>Seita.9G167700 ATGGACAACAATGAGAACAATGTTGAATCCTCCAAAGAGGATTCTGATTCTGATGACGATTGTGGATCGTATTCTACTCCACCTAAGTACGAACCAAGCCCACCTAGGTCTCCTAGTGTCCAGATGAAGATGACCCTGGATACGATCCAATACAGATCATCAGGTACCTGCATGGACATTCATATACTAGCTAGTGATATATTTGTTGTTCACATGAAGATGAACGATGACCAATCCCCGGTGCATTCCCCACCACGACATCGTAGAACATCTACTCTGCATGAAGAGGAGGTAGATGCCTCTGCACCACAACCTTCAGCTAGTACTGCTTCTAGTAGTAATCCAAAAAGGAAACGTAATCTCGTAATAGAAAAGATTGGCACCAAAGGTGAGCCCATATTACCTAAGGGGATATCTGCTAGGTTTCAAAACAAATGTGGAGCTATTGTCAGGGATAAATTGCAGATCTGGATCATGACTAGTAATTGGAAGAAGGTGCCTACCACTACAAAGGATGTATTGTGGGGCACATTGAAAGAAAGGTTCACTTTTCTTGAAGGTCAAGAGAAATTCACAAAAAACTTTGCTGAGGGCCTCCTTGGGAGATGTTTCAGGAATTGGAGGTCTACTCTTAATAAAGAATATGTACAGAAAGGCAAGAATGCTAGCGATGACTTCGCCACCGAGAACCCCCATCACTTGGGTGTGGGAGGGTACGCTGCCAAGATCGCTAAATGGAGGAGAGAGGAACAAGAACGGATGAGAGCTGGTTTACCGGATATGTTTGAAGGTTTGGATAAGCGCACTAGGAATTGGGTACTAGCTCGAATTTCGAATGTAACACCCAACGGTAAGGTTAAATTCAAACACCTCTCAACAGACAAAATTTACAAGAGGTTGGAACAACTCCCCGAGGTGCAAAAGAAGGGTCTTTCCAAGGCCGACAAGGAGAAAGATCAGCCAACTGTCACGATCGGAACTGCGGAGCACTCTGGGCGTGTTCGAGGGATGTCATCAACATTCCCCAACAACCAAGCAAGCTACAGGAAACACGACCGTTATAAGAAAAACCTTGAAGAGAAGATGAGAGAAATTGCCAAGCAGGAGTTCTTGGAATTCTTGGCCAACCATGGGATAAGCCAAACGATGGCTGACCCGACAGTATCCAATGGTCAACGACAGGCAGAACCAACCATGCTACTTGCCCAAACAAGATTCGTTGCTCCAAGTAGTACTGGCTCCATTGCAAACATGCGGTATCCTGTTGACGACATACAAGTGGATACACCATGCAGGTTGGTTATACCTTATGGAAGGAAACAAAATAAGTTTCGAGAGGTCGCAACCGGCATGGCAATAATGAAATACGCCTGGGTGCAAGTTGTTACGTTGTTAGATGAGTTGTGCGAGATAGACATCCCTACTGATGAGGAGATTGAGGTTCTCGGTGATGCGATGAACCAGTACATATTGTGGCATCGCCGAGATATCATTCTGAATGTATCGCTAGAAACCTCACGGACGAGCCAAGAACTACCCCTTTCAGATTCAAATGTTGACACGGAGCAGCCAACGCAATCACATGTGCAGGGAGCTAACAATGAGGACATGTAG >Seita.9G387300 ATGCATAAACGGTGCCACAAGCAACTCCCCCGTAGTACGCTATGCGGATACTACGTGTGCGAGTTCCTAAAAAACAATGGGAGTTACCGAATGAACGACCCCAAAGACTTGCCTAGGATCGACACTCGCAATTCGGCTCTCGAAGACCAAGGCATCGTCAACATTTGTAGGGACATGGCTCATTCCATCCAAACTGAGATTTGTCATGAGAAAGTATTATTCTTTGATCCAAAAGGCGAGTTGGCGGCGGACGGATGCGAGGGTCTTCGTACATGGACGTTATAA >Seita.8G044400 