCAAGCCGCCACGGAATGCGAGCGGTTCCTGCAACTGCCCCTCCTCGTCCTCGGCATCTTCCTCTTCGTCGTATCAGTGCTGGGCTTCGTGGGCTCATGTTTTCGTGTGTCCGTCTTCCTATGGATCTACCTCTTCGTGTTGTTCCTGTTGATCCTTGCCATGGTTGCCTTCACGATGTTCGGCTTAATCGTGACCAATAAGGGTGTCGGACAAGCGATAGTTGGGAGGGCGTACAAAGAGTACAAACTCGACGACTACTCGCACTGGCTGCAGAAGAGGGTGCGGGATTGGCCGACCTGGAATGTCATCGAAGGCTGCTTGAAGGAGGCGAAGGTCTGCGGCCAGCTCGAGGGTGCCGTCGGCATGAAGGCCACCGAGTTCTACCGGAAAAACCTGTCGCCCATTCAGTCTGGTTGCTGCAAGCCACCGAGCTACTGCAGATTCACCTACGTAAATGCTACGTACTGGACGACGCCAAAATCTGGAGCAGTTGCATCAGGGCTCGATTGCAAGGCATGGAGTAACGGCCAGGAGAAGCTGTGCTACTCCTGTAACTCATGCAAGGGAGGTGTTCTGGCAACTCTCAAGGACGGGAGGAAGAAGGTGGCCATCGTCAACGCGGCTCTTCTTGTGTTTCTCATCATCACCCACACGGTGGGCTGCTGTGCGTACAGGAACAACAAGTCTCGCAACCATTACCCTCCTTACTACTATGGGGGTGCGCATCACTGA >MAC07G2520 ATGGTGCGGTTGAGCAACGGCCTCATCGGGGCGCTTAACGTCATCACGCTGATGCTGTCAATCCCCATCCTCGGCGGTGGCATTTGGCTGACCCAGCGCGCTGCCACTGACTGCGAGAGGTTCCTGGACGTGCCCCTCGTCGCGCTCGGCGTCTTCGCCTTCCTCGTCTCCCTCGCGGGCTGCGTCGGCGCCTACTTCCGCAACTCCTGCCTCTTATGGCTCTACCTCGGCGCCAGCCACGCCGTCTCCGGCCGCGGGTTCCCGGAGTACCGCCTCGGCGACTACTCCCATTGGCTCCAGAGGAGGGTGGACAGCGCCAAGAACTGGAGGAGCATCAGGAGCTGCTTGGTGCAGGGCAAGGTGTGCAAGAGCTTGCAGAACCAGAACCAGACGTGGGATCAGTTCATCGACGATAACCTCTCCCCTATACAGTCTGGATGCTGCAAGCCTCCAAGTGCATGCAACTTCACCTACATTAATGGAACTGCATGGACTAAACCTCCTGGCTTTTACTCATCCGATTTGCCAGACTGCAACTCATGGCAAAATGATCCATCCACTCTCTGCTATGACTGCCAATCTTGCAAGGCAGGGGTTCTTGCCAACCTCAAGCATGACTGGAAGAAGATTGCTGTCATTAATTTTGTGCTCCTCATCTTCCTCGTCGTCATCTACTTAATAGGATGCTGTGCTTTCAGGAACGACAAGGATGTCTATTGTTAA >MAC08G0943 ATGGGCGTGAGCAACAACATCACGGCCTTGTTCAACTTCGTGGGCCTGCTGTGCTCCGTGCCCGTGATCGGCGCGGGCATTTGGCTGGCCTCCAAACAGGACAACGAGTGCGTCCGCCTCGCCCGGTGGCCCGTCATCATCCTCGGCGTGCTCGTCATGCTCGTCTCCCTTGCCGGCTTCGTCGGCGCCTACTGGAACAAGCAGGGCCTGCTCGCCGCCTACCTCTTCTGCATGGCCGCCCTCATCGTCCTCCTCCTCGCCCTCCTCATCTTCGCCTTCGCCGTCACTCGCCCCGACGGCTCCTACCCGGTCCCCGGCCGCGCCTACCGCGAGTACCGCCTCGGCGGCTTCTCCGTTTGGCTCCGCCATTACGTCGCCGACCAATGGCCTCAGATCCGCACCTGTCTCAGCTCTTCCGATGTTTGCCAGAAATTTGGCAGGAATCAGCCCTACCTCACCGCCTATCAGTTCTTTCGGACCGACCTCACACCTCTCCAGGCCAGATGCTGTAAACCACCGACGGTGTGTGGATATGGGTACGTGAACCCGACAATGTGGAACAATCCCAGTAACCCCATGGCGGACGTGGACTGCGCTATCTGGAGCAACGACCAGAGCCAGCTCTGCTACGACTGCAGCTCGTGCGAGGCCGGGCTGCTGGGCAACCTGCGGAAGGAATGGCGCAAGGCCAATGTCGCGCTCATCATCGCCGCCGTCGTGCTCATCTGGGTCTACATCATCGGCTGCAGCGCTTTCAAGAATGCGCAGGCCCAGGATCTCTTCCGCCGCTACAAGCAGGGCTTCGTCTGA >MAC09G0820 ATGGTGCGGTTCAGCAACAGCCTCATCGGTGTGCTCAATGTCATCACTCTGGTACTGTCGATCCCCATTATCGGCGGCGGCATTTGGCTGAGCCAGCGTGCCAATACCGACTGCGAGAAGTTCCTGGAGCGGCCCCTCGTCGCCCTCGGTGTCTTCCTCTTCCTTGTCTCCCTCGCCGGCTTCGTCGGCGCCTGCTGCCGCAACTCCTGCCTCCTCTGGCTGTACCTGGTCGTCATGTTCCTCCTCATCCTCCTCCTCGTCTGCTTCACCGTCTTCGCCTTCGTCGTCACCAACAAGGGCGCCGGAGAGGTCGTCTCCGGACGCGGGTTCAAGGAGTACCGCCTGGGGGACTACTCCGACTGGCTCCAGAGGAGGGTGGAGAAGGCCAGTAACTGGAGGAGGATCCGCAGCTGCTTGCAGCAGGGCAAGGTGTGCGAGAGCTTGCAGAACAAGAACCAGACTTGGGACCAATTCATCAAAGATAACCTCTCCCCTATACAGTCTGGATGCTGCAAACCTCCCAGTGCATGTAACTTCACCTACATGAATGGAACTGCATGGAATAAACCTCCTGGCTTCAACTCATCTGATGTGCCGGACTGCAACACATGGCAAAGTGGCCAATCCACTCTTTGCTATGACTGCCAATCTTGCAAGGCAGGGGTTCTCGCCAACCTCAAGCATGACTGGAAGAAGGTTGCCGTAGCTAATATCATTTTCCTCATCTTCCTTGTTGTTGTCTACTCTATTGGATGCTGCGCCTTCAGGAACAACCGGGATGACAACCATCACCCCAGATATAAATGA >MAC10G0025 ATGGCTCTCAGCAACACCCTCATCGCCGGCATTAATTTCGTGGCCATGCTTCTCTCCATCCCCATCGTGGCCGTCGGCATCTGGCTCGCCACGCAGGCCGACAACTCCTGCGTGCAGCTTCTCCAGTGGCCTGTCATCGCAGTCGGCGTCGTCGTCCTCCTCGTGGCCCTGGCGGGCTTCGTCGGCGCCTTTTGGCGCGTTCCGTGGCTTCTGCTCTTCTACCTGGTTGCCATGCTCGTCCTCATACTCCTGCTGGCCGGCCTTGTGGTGTTTATCTACGCGGTCACCGTCAATGGCTCAGGTCACCTCGCCCCGGGCCGAGCTTTCCAGGAGTATCGCCTCGAGGACTACCCGGGGTGGCTTCGGCAGAGGGTGGAGGGACCACACCGGTGGAACCGCATCAAGGAATGTCTTAGCTCGACAGCAGCGTGTGCGGAGTTGAACCGGACGTATACATCGGCTCAGCATTTCTTCGATGCAAGGATCGGTCCCTTACAATCAGGGTGCTGCAAGCCACCGACGGAGTGCGGATACACATTTGTGAACCCGACGTACTGGATCAGCCCCATCAGCGCCGCGTCCGACATCGACTGCATGCTGTGGAGCAACGATCAGACGGTGCTTTGCTACTCGTGCTCGTCCTGCAAAGCCGGCCTCGTAGCCAACCTCGGAAGAGAATGGAAGAGGGGCGATGTGGTCTTGGTGGTGACCCTCGTGGCCCTCATCGTCGTCTACGCCATGGGTTGCTACGCTTTCCGGGATGCCAAGACGCAGGAGCTGTTCCAGAGATACAAGCAAGGCTACTACTGA >MAC10G1729 ATGGCTCTCGATGACACCGTCATCGCCGGCATCAACTTTCTGGCCGTGCTTCTCTCTGTACCTGTCATCGGCATCGGCATCTGGCTCGCCATGCAGACCGATAACTCCTGCGTGCAGCTCCTCCAATGGCCAGTCATCGTCATCGGCATCGTCATCCTCCTCGTGGCTCTTGCGGGCTTCGTCGGTGCCTTTTGGCGCATGCCGAGGCTTCTGCTCTTCTACCTCGTGGCCATGCTCGTCGTCATACTCCTGCTGGCGAGCCTCGTCATCTTCATCTACGCGGTCACCGTCAATGGCTCCGGCCACCCGGCTCCAAACCGAGCCTACCTGGAGTACCGCCTGGAGGACTACTCGGGGTGGCTCCGGCGGAGGGTGGAGGGATCATACAAGTGGAACCGCATCAAGAAATGTCTGAGCTCCACAACTGTGTGCGCGGAGTTGAATCAGACGTACAGATTGGCTGAGGATTTCTTCGGTGCAAGGATGAGTCCCTTGCAGTCAGGATGCTGCAAGCCACCGACGGCATGCGGGTACACGTTCGTGAATCCGACGTACTGGATCAGCCCCATCAGCAGCACATCGGACGTGGATTGCACGCTGTGGAGCAACGACCAGATGGTGCTTTGCTACTCGTGCACGTCCTGCAAAGCCGGCTTGCTGGCCAACCTTAGACGAGAGTGGAGGACAGCGGACGTGGTGCTGGTGGTGACCCTTGTGGCCCTCATCTTCGTCTACGTCATGGGTTTCTGCGCTTTCCGGAACGCCAAGACGGATCAGCTCTTCCGGCGATACAAGCAAGGTCACAACTGA >MAC11G0782 ATGTTCATCCTCATCATCCTCCTCTTCTGCTTCACCGTCTTCGCCTTCGTCGTCACCAACAAGGGCGCCGGCGAGGCCGTCTCCGGCCGCGGGTTCAAGGAGTACCGCCTCGGCGACTACTCCAACTGGCTCCAGAAGCGGGTCGACAGCGACAAGAACTGGAGGCGGATCAAGAGCTGCCTCCAGGACGGTAAGGTCTGCCGCAGCCTTCAGGAGAAGAACCAGACATGGGATCAGTTCGTCAACTACAACCTCTCCCCCATTCAGTCTGGGTGCTGCAAGCCTCCTACAGCTTGCAACTTCATCTACGTGAATGAGACTTTCTGGACCAAGCCCGTAGGCTACAATACATCCGTTCCAGACTGCAACGCATGGCAGAACGATCAATCGGTCCTCTGCTACGACTGCCAGTCCTGCAAGGCCGGCGTCCTCGCCAACATCAAGAGCGACTGGAAGAAGGTCGCCATCGTCAACGTCGTCTTCCTCGTCTTCCTCATCGTCGTCTACTCCATCGGATGCTGCGCCTTCAGGAACAACAGGCGGGACAACGCGTACACGGGATTAAAGACATACCCTTAG >MAC12G1609 ATGGTGAAGATAAGCAACAGCCTGGTCGGCGTGCTCAACTTCCACACCCTCCTCATCTCCTTCCCGGTCATTGACATCGCCCTATGGTTACGGATCAAGGCCCCCACGGAATGCGAGCGGTTCCTCCAACTGCCCCTCCTCGTCGTGGGCGTCTTCCTTTTCGTCGTGTCTGTGCTGGGCGTCGTCGGCTCGTGCTTCCGGGACTCCATCTTCCTCTGCATCTACGTCTTCCTCCTCTTCCTGCTGATCCTTGCCATGGCTGCCTTCACCGTCTTCGCCTTGGTCGTGACGAACAAGAGCATCGGCCAGGCGATATCGGGGAAGGGATACAAGGAGTATAGGCTGGGGGACTACTCGCACTGGCTGCAAAAGAGGGTGGGGGATCGGAAGAATTGGAGGGTGATCCATGGCTGCATGAAGGAGGCCAAGGTCTGTGGCCGTCTCGAAGATGACATCGGCACGAAGGCCTCCGAGTTCTACAGGAAAAACCTGTCACCCATGCAGTCTGGTTGCTGCAAGCCGCCAACCTACTGCGGATTCACCTACGCTAATGCTACATATTGGATCATCCCAAGATCTGGTCTCTCTTCATCAAATCCTGATTGCAAGGCATGGAGCAATGACCAAGATAAGCTGTGCTATGGCTGCAACGCATGCAAGGAAGGTGTTCTTGCAAACCCTCGAGAACGGGTGGAAGAAGGTCGTCATCTTAAATGCTGCTCTTCTTGCCTTTGTCATCGTCATCTACTCGGTTGGATGTTGCGCATTCAGGAACAACAATTCTCATAG >TAE03281G003 ATGGCGCTCAACTACATGGGCGCCGCGGCCATCAACGCGGTGGCGGCCCTGCTGTCCATCCCGGTGATCGCGGCCGGCATCTGGCTCTCCACGCAGGCCGACAACGCCTGCGTCCAGATCCTCCAGTGGCCGCTCATCGGCCTCGGCGTCGCCGTCCTCGCCGTCGGCCTCGCGGGCTTCGTCGGCGCCTTCTGGCGCCTGCCCTGGCTCCTCCTCGCCTACATGGTCCTCATGCTGCTCCTCGTCGCCGCGCTCGCCTGCCTCGCCGTCTTCGTCTTCGTCGCCACCACCGGCACCTCCGGCCGCCCCGTGCCCAGCCGCGCCTTCCTCGAGTACGACCTCGCCGACTACTCCGGCTGGCTGCGCCGCCGCGTCGCCGACGAGCCGGGGAGGTGGGACGAGATCAAGACGTGCCTGGCCGCCACCGCGCCCGTCTGCTCCGAGCTCAACCAGACGTACGCCGCGCCGCAGGACTTCTTCGCCGCCTGGCTCACCCCGATGCAGTCCGGCTGCTGCAAGCCGCCGACGAGGTGCGGCTACACCTTCGTCAGCGCGACCAACTGGATCAGCCCGATCGACGGCGCCGCCGACCCCGACTGCGCCGCCTGGAGCAACGACCAGGACCGGCTCTGCTACTCCTGCGACTCATGCAAGGCCGGGCTGCTGCAGAACCTCCGCCGGGAGTGGCGCCGCGCGGACGTCGTCCTCGCCGTGACCGTCGTCGCCCTCCTTGCGGTCTACGCCATGGGCTGCTACGCGTTCCGCACCGCCAGGACGGACGAGCTCTTCCGCCGCTACCGGCAGGGCTACACGTAA >TAE03483G001 TCGGGCTGCTGCAAGCCCCTGTCGGTGTGCGGGTTCGGGTACGTGAGCCCGACGGTGTGGACAAACCCGGCGCGGCCCGTGTCGGACCCGGACTGCGGCCTGTGGAGCAACGACCCGGCGCAGCTGTGCTACGAGTGCGAGTCGTGCCGCGCGGGCCTCCTGGCGGCGCTGCGGAGCCAGTGGCACAAGGCCAACATCGCGCTCGTCGTCGCCACCGTCTCGCTCGTCTTCCTCTACCTCATCGGCTGCAGCGCCTACAAGAACGCGCACGCCGAGGCCATCTACCACCGCTACAAGTGGTGA >TAE06975G001 ATGGTGGGCCTCTCGAACGGCGTCCTGGGCGCCCTGAGCATCGTGTCCCTGGTGGCCGCCGCCCCGCTCCTCGGCGCGGGCGCCTACCTCCACGACCACGGCGCCTCCACCGAGTGCCAGCGCCTGCTGCGGCTGCCCACCCTCGCCCTCGGCGGCGGGATCCTCCTCCTCTCCCTCATGGCCCTCTTCGGCGCGTGCTGCCGCTCCTGCAGCCCGCTCCTCTGGCTCTACGTGATCGCCATGTTCCTGCTCGTCGTCGGCATGTTCTTCGTCGCCGTCTTCGCCTACGCCGTCACCAACAAGGGCGCCGCCACCGCCGCCGACGGGACCGGCTACGGGGACTACCGGATCGGGGACTACTCCGACTGGCTCAAGGACAAGGTCGAGGACTACGAGACGTGGCAACAGATCCAGAGCTGCATGGCCGACGCCGGCGTCTGCGGGGATGGCCGGTTCAGCGGCCGGCTCGGCGGCGTCTCCGCCGGGATCGACGCCACCGACTTCTACCGCCTGCATCTGCCGCTCCTCCAGTCCGGGTGCTGCAAGCCGCCGGCGTACTGCGGGTACCGGGCGGTGAACGCGACGTTCTATGAGGCCCCGGCGAGCGGGCTGGGCACGGCGGACGCGGACTGCCAGGCGTGGAGCAACGAGCCGAGCCTGATGTGCTTCCGGTGCAACGCGTGCAAGGTGGGCGTGCTGGCCACCGCCAAGAGCAACTGGCGGGCCGTGGCCGGCGCCAACATCGCCGCCCTCCTGCTCATCCTCCTCGCCTACTCCCTCGGCTGCTGCGCCCTCCGCAACCACGACCGGCGTCGCCGCGGCGGATACTACTACTGA >TAE07440G001 ATGGTGGGCCTCTCGAACGGCGTCCTGGGCGCCCTGAGCATCGTGTCCCTCGTGGCCGCCGTCCCGCTCCTCGGCGCGGGCGCCTACCTCCACGACCACGCCGCCTCCACCGAGTGCCAGCGCCTGCTGCGGCTGCCCACCCTCGCCCTGGGCGGCGGGATCATCCTCCTCTCCCTCATGGCCCTCTTCGGCGCGTGCTGCCGCGCCTGCAGCCCGCTCCTCTGGCTCTACGTGATCGCCATGTTCCTGCTCGTCGTCGGCATGTTCTTCCTCACCGTCTTCGCCTACGACGTCACCAACAAGGGCGCCGCCACCGCCGCCGACGGGAGCGGCTACGGGGACTACCGGATCGGGGACTACTCCGACTGGCTCAAGGACAAGGTCGAGGACTACGAGACGTGGCAACAGATCCAGAGCTGCATGGCCGACGCCGGCGTCTGCGGAGATGGCCGGTTCAGCGGCCGGCTCGGCGGCGTCTCCGCGGGGATCGACGCCACCGACTTCTACCGCCTGCATCTGCCGCTCCTCCAGTCCGGGTGCTGCAAGCCGCCGGCGTACTGCGGGTACCGGGCGGTGAACGCGACGTTCTACGAGGCCCCGGCGAGCGGGCCGGGCACGACGGACGCGGACTGCCAGGCGTGGAGCAACGAGCCCAGCCTGATGTGCTTCCGGTGCAACGCGTGCAAGGTGGGCGTGTTGGCCACCGCCAAGAGCAACTGGCGGGCCGTGGCCGGCGCCAACATCGCCGCCCTCCTGCTCATCCTCCTCGCCTACTCCCTCGGCTGCTGCGCTCTCCGCAACCACGACCGGCCCCGCCGCGGCGGATACTACTACTGA >TAE07602G001 ATGGCCGTGAGCAACAACATCACGGCGTGCCTCAACTTCCTGGCCCTAATCTGCACCATCCCGGTGGTCGCCACGGGCCTCTGGTTCGCCTCCAAGCAGGGCGCCGAGTGCGCGCGGCTGGCGCGCTGGCCCGTGGCCATCCTCGGCGGGCTGCTCCTCCTCGTCGCCCTCGCGGGCTTCGTCGGCGCCTACTGGAACCGCCAGGGCCTGCTGGCCGCCTACCTCTTCGCCATGGCGGCCCTCATCACGCTCCTGCTGGCCCTCCTCGTCTTCGCCTTCGCCGTCACCCACGGCTCCGGGGCGTACGACGTGCCCGGCCGCGCCTACCGCGAGTACCGCCTCGAGGGCTTCTCCGGCTGGCTGCGCGGGTATGTTGCTGGGGATCCCCAGCGGTGGGAGGGCATCAGGGCGTGCCTCGCCGCGTCGGACACCTGCAAGAAGCTCACCATGGAGACCGCCTTCTTCATCGCCCCCGAGCAGTTCTACCAGTCCGACCTCTCCCCGCTCCAGTCCGGTTGCTGCAAGCCGCCGACGGCGTGCGGGTACGCGTACGTGTCCCCGACGGTGTGGACGAGCCCGGCGAACCCGGCGGCGGACGCGGACTGCGGCGTCTGGAGCAACGACCCGCGGCAGCTCTGCTACTGGTGCGTCTCCTGCAAGGCCGGCATGCTGGGCACCCTGCGCGACCAGTGGCGCCGGGCCAACGTGGCGCTCGTCGCCGCCACCGTCGCGCTCCTCGTCGTCTACGTCATCGGCTGCAGCGCCTTCAAGAACGCCCAGACCGAGGACCTCTTCCGCCGCTACAAGTGGAGCAACAACACCTGA >TAE09938G001 ATGGCGGTGAGCAACAACATCACGGCGTGCGTGACGCTGATGGCGCTCATCTGCGCGGTCCCCGTCATCGCCTCGGGGGTGTGGTTCGTGTCGGCGCAGGGGGAGGAGTGCGCGCGGCTGGCGCGCTGGCCCGTGGCCATCCTGGGCGGCCTCATCTTGCTGGCGGCCCTGGCGGGCTTCGTCGGCGCCTACTGGAACCGCCGCCGCCTCCTCGCCTTCTACCTCTTCGCCATGGCGGCGCTCATCGCCCTCCTTATCGCGCTCCTCGTCCTCGCCTTCGCGGTTACCCGCGGCTCCGGCGCCTACCCGGTGCTCGGCCGCGAGTACGACGAGTACCGCCTCGACTGCTTCTCCATGTGGCTGCGCGGGTACGTCTCCGATGACCCCGCCCGGTGGGAGGGGATCAGGTCCTGCCTCGCCGTCTCTGACACCTGCAAGAAGCTCGCCCGACAGGCCGGCTACGTCACTGCCGACCAGTTCTACCAGTCCCGCCTCACGCCGCTCCAGGTACGTACTACTGTAGTAGAGTATTATCCATCACCTAATCCCAGTCCTTCTCGTCACTATATTTTTAGAACTAGCTAG >TAE10925G001 ATGGCGCGGTGCAGCAACGGGCTGCTGGGCCTGCTGAACGCGGGGGTGCTGGTGCTCGCCCTCGTCGTCCTCGGCGGCGGCATCTGGCTGAGCCACCGGGCCTCCACCACCGACTGCGAGCGGTTCCTGGAGCGGCCGGTCATCGCGCTCGGCGCCCTCCTCCTCGCGCTCTCCCTCGCGGGCCTCGCCGGCTCCCTCTGCCGCGCCTCCTGCCTCCTCTGGCTCTACCTCGTCGCGCTCTTCCTCCTCATCGCGCTCCTCCTCGTCTTCACCGTCTTCGCCTTCGTCGTCACCAACCGCGGCGCCGGCTCCGTCGTCTCCGGCCGCGGCTACAAGGAGTACCGCCTCGGGGAGTACTCCACCTGGCTCCAGCGCCGGGTCGAGAGCGCCGACAACTGGGCCAAGATCCGCAGCTGCCTCCGCGACGGCGGCGTCTGCCAGAGGTTCGGGGCCAGGGGGGAGTCGCTGCAGCAGTTCGTCACCAACAACCTCTCCCCGATTCAGTCTGGATGCTGCAAGCCCCCAACCGGGTGCAACTTCACCTACCAGAGCGAGACCGTCTGGGCCAAACCTACTGGCCTCAACTCTACCAACGACCCTGACTGCAACACGTGGTCGAATGATCAGAGGGCCCTCTGCTACGACTGCCAGTCATGCAAGGCCGGCGTGCTTGCCAACCTGAAGAACGACTGGAAGAAGATCGCCACCGTCAACATCATATTCCTCATCTTCCTCATCATCGTCTACTCTGTTGGGTGCTGCGCTTTCAGGAACAACAGGCGGGACAACTCGTACCCAGCCTGGAAGTGA >TAE11587G004 