ATGAAAATAATAATACATAAATGGTGCCACAAGCAACCTCCCAGGACTGTGCTATGCGGATATTATGTGTGCGAGTTCCTCATAAAGAATGGGAGGTACCGGACGAACCCTGAAGATATGCCTAGAATCAACACTCGCGATGTGGCGCTCGAAGACACAGGCATCATCAACATTTGTAGGGATATGGCGAGGTTCATCCAACGGGAGATTTGTCATGAGGACGGAGACTTCTTTGATCCAAATGGCATGTTGGCGGCGGACGAATGCACACATCTTCGTAGCTGGATGAAGGCACCGCCGATGTAG >Seita.7G049000 ATGCACAAAGTGTTTGTATACATTGCAAGATGCCACAAGCAACCTCCTGGTAATGCGCTATGCGGATATTACGTGTGCGAGTTCCTCAAAAATAATGGGAGGTATCGGACGAACCCTGAAGATATGCTTAGGATCGACACTCACGATGCGGCACTCGAAGACAAACACATCGACAACATTTGTAGGGACATGTCGAGGTTCATCCAACGCGAGATTTGTCATGAGGATGGAGCATTCTTTGATAAAGATGGCGTGTTGATGGCACACGAATGCAAAGATCTTCGTAGATAG >Seita.6G000600 ATGCGGCACCCTGAGACGAACCCCGAAGACATGTCTAAGATCAACACTCGCAATGCAGTGCTTAAAGATAGAGGCATCGTCAACATTTGTAGGGACATGGCGAGGTTCATTCAATGGGAGATTTGTCATGAGGACGGAGAATTCTTTGATCCAATGGCGTGTTGGCGGCGGACGAATGCACACGCCTTCGTTGATGGACGAAGGCACCGCCGATTTTTTAATAATACGAATTATTTATTATTTAAGTCAACGTGGTTGGAGATACATATTTAA >Seita.6G147900 ATGCATCAAGATCTAAGTAATTCTATGCCCACCAGCCCCTCTGAGCAACCGAGTAGCTGTGCTTCTGTGGGTCTCCCAGAAATGGACTCGGCCCATTATCCTGTGGATGATCTCATGGTTCAACAACCATGTCAACTACATGTCCAATTTTGTAACATCTCCTTCAAGGTGGCTTTAGGCATGGCTTATCCTGTCGAGCAAGGGCCGGTCTTCCATGGCAGCAAGGTACTTCCAGGCTACTCCAGGGTCAAGTTGGATGAGGTATGTGCAGGACTTGATGACCTTGACCTGGTCTATCCCGGACATGAAGAGGTAGCGAAACTTGGGGAGGCCGTCCATAAGGTCATTCTGTGGTCTAAACGCTACATAATCTTTGGCACAAATTGTAATAACAAGTTATCCTCTCTGACGAAAGACCTTCCTCACTTGGAGCCGGTTAGAAGCAGAAGTCCAACTCCACCACAAGCCCACATAAAGAAAATTTGCAGAGCCCAAGGTCTAAAGAACTTGTCGATGAGGCACATCATGACGCTCAGTGTGACGAAGATGATGCTTCATCAGATAATGAAGATCATGAGGATGGGAACTTGCTTGTCCATAGGCGCACTGCAGCCCCATCAGTGTGTGCAATAA >Seita.6G067900 TGCCACAAGCAACCTCGCGGCTTTGTGCTATGCGGATATTATGTGTGCGAGTTCCTCAGAAACAATGGGAGGTACCGGATGAACCCCAAAGATATGCCTAGGATCAACACTCGCGATGCGGCGCTCGAAGACAGAGGCATCGTCAACATTTGTAGGGACATGGCGAGGTTCATCCAACGGGAGATTTGTCACGAGGATGGAGAATTCTTTGATCCAAATGGCGTGTTGGCGGCGGACGAATGCACACGTCTTCGTAGATGGACGAAGTCGTCGCCGGACAAATAG >Seita.5G172600 ATGCACAAAGTGTCCATATACATTGCAAGAGTAATGAGGAAAAAGTGCCACAAGCAACCTCCCGGTACTACGCTATGCAGATATTATGTGTGCGAGTTCCTCAGAAACAATGGGAGGTACCGGACGAACCCTGAAGACATGCCTAGGATTGACACTCACGATGCAACGCTCGAAGACAAACATATCGACAACATTTGTAGGGACATGGCGAGGTTCATCCAACGCGAGATTTGTCATGAGGATAGAGCATTCTTTGATAAAGATGGTGTGTTGATGGTGGATGAATGCAAAGATCTTTGTAGATGGGTGTAG >Seita.5G162700 ATAAAAGAAAACTTCACGTTTGAAGGTGTAGATGAAGCAAAAATGTACAAGAAGAACCTGAACAAAAACTACATAAAGAAGGGTCTTACACCAGATTTCACGAAGCACCCGAAGTTAAGATGTAACTGGGATTCATTTAAATATTATCATCATCTTGGGCCAGGAGGTTACAAGAAGGGGATCATCAAATGGAAGAGGATGGAAGATGACATAATTGCTAAGGGAATCGTACCGGCGACTCTCAAATGGCCGGAGCAAGCAAAGCATTGGTATTATGCTCATGGCGGCACGCTCAATCCCAAAAATGGATCATTTGTGTTTGGCCAAGAATTAAGAGAAGCGGCTATGAGGCTTGTTGAGTTAATAAAGTCTACGGCTGAAGGATCTTTCGTGCCTGATCGAGAGAAGGATGAGCTGACTATGGCACTAGGTAATCCAGAACACCCTGGATATTGCCGAGGCAAAGGAGTAATTCCATGGAAGTTTGCCTTTCGTGAGCACATTGATTCCTACAGAAGACACCAAATAAGTAAGGCACGCACGACAGCTGTAAGAATGGAGGAAGCAATTGACCGGCGTGAGCAGCTACATCATCAAGGGGCTAATGTCGATGTAAGCCCCTATCAGCATCGAAGCAGCGTCGCTTCCACAGAAGCCCCAGCTGGAGGACCTTCAGACATGGTTGAGGACAACCAACGCCACCCCATGGACGACATCACTGTGAGGGTCCCTTGTGAGTTTGTTAATCCCGTGAAAAATAAGCTCATCTTGGTGTCTTATGGTGTGACTGAACAACCAACCAAAGGCCAAAGAATACATGGCGTGGAGATTCTAGCTCGCGGTTACGCCAAAGTTAGGGTGGACCGAGTGGTCAACGGTTGGGATGACCTCAAACTGGAGGTACCTGGAAGTGACAAAGAAAAGAATTTAGGAGAAACCATCCATGGTTGGATTCTATGGCCCAAGCGCTACATAAGGATTCCGCAACCGAATCCCTCGACCTTGGGATTATCTCCTCAGGGCTCAAGTGCAAGATTACCTACGCCATCTGCCAGGGCACCCTCTCCACTAGCTAATAGGGATCCTAGCATGAGTCAACACTCTCCACCAGCTGACAGGGATCCTAACATGATTCTGCTTACTGCGGCTACAAAGAAGAAGCCTAAGGAGAAGCAACCAGAGCCCAAGAAACCTTATGATATCACTTATGCGAAACTCGACGCGGTAGTGGATGCTCAGGTTAAAGCTCACTTCGCACCAAAGCCTCCCATAAAGAAAGATACACCACTTGATAGGGTTAAATTTCAGGTTTTCATTAGAAGCATGGAGTTGGAGAAAAAGAAAAAGTCAGAGAAACCACCGCTATCTGACTATGACCGCACAATAACAAAGGCTTTTCAGAAGAAGAAGAAAAGTGGGTCAACTATTCCACAGCTCGGAACCCAATCCAACCAATCGGTTGCCACGCTCCAGAAATTTGAGTTAGGGAAACCGCTTGTGTGGCCACAGTTTTCCAACGAAGATGTACAAATTGCACCAATAGTACATGGAGGCTTCAGCCAACGGTTTAGTCATGGTAGAAGTTTGGATTGGAGATCAACATTATTTCGTGGGGAAGCCATTATAAATGTGCCACTCGAGGAATTCTATTTTCTTTACAATCAAGACGCACTTGATAAATCACTCATCAGTTCCTGGGTTTTTCATTATGCGATGCCTTATCTCCTATTCTATTTTGTATCATGCATGATGGAGATTCAAGCTTGCCGGAGGATAGGATTGTATGACGTCGGCTTCATGGACCCCAATGTTATAAACGAGGCAAATGTAAGAGATAAACCAAATCGAACCTTGAAGAATATATATAATTTCTTGGACAAGCAACATTACAAGAAGTACATACTTCTGCCATACAACTTCAACATGGTCTATATCCTGGACTCTCTGAGGACACCAAGAAATCAATACACCAACCTTATAGACATGCTTAACAGAGCATGGGCACGCTTCCGTCAACATCACTTAGGTGAATTCAAGAAGCAACTTCATATCCACTTTGAATTCTCGGTATGTATTGAATTTACACATCTCGTATCACTTCCTTGA >Seita.4G022200 