ATGGTGCGGCTGAGCAACACCATGATCGGGATCCTGAACGCAGTCACCTTCCTCCTCTCGGTGCCCATCCTGGCGGGGGGCATCTGGCTGCGGGCCCGCGCCGACGGCACCGAGTGCGAGCGGTACCTGGCGGCGCCGGTGATCGTCCTGGGGGTCTTCCTCATGCTCGTCTCCGTCGCGGGGCTCGTCGGCGCCTGCTGCCGCGTGACCTGCCTCCTCTGGTTCTACCTCGTCGCCATGTTCCTGCTCATCGTCGTCCTCCTCGGCATCACCGTCTTCGCCTTCGTCGTCACGCACAAGGACACCGGCGAGGCCGTCTCCGGCCGCGGGTTCAAGGAGTACCGGCTCGGGGACTACTCCACCTGGCTGCAGAGGCGGGTGGAGAACGACAGGAACTGGAACAGGATCAGGGGCTGCCTCCAGGACGCCAAGGTCTGCAAATCGCTCGAGGACAGGAGGGAGACCCTCGACCAGTTCATGTCCTCCGATCTCTCCCCCATCCAGTCCGGCTGCTGCAAGCCTCCGATCAGCTGCGGCTTCACCTACGTCAACGGCACGCAGTGGAGCGGCCCGGCCAAGTCGACGGAGCCCGACTGCAGCGCGTGGTCCAACGACGACGGGGCGCTCTGCTACGGCTGCCAGTCGTGCAAGGCCGGCGTGGTGGCCACCCTCAAGCGCAACTGGAAGCGCTCCGCCATCATCAACATCGTCTTCCTCGTCTTCATCGTCATCGTCTACTCCGTCGGCTGCTGCGCCTTCAGGAACAACCGCCGCGACCACCGCAACGGCGGCGGGTACAAGCAGCAGGGCGCCTACGCCTGA >TAE14849G001 ATGCCATCCCCACCCACGAAGGAAGCCCGCACCGCAGACGCCCCGCGCCGCGTCAAGAACACACAGAGAGGACGAAGCACGGTCTGGGAGAGCGAGAGCCGCAGCGGCGAGGTTCCAGCCATGGCGGTGAGCAACAACATCACGGCGTGCGTGACGCTGATGGCGCTCATCTGCGCCGTCCCCGTCATCGCCTCGGGGGTGTGGTTCGCGTCGGCGCAGGGGGAGGAGTGCGCGCGGCTGGCGCGCTGGCCTGTGGCCATCCTGGGCGGCCTCATCCTCCTGGCGGCGCTGGCGGGCTTCGTCGGCGCCTACTGGAACCGCCGCCGCCTCCTCGCCTTCTACCTCTTCGCCATGGCGGCGCTCATCGCCCTCCTCATCGCGCTCCTCGTCTTCGCCTTCGCGGTCACCCGCGGCTCCGGCGCCTACCCGGTGCTCGGCCGCGAGTACGACGAGTACCGCCTCGACGGCTTCTCCATGTGGCTGCGCGGGTACGTCTCCGACGACCCCGCCCGCTGGGAGGGGATTAGGTCCTGCCTCGCCGTCTCTGACACCTGCAAGAAGCTCGCCCGGCAGGCCGGCTACGTCACCGCCGACCAGTTCTACCAGTCCCACCTCACGCCGCTCCAGTCGGGCTGCTGCAAGCCCCCGTCGGTGTGCGGGTTCGGGTACGTGAGCCCGACGGTGTGGACGAACCCGGCGCGGCCGGCGTCGGACCCGGACTGCGGCCTGTGGGGCAACGACCCGGCGCAGCTGTGCTACGAGTGCGAGTCGTGCCGCGCGGGCCTCCTGGCGGCGCTGCGGAGCCAGTGGCACAAGGCCAACATCGCGCTCGTCGTCGCCACCGTCTCGCTCGTCTTCCTCTACCTCATCGGCTGCAGCGCATACAAGAACGCGCACGCCGAGGCCATCTACCGCCGCTACAAGTGGTGA >TAE15379G001 ATGTGTGGAGTTGTGGCATCGAACACATTGTGGAAGGCCTTACACCGCAGACGCCCCGCGCCGCGTCAAGAACACAGAGGACAAAGCACGGTCTGGGAGAGCCAGAGCAACAGCAGCGGCGAGGCTCCAGCCATGGCGGTGAGCAACAACATCACGGCGTGCGTGACGCTGATGGCGCTCATCTGCGCGGTCCCCGTCATCGCCTCGGGGGTGTGGTTCGCGTCGGCGCAGGGGGAGGAGTGCGCGCGGCTGGCGCGCTGGCCCGTGGCCATCCTGGGCGGCCTCATCCTGCTGGCGGCGCTGGCGGGCTTTGTCGGCGCCTACGGGAACCGCCGCCGCCTCCTCGCCTTCTACCTCTTCGCCATGGCGGCGCTCATCGCCCTCCTCATCGCGCTCCTCGTCTTCGCCTTCACGGTCACCCGCGGCTCCGGCGCCTACCCGGTGCTCGGCCGCGAGTACGACGAGTACCGCCTCGACGGCTTCTCCATGTGGCTGCGCGGGTACGTCGACCCCGCCCGGTGGGAGGGGATCAGGTCCTGCCTCGCCGTCTCTGACACCTGCAAGAAGCTCGCCCGACAGGCCGGCTACATCACTGCCGACCAGTTGTACCAGTCCCGCCTCACGCCGCTCCAGGTACGTACTACTGTAGTAGAGTATTATCCATCACCTAATCCCAGTCCTTCTCGTCACTATATTTTTAGTTGA >TAE17254G002 ATGGTGCGGCTAAGCAACACGGTGATCGGGATCCTGAACGCGGTGACCTTCCTGCTCTCGGTGCCCATCCTGGCGGGCGGCATCTGGCTGCGGGCGCGCGCCGACGGCACCGAGTGCGAGCGCTACCTGGCGGCGCCGGTGATCGCGGTGGGGGTGTTCCTCATGCTCGTCTCCATCGCGGGGCTCGTCGGCGCCTGCTGCCGCGTCACCTGCCTCCTCTGGTTCTACCTCGTCGCCATGTTCCTGCTCATCGTCGTCCTCCTCGGCCTCACCGTCTTCGCCTTCGTCGTCACGCACAAGGGCACCGGGGAGGCCGTCTCCGGCCGCGGATTCAAGGAGTACAGGCTCGGGGACTACTCCAACTGGCTGCAGAAGCGGGTGGAGAACGACAAGAACTGGAACAGGATCAAGGGCTGCCTCCAGGACGCCAAGGTCTGCAAGTCGCTCGAGGACAAGACGGTCGACCAGTTCATGTCCTCCGATCTCTCCCCCATCCAGTCCGGCTGCTGCAAGCCTCCGATCAGCTGCGGCTTCACCTACGTCAACAGCACGCAATGGACCGGCCCCGCCAAGTCGACGGAGCCCGACTGCGGCGCGTGGTCCAACGACGGGGCGCTCTGCTACGGCTGCCAGTCGTGCAAGGCCGGCGTGGTGGCCACCCTCAAGCGCAATTGGAAGCGCTCCGCCATCATCAACATCGTCTTCCTCGTCTTCATCATCATTGTCTACTCCGTCGGCTGCTGCGCCTTCAGGAACAACCGCCGCGACCACCGCAACGGCGGCGGGTACAAGCAGCAGGGCGCGTACGCCTGA >TAE20238G002 ATGGTGCGGCTGAGCAACACCATGATCGGGATCCTGAACGCCATCACCTTCCTCCTCTCGGTGCCGATCCTGGCGGGGGGCATCTGGCTGCGCGCGCGCGCCGACGGCACCGAGTGCGAGCGGTACCTGGCGGCGCCGGTCATCGTCCTGGGGGTCTTCCTCATGCTCGTCTCCATCGCGGGGCTTGTCGGCGCCTGCTGCCGCGTGACATGCCTCCTCTGGTTCTACCTCGTCGCCATGTTCCTGCTCATCGTCGTCCTCCTCGGCATCACCGTCTTCGCCTTCGTCGTCACGCACAAGGGCACCGGCGAGGCCGTCTCCGGCCGCGGGTTCAAGGAGTACCGGCTCGGGGACTACTCCACCTGGCTGCAGAGGCGGGTGGAGAACGACAGGAACTGGAACAGGATCAGGGGGTGCCTCCAGGACGCCAAGGTCTGCAAGTCGCTCGAGGACAGGAGGGACACGGTCCAACAGTTCATGTCCTCCGATCTCTCCCCCATCCAGTCCGGCTGCTGCAAGCCTCCGATCAGCTGCGGCTTCACCTACGTCAACGGCACGCAGTGGAGCGGCCCGGCCAAGTCGACGGAGCCCGACTGCGGTGCGTGGTCCAACGACGACGGGGCGCTCTGCTACGGCTGCCAGTCGTGCAAGGCCGGCGTGGTGGCCACGCTCAAGCGCAACTGGAAGCGCTCCGCCATCATCAACATCGTCTTCCTCGTCTTCATCGTCATCGTCTACTCCGTCGGCTGCTGCGCCTTCAGGAACAACCGCCGCGACCACCGCAACGGCGGCGGGTACAAGCAGCAGGGCGCGTACGCTTGA >TAE29443G001 CTGACGGAGCTTTTGGTGTGGTGTGGTGTGGTGTGGTCGCAGTCGGGCTGCTGCAAGCCCCTGTCGGTGTGCGGGTTCGGGTACGTGAGCCCGACGGTGTGGACGAATCTGGCGCGGCCCGCGTCGGACCCGGACTGCGGCCTGTGGAGCAACGACCCGGCGCAGCTGTGCTACGAGTGCGAGTCGTGCCGCGCGGGCCTCCTGGCGGCGCTGCGGAGCCAGTGGCACAAGGCCAACATCGCGCTCGTCGTCGCCACCGTCTCGCTCGTCTTCCTCTACCTCATCGGCTGCAGCGCCTACAAGAACGCGCACGCCGAGG >TAE33578G001 ATGGCCGTGAGCAACAACATCACGGCGTGCCTCAACTTCCTGGCCCTAATCTGCACCATCCCGGTGGTGGCCACGGGCCTCTGGTTCGCCTCCAAGCAGGGCGCCGAGTGCGCGCGGCTGGCGCGCTGGCCCGTGGCCATCCTCGGCGTGCTCCTCCTCCTCGTCGCCCTCGCGGGCTTCGTCGGCGCCTACTGGAACCGCCAGGGCCTGCTGGCCGCCTACCTCTTCGCCATGGCGGCCCTCATCACGCTCCTCCTGGCGCTCCTCGTCTTCGCCTTCGCCGTCACCCACGGCTCCGGGGCGTACGACGTGCCCGGCCGCGCCTACCGCGAGTACCGCCTCGAGGGCTTCTCTGGCTGGCTGCGCGGGTATGTTGCTGGGGATCCCCGGCGGTGGGAGGGGATCAGGGCGTGCCTCGTCGCGTCGGACACCTGCAAGAAGCTCACCATGGAGACCGCCTTCTTCATCGCCCCCGAGCAGTTCTACCAGTCCGACCTCTCCCCGCTCCAGTCCGGCTGCTGCAAGCCGCCGACGGCGTGCGGGTACGCGTACGTGTCCCCGACGGTGTGGGCCAGCCCGGCAAACCCGGCGGCGGACGCGGACTGCGGCGCCTGGAGCAACGACCCGCGGCAGCTCTGCTACTGGTGCGAATCCTGCAAGGCCGGCATGCTGGGCACCCTGCGCGACCAGTGGCGCCGGGCCAACGTGGCGCTCGTCGCCGCCACCGTCGCGCTCCTCGTCGTCTACGTCATCGGCTGCAGCGCCTTCAAGAACGCCCAGACCGAGGACCTCTTCCGCCGCTACAAGTGGAGCAACAACACCTGA >TAE40671G002 ATGGCGCGGTGCAGCAACGGGCTGCTGGGCCTGCTGAACGCGGGGGTCCTGGTCCTCGCCCTCGTCGTCCTCGGCGGCGGCATCTGGCTGAGCCACCGCGCCTCCACCACCGACTGCGAGCGGTTCCTGGAGCGGCCGGTCATCGCGCTCGGTGCCCTCCTCCTGGCGCTCTCCCTCGCGGGGCTGGCGGGCTCCCTCTGCCGCGCATCCTGCCTCCTCTGGCTCTACCTCGTCGCGCTCTTCCTCCTCATCGCGCTCCTCCTCGTCTTCACCGTCTTCGCCTTCGTCGTCACCAACCGCGGCGCCGGCTCCGTCGTCTCCGGGAGGGGCTACAGGGAGTACCGCCTCGGGGAGTACTCCACCTGGCTGCAGCGCCGGGTCGAGAACGCCGACAACTGGGCCAAGATCCGCAGCTGCCTCCGCGACGGCGGCGTCTGCCAGAGGTTCGGGGCCAGGGGGGAGTCGCTGCAGCAGTTCGTCACCAACAACCTCTCCCCGATTCAGTCTGGATGCTGCAAACCCCCAACCGGGTGCAACTTCACCTACCAGAGCGAGACCATGTGGAACAAACCTCCTGGCTTCAACTCTACCAATGACCCTGACTGCAACACGTGGTCGAATGATCCGAGGGCCCTTTGCTATGACTGCCAGTCATGCAAGGCTGGCGTGCTCGCTAATGTGAAGAATGACTGGAAGAAAATCGCCACCGTCAACATCATATTCCTCATTTTCCTCATCATTGTCTACTCTGTTGGGTGCTGCGCTTTCAGGAACAACAGGCGGGACAACTCGTACCCAGCCTGGAAGTGA >TAE42143G003 ATGGCGCGGTGCAGCAACGGGCTGCTGGGCCTGCTGAACGCGGGGGTGCTGGTCCTCGCCCTCGTCGTCCTCGGCGGCGGCATCTGGCTGAGCCACCGGGCCGCCACCACCGACTGCGAGCGGTTCCTGGAGCGGCCGGTCATCGCGCTGGGTGCCCTGCTCCTGGCGCTCTCCCTCGCGGGCCTCGCGGGGTCCCTCTGCCGCGCCTCCTGCCTCCTCTGGCTCTACCTCGTCGCGCTCTTCCTCCTCATCGCGCTCCTCCTCGTCTTCACCGTCTTCGCCTTCGTCGTCACCAACCGCGGCGCCGGCTCCGTCGTCTCCGGGAGGGGCTACAGGGAATACCGCCTCGGGGAGTACTCCACCTGGCTCCAGCGCCGGGTCGAGAGCGCCGGCAACTGGGCCAAGATCCGCAGCTGCCTCCGCGATGGCGGGGTCTGCCAGAGGTTCGGCGCCAGGGGGGAGTCCCTGCAGCAGTTCGTCACCAACAACCTCTCCCCGATTCAGTCTGGATGCTGCAAACCCCCAACTGGGTGCAACTTCACCTACCAGAGCGAGACCGTCTGGGCCAAACCTACTGGCTTCAACTCTACCAACGACCCCGACTGCAACACGTGGTCGAATGATCCGAGGGCCCTCTGCTATGACTGCCAGTCATGCAAGGCTGGCGTGCTCGCTAATGTGAAGAATGACTGGAAGAAAATCGCCACCGTCAACATCATATTCCTCATCTTCCTCATCATCGTCTACTCTGTTGGGTGCTGCGCTTTCAGGAATAACAGGCGGGACAACTCGTACCCAGCCTGGAAGTGA >TAE42143G005 ATGGCAAGGATGAATCTGGCTGTTTCCCTGATCATCATGGAGACCATGTCTTACATTCCTCAGAGGAACCTCCGCCTTGTAACCTTGTCTCCTTTTCTCAAGTACACGACCGTCTGGATCAAACCTCCTGTCCTCAACTCTACCAATGACCCTGACTGCAACACATGGTCGAATGATCAGAGGGCCCTGTGCTACGACTGCCAGTCATGCAAGGCTGGCGTGCTCACTAACCTGAAGATTGACTGGATGAAGACCGCCATCATCAACATCGTATTCCTCATCGTCGTCTACTATGTTGGGTGTTGCGCTTTCAGGAACAAGTAA >TAE43513G002 ATGGCGCTCAACTACATGGGCGCCGCGGCCATCAACGCGGTGGCGGCCCTGCTGTCCATCCCGGTGATCGCGGCCGGCATCTGGCTCTCCACGCAGGCCGACAACGCCTGCGTCCAGATCCTCCAGTGGCCACTCGTCGGCCTCGGCGTCGCCGTCCTCGCCGTCGGCCTCGCGGGCTTCATCGGCGCCTTCTGGCGCCTGCCCTGGCTCCTCCTCGCCTACATGGTCCTCATGCTCCTCCTCGTCGCCGCGCTCGCCTGCCTCGCCGTCTTCGTCTTCGTCGCCACCACCGGCACCTCCGGCCGCCCCGTGCCCAGCCGCGCCTTTCTAGAGTACGACCTGGCCGACTACTCCGGCTGGCTGCGCCGCCGCGTCGCCGACGAGCCGGGGAGGTGGGACGAGATCAAGACGTGCCTGGCCGCCACCGCGCCCGTCTGCTCCGAGCTCAACCAGACGTACGCCGCGCCGCAGGACTTCTTCGCCGCCTGGCTCTCCCCGATGCAGTCCGGCTGCTGCAAGCCGCCGACGAGGTGCGGCTACACCTTCGTCAGCGCGACCAACTGGATCAGCCCGATCGACGGCGCCGCCGACCCCGACTGCGCTGCCTGGAGCAACGACCAGGACCGGCTCTGCTACTCCTGCGACTCCTGCAAGGCCGGCCTACTGCAGAATCTCCGCCGGGAGTGGCGCCGCGCGGACGTCGTCCTCGCCGTCACCGTCGTTGCCCTCCTTGCAGTCTACGCCATGGGCTGCTACGCGTTCCGCACCGCCAGGACGGACGAGCTCTTCCGCCGCTACCGGCAGGGCTACACGTGA >TAE55376G002 ATGGCGGTGAGCAACAACATCACGGCGTGCGTGACGCTGATGGCGCTCATCTGCGCGGTCCCCGTCATCGCCTCGGGGGTGTGGTTCGCGTCGGCGCAGGGGGAGGAGTGCGCGCGGCTGGCGCGCTGGCCCGTGGCCATCCTGGGCGGCCTCATCCTCCTGGCGGCGCTGGCGGGCTTCGTCGGCGCCTACTGGAACCGCCGCCGCCTCCTCGCCTTCTACCTCTTCGCCATGGCCGCGCTCATCGCCCTCCTCATCGCGCTCCTCGTCTTCGCCTTCGCGGTCACCCGCGGCTCGGGCGCCTACCCGGTGCTCGGCCGCGAGTACGACGAGTACCGCCTCGACGGCTTCTCCATGTGGCTGCGCGGCTACGTCTCCGACGACCCCGCCCGGTGGGAGGGGATTAGGTCCTGCCTCGCCGTCTCTGACACCTGCAAGAAGCTCGCCCGCCAGGCCGGCTACGTCACCGCCGACCAGTTCTACCAGTCCCACCTCACGCCGCTCCAGTCGGGCTGCTGCAAGCCCCCGTCGGTGTGCGGGTTCGGGTACGTGAGCCCGACGGTGTGGACGAACCCGGCGCGGCCGGCGTCGGACCCGGACTGCGGCCTGTGGAGCAACGACCCGGCGCAGCTGTGCTACGAGTGCGAGTCGTGCCGCGCGGGCCTCCTGGCGGCGCTGCGGAGCCAGTGGCACAAGGCCAACATCGCGCTCGTCGTCGCCACCGTCTCGCTCGTCTTCCTCTACCTCATCGGCTGCAGCGCCTACAAGAACGCGCACGCCGAGGNACATCGCGCTCGTCGTCGCCACCGTCTCGCTCGTCTTCCTCTACCTCATCGGCTGCAGCGCCTACAAGAACGCGCACGCCGAGGCCATCTACCGCCGCTACAAGTGGTGATTCCCATTTCCCATCCCAGCACCGAGAACCAACAGCCATCTCCAAGTAGTATGTTTGCTTCATACTGTATTATTATTAGTAGCTTGGTAACTGGTAGTAAGCTAGTAGGGGAAGATGGGAACTTCAGATTTATGGTTTGCCCATGCATGTATCGTGGAGAATTTTAG >TAE57338G006 ATGGCGCTCAACTACATGGGCGCCGCGGCCATCAACGCGGTGGCGGCCCTTCTGTCCATCCCGGTGATCGCGGCCGGCATCTGGCTCTCCACGCAGGCCGACAACGCCTGCGTCCAGATCCTCCAGTGGCCGCTCATCGGCCTCGGCGTCGCCGTCCTCGCCATCGGCCTCGCGGGCTTCATCGGCGCCTTCTGGCGCCTGCCCTGGCTCCTCCTGGCCTACATGGTCCTCATGCTCCTCCTCGTCGCCGCGCTCGCCTGCCTCGCCGTCTTCATCTTCGTTGCCACCACCGGCTCCAACGTCCGCCCCGTGCCCAGCCGCGCCTTCCTCGAGTACGACCTTGCCGACTACTCCGGCTGGCTGCGCCGCCGCGTCGCCGACGAGCCAGGGAGGTGGGACGAGATCAGGACGTGCCTGGCCGCCACCGCGCCCGTCTGCTCCGAGCTCAACCAGACGTACGCCGCGCCGCAGGACTTCTTCGCCGCCTGGCTCACCCCGATGCAGTCCGGCTGTTGCAAGCCGCCGACGAGGTGCGGCTACACCTTCGTCAGCGCAACCTTCTGGATCAGCCCGATCGACGGCGCTGCCGACCCCGACTGCGCTGCCTGGAGCAACGACCAGGACAGGCTCTGCTACTCCTGCGACTCCTGCAAGGCCGGCCTACTGCAGAATCTCCGCAGGGAGTGGCGCCGCGCGGACGTCGTCCTCGCCGTTACCGTCGTTGCCCTCCTTGCAGTCTACGCCATGGGCTGCTACGCGTTCCGCACCGCCAGGACGGACGAGCTCTTCCGCCGCTACCGGCAGGGCTACACGTAA >LOC_Os02g12750 ATGGCGGTGAGCAACAACATCACGGCGTGCGTGACGCTGATGGCGCTGATCTGCGCCGTCCCGGTGATCGCCTCGGGCGTGTGGTTCGCGTCGGCGCAGGGGGAGGAGTGCGCCCGCCTGGCGCGGTGGCCGGTGGCCATCCTGGGGGGCCTCATCCTCCTTGCCGCCCTCGCCGGCTTCGTCGGCGCCTACTGGAACCGCCGCCGCCTCCTCGCGTTCTACCTCTTCGCCATGGCGTCGCTCATCGCGCTGCTCATCGCGCTCCTCGTCTTCGCCTTCGCCGTCACCCGCGGCTCCGGCGCCTACCCGGTGCTCGGCCGCGCCTACGACGAGTACCACCTCGATGGCTTCTCCATGTGGCTCCGGGGCTACGTCTCCGACGACCCGGCGCGGTGGGAGCGGATCAAGGCGTGCCTCGTCGTCTCCGACACCTGCAAGAAGCTGGCGCGCCAGGCCGGGTTCCTCACCGCCGACCAGTTCTACCAGTCGCGCCTCTCGCCACTCCAGTCCGGGTGTTGCAAGCCGCCGGCGGTGTGCGGGTACAACTACGTGAGCCCGACGGTGTGGGCGGGGCCGGCGGCGCGGCCGGCGGCGGACGCGGACTGCGGGGCGTGGGGGAACGACCCGTCGCAGCTGTGCTACGAGTGCGAGTCGTGCCGCGCGGGCCTCCTCGCGGCGCTCCGCGCCCAGTGGCACCGCGCCAACGTCGCCCTCGTCGTCGCCACCGTCGCCCTCGTCTTCCTCTACCTCGTCGGCTGCAGCGCCTACAAGAACGCCCAGGCCGAGGCCCTCTTCCGCCGCTACAAGTGGTAG >LOC_Os02g49630 ATGGGGCGGTTCTCCAATGGCGTCCTGGGCGCCCTGAGCTTCGCCGCCCTCCTCGCCTCCGTGCCGCTCATCGGCGCGGGCGCCTACCTCCTCGACCACCCGGCCAGCGAGTGCCAGCGCCTTGTGCGGGTGCCCGCCGTGGCGCTCGGCAGCGCGGCGCTCCTCCTCTCCCTCATGGCGATCGCCGGAGTTACCTGCTGCCGCGGCGCGGCGCTCCTCTGGGCCTACGCGTCCGCCATGTTCCTGCTCATCGTCGGCATGTTCTTCGTCACCGCCTTCGTGTTCGTCGTCACCAACAGGGGCGTCGCCACCGCCGTGTCCGGCACCGGCTACGGGGACTACCGGGTCAGGGACTACTCGGAGTGGCTGCGTGCCAGGATCGAGGATTACGAGACGTGGCACCGGATCGAGAGCTGCATGGCCGACGCGGCCGTGTGCGGCGGCCCTCTCGCCGGGATCAACCCCGGCGAGTTCTACCGTCTGCATCTGCCGCTAATCCAGTGTGAACTAAACACAACCGTAGTATCTGACTACCTCTGTGACGTGACAACCGTGCAGTCCGGCTGCTGCAAGCCGCCAGTGTACTGCGGGTACGAGCGCGTGAACGAGACGTTCTGGATAGCGCCGGCGCGGGGCCTGGACGCGGCGGACGTCGACTGCCTGGAGTGGAGCAACGACCAGGCCGTGCTGTGCTTCCGCTGCAACGCCTGCAAGGCCAGTGCGCTGGACACCGTCAGGCGAAACTGGAGGGCCGTGGCCGTGCTCAACGTCGCCGTCCTCGCCATCCTCATGCTCGCCTACTCCCTCGCCTGCTGCTCCGTGCGGGATCGCAGCCGAGTCAGGTTGGGCAAGAAAGAACCCATCTTAGCAGTGCCGGCTATATCCATCAAGACATCAAAGCTAAAACTTTGGAACAACCAAGCGCCAACAACAACCCCATCGGTGTGTGACCGTCGTGTCCTACTGAAAAGGCAATGGATTAGTTCTGAGGAGGCCAATAAGATGGTTGCCGTGGCAAAAGAAGCAGTTGCGATTGAGAATTCACAAGTTGTCAATGAACAAGAATCGGTTGTTACGAACCAGGATGTCATAGAAGAACAATTGCTGCTTCCCAATCTTCATCTCAATCACTGTCACAACTAG >LOC_Os03g01012 ATGGCCCTCAACTATGTGGGCTTGGCGGCCATCAACCTGGTGGCTGCGCTGCTCTCCATCCCTGTCATCGCCGCCGGTATCTGGCTCTCCGCACAGGTGGACAGCGCCTGCGTCCAACTGCTCCAGTGGCCGCTGATCGGCCTCGGCGTCGCCGTCCTCGCCGTCGGTCTCGCCGGCTTCGTCGCCGCCTTCTGGCGCCTGCCCTGGCTTCTCCTCGCCTACTTGGTCGGCATGCTCCTCCTCGTGGTGGCGCTCGCCTGCCTCGCTGTCTTCGTCTTCGTCGTCACCGGCGGCGCGTCGTCGGGTGGTCACACCGTGCCCAGCCGGGCCTTCCTCGAGTACGAGCTCGACGATTTCTCGGGCAGCTGGCTACGCGGCCGCGTGGACGAGCCTGCAGGCAGATGGGAGCAGATCAAGACGTGCCTGGCCGCCACGCCCATCTGCTCCGACGTCAACCAGACATACGCCACGGCGCAGGATTTCTTCTCCGCCTCCTGGCTCACCCCGCTGCAGTCCGGGTGCTGCAAGCCTCCCACCAGGTGTGGCTACACCTTCGTCACCCCGATCTCGTGGATTAGCCCCATCAGCGCCGCCGCCGACCCGGATTGCGGCGCCTGGAGCAACGACCCTTCTCAGCTCTGCTACTCCTGCTCCTCCTGCAAGGCTGGCCTTCTCCACAACCTCAGCAGGGAGTGGCGCCGAGCTGATCTCATCCTCCTCGTCGCCACCGTCGCGCTCCTCGCCGTCTACGCATTCGCCTGCTACGCCTTCCGTACCGCCAAGACCGACGACCTCTTCCGCCGCTACAGGCAGGGCTACACGTAA >LOC_Os06g37510 ATGGCGGTGAGCAACAACATCACGGCGTGCGTCAACTTCCTGGCGCTGGTGTGCGCCGTCCCGGTGGTGGCCACGGGCGTCTGGTTCGCCTCCAAGCAGGGCGACGACTGCGCCCGCGTCGCGCGCTGGCCGCTCGCTATCCTCGGCGCCGCCCTCCTCCTCGTCGCCCTCGCCGGCTTCGCCGGCGCCTACTGGAACCGCCGGGGCCTCCTCGCCGCCTACCTCTTCGCCATGGCCGCGCTCATCACCCTCCTCCTCGCCCTCCTCGTCTTCGCCTTCGCCGTCACCCGCCCCTCCGGCGCCTACCCCGCCTTCGCCCGCGCCTACGACGACTACCGCCTCGACGGCTACTCCACCTGGCTGCGGGACCGCGTCGCCGGCGACCCTCGCCGGTGGGAGGGGATCAGGGCTTGCCTCGCCGCCTCCGACACCTGCAGGAAGCTGGCGCAGGAGAGCGTCTTCTTCATCACCCCCGAGCAGTTCTACCAATCACACCTCACCCCGCTCCAGTCGGGCTGCTGCAAGCCGCCGACGGTGTGCGGGTACGCGTACGTGAGCCCGACGGTGTGGGTGAACCCGGCGAACCCGGCTGCGGACGCGGACTGCGCCGCGTGGGGGAACGACCCGTCGCAGCTCTGCTACGAGTGCAGCTCCTGCAAGGCCGGGATGCTGGGCACCCTGCGGGAGCAGTGGCGCAGGGCCAACGTCGCCCTCGTCATCGCCACCGTCGCGCTCATCTTCTTCTACGTCATCGGCTGCAGCGCCTTCAAGAACGCGCAGACCGAGGACCTCTTCCGCCGCTACAAGTGGCGCAACTGA >LOC_Os06g44310 ATGGCGCGGTGCAGCAACGGCCTCCTCGGCCTCCTCAACGCCGGCGTGCTGGTCCTCGCCGTGGTGGTGCTGGGCGGCGGGATCTGGCTCAGCAACCGCGCCGCCACCACTGACTGCGAGCGGTTCATGGAGCGCCCCGTCGTCGCGCTGGGCGTGCTCCTCCTTGCGCTCTCCCTCGCCGGCCTCGCCGGCGCGCTCTGCGGCGCCTCCTGCCTCCTGTGGCTCTACCTCCTCGCGCTCTTCCTCCTCATCCTCGCCCTCTTCGTCTTCACCGTCTTCGCCTTCGTCGTCACCAACCGCGGCGCCGGCTGGGTCGTCTCCGGGAGAGGGTACAGGGAGTACCGCCTCGGGGACTACTCCACGTGGCTGCAGAGGAGGGTGGAGAACTCCGCGAACTGGGCCAAGATCCGGAGCTGCCTCCAGGACGGCAAGGTCTGCGAGAAGCTTGGGGCCAGGCGCGAGACCATGGACCAGTTCGTCGGCAGCAATCTCTCCCCGATTCAGTCTGGATGCTGCAAGCCCCCAACAGGATGCAACTTCGCCTACGTGAGCGAGACCGTCTGGACCAAACCTTCTGGCTTTAACTCTACCGATGACCCGGACTGCACGACATGGTCGAATGATCAGACCGCCCTGTGCTACGACTGCCAGTCATGCAAAGCTGGTGTGCTCGCTAACCTGAAGAATGACTGGAAGAAGATTGCGACTGTCAACATCATCTTCCTGATCTTCCTCATCATCGTCTACTCCGTTGGGTGCTGCGCTTTCAGGAACAACAGGCGGGACAACTCGTACCCGGCTTGGAAATGA >LOC_Os08g34460 ATGGCGTTCCGGCTCAGCAACAACGTGATCGGGGCGCTCAACCTGGTGACGCTGCTGCTCTCCGCTCCCATCCTCAGCGGCGGGATCTGGATGGCCACCCGCGGCGACGGCGGCGAGTGCGACCGCCACCTCTCCTCGCCGGCCATCGCGCTGGGGGCGGTCCTCATGGCCGTCTCCCTCGCGGGCCTCGTCGGCGCGTGCTGCCGCGTCACCTGGCTACTCTGGGTCTACCTCCTCGCCATGTTCGCCCTCATCGTCGCCCTCCTCGGCTTCACCGCCTTCGCCTTTGCCGTCACCAACCGTGGCGCCGGCGAGGCCGTCTCCGGCCGCGGGTACAGGGAGTACCGCCTCGGGGACTACTCCACGTGGCTGCGGCGCCACGTGGGGAGCAGCAAGAACTGGGACAAGATCAGGAGCTGCCTCGCCGGCGCCGACGTTTGCAGGAGCCTGCAGGACAGGAACGAGACGTGGGCGCAGTTCGTCGCCGACGACCTCTCCCCGGTCCAGTCCGGCTGCTGCAAGCCGCCCACGAGCTGCAACTTCACGTACGGCGGCGGCACGCGGTGGGGCAAGACGGCGAGGCTGAGCTCCGCCGACCCGGACTGCGACGAGTGGAGCAACGACGCCGACGAGGTCTGCTACGGCTGCCGGTCGTGCAAGGCCGGCGTGGTGGCCGCGCTCAAGAGGGACTGGAAGCGCGTGGCCATCGTCAACGTCGTCTTCCTCGCCTTCATCGTCGTCGTCTACTCCGTCGGGTGCTGCGCGTTCAAGAACAGCCGGCGCGACAGTGTCCACCGCCGCAGCGGCGGGTGGAAGCAGGCCGGATACGCCTAG >LOC_Os08g16050 ATGGCGCCGCGGTGCAGCAACGCCGTCTTCGCGGCCATCAACGTCGTCACGCTCCTCCTGGGCGCCGCCGTCCTCGCCGCGGGGATCTACTACGGCGCCCCGCACCGCGGCGGCGGCGGCGTCACCGAGTGCGAGCGGTTCCTCCGCGCGCCGGCGCTCGCCCTCGGCGGCGCCATCGTGGCCGTGTCCCTGGCGGGGCTCGCCGGCGCGTGCTGCCGCGCGACGCCGCTGCTGTGGGCCTACCTCCTCCTGACGGGCCTCCTCATCCTCGCCGCCGCCTGCTTCGGCGTGTTCGCGCTCGTCGTCACCAACGCCGGCGCCGGGCGGGCCGTGTCCGGGAGAGGGTTCAGGGAGTACCACCTCGGCGACTACTCGACGTGGCTCCGCCGGAGCGTGGAGGACGGCGGCCACTGGGCGAGGATCAGGAGCTGCCTCGTCGACACCGGCGTGTGCCGGAGCTTGAAGAGCAACCAGACGCTCGACGAATTCGTCAACTCCAACCTCTCGCCGCTGCAGTCTGGATGCTGCAAGCCACCAACAGCATGCAACTTCACATACCAGAACGAGACATACTGGATCAAGCCTCCTACACCCAGCAACTACTCAGACCCTGACTGCAACTCTTGGTCGAATGACCAGTCTGAGCTCTGCTACGGCTGCCAGTCCTGCAAGGCCGGTGTTCTTGGCAACCTGAGGAGCAGCTGGAAGAAGATCGCCTTCGTCAACGCCGCCTTCGTCGCCCTCCTCCTCGTCGTCTACTCCCTCGGCTGCTGCGCGCTCCGGAACAACCGGCGGCACAAGTACTCGCTGGTTGGGAAATGA >LOC_Os09g25760 ATGGCGTTCCGGCTGAGCAACAGCCTGCTCGGGATCCTGAACGCGGTGACGTTCCTCCTGTCGGTGCCCGTGCTGGGCGGCGGCATCTGGCTGGCGACGCGCGCCGACGGCACGGAGTGCGAGCGCTACTTCTCGGCGCCGGTGATCGCGTTCGGGGTGTTCCTCCTCCTCGTCTCCCTCGCGGGCCTCGTCGGCGCCTGCTGCCGCGTCAACTGCCTCCTCTGGTTCTACCTCGTCGCCATGTTCGTCCTCATCGTCGTCCTCTTCTGCTTCACCGTCTTCGCCTTCGTCGTCACCAACAAGGGCGCCGGCGAGGCCGTCTCCGGCAGAGGGTACAAGGAGTACAGGCTCGGCGACTACTCCAACTGGCTGCAGAAGCGGATGGAGAACAGCAAGAACTGGAACAGGATCAGGAGCTGCCTCCAGGACTCCAAGGTCTGCAAGAAACTGCAGGACAAGAACTGGGATCGGACCCAGTTCTTCAAAGCCGACCTCTCCCCGCTCGAGTCCGGATGCTGCAAGCCACCCAGCAGCTGCAACTTCCTCTACGTCAGCGGCACGAACTGGACGAAGGTGCCCACCAACTCGTCGGACCCGGACTGCAACACGTGGGTCGACGACGGCACGCAGCTGTGCTACAACTGCCAGTCGTGCAAGGCCGGCGCGGTGGCGACCCTGAAGCGGGACTGGAAGCGCGTCGCCGTCGTCTGCATCGTCTTCCTCGTCTTCATCGTCATCGTCTACTCCCTCGGCTGCTGCGCGTTCAGGAACAACCGGAGGGACAACCGCGGCGCCTATCGCGGTGCCGCGTGGAAGGGCGGATACGCCTGA >ChrSy.fgenesh.gene.81 ATGGCCCTCAACTATGTGGGCTTGGCGGCCATCAACCTGGTGGCTGCGCTGCTCTCCATCCCTGTCATCGCCGCCGGTATCTGGCTCTCCGCACAGGTGGACAGCGCCTGCGTCCAACTGCTCCAGTGGCCGCTGATCGGCCTCGGCGTCGCCGTCCTCGCCGTCGGTCTCGCCGGCTTCGTCGCCGCCTTCTGGCGCCTGCCCTGGCTTCTCCTCGCCTACTTGGTCGGCATGCTCCTCCTCGTGGTGGCGCTCGCCTGCCTCGCTGTCTTCGTCTTCGTCGTCACCGGCGGCGCGTCGTCGGGTGGTCACACCGTGCCAACCGGGCCTTCCTCGAGCAGATGGGAGCAGATCAAGACGTGCCTGGCCGCCACGCCCATCTGCTCCGACGTCAACCAGACATACGCCACGGCGCAGGATTTCTTCTCCGCCTCCTGGCTCACCCCGCTGCAGTCCGGGTGCTGCAAGCCTCCCACCAGGTGTGGCTACACCTTCGTCACCCCGATCTCGTGGATTAGCCCCATCAGCGCCGCCGCCGACCCGGATTGCGGCGCCTGGAGCAACGACCCTTCTCAGCTCTGCTACTCCTGCTCCTCCTGCAAGGCTGGCCTTCTCCACAACCTCAGCAGGGAGTGGCGCCGAGCTGATCTCATCCTCCTCGTCGCCACCGTCGCGCTCCTCGCCGTCTACGCATTCGCCTGCTACGCCTTCCGTACCGCCAAGACCGACGACCTCTTCCGCCGCTACAGGCAGGGCTACACGTAA >AT5G46700 ATGCCTTTAAGCAACAATGTAATTGGTTGCATAAACTTCATCACCGTCCTCCTCTCCATTCCGGTCATCGGCGCCGGAATCTGGCTAGCCATAGGAACAGTAAACTCATGCGTCAAGCTTCTTCAATGGCCAGTAATAATCCTCGGAGTCTTAATCCTCTTAGTGGGTCTCGCTGGTTTCATTGGAGGGTTTTGGAGAATCACATGGCTTCTTGTTGTTTACTTAATCGCCATGCTTATTCTCATTGTACTTTTGGGTTGCCTTGTCGGATTTATTTACATGGTTACCATAAGAGGCTCTGGTCATCCAGAACCAAGTAGAGCTTATCTTGAGTATAGTCTTCAAGATTTCTCTGGTTGGTTACGTAGAAGAGTTCAGAGATCTTATAAATGGGAAAGGATTCGTACTTGTTTGAGTACAACTACCATTTGCCCTGAACTAAATCAGAGATACACTTTGGCTCAAGATTTCTTCAATGCTCATCTTGATCCCATTCAATCTGGTTGCTGCAAGCCCCCAACAAAATGTGGATTCACATTTGTTAATCCTACTTATTGGATAAGTCCCATAGATATGTCTGCTGATATGGATTGTCTAAATTGGAGCAATGACCAAAACACTTTGTGTTACACTTGTGATTCTTGTAAAGCCGGCTTGCTCGCAAATATTAAGGTAGATTGGTTAAAAGCGGATATCTTTCTACTCTTGGCGCTTATCGGATTGATTATCGTCTACATTATCGGGTGCTGCGCATTCCGTAATGCGGAAACTGAGGATATTTTCAGGAAGTACAAGCAGGGTTATACTTGA >AT4G28050 ATGGTTCAGTGTAGCAACAATCTCCTCGGAATCCTCAATTTCTTCACATTCCTCCTCTCAATCCCAATTCTCTCCGCCGGGATCTGGCTCGGCAAAAATGCAGCAACCGAATGCGAACGTTTCCTCGACAAACCAATGGTCGTACTCGGAATCTTCCTCATGTTCGTCTCAATCGCCGGACTCGTCGGTGCTTGTTGCCGTGTCTCTTGCCTCCTCTGGCTTTACCTCTTCGCTATGTTCCTCCTCATTCTCCTCGGCTTCTGTTTCACAATCTTCGCTTTCGCAGTCACAAACCGCGGCGCCGGTGAGGTTATATCGGATCGAGGGTATAAAGAGTATCATGTCGCCGATTACTCTAATTGGTTGCAGAAACGTGTCAACAATGCTAAGAATTGGGAACGGATCAGGAGTTGTTTGATGTACTCTGACGTTTGCTCCACTTATCGTACTCGTTATGCCAGCATTAACGTTGAAGATTTCTACAAATCTAATCTTAATGCTCTTCAGTCTGGTTGTTGTAAGCCGTCCAATGACTGTAACTTCACCTATGTGAACCCGACTACTTGGACAAAGACTCCTGGTCCATACAAAAACGAGGACTGTAATGTGTGGGACAACAAACCAGGAACTCTCTGCTACGACTGTGAAGCCTGCAAGGCTGGTCTGCTTGACAACATCAAGAACTCATGGAAAAAGGTGGCTAAGGTCAACATTGTCTTCCTCATATTCCTCATTATCGTCTACTCTGTTGGTTGTTGTGCGTTCAGGAACAACAGGAAACGCAGTTGGTAA >AT4G30430 ATGGTACGTTTTAGTAACAGTCTTGTAGGAATACTCAACTTCTTCGTCTTCCTTCTCTCGGTTCCCATACTCTCAACCGGAATCTGGCTCAGCCTTAAAGCCACGACGCAATGCGAGAGATTCCTCGACAAACCCATGATCGCTCTCGGTGTTTTCCTCATGATAATCGCAATCGCTGGAGTCGTTGGATCTTGTTGCAGAGTGACGTGGCTTCTCTGGTCCTATCTCTTTGTGATGTTCTTCTTAATCCTCATCGTCCTCTGTTTCACCATCTTTGCCTTCGTTGTCACTAGTAAAGGCTCCGGCGAAACTATCCAAGGAAAAGCTTATAAGGAGTATAGGCTCGAGGCTTACTCTGATTGGTTGCAGAGGCGTGTGAACAACGCTAAGCATTGGAACAGCATTAGAAGCTGTCTTTATGAGAGCAAGTTCTGTTATAACTTGGAGTTAGTCACTGCTAATCACACTGTTTCTGATTTCTACAAAGAAGATCTCACTGCTTTTGAGTCTGGTTGCTGCAAGCCCTCTAATGACTGTGACTTCACCTACATAACTTCAACAACTTGGAATAAAACATCAGGAACACATAAAAACTCAGATTGCCAACTTTGGGACAACGAAAAGCATAAGCTTTGCTACAATTGCAAAGCCTGCAAGGCCGGTTTTCTCGACAACCTCAAGGCCGCATGGAAAAGAGTTGCTATTGTCAACATCATTTTCCTTGTACTCCTCGTTGTCGTCTACGCTATGGGATGTTGCGCTTTCCGAAACAACAAAGAAGATAGATATGGCCGTTCCAATGGTTTCAACAATTCTTGA >AT2G19580 ATGGCGTTAGCGAATAACTTAACGGCGATACTCAACTTACTAGCGTTACTCTGTTCCATACCAATAACGGCGTCAGGTATATGGCTAGCTTCAAAGCCAGACAACGAGTGTGTCAATCTCCTCCGTTGGCCCGTTGTCGTCCTCGGCGTTCTCATCCTCGTCGTCTCCGCCACAGGCTTCATCGGCGCCTACAAGTACAAGGAAACTCTACTGGCGGTTTACTTGTGCTGTATGGCGATATTGATCGGACTTTTGCTGGTGGTTCTTATATTTGCATTCGTCGTGACCCGGCCCGATGGATCGTATCGGGTTCCGGGTAGAGGTTATAAAGAGTATAGGCTTGAAGGGTTCTCGAATTGGCTTAAGGAGAACGTTGTGGATTCCAAGAACTGGGGAAGGCTAAGGGCTTGTTTGGCTGATACTAATGTTTGTCCTAAACTCAACCAAGAATTCATCACCGCCGATCAGTTCTTCTCCTCCTCTAAGATCACTCCTCTCCAGTCCGGCTGCTGCAAACCACCAACCGCATGTGGCTACAACTTTGTGAACCCAACACTGTGGCTAAATCCAACCAATATGGCTGCAGACGCAGACTGTTACTTATGGAGCAATGACCAAAGCCAGCTTTGTTACAATTGCAACTCATGCAAAGCTGGTTTATTGGGAAACCTTAGAAAAGAATGGCGTAAAGCAAATCTCATACTTATCATCACAGTCGTTGTTCTCATATGGGTTTATGTTATTGCTTGTAGCGCGTTTAGGAATGCTCAGACTGAGGATCTCTTCCGCAAATACAAACAAGGTTGGGTCTAA >AT2G23810 ATGGCTCGTTGTAGCAACAATCTCGTAGGGATACTCAATTTCCTAGTATTTCTTCTCTCGATCCCAATCTTAGCTGGTGGAATCTGGCTAAGCCAAAAAGGGTCAACAGAGTGTGAAAGATTCCTAGACAAACCAGTGATTGCTCTTGGTGTTTTCCTTATGGTTGTAGCAATAGCTGGTCTAATAGGTTCATGTTGTAGAGTCACATGGCTTCTTTGGGTTTATCTCTTTGTCATGTTCCTTTTGATTCTCCTTGTGTTCTGTATAACAGTTTTTGCCTTTGTTGTTACTAACAAAGGAGCTGGTGAAGCTATTGAAGGAAAAGGTTATAAAGAGTATAAACTTGGTGATTACTCTACTTGGTTACAGAAACGTGTTGAGAATGGTAAAAATTGGAATAAGATTAGGAGTTGTCTTGTGGAGAGCAAAGTTTGTTCTAAGCTTGAAGCCAAGTTTGTTAATGTTCCTGTCAATAGTTTCTACAAGGAACATCTTACTGCTCTTCAGTCTGGTTGCTGCAAACCTTCAGATGAATGTGGTTTCGAGTACGTAAACCCAACAACCTGGACCAAGAACACAACGGGAACACACACTAATCCAGACTGCCAAACCTGGGACAACGCAAAAGAAAAGCTCTGCTTCGATTGTCAATCTTGTAAAGCGGGTCTACTCGACAACGTCAAAAGCGCTTGGAAGAAAGTTGCAATCGTTAACATCGTCTTCCTTGTCTTCCTCATCATTGTCTACTCTGTTGGTTGCTGTGCTTTCAGGAACAACAAGAGGGATGACAGTTATTCCCGTACCTACGGATATAAGCCTTGA >AT1G18520 ATGTTTCGAGTTAGCAATTTCATGGTTGGTCTAGCAAACACATTGGTGATGTTAGTGGGCGCTTCGGCCATTGGTTATTCGATTTACATGTTCGTTCACCAAGGCGTCACTGATTGTGAATCTGCCATTCGGATACCACTTCTCACGACCGGACTCATCCTCTTCTTGGTGTCTTTGCTCGGAGTGATTGGATCTTGTTTCAAGGAGAATTTGGCAATGGTTTCCTACTTGATCATATTGTTTGGGGGCATTGTTGCATTGATGATTTTCTCCATATTTCTCTTCTTTGTGACCAACAAAGGAGCCGGTCGTGTGGTGTCCGGTCGAGGGTATAAAGAGTACCGGACGGTGGATTTCTCGACGTGGCTTAATGGGTTCGTTGGTGGGAAGAGATGGGTTGGGATAAGGTCTTGTTTGGCTGAGGCTAACGTTTGTGATGATTTGAGTGATGGTCGTGTTAGTCAGATCGCTGATGCGTTTTATCACAAGAACTTGTCTCCCATCCAGTCAGGTTGTTGTAAGCCACCATCGGATTGCAACTTCGAGTTCAGAAACGCGACGTTCTGGATACCGCCGAGCAAAAACGAAACGGCAGTTGCGGAAAACGGGGACTGTGGTACGTGGAGCAACGTGCAAACAGAGTTATGTTTCAACTGCAACGCATGCAAAGCGGGTGTGTTAGCGAACATAAGAGAGAAGTGGAGGAATCTTCTTGTTTTCAACATTTGTCTCCTCATTCTCCTCATAACCGTCTATTCCTGCGGTTGCTGTGCTCGTCGTAACAATCGGACGGCTAGGAAAAGTGATTCTGTCTGA >Zosma29g01250 ATGACGATGACCGGCAACATCGTCGGCGGAATTAATATGGTAACCCTTTTCATCTCCATGCCAATCATAGCCACCGGAGTCTATCTTTCCACCCAATCCGACACTCTTTGCTTAAACCCCTTACAATGGCCGATAATACTCCTCGGCGTTGTCATTTTATCTATATCGATTACAGGTTGCGTTGGCGCTTTCTGCCGTATGTCATGGCTCCTCATCCTCTACCTCATCGCCATGCCGATTCTCATCATCCTCTTACTCTCTCTGACCTCATTCATATACATCGTCACTGTCAAATCCTCCGGTGACTATTCCGATTGGATGAAGCAACAGGTGACGAGTTCTTCTAAGTGGGACACAATCAAGACTTGTCTCATCTCCTCCGACACCTGTACTACCACTATTACTAGGTTTCCCTCCCTGAAGTCTGGTTGCTGCAAGCCTCCGACAAGGTGTGGATTCACGTTTGTTGCTCCGACTGCTACTGCAACGACGACGATGAGTACTGTTGACAGGGATTGCTTGTTGTGGGGTAATGGTAGGATGGAACTCTGCTACGAGTGCAGATCTTGCAAGGCGGGATTACTTCAGAGCGTAAGAAGAGAGTGGAGGAAAGCTGATCTCGTCTTGATCATCTCATCGGCGTTACTTTTCTCGATGTATCTGTTAAGTTGTGTTGCTTACCGGAGAGATAAGACCGACGAGCTTTTTCGTCGGTATATACATGGCTACACTTAA >Zosma43g00290 ATGGTTCGTCTGAGCAACAACCTTGTCGGAATCCTAAACTTCATCACTTTTCTCCTCTCCATCCCGATCCTCGGCGGTGGAATATGGCTGTTGTTAAAGGGCAACACCGACTGCGAAAAGTTTTTAGATAGGCCAATGATCATTTTGGGTATTGTCCTAATGTTAGTATCCCTCGCCGGACTCATCGGTGCCTGTTGCCACGTGTCTTTGTTGCTGTGGTTGTACCTTTTCGTGATGTTCTTCCTCATCGTCGCCATCTTGTGCTTCACGATATTCGCCTTCTTTGTGACCAATAAAGGCGCGGGAGATTTGGTGTCTGGAAGAGGCTACAAAGAGTATAAATTGGGGGATTATAGCAATTGGCTTCAGAACAGAGTGGAGGATAGTGAAAATTGGAAGAATATCAGGAGTTGTATTGAACAGAGTAAAGTTTGCCAGAAGCTTGCAGATGATGATCTTCCTTTCAACGATTTTATCAAGAAGAATCTCACGCCACTTGAGTCTGGATGCTGCAAACCACCAACTGAGTGTGGATTCACATACGTGAACGCGACATATTGGTCCGAAACCGGTGGGAACGTCAGCGCCAACGTGGATTGCAAAACATGGGATAACGACGGAAAAAAACTATGTTACGAATGTGGGTCCTGCAAGGGTGGGTTTCTCGCCAATCTGAAGAGTGACTGGAAGAAAGTTGCCATCGTCAACATCAGCATCCTCATCGTCATCATCATCATCTACTCCGTCGGATGTTGTGCGTTCAGAAACAGCAGGAATGCTAATAAGTACCAGAGACACTACGGCCGTCCATAG >Zosma70g00130 ATGGGTCTGAGCAACACGATAACAACAATCCTCAACTTTATAGTTCTACTCTGTTCAATTCCCATAATTGGAGCCGGAATATGGCTAGCAACAAAGCAGTCCACATCTTGCATCCACGGATTCCGATTACCCATCATAATCCTCGGGACACTCATCTTCCTCGTTTCTCTATCAGGCTTCGCAGGCGTGTACTGGAACCGGCAATGTCTCCTGGCAACATACCTTGTAGCCATGGCGATTCTGATAGTAGCTTTGCTGGCGCTTTTAATTTTTGGGTTCGCGGTCACCAGGTCGGATGGGGGGTACAGTGTCGACAGGAGAGAGTATAGATTGGAAGGGTTTTCCAAGTACTTGCGAGAAAGTGTTATTGGGAACGGAAACTGGAAAAGAATCATGAAGTGTCTCGAAGAGAAGGATGTTTGTAACAAGCTGATCGACGTTTATGCCACACCTACTTCTTTCTTTGCTGCTCATCTCACTCCTTTACAGTCAGGGTGCTGTAAACCTCCAAGCGCATGTGGTTATGGATACGTTAACCCAACAATATGGGTGAACAATCCATTGAATAATAATCCAATACCCAATGCAGACTGCAATGCTTGGAGCAATAATCCGGCACAGCTCTGTTACGGATGTGACTCCTGTAAGGCTGGCTTGTTGGGGAGCATTAGGTTGCTGTGGAGAAAAGCCAATGCCGCATTGATCATCTCAGCCGTGGTTCTCATTTCTGTTTACATCATTGCATGCAGTGCATTTAGGAATGTTCAGACTGAAGAATTATTCAGAAGATACAAGTGGGGAAACCCCTAA >Zosma125g00300 ATGGTTCGCCTGAGCAACAATCTTCTGGGGATCCTGAACGTCGTAGTCTTCGTTCTCTCTATTCCGATCTTCATCGCAGGTGTATGGCTCGCGAATCAAGCAAGCAGCGAATGTGAGAAGTTCCTCGATAAACCTATGATCGTTCTAGGTGTTTTTCTGATGGCTGTTTCCCTAGCGGGAATCATCGGCGCCTGTTGCCGTGTGTCTTGTCTTCTTTGGTTGTATCTGTGCGTGATGTTCATCCTGATTCTCCTCATATTCTGCTTCACCGTGTTCGCTTTCGTAGTCACGAATAAGGGAGCTGGAGAAGCGGTTTCGGGGAGAGGCTACAAGGAGTACAAGTTGGGGGATTACAGTCACTGGTTGCAGAAGAGAGTAGAGAGTGGTAAAAATTGGGATCGGATCCGGAGTTGTGTACAGGAGTCCAAAGTCTGCCAGAAACTCGCCAATAAAGGCGATTCCGTTCAGCAGTTCTTCCGCCAGAATCTCAGCCCACTCCAGTCTGGATGTTGCAAGCCACCGACAGAATGTAACCTGCAGTACGTTAATGCGACGTATTGGAGTGGAAAGATCAGCCCCGGCAGTGCGGACAACCAAGATTGCAAGGAATGGAATAACGACCCATCTGTGCTTTGCTACAATTGCAATTCTTGCAAGGCCGGGATCTTAGCGAGCATTAAAGATGATTGGAAAAAGGTTGCTATAGTGAATGTGGTGTTCCTTGTGTTCTTGGTGATTGTCTACTCCATTGGATGCTGTGCTTTCAGAAACAACAGGAATGATAACTACTACATGAAACGTTAA >Zosma125g00320 ATGGTTCGCCTGAGCAACAATCTTCTGGGGATCCTGAACGTCGTAGTCTTCGTTCTCTCTATTCCGATCTTCATCGCAGGTGTATGGCTCGCGAATCAAGCAAGCAGCGAATGTGAGAAGTTCCTCGATAAACCTATGATCGTTCTAGGTGTTTTTCTGATGGCTGTTTCCCTAGCGGGAATCATCGGCGCCTGTTGCCGTGTGTCTTGTCTTCTTTGGTTGTATCTGTGCGTGATGTTCATCCTGATTCTCCTCATATTCTGCTTCACCGTGTTCGCTTTCGTAGTCACGAATAAGGGAGCTGGAGAAGCGGTTTCGGGGAGAGGCTACAAGGAGTACAAGTTGGGGGATTACAGTCACTGGTTGCAGAAGAGAGTAGAGAGTGGTAAAAATTGGGATCGGATCCGGAGTTGTGTACAGGAGTCCAAAGTCTGCCAGAAACTCGCCAATAAAGGCGATTCCGTTCAGCAGTTCTTCCGCCAGAATCTCAGCCCACTCCAGTCTGGATGTTGCAAGCCACCGACAGAATGTAACCTGCAGTACGTTAATGCGACGTATTGGAGTGGAAAGATCAGCCCCGGCAGTGCGGACAACCAAGATTGCAAGGAATGGAATAACGACCCATCTGTGCTTTGCTACAATTGCAATTCTTGCAAGGCCGGGATCTTAGCGAGCATTAAAGATGATTGGAAAAAGGTTGCTATAGTGAATGTGGTGTTCCTTGTGTTCTTGGTGATTGTCTACTCCATTGGATGCTGTGCTTTCAGAAACAACAGGAATGATAACTACTACATGAAACGTTAA >Bradi3g56223 ATGGTGAGCCTCTCCAACGGCGTGCTGGCCGCCGTGAGCATCGTTGCCCTGGTGGCGTCCATCCCGCTCATCGGCGTCGGCACGTACCTCCACGACCGCGGCGGCGGCGACGGGTCCCCCACCAGCGAGTGCCAGCGCCTGCTGCGGCTGCCGGCCCTGGCGCTGGGCCTCGGCATCCTCCTGTTGTCCCTCATGGCGATCGCGGGCGCGTGCTGCCGTGGCGCGGCCCCGCTCCTGTGGCTCTACGTCGTGGCCATGTTCCTGCTCGTCATCGGCATGTTCTTCGTCACCGTCTTCGCCTACGCCGTCACCAACAAGGCCGCCGCCTCCGGGGGCGGCTACGGGGACTACCGGATCGGGGACTACTCCGACTGGCTCAGGGACAGGGTCGGGGACTACGACACGTGGCGCCGGATCGAGAGCTGCCTGGCCGACGCCGGAGTCTGCGGCGGCCCCGGCGGGGGGCAGTTCAGCGGACGGCTTGGCGGCGTCGCCGCCGGGATCGACGCCTCCGAGTTCTACCGCCTGCATCTGCCGCTCCTCCAGTCCGGTTGCTGCAAGCCGCCGGCGTACTGCGGGTACCGGCCGGTGAACGCGACATTCTACGAGCCCCCCGAGCCCGGGCACCTGGGGACGGCGGGCGTGGACTGCCAGGCGTGGAGCAACGACCAGCGGGTGCTGTGCTTCCGTTGCAACGCGTGCAAGGCCGGCGTGCTGGCCACCGCCAAGAGCAACTGGAGGGCCGTCGCCGCCGCCAACGTCGCCGTCCTCGCGCTCCTCGTCTTCGTCTACTCCCTCGGCTGCTGCGCCCTGCGCAACCACGACCGCCGCCGCCGTGGCTACGGCCGGTACTACTGA >Bradi3g08200 ATGGCGGTGAGCAACAACATCACGGCGTGCGTGACCCTGATGGCGCTGATCTGCGCGCTCCCCGTGATCGCCTCCGGCGTCTGGTTCGCCTCGGCCCAGGGGGAGGAGTGCGCGCGGCTGGCGCGGTGGCCCGTGGCGATCCTGGGCGGGCTCATCCTCCTCACGGCCCTGGCGGGATTCGTCGGCGCCTACTGGAACCGCAGGCGACTCCTGGCCTTCTACCTCTTCGCCATGGCGGCGCTCATCGTGCTCCTCATCGCGCTGCTCGCCTTCGCCTTCGCCGTCACCAGGGGGTCCGGGGCCTACCCGGTGCTCGGCCGCAACTACGACGAGTACCGCCTCGACGGGTTCTCCATGTGGCTCCGCGGGTATGTCTCTGATGACCCTGGACGGTGGGAGGGGATCCGGTCCTGCCTTGCCGTCTCTGATACCTGCAAGAAGCTCGCTCGCCAGGCCAGCTTCGTCACCGCCGACCAGTTCTACCAGTCCAACCTCACGCCCCTCCAGTCGGGGTGCTGCAAGCCGCCGTCGGTGTGCGGGCACGTGTACGTGAGCCCGACGGTGTGGACGAGCCCGGCGCGGCCAGCGGCGGACCCGGACTGCGGGCTGTGGAGCAACGACCCGGCGCAGCTGTGCTACGAGTGCGAGTCGTGCCGCGCGGGGCTGCTGGCGGCGCTGCGGAGCCAGTGGCACAGGGCCAACATCGCGCTCGTCGTCGCCACCGTCGCCCTCGTCTTCCTCTACCTCGTCGGATGCAGCGCATACAAGAACGCCCAGGCCGAGGCCATCTTCCGCCGCTACAAGTGGTAA >Bradi4g30710 ATGGCGTTCCGGCTGAGCAACAACCTGATCGGCATCCTGAACGCGATCACCTTCCTGCTCTCCGTGCCCGTGCTGGCGGCGGGGATCTGGCTGGGCGTCCGCGGCGACGGCACCGAGTGCGAGCGCTACCTGACGGGGCCCATCATCGCCATCGGCGTCTTGCTCATGGTGATCTCCATCGCGGGCCTCGTCGGCGCCTGCTGCCGCGTCACCTGGCTCCTCTGGGTCTACCTCGTCGCCATGTTCGTCGTCATCGTCGTGCTCCTCGGCTTCATCGTCTTCGCCTTCGTCGTCACAAACAAGGGCGCCGGCGAGGCCGTCTCCGGCCGCGGGTTCAAGGAGTACAGGCTCGGCGACTACTCCAACTGGCTCCAGAAGCGGGTGGAGAACGACGGGAACTGGAACAGGATCAGGAGCTGCCTTCAGAGCAGCAAGGTCTGCAAGTCCCTGCAGGAGAAGAGGGAGTCCTGGGACGAATTCATCCGCACCGATCTCTCCCCCATCGAGTCCGGTTGCTGCAAGCCTCCGAGCAGCTGCGGTTTCACCTACGTCAACAGCACGCAGTGGACCCCCGGCGGCGCCAATTCATCGTCGGACCCGGACTGCAACACGTGGGGCAACGACGCGTCGGCGCTCTGCTACGGCTGCAGTTCGTGCAAGGCCGGCGTCGTTGCCACGCTGAAGAAGGACTGGAAGCGCACCGCCATCGTCAGCATCGTCTTCCTCGTCTTCATCGTCATTGTCTACTCCGTCGGCTGCTGCGCCTTCAGGAACAACCGCAGGGACAATCACAACCGTGGCGGGTACAACAAGCAGGGCGGATACGCTTGA >Bradi1g31150 ATGGCGCGGTGCAGCAACGGGCTCCTGGGCCTGCTGAACGCGGGGGTGCTGGTCCTCTCCCTCGTGGTCCTCGGCGGCGGCATCTGGCTGAGCCACCGCGCGACCACCACGGACTGCGAGCGGTTCCTGGAGCGGCCCGTCATCGCGCTCGGGGTGCTCCTCCTGGCGCTCTCCCTCGCGGGCCTGGCTGGGTCCCTCTGCCGCGGCGCATCCTGCCTCCTCTGGCTCTACCTCCTCGCGCTCTTCCTCCTCATCGCGCTTCTCTTCGTCTTCACCGTCTTCGCCTTCGCCGTCACCAACCCCGGCGCCGGGTCCGCCGTCTCCGGGAGAGGGTTCAAGGAGTACCGCCTCGGGGCCTACTCCACCTGGCTGCAGAAGCGGGTCGAGGACTCCGGGAACTGGGCTAAGATCCGGAGCTGCCTCCACGACGGCGGCGTCTGCCAGAAGCTTGGGGACAGGAAGGAGACGCTGCAGCAGTTCGCCCTCAGCAACCTCTCCCCGATTCAGTCTGGATGCTGCAAGCCCCCAACAGGGTGCAACTTCGCCTACCAGAGTGAGACTGTCTGGACGAAACCCCCTGGCTTCAACTCTACCGATAACCCAGATTGCATCACATGGTCAAATAATCAGAACGTCCTCTGCTACGACTGCCAGTCATGCAAGGCTGGCGTGCTCGCTAACCTGAAGAACGACTGGAAAAAGATTGCCACCGTCAACATCATATTCCTTGTCTTCCTCATCGTCGTCTACTCTGTTGGTTGCTGTGCTTTCAGGAACAACAGGCAGGACAACTCGTACCCAGCTTGGAAGTGA >Bradi1g74040 ATGGCTCTCAACCACGTGGTGGCAGCGGCCATCAACCTAGCGGCGGCGCTGCTCTCGATCCCGGTGATCGCGGCGGGCATCTGGCTGTCAACGCAGACCGACAACGCCTGCGTCAACCTCCTCCAGTGGCCGCTCATCGGGCTCGGCATCGCCATCCTGGCCGTCGGCCTCGCGGGCTTCGTGGGCGCGCTCTGGCGCCTCCCCCGTCTCCTCCTCGCCTACCTCGTCGCCATGCTCATCCTGGCCCTCTCCCTCGCCTCCCTCGTCGTCTTCGTCTTCCTCGTCACGACCGGCAGCTCGGGACGCCCCGTGCCCAGCAGGGCCTTCCTCGAGTACGACCTCGACGACTACTCCGGCTGGCTGCGACAGCGACTGGATTCCGCTAGCCGCTGGGACGGCATCAAGACTTGCCTGGCGTCCACGCCAATTTGCCCGAGCCTGAACCAGACGTATGCGACGGCGGAGGGCTTCTTTGCGGCGAGATGGCTGTCCCCTGTGGAGTCCGGGTGCTGCAAGCCGCCCACCAGGTGCGGCTACACGTTCGTGAACCCGACGTTCTGGATCAGCCCGATCGACGGCGCCGTGGATCCTGACTGCGCTGCGTGGAGCAACGACCAGGCCCAGCTCTGCTACTCCTGCTCCTCCTGCAAGGCCGGCGTGCTCCAGAACCTGCGCCGGGAGTGGCGCCGTGCGGACCTCATACTCCTTGTTGCTGCACTTGGTCTTCTCGCTGTTTACGCCGTTGGATGCTACACGTTCCGCCAAGCCAAGACTGACAATCTCTTCCGCCGCTACAGGCAGGGCTACACCTAG >Bradi1g37460 ATGGGGGGCGCGAGCAACAGCATAACGGCGTGCATCAACTTCCTGGCCCTCCTCTGCACGATCCCCATCGTCATCACGGGCATCTGGCTCGCGTCCTCCAAGCAAGGCGGCGAAGAGTGCGCGCGGCTGCAGGCGCGCTGGCCCGTGGCCATCCTGGGCGGGCTCCTCTTCCTCGTCGCCGTCGCCGGGTTCGCGGGCGCCTACTGGAACCGGAAGGGCCTCCTGGCCGCCTACCTCTTCGCCATGGGCGGCCTCATCACGCTCCTCCTCGCGCTCCTCGTCTTCGCCTTCGCCGTCACCCGCGGCTCCGGCGCCTACGAGGTGCCCGGACGCGCGTATCAAGAGTACCGGCTCGAGGGGTTCTCGGCGTGGCTGCGTGGTTATGTACTAGATGGAGAGGGAGACCCGCGGCGGTGGGGAAGGATCAGGGCTTGCCTTGCGGCGTCGGACACTTGCAGGAAGCTCGCCGGGGAGAGGGGGAGCGCCTTCTTCGTCGCGCCGCAGCAGTTCTACCAGTCGGACCTCTCGCCGCTCCAGTCCGGGTGCTGCAAGCCGCCGACGGCGTGCGGGTACGCGTACGTGGCCCCGACGGCGTGGACGAGCCCGGCGGCGAGCCCCGGCGGCGGCGCGGACGCGGCCGCGGACTGCGGCCTGTGGAGCAACGACCCGGGGCAGCTCTGCTACGGGTGCGCGTCGTGCAGGGCCGGCATGCTGGGCGCGCTCCGCGAGCAGTGGCGCCGGGCCAGCGCCGCCCTCGTGGCCGCCGCCGTGGCGCTCATCGTCGTCTACGTCATCGGCTGCAGCGCCTTCAAGAACGCCCACACCGAGGACCTCTTCCGCCGCTACAAGTGGCCCAACAACACCTGA >GSVIVG01013147001 ATGGCACTCAATAACACTGTCATTGGAGCAATCAACTTTGTAGCTATGCTTCTCTCCATTCCCATCATCGGCACGGGGATTTGGCTATCAACAGAGCCTGATAATTCTTGTGTGAAGATCCTACAATGGCCAGTCATCATTTTGGGCGTCTTGATCTTGGTTGTGGCTCTAGCAGGATTTATAGGAGGGTTTTGGAGAATCCCATGGCTCCTTCTCTTTTACCTTATTGCCATGCTGATCCTTATAATTTTGCTGGCCTCTTTGGTGGTTTTCATTTATATGGTTACCGTTCGAGGCCATGGCCACATCGAACCAAGTCGGGCTTACTTGGAGTATCATCTTGATGACTACTCAGGATGGCTTCGCAGAAGAGTTCGAAGTTCCTACAAGTGGGATCGGATTAGAACCTGTCTTAGCTCCACAAATATGTGTGCAGAGTTGAACCAGCGTTATCGGATGGCCCAGGATTTCTTCAATGCACATATTAGTCCCATACAGTCGGGATGCTGTAAGCCACCAACTGAATGCGGGTACACCTTTGTGAATCCGAGCTATTGGATTAGCCCCATATACACAGCAGCGGACATGGATTGCCTGCAGTGGAGCAACGAGCAGACACAGTTGTGCTACAACTGCAACTCATGCAAAGCTGGGTTACTGGCAAATCTGAAGAAGGAATGGAGAAGAGCAGACATTGTTCTACTCATAACTCTGATTGCTTTGATAGCAGTTTATTTGATCGGGTGTTGTGCATTTAGAAATGCTAAAACAGAAGAGCTGTTTCGCAAGTACAAGCAAGGCTATACGTAA >GSVIVG01015218001 ATGGCTCACATCTCTCCTCTTCAGTCAGGGTGTTGTAAACCTCCAACAATCTGCAATTATGGGTATGTGAACCCAACATTGTGGATGAACCCCACCAATCCGATTGCAGACTCGGACTGTTATGCCTGGAGCAATGACCAAAGCCAATTGTGCTATGGGTGCAATTCCTGCAAGGCTGGTTTGTTGGGGAACCTGAGGAAGGAATGGAGGAGAGCCAATGTGATTTTGATAGTGGCAGTGGTGGTGCTGATATGGGTTTACCTCATTGCATGCAGTGCATTCAAGAATGCTCAGACAGAGGATCTCTTCCGCAGATACAAGCAGGGTTGGGCCTAG >GSVIVG01023726001 ATGTTTCTCTTGATCGTGCTTCTCTTCTGCTTCACCATCTTCGCCTTTGTGGTCACTAACAAGGGTGCCGGAGAGGTTTTGTCTGGGAAGGGGTATAAGGAGTATAGGCTCGGGGATTACTCCAATTGGCTGCAAAAGAGAGTTAACAACACCAAGAACTGGAACAGGATCAAGAGCTGTTTGCAGGATGGCAAGGTGTGTCAGAGCTTGAGCCAGGACAAGGTTGGCGAAACTGTTCAGCAGTTTTATGCGGAGCAGTTGTCTCCCATTCAGTCTGGTTGCTGTAAGCCATCAAATGATTGTGGTTTCACCTATGTCACTCCGACTAATTGGACCTCGACGAACGCGGCTACATACACCAACTCTGACTGTTCTTTGTGGAATAATGAGCCTAGCATTCTGTGCTTCAATTGCCAGGCGTGCAAAGCCGGAGTGCTGGACAATCTGAAGCGTGATTGGAAGAAGGTTGCCATTATCAACATTATATTCCTTGTTTTCCTCATTATTGTATACTCCATTGGATGCTGTGCATTCAGGAACAACAGAGAGGACAATGCTCAACCCAGATGGAAGCCATACCCTTGA >GSVIVG01008198001 ATGAGACGTCCGAGCAATCGCTGGTTTTTATCTCTTTCTCTCTCTAAAAATATATGTTTTCTCTCCTTAAATTTCTTCCTTCTCGCTTTTAGGAAGTTTCTACAAATGCCGCTTCTGGTGGTGGGTGCGTTTCTGTTTGTGGTTTCATTGTGCGGATTGGTCGGGTCGACGTGCAAGGTCAGCTTCCTGCTGTGGATATACCTGTTCGTAATGTTTTTGATGATTCTGGGGCTCTTGTGCTTCACCATATTGGCGCTCGTGGTCACCAACAAGGGCGTGGGTCAGGTGATATCGAACCGAGGGTATAAGGAGTACAGGCTTGGGGATTACTCTAACTGGCTGCAGAATCATTTGGTGAATGACAAGAACTGGGGTCGGATCAAGAGTTGTTTGATGGATACTGACATTTGCACCTCAAATCTTCTAATCTCCACATCATATATTTAA >OsR498G0204695300.01 