ATGCTATGTGAATATTACGTGTGCAAGTTCCTCAGAAATAATGGGAGGTACCGGACGAATCCTGAAGACATGTCTACCATCAACAGTAACTATAGCAAGGTCGAAGACAAACAAATCGACAACATTTGTACGGACATGGCGAGATTCATCCTACGCGAGATTTGTCATGAGGATGGAACATTCTTTGATAAAGATGGCGTGTTGATAGAGGATGAGTGCTCAAATCTTCGTAGATGGGCGTAA >Seita.4G210100 CGCCACAAGCAATCTCTTGGCTCTGTGCTATGTGGATATTACGTGTGTGAGTTCATCAGAAATAATGGGAGGTACCGGACGAACCCTGAAGACATGGCTACCATCGACAGTACCTATAGCAAGATCGAAGACAAACAAATCGACAACATTTGTACGGACATGACGAAATTCATCCTACGCGAGATTTTTCATGAGGATGGAGCATTCTTTGATAAAGATGGTGTGTTGATGGCGGACGAGTGCACAAATCTTTATAGATGGACGTAG >Seita.3G216200 ATGATTAGTAATTGGAAGAATGTGCCTACCACTACAAAGGATGCATTGTGGGCCACATTATTCACTTTTATTGAAGATCAAAAGAAATTCGCAATAAACTTTGCTGAGGGCCTCCTTGGGAGATGTTTCAAGAATTGGAGGTCTACTCTTAATAAAGAATATGTACAAAAAGACAAGAATGCTAGGAATGACTTCAGTAGGATCCCTCCAGAAATGTGGGAAGAGTTCATACAACAGAAGAACATGCCAGAAGCAAAAGCCCTGAGCGAAGAAAATACAGTGAAGAACACCCATCACTTGGGCGCGAGAGGGTACGCATCCAAGATCGCTAAATGGAGAAGAGAGGAAGAAGCACAGATGAGAGTTGGTTTACCGGATTTGTTTGAAGGCTTGGATGAGTGCAGCAAGAATTGGGTACTAGCTCGAATTTCGAAAGTAACACCCAACGACAAGGTTAAATTCAAACACCCAACAAAAGATGAAATTTACGCGAGGTTGGAACAGCTCACTGAGGCGCAAAAAAAGGGTCGTTTTAAGCCGAACAGGGAGAAAGATCATCTAACAGCTGCAATCGGAACCGCGCAGCACTCTGGGCGTGTTCGAAGGATATCATCAACATTGATCTGGGGTAAAGCATTCCCCAACAACCAAGCAACCTACAAGAAGCGCAACCGTTATAAGAAAAACCTTGAAGAGAAGATGAGAGAAATCGCCAAGCAGGAGTTGATTGAGTTCTTCGCCAGCCAGCAACTAGCAACAAGGGCTGACCCAACAGCATCCGATGGTCAACGACAGAGTAGTGCTGGCTCCATTGCAAACATGAGGTATCCCGTTGACGACATACAAGTGGATGCACCATGTAGGTTGGTGATACCTTATGGAAGGAAACAAAATAAGTTTCGAGAGGTCACAACCGGCATGGTAGTAACAGGTCATGTGTTCCTAGAGGAACCCCTGCCAGAATACGCCTGGGTGCAAGTTGTTATGGTGTTGGATGAGTCGTGCAAGATTGACATCCCTAATGATGAGGGGATTGAGGTTCTCGATGATGTGATGAACCAGTACATACTGTGCCAAGATGTACCCCTTCTAGATTCAAATGTTGACACGGAGCAGCCGACACTGTCACATGTGTAG >Seita.1G290600 ATGAAAGTTATGAAAATAATATATCATAAATACCAACCTTCCGGCTCTGTGCTATGCGGATATTACGTGTGCGAGTTCATTAGAAATAATGGAAGGTACCGGACGAACCCTGAAGATATGCCTACCATCCACGGTAACTATACCAAGATCGAAGAGAAACAGATCGATAATATTTGTACGGACATGGCGAGGTTCATCCTATGTGAGATTTGTCATGAGGATGGAGCATTTTTTGATAAAGCTGGTGTGTTGATGATGGACAAGTGCACAAATCCGTAG >Seita.1G271300 