ATGGGGCGGTTCTCCAATGGCGTCCTGGGCGCCCTGAGCTTCGCCGCCCTCCTCGCCTCCGTGCCGCTCATCGGCGCGGGCGCCTACCTCCTCGACCACCCGGCCAGCGAGTGCCAGCGCCTTGTGCGGGTGCCCGCCGTGGCGCTCGGCAGCGCGGCGCTCCTCCTCTCCCTCATGGCGATCGCCGGAGTTACCTGCTGCCACGGCGCGGCGCTCCTCTGGGCCTACGCGTCCGCCATGTTTCTGCTCATCGTCGGCATGTTCTTCGTCACCGCCTTCGTGTTCGTCGTCACCAACAGGGGCGTCGCCACCGCCGTGTCCGGCACCGGCTACGGGGACTACCGGGTCAGGGACTACTCGGAGTGGCTGCGTGCCAGGATCGAGGATTACGAGACGTGGCACCGGATCGAGAGCTGCATGGCCGACGCGGCCGTGTGCGGCGGCCCTCTCGCCGGGATCAACCCCGGCGAGTTCTACCGTCTGCATCTGCCGCTAATCCAGTCCGGCTGCTGCAAGCCGCCGGTGTACTGCGGGTACGAGCGCGTGAACGAGACGTTCTGGATAGCGCCGGCGCGGGGCCTGGACGCGGCGGACGTCGACTGCCTGGAGTGGAGCAACGACCAGGCC >OsR498G0203230900.01 ATGGCGGTGAGCAACAACATCACGGCGTGCGTGACGCTGATGGCGCTGATCTGCGCCGTCCCGGTGATCGCCTCGGGCGTGTGGTTCGCGTCGGCGCAGGGGGAGGAGTGCGCCCGCCTGGCGCGGTGGCCGGTGGCCATCCTGGGGGGCCTCATCCTCCTTGCCGCCCTCGCCGGCTTCGTCGGCGCCTACTGGAACCGCCGCCGCCTCCTCGCGTTCTACCTCTTCGCCATGGCGTCGCTCATCGCGCTGCTCATCGCGCTCCTCGTCTTCGCCTTCGCCGTCACCCGCGGCTCCGGCGCCTACCCGGTGCTCGGCCGCGCCTACGACGAGTACCACCTCGATGGCTTCTCCATGTGGCTCCGGGGCTACGTCTCCGACGACCCGGCGCGGTGGGAGCGGATCAAGGCGTGCCTCGTCGTCTCCGACACCTGCAAGAAGCTGGCGCGCCAGGCCGGGTTCCTCACCGCCGACCAGTTCTACCAGTCGCGCCTCTCGCCACTCCAGTCCGGGTGTTGCAAGCCGCCGGCGGTGTGCGGGTACAACTACGTGAGCCCGACGGTGTGGGCGGGGCCGGCGGCGCGGCCGGCGGCGGACGCGGACTGCGGGGCGTGGGGGAACGACCCGTCGCAGCTGTGCTACGAGTGCGAGTCGTGCCGCGCGGGCCTCCTCGCGGCGCTCCGCGCCCAGTGGCACCGCGCCAACGTCGCCCTCGTCGTCGCCACCGTCGCCCTCGTCTTCCTCTACCTCGTCGGCTGCAGCGCCTACAAGAACGCCCAGGCCGAGGCCCTCTTCCGCCGCTACAAGTGGTAG >OsR498G0305065200.01 ATGGCCCTCAACTATGTGGGCTTGGCGGCCATCAACCTGGTGGCTGCGCTGCTCTCCATCCCTGTCATCGCCGCCGGTATCTGGCTCTCCGCACAGGTGGACAGCGCCTGCGTCCAACTGCTCCAGTGGCCGCTGATCGGCCTCGGCGTCGCCGTCCTCGCCGTCGGTCTCGCCGGCTTCGTCGCCGCCTTCTGGCGCCTGCCCTGGCTTCTCCTCGCCTACTTGGTCGGCATGCTCCTCCTCGTGGTGGCGCTCGCCTGCCTCGCTGTCTTCGTCTTCGTCGTCACCGGCGGCGCGTCGTCGGGTGGTCACACCGTGCCCAGCCGGGCCTTCCTCGAGTACGAGCTCGACGATTTCTCGGGCAGCTGGCTACGCGGCCGCGTGGACGAGCCTGCAGGCAGATGGGAGCAGATCAAGACGTGCCTGGCCGCCACGCCCATCTGCTCCGACGTCAACCAGACATACGCCACGGCGCAGGATTTCTTCTCCGCCTCCTGGCTCACCCCGCTGCAGTCCGGGTGCTGCAAGCCTCCCACCAGGTGTGGCTACACCTTCGTCACCCCGATCTCGTGGATTAGCCCCATCAGCGCCGCCGCCGACCCGGATTGCGGCGCCTGGAGCAACGACCCTTCTCAGCTCTGCTACTCCTGCTCCTCCTGCAAGGCTGGCCTTCTCCACAACCTCAGCAGGGAGTGGCGCCGAGCTGATCTCATCCTCCTCGTCGCCACCGTCGCGCTCCTCGCCGTCTACGCATTCGCCTGCTACGCCTTCCGTACCGCCAAGACCGACGACCTCTTCCGCCGCTACAGGCAGGGCTACACGTAA >OsR498G0613079700.01 ATGGCGCGGTGCAGCAACGGCCTCCTCGGCCTCCTCAACGCCGGCGTGCTGGTCCTCGCCGTGGTGGTGCTGGGCGGCGGGATCTGGCTCAGCAACCGCGCCGCCACCACCGACTGCGAGCGGTTCATGGAGCGCCCCGTCGTCGCGCTGGGCGTGCTCCTCCTTGCGCTCTCCCTCGCCGGCCTCGCCGGCGCGCTCTGCGGCGCCTCCTGCCTCCTGTGGCTCTACCTCCTCGCGCTCTTCCTCCTCATCCTCGCCCTCTTCATCTTCACCGTCTTCGCCTTCGTCGTCACCAACCGCGGCGCCGGCTGGGTCGTCTCCGGGAGAGGGTACAGGGAGTACCGCCTCGGGGACTACTCCACGTGGCTGCAGAGGAGGGTGGAGAACTCCGCGAACTGGGCCAAGATCCGGAGCTGCCTCCAGGATGGCAAGGTCTGCGAGAAGCTTGGGGCCAGGCGCGAGACCATGGACCAGTTCGTCGGCAGCAATCTCTCCCCGATTCAGTCTGGATGCTGCAAGCCCCCAACAGGATGCAACTTCGCCTACGTGAGCGAGACCGTCTGGACCAAACCTTCTGGCTTTAACTCTACCGATGACCCGGACTGCACGACATGGTCGAATGATCAGACCGCCCTGTGCTACGACTGCCAGTCATGCAAAGCTGGTGTGCTCGCTAACCTGAAGAATGACTGGAAGAAGATTGCGACTGTCAACATCATCTTCCTGATCTTCCTCATCATCGTCTACTCCGTTGGGTGCTGCGCTTTCAGGAACAACAGGCGGGACAACTCGTACCCGGCTTGGAAATGA >OsR498G0612807400.01 ATGGCGGTGAGCAACAACATCACGGCGTGCGTCAACTTCCTGGCGCTGGTGTGCGCCGTCCCGGTGGTGGCCACGGGCGTCTGGTTCGCCTCCAAGCAGGGCGACGACTGCGCCCGCGTCGCGCGCTGGCCGCTCGCTATCCTCGGCGCCGCCCTCCTCCTCGTCGCCCTCGCCGGCTTCGCCGGCGCCTACTGGAACCGCCGGGGCCTCCTCGCCGCCTACCTCTTCGCCATGGCCGCGCTCATCACCCTCCTCCTCGCCCTCCTCGTCTTCGCCTTCGCCGTCACCCGCCCCTCCGGCGCCTACCCCGCCTTCGCCCGCGCCTACGACGACTACCGCCTCGACGGCTACTCCACCTGGCTGCGGGACCGCATCGCCGGCGACCCTCGCCGGTGGGAGGGGATCAGGGCTTGCCTCGCCGCCTCCGACACCTGCAGGAAGCTGGCGCAGGAGAGCGTCTTCTTCATCACCCCCGAGCAGTTCTACCAATCACACCTCACCCCGCTCCAGTCCGGCTGCTGCAAGCCTCCGACGGTGTGCGGGTACGCGTACGTGAGCCCGACGGTGTGGGTGAACCCGGCGAACCCGGCTGCTGACGCGGACTGCGCCGCGTGGGGGAACGACCCGTCGCAGCTCTGCTACGAGTGCAGCTCCTGCAAGGCCGGGATGCTGGGCACCCTGCGGGAGCAGTGGCGCAGGGCCAACGTCGCCCTCGTCATCGCCACCGTCGCGCTCATCTTCTTCTACGTCATCGGCTGCAGCGCCTTCAAGAACGCGCAGACCGAGGACCTCTTCCGCCGCTACAAGTGGCGCAACTGA >OsR498G0815571400.01 ATGGCGCCGCGGTGCAGCAACGCCGTCTTCGCGGCCTTCAACGTCGTCACGCTCCTCCTGGGCGCCGCCGTCCTCGCCGCGGGGATCTACTACGGCGCCCCGCACCGCGGCGGCGGCGGCGTCACCGAGTGCGAGCGGTTCCTCCGCGCGCCGGCGCTCGCCCTCGGCGGCGCCATCGTGGCCGTGTCCCTGGCGGGGCTCGCCGGCGCGTGCTGCCGCGCGACGCCGCTGCTGTGGGCCTACCTCCTCCTGACGGGCCTCCTCATCCTCGCCGCCGCCTGCTTCGGCGTGTTCGCGCTCGTCGTCACCAACGCCGGCGCCGGGCGGGCCGTGTCCGGGAGAGGGTTCAGGGAGTACCACCTCGGCGACTACTCGACGTGGCTCCGCCGGAGCGTGGAGGACGGCGGCCACTGGGCGAGGATCAGGAGCTGCCTCGTCGACACCGGCGTGTGCCGGAGCTTGAAGAGCAACCAGACGCTCGACGAATTCGTCAACTCCAACCTCTCGCCGCTGCAGTCTGGATGCTGCAAGCCACCAACAGCATGCAACTTCACATACCAGAACGAGACATACTGGATCAAGCCTCCTACACCCAGCAACTACTCAGACCCTGACTGCAACTCCTGGTCGAATGACCAGTCTGAGCTCTGCTACGGCTGCCAGTCCTGCAAGGCCGGTGTTCTTGGCAACCTGAGGAGCAGCTGGAAGAAGATCGCCTTCGTCAACGCCGCCTTCGTCGCCCTCCTCCTCGTCGTCTACTCCCTCGGCTGCTGCGCGCTCCGGAACAACCGGCGGCACAAGTACTCGCTGGTTGGGAAATGA >OsR498G0816189900.01 ATGGCGTTCCGGCTCAGCAACAACGTGATCGGGGCGCTCAACCTGGTGACGCTGCTGCTCTCCGCGCCCATCCTCGGCGGCGGGATCTGGATGGCCACCCGCGGCGACGGCGGCGAGTGCGACCGCCACCTCTCCTCGCCGGCCATCGCGCTGGGGGCGGTCCTCATGGCCGTCTCCCTCGCGGGCCTCGTCGGCGCGTGCTGCCGCGTCACCTGGCTGCTCTGGGTCTACCTCCTCGCCATGTTCGCCCTCATCGTCGCCCTCCTCGGCTTCACCGCCTTCGCCTTTGCCGTCACCAACCGTGGCGCCGGCGAGGCCGTCTCCGGCCGCGGGTACAGGGAGTACCGCCTCGGGGACTACTCCACGTGGCTGCGGCGCCACGTGGGGAGCAGCAAGAACTGGGACAAGATCAGGAGCTGCCTCGCCGGCGCCGACGTTTGCAGGAGCCTGCAGGACAGGAACGAGACGTGGGCGCAGTTCGTCGCTGACGACCTCTCCCCGGTCCAGTCCGGCTGCTGCAAGCCGCCCACGAGCTGCAACTTCACGTACGGCGGCGGCACGCGGTGGGGCAAGACGGCGAGGCTGAGCTCCGCCGACCCGGACTGCGACGAGTGGAGCAACGACGCCGACGAGGTCTGCTACGGCTGCCGGTCGTGCAAGGCCGGCGTGGTGGCCGCGCTCAAGAGGGACTGGAAGCGCGTGGCCATCGTCAACGTCGTCTTCCTCGCCTTCATCGTCGTCGTCTACTCCGTCGGGTGCTGCGCGTTCAAGAACAGCCGGCGCGACAGTGTCCACCGCCGCAGCGGCGGGTGGAAGCAGGCCGGATACGCCTAG >OsR498G0917488500.01 ATGGCGTTCCGGCTGAGCAACAGCCTGCTCGGGATCCTGAACGCGGTGACGTTCCTCCTGTCGGTGCCCGTGCTGGGCGGCGGCATCTGGCTGGCGACGCGCGCCGACGGCACGGAGTGCGAGCGCTACTTCTCGGCGCCGGTGATCGCGTTCGGGGTGTTCCTCCTCCTCGTCTCCCTCGCGGGCCTCGTCGGCGCCTGCTGCCGCGTCAACTGCCTCCTCTGGTTCTACCTCGTCGCCATGTTCGTCCTCATCGTCGTCCTCTTCTGCTTCACCGTCTTCGCCTTCGTCGTCACCAACAAGGGCGCCGGCGAGGCCGTCTCCGGCAGAGGGTACAAGGAGTACAGGCTCGGCGACTACTCCAACTGGCTGCAGAAGCGGATGGAGAACAGCAAGAACTGGAACAGGATCAGGAGCTGCCTCCAGGACTCCAAGGTCTGCAAGAAACTGCAGGACAAGAACTGGGATCGGACCCAGTTCTTCAAAGCCGACCTCTCCCCGCTCGAGTCCGGATGCTGCAAGCCACCCAGCAGCTGCAACTTCCTCTACGTCAGCGGCACGAACTGGACGAAGGTGCCCACCAACTCGTCGGACCCGGACTGCAACACGTGGGTCGACGACGGCACGCAGCTGTGCTACAACTGCCAGTCGTGCAAGGCCGGCGCGGTGGCGACCCTGAAGCGGGACTGGAAGCGCGTCGCCGTCGTCTGCATCGTCTTCCTCGTCTTCATCGTCATCGTCTACTCCCTCGGCTGCTGCGCGTTCAGGAACAATCGGAGGGACAACCGCGGCGCCTACCGCGGTGCCGCGTGGAAGGGCGGATACGCCTGA >ATR0307G021 ATGGCAGTGAGCAACAACATAACGGCGGGCCTCAACTTTGTGGCCCTCCTGAGCTCCATAGCCATCATCGCTTCCGGAGTGTGGCTTGCATCACGGCAAGACAACGAGTGCATCCGCCTGGTCCGATGGCCGATAATCCTCATCGGACTCCTCATCTTTCTGGTGTCTCTTGCGGGCTTCGTTGGGGCGTTCTGGCGCGTCCAGTGCCTCCTCGCGGTCTACCTCGTCGCCATGATTATTCTCATCGTCCTTCTCCTCTCGTTTGTCGTCTTTGCGTTCGTCGTCACGGGGCCATCGGGAGCCTACCCGATTTCTGGCAGGGCATATGATGAGTACCGCCTGCAGGGCTACTCGGCATGGCTCCGCCATTATGTGGCCGACAACGGCAATTGGAACCGCGTCCGGGCCTGTTTGGGTGGCTCCACTGCGTGTTCGGGGCTCCCCCTGAAGTACCTTAGTTTTCAGGACTTCATTGCTGCGCATCTCACTCCTTTGCAGGTCTTTCCTGCGAGGGGCACTTCTTTCTCTCTCCTCCCCTCTGGAAAAAGAGAGATAGATTCAGTTGCAGGGTCCAGCGATGGCCTCCTCTTGTTCTCTCTCATCATCCCACCCAGTGAGCGTCAACTCGCAGCCCACTTGTTCTTAATCCACTAA >ATR0580G008 ATGTTTCGTTTGAGCAATAACCTGATTGGGATCCTGAACTTCATCACCTTCCTCCTCTCAATCCCCATTCTTGGGGGTGGGATATGGCTTAGCCACAGGGCTAGCACTGACTGTGAAAAGTTTTTGGATGGCCCTATCATAGCTTTGGGAGTTTTTCTCATGGTGGTTTCTCTTGCTGGTCTTGTTGGATCTTGCTGTAAAGTCACATGGCTTCTGTGGTTCTATCTTCTGGTTATGTTCTTGCTCATCGTTCTCCTCTTTTGCTTCACCATTTTCGCTTTCGTGGTGACAAACAAAGGCGTAGGAGAAGTGGTTTCAGGGAAAGGTTACAAGGAGTATAAGCTTGGAGATTACTCGAATTGGTTGCAGAAGAGAGTGAGCAATACCAAGAACTGGAACAAGATCAAGAGTTGCTTGAGTGATGCGAAGGTTTGCAAGAGCCTTGCAGAGGATGAAAAGAACGAGCCTGAAGCCATTTTCTATGCTAAGCATCTCTCTCCGATTCAGGGTTCGATGAATTTCTCGGTGGCTTAG >ATR0665G461 ATGGCTATGAGCAACAATGTTATCGCGGCCATCAATTTCGCAGCGATGCTCCTATCCATTCCAATTATCGGCACTGGAATATGGCTGGCCACAGAACCGGACAACGCCTGCGTAAAGCTCCTACAATGGCCGGTGATCATTCTTGGCATCCTAGTCCTCATAGTTGCCCTTGCCGGTTTTGTCGGAGCATTTTGGCGAGTTCAATGGCTTCTTCTCTTCTACTTAGTGGCCATGCTCATCCTCATAGCTCTTCTCGTGGCTCTCGTGGTCTTTACATACATGGTCACAGATAAGGGGGAAGGTCACCTGGTCCCGAGTCGAGCCTACTTGGAGTATAGGCTCGAAGATTACTCAGGATGGCTCAGGATGAGGGTTCAGGGTCCATTCAAGTGGGATAGGATCAGAAACTGCCTTAGTTCCTCTAATTTTTGTGCAGAGCTGAATCAAAGTTATCATTTTGCACAGGATTTCTTCAATTCACCCCTTAACCCTTTGCAGGTAATTTTGTTCTTCTTTTCTTTTACCAAAGGATTTTTAGTATGGAGGTGGTTTTTTCTATCATATAGTGGAGCCATAACTTGA >Zm00001d032120 ATGGCGATCCGGATGAGCAACAACGTGATCGGCGCGCTGAACCTGGTGACACTCCTGCTCTCGGTCCCCATCCTCGTCTCGGGAATCTGGCTGCGGTCGCGCGCCGACGGCACCGAGTGCGACCACCTCCTGTCCACCCCGGCCATCGCGCTGGGCGCGGTGCTCATGGCCGTCGCTGTCGCGGGCCTCGCCGGCGCCTGCTTCCGCGCCACCTGGCTGCTATGGCTCTACCTCCTCGCCATGCTCGTGTTCATCGTCGCGCTGCTCTGCTTCACCGTCTTCGCCTTCGCCGTCACCAACAGGGGCGCCGGGGAGGCCGTGTCGGGGGTAGGCTACAGGGAGTACCGCCTCGGGGACTACTCCACCTGGCTGCGGCGCCACGTCGAAAGCCGCAAGGACTGGGCCCGGATCCGGAGCTGCCTCGCCGACGCGCACGTCTGCAGGCGCCTGGAGGAGAGGGAGAGGGAGAGCAAGGACGCGGCGGGTCTGGTTCGGCTCGGCCTGTCCCCGGTCGAGTCCGGGTGCTGCAAGCCGCCCACGAGCTGCAACTTCACGTACACCGGCGGCACGGAGTGGACCAGGACAGCGGCGGGCTCCGCGCCCGCCGGCCGGGACTGCAGCGCGTGGGGCAACGACGAGGACGACCTCTGCTACGGGTGCCAGTCGTGCAAGGCCGGCGTGGTGGACGCGCTCAAGCGGGACTGGAAGCGGGCCGCCATCGTCAACGTCGTCATCCTCTCCTTCATCGTCGTCGTTTACTCCGTCGGCTGCTGCGCCTTCAAGAACAGCCGCCGGGACAACTACGCCTACCACAGCGGCCGCGGATGGAAACGAGGCGGTGACGCTTAA >Zm00001d052076 ATGAGGCAGAGGAGGAGCGTGGCGGCGCCGCTACACTCTAATCCGCTGGCTACCCCATCAGGAGAGAGAGAGAGGGGGGAGAGAAGGCACCAGACACCGCCAGTAAGCATGAGGCAGAGAAGGCACCAGACATCGCGCTATCCTCCGCATCCGCCGCCCGTCGGCTTCGTCCGCTGCGAGAATTCTCGTGTCGCCCATCGGCGACAACTGTCCGGGTGCTGCAAGCCACCGACGGTGTGCGGGTACGCGTACGCGAGCCCGACGGCGTGGACGAGCCCGGCGGCGGACGCGGACTGCGTGGCGTGGAGCAACGACCCCGACCTGCTCTGCTACGCCTGCGCCTCATGCAAGGCCGGCGTGCTGGGCGGCTTGCACGAGCAGTGGCGCAGGGCCACCATCGCGCTCATCTTCGTCTACGTCGTCGGCTGCAGCGCGTTCCGTAACGCGCAGACCGAGGACCTCTTCCGCCGCTACAAATGGGGAAATTATTAA >Zm00001d017917 ATGGTGAGCCTCTCCAACGGCATCCTGGGCGCCCTGAACTTTATCTCCCTCCTCGCCTCCGTGGCGCTCATCGGCGCGGGCGCCTACGTCCTGGCGCAACCGGCCAGCGAGTGCCAGCGCCTGGTGCGGGCGCCCGCCATGGCGCTGGGCGCCGCGTTCCTCCTGCTGTCGCTCCTGGCTCTGGCCGGCGCGTGCTGCCGCGCCACGCCGCTCCTCTGGGCGTACGTCGTCGCCATCTTCGTGATCCTCATCGGCATGTTCGTGGCCACCGCCTTCGCGTTCGCCGTCACCAACCGGGGCGCCGCCTCCGCCGTGTCCGGGGCCGGGTACGGGGAGTACCGGATCGCGGACTACTCCGACTGGCTGCAGGACATGGTCGGGGACTATGAGACGTGGCGTCGGATCCAGAGCTGCATCGAGGACGCGGGCGTGTGCGGTGGCGGCTGGGCCGGCGGGACCAACGGCGGCGAGCTGTACCAGCGGTACCTGCCGCTCGTTCAGTCTGGCTGCTGCAAGCCGCCGGCGTACTGCGGGCTCCAGCACGTCAACGCCACGTTCTGGGCACCCCCGGCGTCCGGCGCGGCCACGGCGGCGGACGCCATCGACTGCCGCGTGTGGAGCAACGACCGGCGGGTGCTGTGCTTCCAGTGCGACGCGTGCAAGGCCGGCGTGGTGGCCACCGCCAGGCTCCACTGGAGGACCGTGGCCGAGCTCAACGTCGCCGTCCTCGTGCTCCTCATGGTCGTCTACTCTCTCGGCTGCTGTGCCATCCGCAACAACCACAACCGCCGGTACTACTACTGA >Zm00001d016364 ATGGCGGTGAGCAACAACATCACGGCATGCGTGACGCTGCTGGCGCTGATCTGCGCGGTGCCCGTGATCGCGTCGGGGGTGTGGTTCGCGTCGGCGCAGGGCGAGGAGTGCGCGCGCCTGGCGCGGTGGCCCGTGGCCATCCTGGGCGGGCTGCTCCTGCTGGCCGCGCTGGCGGGCTTCGTGGGCGCGTACTGGAACCGGCGCGGCCTGCTTGCCTTCTACCTCTTCGCCATGGCGTCGCTCGTCGTGCTCCTCATCGCGCTCCTCGCCTTCGCCTTCGCCGTCACCCGCGGGTCCGGCGCCTACCCCGTGCTCGGCCGCGCCTACGACGACTACCGCCTCGACGGCTTCTCCATGTGGCTCCGCGGGTACGTCTCCGACGACCCCGGGCGCTGGGACAAGGTCAGGGCCTGCCTCGCCGTCTCCGACACCTGCAAGAAGCTCGCGCGCCAGGCCGCCTTCACCAGCGCAGACCAGTTCTATCAGTCGCACCTCTCCCCGCTCCAGTCCGGGTGCTGCAAGCCGCCGTCGGTGTGCGGGTTCAGCTACGTGAGCCCGACGGTGTGGTCCGCCCCGGCGGCGCGGCCGGCGGCGGACGCGGACTGCGGGCTGTGGAGCAACGACCCGGGGCAGCTGTGCTACGGGTGCGAGTCCTGCAAGGCGGGCCTCCTGGAGGCGCTCCGGGACCAGTGGCACAAGGCCAACGTCGCCCTCGTCGTCGCCACCGTCGCCCTCGTCATCCTCTACCTCGTCGGCTGCAGCGCCTACAAGAACGCGCAGGCCGCCGCCATCTTCGGACGCCGCAAGTATTAG >Zm00001d037299 