ATGTGGAAGCTTTTGAAAGAAACATTTATTTTGCATAGATCAGAAGAACTCAGAAAACGCGTAAAGCATTATGCCAGGAAGCAGCTTGGTGAAAGTTTCCGCCGGTGGAGGGGTGAGCTGAATGACAAGTATCTCAAAACGGGCCTACCCCCCTTTAATGAATACGGGAGCATCACACTATCCCAATGGGATGAGTTTGTAAGGCAAAAGACCTCTCCAGAAGCTTTAGCTCTAAGCCAGAGGAATAGAGAATTTGCGCTGAGGAACATACATAAAGTTCACCTTAGGCCGGGTGGGTATCGAGGGAAGATTGACAAGTGGCAGCAGGATAGGGAGGCAGCAATAGCTGCAAGGCAACCCGACCCTTTTGAAGGCTTGGATGAGCATGCAAGGAAGCCTACAATAGTAGATGGTAAACCTACGTTTTTAACATCCAAAACCAATCAGGTGGCAGAAAAGATAAACGATCTTTCCAAGCGTCAGAGGAAAGGAGAGTTCATACCAAATAGGGATAAAGATGTGCTTAGTTCGGCCCTTGGGATGAAAGAGCATGGAGGCCGCGTCAGAGGGGTTTCCTTGAAGTTGACCATCAAGGATGGGTTCGAGAGGGATAGGGCTAGCTACAAGAGCCACTCCCGTTACAAGGACGATCTAAGAGAGGCGACAGAGAAAGCACTAGAATCTAGAGTGCTTGAAATTAATTCAAACTATGATGATCATGAGATAGACATTCCCACTGCGGAAGGTATCCATTGCCTTGGACAAAGCACCAGCAGTACCATACTGTGGCATAAACGAGATATCATATTATCTTCGGTTCCTTCTGAGCACGCACTTGTGGACTCTACACTGCCGGGTCCAGCACCACCAAATGCAGCATCAGAAGAACAATGGGTGGCCACACCACCGGCATCCCCAGCTGCAACATCAGAGCCGGTGGAATGGCCGGAAGACCATCCACCACCTTCTCAAGCATCACCACAACAACAACAGGTGGACCTGCCACAGGAGCCACAACAACAATAG >Seita.1G035600 ATGCACAAAGTGTCCGTATACATTGCAAGATGCCACAAACAACCTCCTGACTCTGTGCTATGCGGATATTACGTGTGCGAGTTCATCAGAAACAATGGGAGGTACCGGACGAACCCTGAAGATATGCCTACCATCGATAGAAACTATAGCAAGATAGAAGACAAACAAATCGACAATATTTGTACGGACATTATGAGGTTCATCCTACGCGAGATTTGTCATGAGGATGGAGCATTCTTTGATAAAGATGGCGGACGAGTGCACAAATCTTTATAG >Seita.1G059000 ATGCTATATGGATATTACGTGTGCGAGTTCCTCGGAAATAATGGGAGGTACCGAACGAACCCCGAACATACGTCTAGAATCGACACTCGCGATGCGGCGCTCGAAGACAAAGGCATCGACAACATTTGTAGGGATATGGCGAAATTCATCCAACGTGAGATTTGTCATGAGGATGGAATATTTTTTGATAAAGATGGCATGTTGATGGCGGACGAATGCAAAGGTCTTTGTGTAGTTTTAATATTAACGTGGCAATGA >Seita.1G159300 ATGGACAATAATGAGAACAATGTTGAATCCTCCAAGGAGGATTCAGATTCTAACGATGATTGTGGATCGTATTCTACTCCACCTGAGTACGAACAAAGCCCACCTAGGTCTCGCAGCCATCCAGATGAAGATGACCCTGAATACGATCCAACCGAAGATCATCAAAACAATGACCAATCCTCAGTGCATTCCCCGCCGTGGTGTCGTAGAACATTTACACTGCATGAAGAGGAGGTAGCTACCTCTACACCACAAACTTCGGCTACTACTGCTTCTAGTAGTAATCCAGAAAGGAAACATGGGCAACAAAGCCGAAACCAGATCCCTGAAAAAGGTAGTCTCGTAATAGAAGAGCTTGGTGCCAAAGGTGAGCCCATATTACCTGAGGGGATATCTACTACGTTTCGGAACATATGTGGAGCTATTGTCAGGGATAAATTGCAGAATTGGATCACGACTAGTAATTGGAAGAAGGTGCCAACCACTACAAAGGATGTATTGTGGGCCACAGTGAAAGGAAGGTTCACTTTTCCTGAAGGTCAAGAGAAATTCACAAGAAACATTGCCGAGGGCCTCCTTGGGAGATGTTTCAGGAATTGGAGGTCTACTTTTAATAAAGAATATGTACAGAAAGGCAAGAATGCTAGGGATGACTTCGTTCAAACAACAGAAGAACATGTGAAGGCTATGAAAGCCACTGAGAACCCTCATCACTTCGGTTCGGGAGGGTACGCTGCTAAGATTGCTAAATGGAGGAGAGAGGAAGAAGAACGGAGGAGAGCCGGATTACTGGATATGTTTGCAGGCTTGGATGAGCGCAGTAGGAATTGGCCCGACAGGGAGAAAGATCAGCTAACAACCATGATCGGAACTGTGGAGCACTCTGGGTATGTTCGAGCGATGTCATCAACATTGCCCTGGGGTAAAGCATTCCCCAACAACCAAGCAAGGTACAGGAAGCGCGACCGTTATAAAAAAAACCTTGAAGAGAAGATGAGAGAAATCACCAAGCAGCAGTTCTTAGATATTCGATGGTCAACGGCAGGTAGAACAAACCATGCTACTTGCCGGACAGGATTCGTTGCTCCGAGTAGTGCTAGCTCCATTGCAAATGTGAGGTATCCCATTGATGACATACAAGTGGATACACCATGCAGGTTGGTTGGTTATACTAGCACAGCAGTAACGGGTCATGTGTTCCCAAAGGCACCCCTGCCAGAATATGCTTGGGTGCAAGTTGTTACGGTGTTGGATGAGTCGTACGAGATAGACATCCCTACTAATGAGGGGATTGAAGTTCTTGGTGATACGATGAACCAATACATACTGTGGCATCGCCGAGATATCATTTTGAATGCATCGCCAGAAACCTCACGGCCGAGCCAAGAACTACCCCTTCCAGATTCAAATGTTGACACAGAGCAGCCGACGCTATCCCATGTGTAG >Seita.1G032200 ATGGCCCAGGAAGGTGAGGTAGCTGCCTCTACACCACAGCCTTCAGCTACAACTGCTTCCGGTAGTAATCCGAAAAGGCAACGTGGGAAAAGAACCCAAAACCATATCCCTGAAAAAGGTATTCTCTTCATAGAATTTCTTGGCTCCAAAGGTGAGCCCATATTACCTGAGGTGATAGCTGCTAGGTTTCGGAACATATGTGGAGCTATTGTCAGGGATAAAATGGAGACTTGGACACAACTAGATGTATTATGGGCCATATTGAAAGAAAAGTTCACTTTTCCTGAAGGCCAAGAGGAATCCGCAAGAAAATTTGCTGAGGGCCTCCTTGGGAGATGTTTCATGAATTGCAGGTCTACTCTTAATACAAAATATGTAAAGAAAGGCAAGAATGCTAGGGACGACATCGACCGCCATCACTTGGGTGCGGGAGGGTACGCAGCCAAGATTGCTAAGTGGAGGAGAGAGGAAGAAGAACGGAGGATAGCTGGTTTATCGGATTTGTTTGAAGGCTTGGATGAGCACAGTAGGAATTGGGTACTAGCTCGAATTCCGACATTCACACCTGACGGCAAGGTTACATTCAAACGCCCGAATACAGATAAAATTTACCATCTCCAGAACGACCAAGCAAGCTACAGGAAGCGGGACCGTTATAAGAAAGACCTTAAGGAGAAGATGAGAGAAATCGCCAAGCAGGAGTTCTTGACCAGCCAGCAACTACAAACGATGACCAACCCGATAGTATCTGATGCTCAACGACAGGCAGAACCAACCCTGCAGCTTGCCCACACAGGATTCGTTGCTCCAAGTAGTGCTGGCTCCATTGCAAACGTGAGGTATCCCGTTGATGACATACAAGTGGATACACCATGCAGGTTGGTTACAACCGGCATGGAAGTAACGGATCATGTGTTCCCAAAGGAACTCCTGCCAGAATACGCATGGGTGCAAGTTGTTACGGTGTTGGATGAGTCGTGCGAGCTTGACATCCCTATTGATGAGGGGATTGATGTTCTCGGTGATGCGATGATCCAGTACATATTGTGGCATCGCCGAGATATCATTCTGAATAATGCATCGCTAAAAACCTCATGA >Seita.1G159900 ATGCACAAAGTGTCCATATACATTGCAAGATGCCACAGGCAACCTCCCGGCTCTATGCTATGTGGATATTATGTATGCGAGTTTCTCAGAAATAATGGGAGGTACCGGACAAACTCCGAAGACATGCCTAGGATCGAACCTCATGATGCGGCGCTCGAAGATAAAGGCATCGACAACATTTGTAGGGACATGGCGAGGTTCATCCAACGTGAGATTTGCCATGAAGATGGAGCATTCTTTGATAAAAATGGCATGTTGATCAGACGAATGCAAAGGTCTTCGTAG >Sobic.004G216500 ATGGAGAAGCAACTGAACACTCAAGGTGGGGAAGAACAACCTTCACCCCCATTCGACAAATTTATTACACCGAGCCCTAGTGCAAGTGAGGGTTGGGAAACTGAGTATGAGAGTGGTGAGGAGGAACTTACCTCGAGATTGAAGAAGAAACCTCATGGAGAGGGAGCATATTTCAATCCTAAGGATGATGAAGAACACCAAAGTAACGAGATCCCACTAAGACCCTCTCTATTGGAATTCAACGAGGAAGAGGGAACCTCTGCACCTAAGCTGATGCCTACAACGTCCTCAGAAAATTCTAAGAGGAAACGAGGCCAGCACGGCAGGCACCAGCTACCTACCAAGGTGTTTGCAATACATGAGGTCGGCAAAAAAGGGGAGCCCCTCGAGCCAGTCTCGGTGATTTCCAAGTTTAGTAATGCTTGCGGAGTGTTGGTCAGGGAAAGGGTGGACTTCAACATAGACGATTGGAAGAAGGTTGATGTTTTACTTAAGAATTCACTATGGGAAGAGATTAAGAGGAGATTCACATACCCACTGGGCACCAATGAAGAGCTCAACAAGAGCTATGCACTGAGTACCTGTGCAAAATCCCTGCGCCAGTTCAGGTGGAAGCTTAACCAGAAGTACGTTAAGAAGGGGGAGATGCCTTTTAAAGAATACGGGTTTATCACACAGGAAAGGTGGGACCAATTTGTCCGATATCACACAAGTGAAGATGCTATGGACAAGAGTGAGAAGTTCTGCTTGCTAGCAAAGAGGAATCTCTACCCCCACCACCTCGGCAGTACAGGGTATGTGGTGAAGAAAAAGAAATGGCGGAGGGAAGAAAGGGAGGCAGCTGTGGCCGGCAAGCCTATAGAGTATGAGGGACTGAACGAGAGGACAAGGGACTTCCTCAAAGCCCGTAGGCCAAAGCAACTCGCGCAGGGGAAGAGTAAATTCAATGAGCCACAGACTGAGGAAGCGGAGAAAAAGATTCTAGCATTTGTTGCGGCTGAGCAAGCTGGAACATTTACTCCACATAGGGAAAAGGATCAACTGTCGGCTGCGTTGGGCAATCCCGAGCATCGTGGTCGCGTCCGAGGCATGTCCTCAAGAATGAGCTGGAAAGATGCCTGGGCCATCAACGCGGGCTCTTGTAGGACGCAACAGGGTTACAAGGAAAAGTTGATCCAAGAAACCAGTGAGGAAACAATGAGGGAAATTGTGATGGAAGAGATCCGTAACGTTCTGACGAGTGGTGACCCTAAGATGGTGCAACTGAGGTCACAGTTTTTGGGCAAGGCTAGCTCGATGGAACTAATGCAACAAACACAACCGGACCAAGGCCTGTCAGTTCCTAGCAACTCGGCATCGACTGTGAACCAACCAGCTGATGATATTATCTCATGTACGCCGTGCTCATTGCATATCCCGGTCGGCAGGAAGAAGCGGATGATGGAGGTGGCCACAGGCATGGCAATCCCAGGCCGCACATTTCAGTGCCAACCCATCCCGATCGACTACGCCAAGGTCTTGGTGGTTGATGTCCATCCTAATCACCAGAGGCTTGAGATCGACTTGCCCACCAAGGAAGGCATCCGGTACTTGGGAGATGCAAAAAACAACTTAATACTTTGGAATAGGTTCGACATCGGCCTTGCTACTGCATCACCGCCACTGCCTCCAGTGCAGCTGGAGAGCGACAACGATCCTTCCCCAGGTCAGGCGTCGGCATCTGGAAACGTGACAGACGAGGGAGAAGCAGCAACCCCGTCATGA >Sobic.004G094900 