ATGGCGAGGCTGAGCCACGGCCTCCTGGGCGCCCTGAACCTGGTGACGCTCCTGCTGTCCCTGCCGGTGCTGTGCGCCGGCGTGTACATCGTCACGCGCGCCACCACGGCGTGCGAGCGCGGCCTCCAGATCCCCGTCGTCGCGTTCGGCTGCGGACTGCTCCTGCTCTCCCTCGTCGGCCTCGCCGGCGCCTGCGGACGCCGCGGCGCCGCCAGGCCGTTCCTCTGGGTGTACGTGGCCTTCATGTTTCTGCTCGCCGTCCTCGTGTTCGCGTTCGCCGTGTTCGCGTTCGTGGTCACCCACCGGGGCGCGGGCGGCGCCGTGTCCGGGCGCGGGTACAGGGAGTACCGCCTCGGGGACTACTCCGGCTGGCTGCAGGCGCGGATCGCCGAGCCGGAGACGTGGCGGCGCGTCGAGAGCTGCCTCTCTGAGGCGCGCGTGTGCGGCGGCCGGGAATTCTACAGGCAACACCTCTCGCCAATCCAGTCCGGTTGCTGCAAGCCGCCGACGTGGTGCAGGTTCCGGTACGTGAACGCCACGTTCTGGGAGGCACCGAGATCGGGGCTGTCTGCGGCGGCGGCCAGCGACGGTGACTGCCGGGCATGGAGCAACGACCAGCAGGTGCTTTGCTTCGAGTGCGACACGTGCAAGGCCGGCGTGCTGGAGACCGCCAAGAAGAAGTGGAAGACAGTGGCTATCGTCAACGTTTCCCTCCTCGCGTTCATCGTTATTGTCTACACGGTCGGGTGCTTCGCCTTGCGCAGCAAAGGTGGTGGTCGGTACTTCAATGGCGGTGGTCCTGACCAAACATAA >Zm00001d036956 ATGGCGGTGAGCAACAACATCACGGCATGCATCAACTTCCTGGTGCTTCTCTGCACCATCCCCATCGCCGCGACGGGGCTGTGGCTGGCCTCGAGGCACGGCGGCGAGGACTGCGCCAGGCTGGCCCGCTGGCCCATCGCCGTGCTGGGCGCGCTCCTCCTGCTGGTCGCGCTGGCGGGTTTCGCGGGCGCCTACTGGAACCGCAGGGGCCTGCTCGCCTGCTACCTCTTCGCGATGGCCGCCCTCATCACGCTCCTCCTCGCCCTCCTCGTCTTCGCCTTCGCCGTCGCGCACGACTCCGGCGCCTACCCGGCTCCCGGCAGGGCCTACCAGGACTACCGCCTCCAGGGCTACTCCTCGTGGCTGCGGGGGTACGTCGCCGACGACCCCCGCAGGTGGGAGGGGGTCCGGGCCTGCGTCGCCGCCTCCGGCACCTGCAGGAAGCTCGCCATGGATAGATCATTCATCGTGCCGGAGCAGTTCTACATGTCGCACCTCTCGCCCATCGAGTCCGGGTGCTGCAAGCCACCGACGGTGTGCGGGTACGCGTACGCGAACCCGACGGCGTGGACGGGCCCGGCGGCGAGCCCGGCGGCGGACGCGGACTGCGCGGCGTGGAGCAACGACCCCGGCCAGCTCTGCTACGCCTGCGCCTCCTGCAAGGCCGGCGTGCTGGGCGGCCTGCGCGAGCAGTGGCGCAGGGCCACCGTCCCGCTGCTCGTCGCCACCGTCGCGCTCATCTTCGTCTACGTCGTCGGCTGCAGCGCCTTCCGCAACGCGCAGACCGAGGACCTCTTCCGCCGCTACAAATGGGGAAATTATTAA >Zm00001d020552 ATGGCCTTCCGGCTGAGCAACAACCTGATCGGGGTCCTAAACTTCGTCACCTTCCTGCTCTCCGTCCCGATCCTGGGCGCGGGCATCTGGCTGGGCCACCGCGCCGACGGCACCGAGTGCGAGCGCTACCTCTCGGCGCCCGTCATCGCGCTGGGGGCCTTCCTCCTCGCCGTCTCCCTGGCGGGCCTCGTCGGCGCCTGCTGCCGCGTCACCTGGCTGCTCTGGGCCTACCTCCTCGCCATGTTCGTCCTCATCCTCGTCCTCTTCTGCTTCACCGTCTTCGCCTTCGTCGTCACCAACAGGGGCGCCGGCGAGGCCGTCTCCGGCCGCGGATACAAGGAGTACCGCCTCGGGGACTACTCCAACTGGCTGCAGAAGCGCGTCGAGAACACCAGGAACTGGGACCGGATCAGGAGCTGCCTCCAGGACTCCAAGGTCTGCAAGAGCCTGCAGGACAAGAACGAGACCGTCGCCCAGTTCATGAGTTCCAGCCTCTCCCCCATCGAGTCTGGCTGCTGCAAGCCCCCCACCAGCTGCGGCTACACCTACGTCGGCGGCACGGACTGGACGCCGGTGACCACCAACTCGACGGACCCGGACTGCAAGACCTGGAGCAACGACGCCTCGGCGCTCTGCTACAACTGCCAGTCGTGCAAGGCCGGCGTGGTGGCCACGTTCCAGCGGAACTGGAAGCGCGTCGCCGTCGTCTGCATCGTCTTCCTCGTCTTCATCATCATCGTCTACTCCGTCGGCTGCTGCGCCTTCAGGAACAACCGCAGAGACAACGCCTACCGCGGCGGGTGGAAGGGCGGGTACGCTTGA >Zm00001d046866 ATGGCGCGGTGCAGCAACGGCCTCCTGGGTCTCCTCAACGCGGGCGTGCTGGTCCTCGCCATCGTCGCGCTGGGGGGCGGCGCCTGGCTCAGCCACCGCGCGTCCACCACCGACTGCGAGCGGTTCCTCGAGCGGCCCGTCATCGCGCTGGGCGTGCTCCTCCTCGCGCTCTCCCTCGCGGGCCTGGCCGGCGCGCTCTGCCGTGCCTCCTGCCTCCTCTGGCTCTACCTCCTCGCGCTCTTCCTCCTCATCCTGCTCCTCTTCGCATTCACCGTCTTCGCGTTCGTCGTCACCAACCGCGGCGCCGGGTGGGTCGTCTCCGGCAGGGGGTACAAGGAGTACCGCCTCGGGGACTACTCCACCTGGCTGCAAAGGAGGGTGGAGAACTCGCAGAACTGGGCCAAGATCCGCAGCTGCCTCCAGGACGGCAAGGTCTGCCAGAAGCTTGCGTCCAGAAAGGAGACGGCCGCCCAGTTCGTCAACAGCAACCTCTCCCCGATCCAGTCTGGATGCTGCAAGCCACCAACGGGTTGCAACTTCACCTACCAGAGCGAAACTGTCTGGACCAAGCCCGCTGGTTTCAACACCACAACTGACGACCCTGACTGCACCACATGGTCGAACGACCAGACCGTGCTCTGCTACGACTGCATGGCCTGCAAGGCAGGCGTGCTGGCCAACCTGAAGAACGACTGGAAGAAGATCGCCACCGTCAACATCGTCTTCCTGATCTTCCTCGTCGTCGTCTACTCCGTCGGGTGCTGCGCGTTCAGGAACAACCGGCAGGACAACTCGTACCCGGCCTGGAAATGA >Zm00001d048555 ATGGCGCTCAACTACATGGCCGTGGCCGCCATCAACTTGGTCGCCGCGCTGCTGTCCGTCCCCGTGATCGCCGCTGGCATCTGGCTGTCCACGCAGGCCGACAACGCCTGCGTCCAGATCCTCCAGTGGCCAGTGATCGCCCTCGGCGTCGCCCTCCTCGCCGTCGGCCTCGCGGGCTTCGTGGCCGCCTTCTGCCGCCTGCCGTGGCTCCTCCTCGCCTACCTCGTCGCCATCTCCGTCCTGGTCGTCGCGCTGGCCTGCCTCGCCGTCTTCGTCTTCGCGGTGACCACGGGGTCGTCGGGCCACCGGGTGCCCAGCCGGGACTTCCTCGAGTACGACCTGGACGACTACTCCGGCTGGCTGCGCGCCCGCCTGGACGCGCCGGGGCGCTGGGACCGGATCAAGGCCTGCCTGGCCGCCACGCCCACCTGCACCGACTTCAACGCCACGTACGCCACGGCGCAGGACCTCTTCACGGCCGCCCCCAACAGGATGAGCCCGCTGCAGTCCGGCTGCTGCAAGCCTCCCACCAAGTGCGGCTACACCTTGGTCACCCCGACGTACTGGATCAGCCCCATCAGCGCCACCGCCGACCCCGACTGCGCCGCCTGGAGCAACGAGGAGGCCAAGTTCTGCTACTCGTGCGCCTCCTGCAAGGCCGGCCTGCTCCAGAACCTGCGAGGGGAGTGGCGCCGCGCAGACCTCATCCTCGCCGTCGCCACTGCCGCGCTGCTGGCTGTCTACGCCATGGGCTGCTACGCGTTCCGCACCGCCAAGACCGACGAACTCTTTCGCCGCTACAGGCAGGGCTATACATGA >Zjn_sc00008.1.g03730.1.sm.mk ATGGTGCGGTGCAGCAACGGCCTGCTGGGCCTCCTCAACGCGTGCGTGCTGGTGCTCGCGGTCGCCACCCTCGGCGGCGGGCTCTGGCTGAGCCACCGCGCCGCCTCGGCCACCGACTGCGAGCGGTTCCTCGAGCGCCCCGTCCTCGCGCTCGGCGCCCTCCTCGTGGCGCTCTCCGCCGCGGGGCTCGCCGGCGCGCTCTGCCGCGCCTCCTGCCTCCTCTGGCTCTACCTCGTGGCGCTCTTCATCCTCATCGTCCTCCTCGGCGCCTTCACCGTCTTCGCGTTCGTCGTCACCAACCGCGGCGCCGGGTGGACCGTCTCCGGCAGGGGGTACAAGGAGCACCGCCTCGGGGACTACTCCACCTGGCTGCAGCGGAGGGTGGAGAACGCTGAGAATTGGGTGAAAATTCGGAGCTGCCTCCAGGACGGCAAGGTCTGCGAGAAGCTTGGGGCCAGGAAAGAGACGATCAGCCAGTTCGTCAACACTAACCTCTCCCCGATCCAGTCTGGATGCTGCAAGCCACCAACTGGATGCAACTTCATGTACCAGAGCGAGACCGTCTGGATCAAACCTAATGGTTTCAACGGTACCGACGACCCTGATTGCAACACATGGTCCAACAGTCAGAACGCGCTCTGTTACGACTGCACATCATGCAAGGCAGGCGTACTCGCCAACCTGAAGAACTCCTGGAAGAAGATCGCCATTGTCAACACCAGTTTCCTGGTGTTCCTCATCGTTGTGTACTCTGTTGGGTGCTGCGCTTTCAGGAACAATAGGCGAGACAACTCGTACCCAGCTTGGAAATGA >Zjn_sc00008.1.g06730.1.am.mk ATGCCAGTGTTCAGGAGGAGGAGGAAGAGGAAAGGGAGTACGAGAGGATGGAAAGGGGTAGAGGCGGCGAGCTTATATGTGTGCTATGCTGATGCCGAGTGGGAATGCGTTCTCGGTTTTCGGATTCTTTTCTGGTTCTTTTACCAGCTGCGCTTCAATCTTTTTCCCTCGCTATTGGATTACCAGCTGTGTTTACCGTTGGACGAGGCTGCCGGCGAGAGAGGAACGAGGGAGAAGAGTGCTGGAATGGTGAAAGGGCAAGGAGGAAGGAAGAAGCAGAGGAAGCACCTGCAGGGCTTCGGTTGGCGCCGAAGCAGGGGAGGGAAAAAGCAAGACAAATGGAGCCCGGGGATTGGCGCCGGACATGTCGTCCCGAATAGCGAGACCCTCAGCGGCCTGGCCAAGAGTGCACAGGGGCCTGATCGGAGTGGATGCACCTGGCTCCAGCGACCGAGGCAGTTTTGGGCGGTGCATCCTGACCCCAGAGGACGCGGTAGCCGGTGGGCCCCACACGTGCGCATGCGCCCAAGGAACGTAGCCACTCCGCTGCCGATGCGCACGGTTCGATGGGTTTCCATTCCTCAAGCTTGCTCAGGCGGTGGCGGCTTCCTCGGTTTGCGCGGCCTCACGTGGTCGTCGGTGGTGCTTCTACTGTTCCCCACACCGATCCGGGCACGAGTAGCCTCCGCTGCCGATCCCCGGATGGCGGTGAGCAACAACATCACGGCGTGCATCAACTTCCTTGCCCTTCTGTGCACGATCCCCGTGGCGGCGACGGGGCTGTGGCTGGCGGCGAAGCAGGGCGAGGACTGCGCGCGGCTGGCGCGGTGGCCCGTGGCGGTCCTGGGCGGGCTGCTCCTGCTGGTCGCGCTGGCGGGCTTCCTCGGCGCGTACCGGAACCGCAAGGGCCTGCTGGCCTGCTACCTCTTCGCGATGGCCGCGCTCATCACGCTGCTGCTGGCGCTCCTCGTCTTCGCCTTCGCCGTCACCCGCGCGTCCGGCGGGCAGCCCGTGCCCGGCCGCGCGTACGAGGACTACCGCCTCGAGGGGTACTCGGCGTGGCTGCGAGGGTACGTCACCGGCGACCCGGGACGGTGGGAGGGGATCAGGGCGTGCATCGCTGCATCAGGGACATGCAGGAAGCTCGCGCAGGACACCGCCTTCATCGCGCCGGAGCAGTTCTACGCGTCGCACCTCTCTCCGATCCAGTCCGGCTGCTGCAAGCCTCCGACGGTGTGCGGGTACGCGTACCTGAGCCCGACGACGTGGACGAGCCCGGCGAACCCGGCGGCGGACGCGGACTGCGCGGCGTGGAGCAACGACCCCGCGCAGCTCTGCTACGGCTGCGCCTCCTGCAAAGCCGGCGTGCTCGGCGGCCTGCGCCAGGAGTGGCGCAAGGCCAACGTCGCGCTGCTCGTCGCGACCGTCGCCCTCATCTTCGTCTACATCATCGGGTGCAGCGCATTCAGGAACGCGCAGACAGAGGACCTCTTCCGCCGGTACAAGGTCGCCGCGCTGAAGCGCAAGTACCCCGGGGCGCTTGTTCTGTCGCCGGAGCAGGGGATCGTCTCCTCGCTGGCCGCCACCTCTGATTCTCTGGAGGAACAGCGAAAGAAACCTTACAACGAGAAGAACCCTCAGCGAAAACCTCCGCGTGATCCCGGACGAAACGCCGCAGATCATACAGCCAGGAAGGATACGACCGGATATCCCGATACGATTCGGCACGCGCGGATAAGGCGGAGCACGCACGCCGCAGCGCCGCGAACCGAAGATATGGCGATAAGCGCCTGCCCGCGTTTCTGTTTAGCCCGCCTAATAAAGCCCTTCGCCGTCAGGCCGTCCGTCCGTCACGACAAGCTCGGTTCCAACAAACCGCCGATCAATCACGGTGAAGTGACCGGAGCCACACGGAAGGGGATCCAGCAGTCGACGTTCCGACACCACGGCGACGGGCGCGCGTCCGACGGCGACGTCGGAATCAGCTCGCCCCAGCAGACGTGCGGCGCCGCGGAGAAACGCGGCGAAGTCCACATAAAAACGCCCGCGAAAAAACAGCTCCGTGACACGCGAGAGAAAGCGACGGCGTTTTCTCGAACAGCCCGTGCGCTCGACCAATTGCGGACGCTCCGCTCCGGCGTGTCGACCTGGAGTCTGGCGGGTGATCACTGA >Zjn_sc00132.1.g00890.1.am.mk CTGGAACCCGCATACGAGCCAGCACCAGCGCCCGATCGTCCGTCTCCACCCTTCGAGCCAGCGTGCGAGCCTGCGCTGGACCCGGCAGATGACCCCGCGCCGCCGGACCTGGAGCTCGAGCCAGAGCGTGACCCGGACCAGGAACCAGAACCGGAGCCGGATCCTGACCCGGACGTGGAACCAGAACCAGAACCGGAGCCAGAGCCGGAACCGCCACCGCCGACGCCGATGCCAATCCCTGAGCCGACACCGACGTCGCCGCCCCCGCCGCGCGCTCAGGTCTCCTCAAACGCGGAGTCAAGCTCGCAGACTTGTCCAAAGCGGTGGCCCGGTAGGTACCCGGGCGAGCAGGTTCATCACGATTGGGCGTGCCGCTGTGGGGGGCGCACGGCCGCTCGCCCGCGCGACGTGTCCCTCGCACGCCCAAGGAGCCGGTTTCGGTTTCCCCGGCGACTTGCTTGCCGGTTGCCGCCGGCTCGTCCGTCCGTAGCGCCCACACGATTTCCCGCTCTCCCATTGGAGAAACCACGAAACTTCCCAGAGTCCGCGGCGACGCCAGCAAGCCTCTCCGCCACCCTACAAATATACAAACTCATCGGCCTCACATTATCCATCATCGCCACGCGGAAAAATCACGAGACGTCCAAGCGCAGCAAACGGTTCACACTTCGGAGAGCGCGCGCAAGCTCTGGGGCGGCCACACCGACCATGGCGTTCCGGCTGAGCAACAACGTGATCGGCTTGCTGAACCTGGTCACGTTCCTGCTCTCGATCCCGATCCTCGGCGCGGGGATCTGGCTGCGCACGCGCGGCGACGGGACGGAGTGCGACCACTTCCTGTCCTCCCCGGCCATAGCGTTCGGGGCCGCGCTCATGGCGGTCTCCCTGGCCGGGCTCGTCGGCGCGTGCTGCCGCGTGACGTGGCTGCTCTGCCTGTACCTCCTGGCCATGTTCGTGCTCATCGTCGCGCTGCTCTGCTTCACCGTCTTCGCGTTCGTCGTGACCAACAAGGGCGCCGGGGAGGCGGTCTCGGGGACCGGGTTCAAGGAGTACCGTCTCGGGGACTACTCCACCTGGCTGCGGCGCCACGTGCAGAGCACCAAGAACTGGGCCAGGATCCGCAGCTGCCTCGCCGACGCCGACGTGTGCAGGCACGTGCAGGAGGAGGACCGGAACGCGACGCTGGCGCAGTTCCTGCGCGCCGACCTGGACCCGGTCGAGTCCGGGTGCTGCAAGCCGCCCACCAGCTGTAAGTTCACGTACAACGGCGGGACGGAGTGGACCGAGACGCCGAGCTCCGCTTCGGGCGGACCGGACTGCCGCGCGTGGAGCAACGATTCGGATAAGCTCTGCTACGACTGCCAGACGTGTAAGGCCGGCGTGGTGGACGCGCTGAAGCGGGACTGGAAGCGCGCCGCCATCGTCAACATCGTCTTCCTCGTGTTCATCATCGTTGTCTATTCCGTCGGGTGCTGCGCGTTCAGGAACAGCCGCCGGGACAACAACGCCTACCGTCGCGGAGGCGAATGGAAGCAGGGCGGATACGCTTGA >Zjn_sc00069.1.g00170.1.am.mk ATGCCTTCCTTGATCGGAGCTGGTTCCCTCCATTTCTTCTTTCCCTCCTCAGCTCAAAAGGTGCACCCTGCCACCCACACTTCACGATCCGATCTCCTTCCACACTTGCATTGCCGTGGATCCAGCGCTGCAGATTCGTCGAGGCTTATATACCTCACCTCCAGCCGTCAGCCGAGGCTTCCTCTGCACGAGAAGCAGGCCTCACGAAGGCGCCGTCACGCACAGATGGGCAACATCGCGTCGGGGAACCGGCGGCGGCCGCCGGTGGTGGAGGAGCGGCTCACGCAGCCGCAGCGCCTCGTCATGCAGCTGCCCGACATGGACGCCGGCTGCCTGCGCCGCCTCATCCGCAGCGGCGACCTCGCGCCGTGCTTCGACGCGGCCGAGGACGCCGACGACGGCCACGTCGAGGAGTGCCCCATTTGCTTCTACGTACGTTTGGTGATCGACCGTCCCCTAGGGAGGCGCTGGAACGAGAAATTCAAATTCCAAATCATGCGAGAACTGCCAAAAAGCAGCCAGCCCAGCAGTCGAGCCCTCCACACCCACCGCCCGACTGCAAAATCCCACGCCACGCCACGCCCCGCCCCACTCGCCGCAAAACTTCCCAACTCCCCAGTCCTCAGTGCCCAGTCCCCCACCCCGAGAAGAACAGCGGCGGCGGCGGCCATGGTGCGGTGCAGCAACGGCCTCTTGGGCCTCCTCAACGCGTGCGTGCTGGTGCTGGCCGTCGTGACCCTCGGCGGCGGGGTCTGGCTGAGCCACCGCGCCTCCACCACCGACTGCGAGCGGTTCCTCGAGCGCCCCGTCATCGCGCTCGGCGTGCTTCTCCTCGCGCTCTCCCTCGCGGGTCTCGCGGGCTCGCTCTGCCGCGCGTCGTGCCTCCTCTGGCTCTACCTCCTCGCGCTCTTCCTCCTCATCGTCCTCCTCTTCGCCTTCACCGTCTTCGCCTTCGTCGTCACCAACCGCGGCGCCGGCTGGGCCGTCTCCGGCAGGGGGTACAAGGAGTACCGGCTCGGAGACTACTCCATCTGGCTGCAGAAGAGGGTGGAGAACGCCGAGAACTGGGCTAAGATCCGGAGCTGCCTCCAGGACAGCAAGGTATGCGAGAAGCTCGGGGCCAGGAAGGAGACGCTCAGCCAGTTCGTCAACACCAACCTCTCCCCGATCCAGTCTGGATGCTGCAAGCCACCAACTGGTTGCAACTTCATCTACCAGAGCGAGACAGTCTGGATGAAACCAAATGGTTTCAATGCTACCGACGACCCTGATTGTAATGCATGGTCCAACGATCAGGCAGCGCTATGCTATGACTGCACATCATGCAAGGCAGGCGTACTTGCCAACCTGAAGAACTCCTGGAAGAAGATTGCCACAGTCAACATCATTTTCCTGGTGTTTCTCATCGTTGTCTACTCTGTTGGGTGCTGCGCTTTCAGGAACAACAGGCAGGATAACTCGTACCCAGCTTGGAAATGA >Zjn_sc00022.1.g02530.1.sm.mk ATGATGAGCCTGTCCAATGGCGTCCTGGGCGCCCTGAACACCGTCGCCCTCCTCGTCTCCACCGCGCTCATCGCCGCGGGCGCCTACATCCTGGCGCACCCAACCACCGAGTGCCAGCGCCTGCTGCGGCTCCCTGCAATGGCGATCGGCGGCGCGCTCCTCCTGCTCTCCCTCATGGCCCTCGCCGGCGCGTGCTGCCGCGCCACGCTGCTCCTCTGGGCGTACGCGACCGCCATGTTCCTGCTCATCGTCGCCATGTTCGCGGTCACCGCCTTCACGTTCGTCGTGACTAACAAGGCCGCCGCGACCGCTGCGTCCGGCGCGGGGTACGGCGAGCACCGGATCGGTGACTACTCCGACTGGCTGCGCGACAGGGTCGGGGAGTACGAGACCTGGCGGCGGATCGAGAGCTGCATGTCGGACGCGGCCGTGTGCGGCGGGTGGCTAGGCGGCGTCCACGGCGGCATCCGCGCCGGCGAGTTCTACCGGGAGCACCTGCCGCTCGTTCAGTCTGGCTGCTGCAAGCCGCCGGCGTACTGCCGATTCGAGCCCGTGAACGCGACGTTCTGGGTGACCCCCGCTTCCGGCGCGGCCACGACGTCCGACGCCATCGACTGCCGGGCGTGGAGCAACGACCAGCAGGTGCTGTGCTTCCGGTGCGACGCGTGCAAGGCCGGCGTGCTGGCGACCGCCCAGAACAACTCGAAGGCCGTGGGCGCGCTCAACCTCGCCGTCGTCGCGGTCCTCACGCTCGTCTACTCGCTCAGCTGCTGCGCCATCCGCAGCAACAACCGGCGATACTGA >Zjn_sc00047.1.g02900.1.sm.mkhc ATGCCGGTGAGCAACAACATCACGGCGTGCATCACCCTTCTGGCGCTGATCTGCGCGGTGCCGGTCATCGCGTCGGGGATCTGGTTCGCGTCGGCGCAGGGGGAGGAGTGCGCGCGGCTGGCGCGGTGGCCGGTGGCCATCCTGGGCGGGCTGCTCCTGCTCGTGGCGCTCGCGGGGTTCGTCGGCGCGTACTGGAACCGCCGCCGCCTGCTCTTCTTCTACCTCTGCGCGATGGCGGTGCTCATCGTGCTGCTCATCGTGCTGCTCGTCTGGGCGTTCGCCGTATCCCGCGGGTCCGGCGCGTACCCGGTCCTGGGCCGCGCGTACGAGGACTACCGCCTCGACGGGTTCTCCATGTGGCTGCGCGGGTACGTCTCCGACGACCCCGGACGCTGGGAGAGGATCAAGGCCTGCCTCGCCGTCTCCGACACCTGCAGGAAGCTCGAGCGGCAGGGCGTCGGACTCACCGCCGACCAGTTCTACCAGTCGCATCTCTCTCCGCTCCAGTCCGGCTGCTGCAAGCCGCCGTCGGTGTGCGGGTTCAGCTACGTGAGCCCGACGGTGTGGTCGAGCCCGTCGCACCCGGCGGCGGACCCGGACTGCGGGCTGTGGAGCAGCGACCGGGCGCGGCTCTGCTACGACTGCGAGTCCTGCAAGGCCGGGCTCCTGGAGGCGCTGCGCGACCAGTGGCACAAGGCCAACATCGCGCTCGTCGTCGCCACCGTCGCGCTCGTCATCCTCTACCTCGTAGGCTGCAGCGCCTACAAGAACGCGCAGGCCGCCTCGCTCTTCCGCCGCTACAAGTGGTAG >Zjn_sc00002.1.g17600.1.am.mk ATGAGGGCCCGGCCTGCGGCCCGGCCCACCAGTGGTAATCTGCAATGGGCCGAGTTTAGTAGGCTTGATCGACGATATCCGTCCGTCGTGTGGCCGACCCAGGCAGCACAGCAGCCAGAGAAAGGTAACCGGAACATGGCGCTCAACTACGTGGGCTTGGCGGCCATCAAACTGGTCGCCTCGCTTCTGTCCATCCCCGTGCTCGCGGCCGGCATCTGGCTGTCCATGCAGGCTGACAACGCCTGCGTCCAGATCCTCCAGTGGCCCCTCATCGCCCTCGGTGCTGCCGTCCTCGCCGTCGGCCTCGCGGGCTTCGTGGGTGCCTTCTGGCGCCTGCCCTGGCTCCTCCTCGCCTACCTCGTTGCCATGCTCCTCCTCGTTGCCACGCTCGCCTGCCTCGCGGTCTTCGTCTTCATCGTCACCAACGGATCCTCGGGACACACGCCACCAGGCCGGGCCTTCCTCGAGTACGACCTCGACGACTACTCCGGCTGGCTGCGCGCCCGCCTTGAAGCGCCGGGAAGCTGGGACCGGATCAAGACGTGCCTCGCCGTTTCTACCATTTGCTCCGACTTCAACCAGACATACGCTACGATGACGGCGCAGGAATTCTTCACCGCCGCTTGGCTTAGCCCCCTGCAGTCAGGCTGCTGCAAGCCGCCGACGAGATGTGGCTACACCTTCGTCACCCCAACCTACTGGATCAGCCCGATCGACGCTGCCGCCGACCCCGACTGCGCTGCCTGGAGCAACGAACAGGAAAAGTTCTGCTACTCATGTGCCTCCTGCAAGGCCGGCCTGCTTCAGAACCTCCGCCGGGAGTGGCGTCGCGCTGACATCATCGTCACCGTCGCCACCGTGGTGCTCCTTGCCGTCTACACCATGGGTTGCTACGCCTTCCGCGCCGCCAAGACAGACGAGCTCTTTCGCCGCTACCGGCAAGGCTACACATAG >Zjn_sc00093.1.g01120.1.sm.mk ATGGCGAGGCTGAGCCATGCCCTCCTGGGCGCCGTCAACCTGGTGACGCTCCTCCTGTCCCTGCTGCTGGTGTGCGCGGGCGTCTACTTCCGCATGCGCGCCGTCACCGACTGCGACCGCGCGCTGCAGCTCCCCGTCATCGCGATCGGCTGCGCGGTGCTGCTCCTCTCCCTCGTCGGCCTCGTGGGCGCGTGCGGACGCCGCGCCGCCACCCGGCCGTTCCTGTGGGCGTACGTGACGGCCATGTTCCTGCTCACCGTCGCCGTGTTCGCGCTCACCGTGTTCGCGTTCGTGGTCACCGGTCGCGGCGTCGGGTCCAGGGAGTACCGTCTCGGCGAGTTCTCCGGCTGGATGTGGGCTCGGATCGCCGCGCCGGAGACTTGGCGGCATGTCGAGAGCTGCCTCTTGGAGGCGCGCGTGTGCGGCGGCCAGTTCGATGGCGGCGACGTCGGGCCCCTCGCGCTGGACTTCTACCGGCGACACCTCTCGCCGATCCAGTCCGGTTGCTGCAAGCCCCCGTCGCGTTGCGGGTTCCGGTTCGTGAACGCCACGTTTTGGGAAACCCCGAGATCCGGCGGTGAGATGTCTCCGGCCGCCGCCGGCGACGGTGACTGCAGCGCGTGGAGCAACGACCCGCAGGTGCTCTGCTTCCAGTGCGACGCGTGCAAGGCCGGCGTGCTGGCCACAGTGAACAGGAAGTGGAAGGCGGTGGCCGTCTTCAACGTCGCGCTCCTCGTGGTCCTCGTCGTCGTCTACACGTTCGGGTGCTGCGCCTTGCGCAGCAGCGGCGGGAAGAAGCACCACGACGGCTGTGGAGCCTAG >Zjn_sc00039.1.g02740.1.am.mkhc ATGGTCGTAAGTTCGCCGGTAAGTGGTGTGGTTGAGTCGCGACGTCGCGTCTGCCTTCGCTCCGGAGCCTCCATGTGTGTGGCTGCGACGGCCGGCGAGCCGTGCCTTTTGCCGAGTAGAGCGAGATGTGCAGCTGGGGGCGACACGTTCTTGGCCTCTGAAACTTGGGAGATATTCAGCGGCATCGATCGTCAGATGTTAGTGCGCGGGAAAGTTGCGGATTGGGAGGTGTCGTCCACTTGCTCGACGGCTAAACAGCTGTGGTGTCCACGTACGGATGAGGCCAGTGTGCTTTATATCTCCAACTTTCGATGGTGGAGAGATGAGGCAGCAGCCAGCCCAACAACTATTGCACGCCTCTTTGTGCGCGGGCACGGGCTCGGGACACCGGCCGGACGCGACGCGACAGCCGAGCTGATCGATATCAAACCCCGATCGCCATCCCCGTGGCCGCTTCCTCTCCCGTGCAGCAGCAGCGCACTGCGCACTCGTCGTCGATCACAACCACTCCCGCCACCTAACCCAATCATACCCGTCCGGTCCCCCGCCTTTCCGACCTGCACGGCACCAGACCACCACCACCATTCCATGCTCCCAACCACAACGCTCGCGCCCACGGCCACAAGATCGCACGCTCGGTCACTTTGCAGCGCGCCTCGAGGCACCCGTCGCGTCCAGTACTTGGCGTCGCACGCTCACCGTCTCCTATATAAGCAGCACGTTCGCCAAAGACCTTCAATCCGCCAAGTGTTCATGCGTGCTCGGCGCGGCGCTGTTGTGCGAGCTAGGATGGCGAGCAGCAAGGTCAGCGTGGCCACAGCGGCGCTGGTGCTGGTGGCCTTCGCTTGCTTGCAGTCCTGTGCGCTCGTTGAGGGCCGCGTGGCAAGGAAGGATCTCGGCATCGACCTGGGAGGAGAAGGACAGGGGCAAGGCGTGGGGCTGGGCCTTGGACTTGGGCTCGGGCTCGGAGTGGGCACGGGTGGAGTCTCCGCGTCTGGGTCCGGTTCTGGCTCAGGGTCCGTGGCCGGGGTGGGATCGACATCGGGGTCTAGGTCCGGGTCTGTATCTATCGGAGGGGCTAGCTCGTCCGCCGGGTCGAGTGCTGGATCGTCCGCGGGATCGGGTGGATCAGGGGTAGGGTCCTCCGCGGGGTCTGAGGCTGGATCCAGTGGTGGAAATGGGCTGGGCTTAGGGTATGGCCAGGGGTATGGCAGTGGGAGACCAGACGCGCTCACTTCTCAGCTTGGCCCAAAAGATAGCCAAATCTCTGGAGATCTGCTTGCCTTTCAGACGAAAGCTTGGCTGATGGTCAGCCCGATCACGCAGCGGCTACAGATTGAGTCCAGGCACGGCGGTAACGACGCCTCTGACATGGTCTGCCGGCCGGGTCACTCCATGAGTCGCCGCCGAGCCCAAATCCAACACCTCCCGTCGTCGCGGCAACCTCCGTGCATGCGACTTTTCTCCCCAACCCCCGGCCGAACCACGAAACCCACGAGGAACTTTCCGTGCACCATCCCACGACACCAGCACCCCGGACCTCCTACAAATACACCACGACACCACGTCCGCTCCAAAACCCCTCGCCGATCAACGAAAGCACACACCCGTCCATCGAAAACCACCGCTCCCCACTCTCCAGTCCCCCTAGCTCCCTCCCTCCCTCCCTGCCCGCCCACGACCATGGCGTTCCGGCTGAGCAACAACCTGATCGGGATCCTGAACACGATCACGTTCCTCCTGTCCGTGCCCATCCTGGGCGCGGGCATCTGGCTGGGCTCGCGCGCGGACGGCACCGAGTGCGAGCGGTACCTCTCCGCGCCGGTCATCGCGCTGGGGGTCTTCCTCATGGTGGTCTCCATCGCGGGGCTTGTCGGGGCGTGCTGCCGCGTCACGTGGCTGCTCTGGGTGTACCTGCTCGCCATGTTCGTGCTCATCGTCGCGCTCTTCTGCTTCACCGTCTTCGCCTTCGTCGTCACCAACAAGGGCGCGGGGGAGGCCGTGTCCGGCAGAGGGTACAAGGAGTACAGGCTCGGGGACTACTCTAGCTGGCTGCAGAAGAGGGTTGAGAACAACAAGAACTGGAACAAGATTAGGAGCTGCCTGCAGGATTCGAAGGTGTGCAAGAGCCTGCAGGACAAGAACCAGAGCTGGCAGCAGTTTGTCACCTCGGACCTATCCCCCATCGAGTCTGGGTGCTGCAAGCCCGCCACCAGCTGCGGCTACACCTACGTCGGCGGCACGGAATGGACCAAGACCCCCGTCGCCAACTCGACGGACCCGGATTGCCAGACCTGGAGCAACAACGCCTCGGACCTCTGCTACGGCTGCAACTCGTGCAAGGCCGGCGTGGTGGCCACGTTGAAGCGCGACTGGAAGCGCGTCGCCGTCGTCAGCATCGTCTTCCTCGTCTTCATCGTCATCGTCTACTCCGTCGGCTGCTGCGCGTTCAGGAACAACCGCAGGGACAACGCCTACCATGGCGGATGGAAGGGCGGGCGCGGATACGCCTGA >EGU0139G0584 ATGGCTCTCAGCAACGTCATCATGGCTGCCATCAACTTCATGGCTATGCTACTCTCCATCCCAGTCATTGCGGCCGGCATCTGGCTCTCCACAGATACCGATAACTCCTGCCTGAAGCTCCTTCAATGGCCGGTCATTGCACTGGGCATCGTGCTTCTTGTCGTGGCCCTCGCTGGCTTTGTGGGCGCCTTCTGGCGCATCCCATGGCTCCTCCTCTTCTACCTCGTCGCCATGCTGGTTCTCATCCTGCTGCTTGCGAGCTTGGTGATATTTATCTATGCGGTTACCAATACTGGGGGAGCCCACCTTGCCCCAAGCAGGGCCTTCTTGGAGTACCGGCTCGAGGACTTCTCGGGATGGCTTCGACAAAGAGTGGAGGGCTCGCACAAGTGGGATCGGATCAAGGCGTGTCTTAGCTCGACTTCTACGTGCGCTGAATTGAACCAAACTTACAGAGAGGCCCAGGATTTCTTTAATGCAAGGCTCAGTCCCTTACAGTCAGGATGCTGCAAGCCCCCAACACAATGTGGATACACGTTCGTGAACCCGACATATTGGATCAGCCCGATCAGCATTACATCCGACATGGACTGCGTGCTGTGGAGCAACGATCAGACGCAGCTCTGCTACTCATGCTCCTCATGCAAGGCCGGCCTCCTCGCAAACCTTAGGAAGGAATGGAGGAGGGCAAATTTGATCTTGGTGGTTACTCTTGTGGGCCTCGTCTGTGTTTACTTGATGGGCTGCCATGCATTTCGGCATGCCAAGACCGATGAGCTTTTCCAACGATACAAGCAAGGTTACACCTAG >EGU0881G0466 ATGGTGCGGGTGAGCAACAACTTGGTCGGGCTTCTCAACATCGTGACGCTTCTCCTCTCGATCCCCATTCTGGGGGCCGGCATCTGGCTGGGCCACCGCGCCCACACCGACTGCGAGAAGTTCTTGGAGCGCCCCGTCATCTTCCTCGGCGTCTTCCTCCTCCTCGTCTCCCTCGCCGGCCTCGTCGGCGCCTGCTGCGGCGTCTCCTGGCTCCTATGGCTCTACCTCCTCGTCATGTTCCTCCTCATCGTCGTCCTCTTTTGCTTCACCGTCTTCGCCTTCGTCGTCACCAACCCCGGCGCAGGCGAGGTCGTGTCGGGCCGGGGATACAAGGAGTACCGCCTCGGGGACTACTCCCACTGGCTCCAGAAGAGGGTCGACGACGACGGAAACTGGCGCAAGATCCGGAGCTGCTTGCAGGAAGGCAAGGTGTGCCAGAGGATGGAGGAGAGGAACCAGACGCTCGATGAGTTCATCAACAACCACCTCTCGCCAATTCAGTCTGGATGCTGCAAGCCTCCCACTGCATGCAACTTCACCTACCGGAGTGAAACTGTTTGGGATAAACCTTCTGGCTTCGCCTCTTCTACTAATTCGGACTGCAACACATGGCAAAACGATCCATCTATCCTCTGCTATGACTGCCAATCTTGCAAGGCAGGGGTCCTCGCCAATGTCAAGAATGACTGGAAGAAGGTCGCGGTCGTGAACATCATCTTCCTCATCTTCCTTATTGTTGTCTACTCTGTTGGATGCTGTGCCTTCAGAAACAACAGGAATGACAATGCTCACCCTAGATGGAAAGGAGGATATGCTTAG >EGU0881G0673 ATGGTTAAATTCAGCAATAGCCTTTTAGGCCTCCTGAACTTTGTAACCTTTTTTATCTCTTTCCTAATCATCGGCATCGGTTTATGGTTTAAACTCATCTCATCTGCGGAGTGTGGAAAATTTCTCCAACTACCTATCCTCTCCTTTGGCATATTTCTAATGGTAGTTTCATTGTTCGGCATGGTCGGCTCATGTTGTTATGTATCCTTACTTTTGTGGATCTATCTTTTTGTGATGTTTATGTTCATTCTTGGGATGCTTGGCTTCACTATGTTTACTTTCATGGTCACGAATAAAGGCATAGGGCAAGCGATAGGGACAAGTTACAAGGAGTATAGTCTTGAGGGTCACTCAAATTGGCTCCGAAAAAAGATGGGGGAATACCACACTTGGAAAGATATTCAAACCTGCTTGAACGATGCTAAGGTGTGCGGGGGGTTTCAAACTGAAATGGGATTGAAGGCTGATGAGTTTTACAAGCAATACCTCTCCCCCTTACAGTCTGGCTGCTGTAAACCACCAACATACTGTGGATATACATATGAGAATGCTACGTATTGGACAGTCCCAAAATCTGGGCTTAAATCGGAAGAGACTGACTGTAAGATGTGGAGCAATGATCAACAAACCTTGTGCTACAATTGTAATTCATGCAAGGCAGGAGTGCTCCAAACTATTAAAGATAAATGGAAGCAGTCTGCTATCTTCAACTTTGCCCTCCTCGTCTTCCTCAACATTGTCTATTCTGTTGGCTGTTGTGCCTTGCAAAATAATAGGAATCGTAAAAAGTACCGCAGTATTTATTATTATACGGGGCCATATGCATATCGCCAAGTTGAATGGGCTTAG >EGU1136G0235 ATGGGGGTGAGCAACAACATAACGGCGGTGCTCAACTTCGTGGGGCTGCTGTGCTCGGTGCCGATCATCGGCGCGGGGATCTGGCTGGCCTCGAAGCAGGACAACGAGTGCGTCCAGTTGGCCCGGTGGCCGATCATCATCCTGGGGGTCCTCATCCTCCTGGTCTCCCTCGCCGGCTTCGTGGGTGCCTACTGGAACCGCCAGGGCCTCCTCGCCGCCTACCTCTTCTGCATGGCCGTCCTCATCGTCCTCCTCCTCATCTTCCTCGTCTTCGCCTTCGTCGTCACCCGCCCCGACGGCTCCTACCCCGTCCCCGGCCGCGCCTACAGCGAGTACCGCCTCTCCGGCTTCTCCTCCTGGCTCCGCGACCACGTCACCGATTCCGACCACTGGGACCAGATCCGCTCCTGCCTCAGCGCCTCCGACGTGTGCCAGAAGCTGGGCCATGACCAGCCCTACCTGACCGCCGACCAGTACTTCCAAACCCATCTCTCCCCTCTCCAGTCCGGGTGCTGCAAGCCACCGACGGTGTGTGGGTACGCGTACGTGAATCCGACGGTGTGGATAAACCCGAGCAACGCGATGGCGGACACGGATTGCTCGATCTGGAGCAACGAGCAGAGCCAGCTGTGCTACGCGTGCACCTCCTGCAAGGCGGGCCTGCTGGGCAACCTCCGGCAGGAGTGGAGGAAGGCGAATATCGTCCTCATCGTCACCGCCGTCGCTCTCATCTGGGTCTACATCATCGGCTGCAGCGCCTTCAAGAACGCCCAGACCGAGGAACTCTTCCGCCGCTACAAGCAGGGATTCGCTTAG >EGU1685G0422 ATGGTTAAATTCAGCAACAGCCTTCTAGGCCTCTTAAACTTTGTAACCTTTCTAATCTCCTTCCCGATCATCGGCATCGGGTTCTGGTTCAAGTTTGTCTCATCCACCGAATGTGGAAAATTCCTACAGCTGCCCATGTTCTCCTTTGGCATATTTCTAATGGTGGTGTCTCTCTTTGGTATGGTTGGCTCATGTTGTCGTGTGTCCTTCCTCTTGTGGATCTATCTGTTTGTGATGTTTGTGTTGATCCTTGGGATGCTTGGCTTTACGGTGTTTGCTTTTATTGTCACGAACAAGGGCGTAGGGCAGGCAATATCAGGGACGGGGTATAAGGAGTATAGGCTTGGGGACTACTCAAATTGGCTACAGAAAAAGGTGGGGGAAGATAACACTTGGAAGGATATCCAAAGTTGCCTGAAGGATGCCAAGGTGTGTGGAGGATTCCACACTGAAATTGGATTGAAGGCTGATGAGTTTTACAAGCAACACCTATCACCCTTACAGTCTGGCTGCTGCAAACCGCCTACATACTGCGGATACGTGTATAAGAACGCTACATATTGGACAATCCCAGAATCTGGGCTTAAATCAACGGATGTTGATTGTAAAATGTGGAACAATGATCAGCAACGCTTGTGCTACGAATGCAACTCATGCAAGGCAGGAGTGCTAGAAACTGTTAAGAAAAAATGGAAGCAGTTTGCCATCTTCAACATTGCCCTCTTTGTATTCCTCAACATCGTCTACTGTGTTGGGTGTTGCGCGTTGCGGAATAACAAGAACCGTAGCAAGTACAGCAATGGTCATTATTATCGAGGGCCATATCATTAA >EGU1685G0681 ATGTTTCGTGTGAGCAACAACCTGATCGGGATCCTCAACTTTTTGACGTTCCTCCTGTCGATCCCGATCGTCGGCGGGGGGATATGGCTGGCGACGAGGGGGAGCACCGACTGCGAGAAGTTCCTCCAGGGGCCGGTGATTGCCGTCGGCGTGTTCTTGATGGTCGTCTCTCTCGCGGGGCTCGTCGGTGCCTGCTGCCGCGTCACCTGGCTCCTCTGGGTCTACCTCTTCGTCATGTTCCTCCTCATCGTCCTCCTCTTCTGCTTCACCGTCTTTGCCTTCGTCGTGACCAATAAGGGCGCCGGTGAGGTCGTCTCCAACCGGGGTTACAAGGAGTACCGCCTGGGGGACTACTCCAACTGGCTTCAGAAGAGGGTCAACAACAGCAAAACCTGGGCCAGGATCCACAGCTGCATCCAGGACAGCAAGGTCTGCCAGAGTTTGCAGGAGAAGAACCAGACCTTCCAGCAGTTCGCCAACGACAACCTCTCCCCCATTCAGTCTGGATGCTGCAAGCCGCCCACGGAATGTAACTTCACCTATCAGAGTGAAACTTCCTGGGCTAAATCCACCATCTCAAACTCAAGCAACCCAGACTGCAATGCCTGGGATAATAATCCTTCCATCCTTTGCTACAACTGCCAATCTTGCAAGGCTGGTGTGCTGGCCAACATCAAGAATGACTGGAAGAAGGTTGCGATCATCAACATCATAGTCCTTGTCTTCCTTATCGTTGTCTACTCCATCGGATGCTGTGCCTTCAGAAACAACAGACGGGACGATGCTTATGGCGGATGGAAAGGACACCCATAG >EGU1770G0001 ATGGCTCTCAGCAACACCATCATTGCTGCCATAAACTTTGTCGCTATGCTGCTTTCCATCCCGATCATTGCAGCCGGCATCTGGCTCTCCATGCAAACCGATAACTCCTGCGTCGGACTCCTCCAATGGCCGGTCATCGTGCTGGGCGTCGTTATTCTTGTTGTGGCCTTCGCAGGCTTCGTGGGTGCCTTCTGGCGCATCCCGTGGCTCCTCCTCTTCTACCTCGTCGCCATGTTCGTCCTCATTCTTCTGGTCGCGAGCTTGGTGGTATTTATCTACACTGTTACCAACCCTGGGGGAGCCCACCCTGCCCCAAGCAGGGCCTACTTGGAGTATCGTCTCGAGGACTACTCAGGATGGCTTCGACGAAGAGTTGAGAGCTCACACAAGTGGGATCGGATCAAGAAGTGTCTTGGCTCCACTTCTACGTGTGCTGAATTGAACCAAACTTATAGAGAGGCCCAGGATTTCTTCAATGCAAGGATCAATCCCCTGGAG >EGU2254G0003 ATGGTGCGGGTGAGCAACAATCTGATCGGTATTCTTAACATCTTGACGCTGCTGCTCTCCATCCCCATCCTGGGCGCCGGAATCTGGCTGGGCCACCGCGCCCACACCGACTGCGAGAAGTTCTTGGAGCGTCCCGTCATCGCCCTTGGCGTCTTCCTCCTTCTCTTGTCCCTCGCGGGGCTCTTCGGCTCCTGCTGCCGGGTCTCCTGCCTCCTCTGCCTCTACCTCTTCGTGATGTTCCTCCTCATCGTCCTTCTCTTCTGCTTCACCGTCTTCGCCTTCGTCGTCACCAACCGTGGCGCGGGCGAGATCGTCTCCGGCAGGGGATACAAGGAGTACCGCCTTGGTGACTACTCCCACTGGCTCCAGAAGCGGGTCGAGAACGCGGCGAACTGGCGCAAGATCCGGAGCTGCTTGCAGGATAGCGAGGTGTGCAAGAGTTTGCAGGAGAAGAACGAGACGTTTCATGAGTTCATCAACAACAACCTCTCGCCGACCCAGTCTGGATGCTGCAAGCCTCCCACTGAATGCAACTTCACCTACCGGAGCGGGACTGTTTGGGATAAACCTGCTGACTTTACCTCTTCTAATAATCCGGACTGCAATACATGGCAAAATGATCCATCTGTCCTCTGCTATGACTGCCAATCTTGCAAGGGAGGGGTCCTGGCCAACATCAAGAATGACTGGAGGAGGGTTGCAACTGTGAACATTGTCTTCCTCATCTTCCTTGTTGTTGTCTACTCTGTTGGATGCTGTGCCTGCAGGAACAACAGGCACGACGATGCTTACCCAGGATGGAAAAGAGGATATGCATAG >OB02G17960 ATGGCGGTGAGCAACAACATCACGGCGTGCGTGACGCTGATGGCGCTGATCTGCGCCGTCCCGGTGATCGCGTCGGGCGTTTGGTTCGCCTCGGCCCAGGGGGAGGAGTGCGCGCGCCTCGCGCGGTGGCCCGTCGCCATCCTGGGCGGCCTCATCCTCCTCGCCGCGCTCGCCGGCTTCGTCGGCGCCTACTGGAACCGCCGCCGCCTCCTCGCCTTCTACCTCTTCGCCATGGCGTCGCTCATCGCCCTCCTCGTCGCGCTCCTCGTCTTCGCCTTCGCCGTCACCCGCGGCTCCGGCGCCTACCCGGTTGTCGGCCGCGCCTACGACGAGTACCACCTCGACGGCTTCTCCATGTGGCTCCGCGGCTACGTCTCCGACGACCCCGCGCGGTGGGAGCGCATCAAGGCCTGCCTCGTCGTCTCCGACACCTGCAAGAAGCTCGCCCGCCAGGCCGGCTTCCTCACCGCCGACCAGTTCTACCAGTCTCACCTCTCGCCACTCCAGTCTGGGTGCTGCAAGCCGCCGGCGGTGTGCGGGTACAACTACGTGAGCCCGACGGTGTGGGCGGGGCCGGCGGCGCGGCCGGCGGCGGACCCGGAGTGCGCGCTGTGCTACGAGTGCGAGTCCTGCCGCGCGGGCCTCCTCGCCGCGCTCCGCGACCAGTGGCGCCGCGCCAACATCGCCCTCGTCGTCGCCGCCGTCGCCCTCGTCTTCCTCTACCTCGTCGGCTGCAGCGCCTACAAGAACGCCCATGCCGAAGCCCTCTTCCGCCGCTACAAGTGGTAG >OB02G38150 ATGGGGAGGCTCTCCAATGGCGTCCTGGGCGCCCTGAGCTTCGCCGCCCTCCTCGCCTCCGTGCCGCTCATCGGCGCCGGAGCCTACCTCCTCGACCACCCTGCCAGCGAGTGCCAGCGCCTGGCGCGGCTGCCCGCCGTCGCGCTCGGCTGCGCGGCGCTCGTGCTCTCCCTCATGGCGATCGCCGGCACCTGCTGCCGCGCCGCGCCGCTCCTCTGGGCCTACGTCTCCGTCATGTTCCTGCTCATCGTCGGCATGTTCTTCGTCACCACCTTCGTGTTCGTCGTCACCAACAAGGGCGTCGCCACCGCCATGTCCGGCACCGGGTACGGGGACTACCGGGTCAGTGACTACTCGGAGTGGCTGCGTGAAAGGATCGAGGAATACGAGACGTGGCACCGGATCGAGAGCTGCATGGCCGACGCGGCCGTGTGCGGAGGCCGGGTCGCCGGGATCAACACCGACGAGTTCTACCGGCAGCATCTGCCACTCGTCCAGTCAGGCTGCTGCAAGCCACCGGCGTACTGCGGGTACGAGCGCGTGAACGAGACGTCCTGGGTGGCGCCGGCGCAGGGCCTGGGCGCGGCGGACGTCGACTGCCTGGCGTGGAGCAACGACCAGGCCGTGCTGTGCTTCCGCTGCAACGCCTGCAAGGCCGGCGTGCTGGCCACCGCCAGGACGAACTGGAGGGCCGTCGCCGCGCTCAACTCACAGAAGAACAGCCTGTCTTCCCCGAAGCGATCGGCTGCCATTGCTGCGCCGATCGCGCTCCTTCTAGCTCTCGGGGTCATCTCGCTCTATGACTTCGCTTTCTCTGATCGCTACCCGTACATTGATGCCGCGTCGTCGTCCTCGCCGTCTCCGGCCACCGTCAGGGCGTGTAACCTGACGCGTGGCGAGTGGGTGCGGGACGCCGGGGCACCGTACTACACGAACCTGACGTGCCCGTTCATCGACGACCACCAGAACTGCATGAAGTTCGGCAAGCCCAGCCTTGAGTACGTGAGCTGGAGGTGGAAGCCGGACGGGTGCGAGCTTCCCCGCTTCGACGCGGCGAGGTTCTTGGAGGCCATGAGGGGCAAGTCCATGGCGTTTGTCGGGGACTCGCTCGCCAGGAACCATTTCAAGTCTTTGTTGTGCCTCTTGTCCAAGGTCGACGCGTTCAGGGAGGCGGAGGCGGCGGTGAGGAGGAACGGCGGGGAGCTGCTGCTGCTGGACATCACGGAGGCGATGGACCTGCGGCCGGACGGGCACCCGAGCCGGGACGGGCACCAGCGTGGAAGGCAGCTTCGTGGTGGACTGCCTGCATTGGTGCTTGCCGGGGCCGATCATGAGCTCAAGTACTCCGCCAACTTGTCAGCTGTCAAAATGCAGCTTCTGGAATCTGAAGTGCATTACACCCAGAGACCATTATGTAAAAAGGTCGACTCCGGTGTATTTTATTGCGGAGATCCATTACTCCAAACTCCAAACTCCAAACCGAGTAACCGACATTACCATTGGAGTTTGGAGGCACAAAATGAGGAACTCAACGACGTGGAACACTGGAACGTGTACTCCAACCTACCCTGTGATATCGACTCCAGATATGGTACCAGATGTCCAGATGATCGTGATAAAGAGCTGAGCAGTTCAGGGAATATCTCGATGGGGCTCTCATCATTGGACTCTAAACAGATACTCCGCATATCATACAGTGAGATTTCAGAATGTAAAGATATTCAGCTAACAGCTATCTGA >OB03G10020 ATGGCCCTCAGCTATGTTGGTGTGGCGGCCATCAACCTGGTGGCTGCGCTGTTCTCCATCCCGGTGATCGCGGCTGGTAGCTGGCTGTCCTCACAAGTAGACAGCGCGTGCGTCCAGATCCTCCAGTGGCCACTGATTGGCCTCGGCGTCGCCGTCCTCGCCGTTGGTCTCGCTGGATTCGTCGCCGCCTTCTGGCGACTGCCCTGGCTACTCCTTGCCTACTTCGTCGGCATGCTCCTCCTCATGGTGGCGCTCGCCGGCCTTGCTGTCTTCGTCTTCGTCGTCACCGCCAGCGCGTCGGGTCACCCCGTGCCTAGCCGGGCCTTCCTCGAGTACGACCTGGACGATTTTTCCGGCTGGCTGCGTGGCCGCGTCGATGATCCAGGCAGATGGGAGCAGATCAAGACGTGTCTGGCCGCCACGCCCGTCTGCACGGCCGTCAACCAGACCTACGCCACGGCGCAGGAATTGTTCTCCGCCTCGTGGCTCACCCCATTGCAGTCAGGGTGCTGCAAGCCGCCCACCCGGTGTGGCTACACCTTCGTCACTCCGATGTTCTGGATTAGCCCCATCAGCCCCACTGCCGACCCCGATTGCACCGCTTGGAGCAACGACCAGTCCCAGCTCTGCTACTCCTGCGCCTCCTGCAAGGCTGGTCTTCTCCAGAACCTTCGTAGGGAGTGGCGCCGAGCGGATCTCATCCTCGTCGTCGCCACCGTCGCGCTCCTCGCCGTCTACGCATTGGGGTGCTATGCCTTCCGCACCGCCAAGACCGACGAGCTCTTCCGTCGCTACAGGCAGGGCTATACGTAG >OB06G26650 ATGGCGGTGAGCAACAACATCACGGCGTGCGTCAACTTCCTTGCGCTGGTGTGCGCCGTCCCCGTGGTGGCCACCGGCATCTGGTTCGCCTCCAAGCAGGGGGAGGAGTGCGCGCGCGTGGCGCGGTGGCCCGTCGCCATCCTCGGGGGCCTCCTCCTCCTCGTCGCCCTCGCGGGCTTCGTCGGCGCCTACTGGAACCGCCAGGGCCTCCTCGCCGCCTACCTCTTCGCCATGGCGGCCCTCATCACGCTCCTCCTCGCGCTCCTCGTCTTCGCCTTCGCCGTCACCCGGGGGTCGGGCGCCTACCCGGCCCCCGGCCGCGGCTACGACGACTACCGCCTCGAGGGTTACTCCACGTGGCTGCGCGACTACGTCGCCGGCGACCCGCGCCGGTGGGAGGGGATCAGGGCCTGCCTCGCCGCCTCCGACACCTGCAGGAAGCTGGCGCAGGAGAGCGTCTTCTTCATCACCCCCGAGCAGTTCTACCAATCCCATCTCACGCCGCTGCAGTCGGGCTGCTGCAAGCCGCCTACAGTGTGCGGGTACGCATACATGAGCCCGACGGTGTGGGTGAACCCGGCGAACCCAGCTGCTGATGCGGACTGTGCTATGTGGGGGAATGACCCATCACAGCTGTGCTATGAGTGCAGCTCCTGCAAGGCTGGCATGCTGGGGACCTTGCGTGAGCAGTGGCGCAAGGCCAATGTCGCTCTCGTCATCGCCACCGTCGCACTCATCTTCTTCTATGTCATTGGCTGCAGTGCCTTCAAGAATGCCCAGACAGAGGACCTCTTCCGCCGCTACAAGTGGCGCAACTGA >OB06G30870 ATGGCGCGGTGCAGCAACGGCCTCCTGGGCGTCCTCAACGCCGGCGTCCTGGTCCTCGCCCTGGTCGTCCTCGGCGGCGGCGTCTGGCTCAGCCACCGCGCCGCCACCACCGACTGCGAGCGCTTCCTGGAGCGGCCCGTCGTCGCGCTCGGCGTGCTCCTCCTCGCGCTCTCCCTCGCGGGCCTCGCGGGGGCGCTCTGCGGCGCCTCCTGCCTCCTCTGGCTCTACCTCCTCGCGCTCTTCCTCCTCATCCTCCTCCTCTTCGTCTTCACCGTCTTCGCCTTCGTCGTCACCAACCGCGGCGCCGGCTGGGTGGTCTCCGGGAGAGGCTACAGGGAGTACCGCCTCGAGGACTACTCCACGTGGCTGCAGAGGAGGGTGGAGAACTCCGGCAACTGGGCCAAGATCCGGAGCTGCCTCCAGGACGGCAAGGTCTGCGAGAAGCTCGCCGCCGGCCACCAGACGCTGGGCCAGTTCGTCAACACCAACCTCTCTCCGGTTCAGTCTGGATGCTGCAAGCCTCCAACAGGATGCAACTTCACCTACGAGAGTGAGACCGTCTGGAACAAACCTACTGGCTTTAACTCTACTGATGATCCGGACTGCACGACATGGTCGAATGTTCAGACTGCTCTGTGCTACGATTGCCAGTCATGCAAAGCTGGTGTACTCGCGAACCTGAAGAACGATTGGAAGAAGATTGCGACGGTGAACATCATATTCCTGATCTTCCTCATCATCGTCTACTCCGTTGGGTGCTGCGCTTTCAGGAACAACAGGCGGGACAACTCGTACCCAGCTTGGAAATGA >OB08G17640 CTCCGCGCCCCGGCGCTCGTCCTCGGCGGCGCCATCATCGCCGTCTCCCTGGCCGGGCTCGCCGGCGCGTGCTTCCGCGCGTCGGCGCTTCTGTGGGCGTACCTGCTGCTCACCGGCCTGCTCATCCTCGCCGCCGTCTGCTTCGGCGTGTTCGCGCTCGTCGTCACCAACGCCGGCGCCGGGAGGGCCGTGTCCGGGACAGGGTTCAAGGAGTACCGCCTCGGCGACTATTCGACGTGGCTCCGGCGGAGGGTGGAGGACGGCGGCAACTGGGCCAGGATCAGGAGCTGCCTCGTCGACGCCAAAGTGTGCCGGAGCTTGAAGAGCAACCAGACGCTTGACGAGTTCGTCAACTCTAACCTCTCGCCGCTGCAGGTTCGACAAGCCTCTCTATAA >OB08G23870 ATGGCGGCGTTCAGGCTCAGCAACAACGTGATCGGGGCGCTCAACCTGGTGACGCTCCTGCTCTCGGCGCCCATCCTCGGCGGGGGGGTCTGGATGGCCACCCGCGGCGACGGCAGCGAGTGCGACCGCCACCTCTCCTCGCCGGCCATCGCGCTCGGGGCGGTCCTCATGGCCGTCTCCCTCGCGGGTCTCGTCGGCGCCTGTTGCCGCGTCACCTGGCTGCTCTGGGTCTACCTCCTCGCCATGTTCGCCCTCATCGTCCTTCTTCTCGGCTTCACCGCCTTCGCCTTCGCCGTCACCAACAAGGGCGCCGGCGAGGCCGTCTCCGGCCGCGGGTACAGGGAGTACCGCCTCGGGGACTACTCGACGTGGCTGCAGCGCCGCGTGGAGAGCAGCAAGAACTGGGACAAGATCAGGAGCTGCCTCGCCGGCGCCGGCGTGTGCGGGAGCCTGCAGGGCAGGAACGAGACGTGGGCGCAGTTCGTCGCCGCCGACCTCTCCCCGGTCCAGTCCGGCTGCTGCAAGCCGCCCACTAGCTGCAACTTCACCTACGGCGGTGGCACGCGGTGGGGCAAGACGGCCAGGATGGGCTCGGCTGATCCGGACTGCGATGAGTGGAGCAACGACGCCGACGAGCTCTGCTTCGGCTGCCAGTCGTGCAAGGCCGGCGTGGTGGCCACGCTCAAGAAGGACTGGAACCGCGTGGCCATCGTCAACGTCGTCTTCCCCTCTTTCATCGTCGTCGTCTACTTCGTCGGATGCTGCGCGTTCAAGAACAGCCGGCGGGACAGTGTCTACCGCCGCGCCGGCGGGTGGAAGCAGGCCGGATATGCCTAA >OB09G17550 ATGGCGTTCCGGCTGAGCAACAACCTGATCGGGATCCTGAACGCGGTCACCTTCCTGCTGTCGGTGCCGGTGCTGGGCGCCGGCATCTGGCTGGGCACGCGCGCCGACGGCACCGAGTGCGAGCGCTACCTCTCGGCGCCGGTCATCGCGCTGGGGGTCTTCCTCATGCTCGTCTCCGTCGCGGGCCTCGTCGGCGCCTGCTGCCGCGTCAACTGCCTCCTCTGGTTCTACCTCGTCGCCATGTTCGTCCTCATCGTCGTCGTCCTCTGCTTCACCGTCTTCGCCTTCGCCGTCACCAACAAGGGCGCCGGCGAGGCCGTCTCCGGCAAGGGCTACAAGGAGTACAAGCTCGGCGACTACTCCAACTGGCTGCGCAAGAGGGTGGAGAACAGCAAGAACTGGAACAGGATCAGGAGCTGCCTCCAGGACTCCAAGGTCTGCAAGACCCTGCAGCAGGAGAAGTGGACCCAGGATCAGTTCTTCAAAGCCAGCCTCTCCCCTCTCGAGTCCGGATGCTGCAAGCCTCCCACCAGCTGCGGCTTCACCTACATCGGCGGCACGAACTGGACGACGACGACGACGACGCCGGCGTCGACGGACCCGGACTGCGCCACCTGGAAGAACGACGACAGGGCGCTGTGCTACGACTGCCAGTCGTGCAAGGCCGGCGTGGTGGCCACCCTGAAGCGCGACTGGAAGCGCGTCGCCGTCGTCTGCATCGTCTTCCTCGTCTTCATCGTCATCGTCTACTCCGTCGGCTGCTGCGCCTTCAGGAACAACCGGAGGGACAACCACCGCGGCGCCTACCGCGGCGCCGGCGGGGCCGGGCGGGCGTCGCCGTCGTCTGCATCGTCTTCCTCGTCTTCATCGTCATCGTCTACTCCGTCGGCTGCTGCGCCTTCAGGAACAACCGGAGGGACAACCACCGCGGCGCCTACCGCGGCGCCGGCGGCGCCGGCTGGAAGGGCGGCTACGCCTGATCGCGACCGAGCATCGGCCGGCCTGTTCATCTCTGATCGATCGTGTCAGATATTCTTGTCCATATAG >HVU0041G1509 ATGGTGCGGCTGAGCAACACGGTGATCGGGATCCTGAACGCGGTGACGTTCCTGCTGTCGGTGCCGATCCTGGCGGGCGGCATCTGGCTGCGGGCGCGGGCCGACGGCACCGAGTGCGAGCGCTACCTGGCGGCGCCGTTCATCGTGCTGGGGGTCTTCCTCATGCTCGTATCTGTCGCGGGGCTCGTCGGCGCCTGCTGCCGCGTCACGTGCCTCCTCTGGTTCTACCTCGTCGCCATGTTCCTGCTCATCGTCGTCCTCCTCGGCTTCACCGTCTTCGCCTTCGTCGTCACGCACAAGGGCACCGGCGAGGCCGTCTCCGGCCGCGGATTCAAGGAGTACAGGCTCGGGGACTACTCAACCTGGCTGCAGCGGCGGCTGGAGGACGACAAGAACTGGAACAGGATCAAGGGCTGCCTCCAGGACGCCAAGGTCTGCAAGTCCCTCGAGGACAGGAAGGAGACGCTCGACCAGTTCATGGCCTCCGATCTCTCCCCCATCCAGTCCGGCTGCTGCAAGCCTCCGATCAGCTGCGGCTTCACCTACCAAAACAGCACGCAGTGGACCGGGCCGGCCAAGTCGACGGAGCCCGACTGCAGCGCGTGGTCCAACGACGGGGCCTTCTGCTACGGCTGTCAGTCGTGCAAGGCCGGCGTGGTGGCCACCCTCAAGCGCAACTGGAAGCGCTCCGCCATCATCAACATCGTCTTCCTCGTCTTCATCGTCATTGTCTACTCCGTCGGCTGCTGCGCCTTCAGGAACAACCGCAGGGATCACCGCAATGGCGGCGGGTACAAGCAGCAGGGCGCTTACGCTTGA >HVU0042G2517 ATGGTCTCGCGGGGCCAGCGTGTCAGCCCCAGTAAGTCCCCGCCACCTTTCCGCAAAACCGCAAAGCCCTTTTATGCCATCCCCCACCCACGAAGGAAGCCTGCACTGCAAACGAGACACCCCGCGCCGCGTCAAGAACACACAGCACAGCACAGCGCAGGCACGGTCTGGGAGAGTGGCAGCGGCGAGGGCGAGCCTCCAGCCATGGCGGTGAGCAACAACATCACGGCGTGCGTGACGCTGATGGCGCTCATCTGCGCCGTCCCCGTCATCGCCTCGGGCGTCTGGTTCGCGTCGGCTCAGGGGGAGGAGTGCGCGCGGCTGGCGCGCTGGCCAGTGGCCATCCTGGGCGGGCTCATCCTGCTGGCGGCGCTGGCGGGTTTCGTCGGCGCCTACTGGAACCGCCGCCGCCTCCTTGCCTTCTACCTCTTCGCCATGGGGGCGCTCATCGCCCTCCTCATCGCGCTCCTCGTCTTCGCCTTCGCCGTCACCCGCGGCTCCGGCGCCTACCCGGTGCTCGGCCGCGAGTACGACGAGTACCGCCTCGACGGCTTCTCCATGTGGCTGCGCGGGTACGTCTCCGACGACCCCGCCAGGTGGGAGGGGATCAGGTCCTGCATCGCCGTCTCTGACACCTGCAAGAAGCTCGCCCGACAGGCCAGCTTCGTCACCGCCGACCAGTTCTACCAATCCCACCTCACGCCGCTCCAGTCGGGCTGCTGCAAGCCCCCGTCGGTGTGCGGGTTCGGGTACGTGAGCCCGACGGTGTGGACGAACCCGGCGCGGCCCGCGGCCGACCCGGACTGCGGCCTGTGGAGCAACGACCCGGCGCAGCTGTGCTACGAGTGCGAGTCGTGCCGCGCGGGCCTCCTGGCGGCGCTGCGGAGCCAGTGGCACAAGGCCAACATCGCGCTCGTCGTCGCCACCGTCTCGCTCCTCTTCCTCTACCTCATCGGTTGCAGCGCCTACAAGAACGCGCACGCCGAGGCCATCTACCGCCGCTACAAGTGGTGA >HVU0045G0243 ATGTGGGTCAAACCTTCTGGCTTCAACGCTACCAATGACCCTGACTGCAACACGTGGTCGAATGATCAGAGGGCCCTCTGCTACGACTGCCAGTCATGCAAGGCCGGCGTGCTCGCAAACCTGAAGAACGACTGGAAGAAGATCGCCACCGTCAACATCGTATTCCTCATCTTCCTCATCATCGTCTACTCTGTTGGGTGCTGCGCTTTCAGGAACAACAGGCGGGACAACTCGTACCCAGCCTGGAAGTGA >HVU0262G0019 ATGGCACTCAACTACATGGGCGCCGCGGCCATCAATGCGGTGGCGGCCCTGCTGTCCATCCCGGTGATCGCGGCCGGCATCTGGCTCTCCACGCAGGCCGACAACGCCTGCGTCCAGATCCTCCAGTGGCCGCTCATCGGCCTCGGTGTCGCCGTCCTCGCCGTCGGCCTGGCGGGCTTCATCGGCGCCTTCTGGCGCCTGCCCTGGCTCCTCCTCGCCTACATGGTTCTCATGCTCCTCCTCGTCGCCGCGCTCGCCTGCGTTGCCGTCTTCGTCTTCGTCGCCACCGCCGGCACCTCCGGTCGGCCCGTGCCCAGCCGCGCCTTCCTTGAGTACGACCTCTCCGACTACTCCGGCTGGCTGCGCCGCCGCGTCGCGGATGAGCCGGCGAGGTGGGACGAGATCAAGACGTGCCTCGCCGCCACCGCGCCCGTCTGCTCCGAGCTCAACCAGACGTACGCCGCGCCGCAGGACTTCTTCGCCGCCTGGCTCTCCCCGATGCAGTCCGGCTGCTGCAAGCCGCCGACGAGGTGCGGCTACACGTTCGTCAGCGCGACAAACTGGATCAGCCCGATCGACACCGCCGCCGACCCCGACTGCGCCGCCTGGAGCAACGACCAGGACCGGCTCTGCTACTCCTGCGACTCCTGCAAGGCCGGCCTGCTGCAGAACCTCCGCCGGGAGTGGCGACGCGCAGACGTCGTCCTCGCCGTCACCGTCGTCGCCCTCCTTGCAGTCTACGCCATGGGCTGCTACGCGTTCCGCACCGCCAGGACGGACGAGCTCTTCCGCCGCTACCGGCAGGGCTACACGTAA >HVU0399G0001 ATGGCTTTGATGTCCTGGCTAAACCAGCTCACCCTGCATGCGCTCATTCTTGTCCTCTTGCGTAACCGCTTGCTCTGGACTTACCCTGTGGTTGTTGTCGCGTCGCGCGTGCAGTCCGGCTGCTGCAAGCCGCCGACGGCGTGCGGGTACGCGTACGTGTCCCCGACGGTGTGGGCGAGCCCGGCGAACCCGGCGGCGGACGCGGACTGCGGCGCCTGGAGCAACGACCCCCGGCAGCTCTGCTACTGGTGCACCTCCTGCAAGGCCGGCATGCTGGGCACCCTGCGCGACCAGTGGCGCCGGGCCAACGTGGCGCTCGTCGCCGCCACCGTCGCGCTCCTCGTCGTCTACGTCATCGGCTGCAGCGCCTTCAAGAACGCGCAGACCGAGGACCTCTTCCGCCGCTACAAGTGGAGCAACAACACCTGA >Zjn_sc00030.1.g01090.1.am.mk ATGAAACCAGTTCCACCTCGGCAACCAATGGCGCGTTGCAGCAACGCCGTCTTCGCGTTCTTCAACGTCCTGACCCTCCTCCTCGGCGTGGCCGTCCTGGCGGGGGGCATCTACCTCGGCTCCGGCGCCACCGCCGACTGCGAGCGGTTCCTCCGCGCGCCGGCGCTGGTGCTCGGCGCCGCCATCGTGGTCGTTTCCACGGCCGGAATCGCCGGCGCCTGCTGCCGCGCGTCGCTGCTCCTCTGGCTCTACCTCTTCCTCGCCGCGCTGCTCGTACTCGCCGCGGTCTGCTTCATGGTGTTCGCGCTCGTCGTCACCAACGATGGCGCCGGGCGGGCCGTGTCGGGGAGGGGGTTCAACGAGCACCGTCTCGGAGACTACTCCGGCTGGCTGCGGCGCAGGGTGGAGAACCGCCGGAACTGGGACAGGATCAGGAGCTGCCTCGCCGGCGCTGGCGTGTGCCGGAGCTTGCGGAAGAACCGGACGTTCGATGAGTTCGTCAACGGCAACCTCTCGCCGGTGCAGTCCGGATGCTGCATGCCCCCGACCGACTGCGACTTCACGTACGTGAACGAGACGTACTGGACCAAGCCCGGAGACGGCCGCAGCAACTCATCATCCAACAACCCTGACTGCGCCTCGTGGTCGAACGACCGGTCCGAGCTCTGCTACGGCTGCCAGTCCTGCAAGGCCGGCGTCCTGGGGAACCTCAGGGGCAGCTGGAAGAAGATCGCCGTCGGCAACGCGGCCTTCGTCGTGCTCCTCGTCGGCGTATACTCGCTCGGGTGCTGCGTGCTGCGGAACAACCGGTGGCACAAGTACACCAGGGTTGGGAAGCTCTTCGATCCCCTCCTTTCCTATCCCCGCTCCGCCGCCAGCCGCCTTCGATTTATGTGCTCCGCCTTCGCCTGGCTTCTTCGCTACGCCTCGAGGACGGCCGCGGCAGGCCTTACTAGCTGCACCACCCTGCGCCGCCTAGCCCACGGCGCAAGGCCCTGCAGCCCTGCCTGCTCCTCCCCACGCCGGCCGCTGGCTGACCCTGTCGGTGCCGTCCCACCCACGCCGCCCTGGCGTCGGTCACCCCTCCCCGCATCGCTCTGCCCAAGCCGCCCTGCCGCTCTCGCACCGCGCCGCCCCTGCCCGGCCGCCCTCGGACAGCCCCGACCACCCCCCTCGCCGCGGCGCGCCGACTGA