ATGGAGGATGCCGAGAAGATCTACACCGACAGAAAAGAAATTCCCAAGGCAAAAGTCGCATACGAGTATAAAATAGGCAAAGATCTAATGGCCACAAAAAGGGAGATTAAGGAGTTGTCGCCTGCTATGCGTAAGCTGCATGATTATTACTTGGTTGATACTGTAAAAGCGGGTTGCTGCTCTTTTGGTGTTTGTATCCCCAAGCATTACATTTTTGAGAAAGAAGAAGAAGAGATCCACTGGGTTGAATATGCGGCCTTGTTTCAGCTCTTCCACAGGCGTGATCTCGATCTTCAAATAATGATGATGTGGACTATGTTAGAGGCAAAATATTGCTTAAAGAAAGGCCTGGATCATATAGCCTTCTTGGACCCGGTGCGAGTAAACCAGAATACATGCAAAGGCATCCACAGTGATGTGAAAGATTTGGTTGATGAGTTGACCAAAATCTTCTATCGAATCAAACATACTCCTAGCCTACAACTGCATGAACCATTACGTCCTCATAGATATCAAACTTGCAGAATCACGTGTCAAGGTGTGGGACTCAAAGAGAGGGAAACTTTCTTAGTTGAACGACCTACTCAAAGTGCTAAACGATGTCAAGGAAAATATGGATGGGGACAGGACGATCCAATTTGA >Sobic.003G311150 ATGAAGTTTACTGAGAACCCATTTCTTCACAGGGGGAAAAAGTGTCACAAGCAATCACCGGGATCGATGCACTGTGGGTACTATGTATGCGAGTTTCTTAGACACGACGGTCGGTACACTGGCAAGAAAGTATACAAGTGTAATGATTCAATGGGTAATCATCTTTCGTTAGAAGAGCTCATAAAAATTTGCGATGAAATGTGTAGGTTCATCATGAAAGAAGTGCTTCACAAGGATGGAAAGTATTTTGATACCCATGATAACTTAGCGAATCCAGAGTACCAAGATCTCATAGAACATGAGGATTCGTAG >Sobic.007G218450 ATGCATTGTGGGTATTATGTGTGTGAGTTTCGCAGACACAATGGTCTATACACAAACAACCCTAAGAAAGTATACAAGTGTGCTGATGCAATGGATAACCACCTTTTGGATGAAGAGCTCATGAACATTTGTGATGAATTTTGTTGTTTCATCCTGAAAGAAATACTTGACAAAGATTGGAAGTATTTTGATCACTATGGTGAGTTAGCAAAACCAGAGTACCAAGATCTCGTAGATATTAACATGCTACAGCTGAACAATGAGTATTATTAG >Sobic.009G058200 ATGCACTGTGGGTACTATGTATGCGAGTTTCTTAGACACGACGGTTGGTACACTGGCAAGAAAGTATACAAGTGTAATGATTCAATGGGTAATCATCTTTCGTTAGAAGAGCTCATAAAAATTTGCGATGAAATGTGTAGCTTCATCATGAAAGAAGTCCTTCACAAGGATGGAAAGTATTTTGATACCCATGATAAGTTAGCGAATCGAGAGTACCAAGATCTCATAGAATATGAGGATTCGTAG >TAE04756G001 ATGGAGGAGGTGCAAAGGAAGCTCGACTATGAACGCCTTCAAGGCCTAGAAGCAAGTCAAGCGGAATTGGCAGCTAAATTCCAGCGGCAGCAGGAGCAGATCGACTCACTTAGCCAGCAAAGGGGGTCTCAGCAGCTGCAGCAGCTAGCGGATGATCCAGCATTGAATACCACCGCCCCATCCATGCTGAGAAGCAGCGTGGGTTCCGCACCGGGCGACGTAGTAGTGCTGGATAGATACCCCGTGGATGACATCACGGAGAACACTAACTGCGAGCTACACTTCAAAATGAAGAACATATCCATGAAGGTGGCGGACGCCGTTGCTTTTTCAAATTCCCCTGAGGCAACCTTCCATTGCAACCCGATTCCAGCGGGCTATGCTCGTGTCTTGGTTGATGAGGTGGTGGACCAATATTCGGGGCTAGAGCTTGACATTCCTGGAGGTGATGAGGAGCACACACTCGGAGATGCCAAACATCGTACCATCCTATGGAGAAAGGATTGCATCATTTTTCGAAGGCCACCGACACCGCGTCACCCGACTCCTCGTCGAAGTCCGCCACCGAGTCAGCAGACTCCCACTCCTCCAAGTCCACCAACGCGTGAGGCCACTCCTCCTCCTCCAAGTCCGGCAAAGTGTCAAGCCACTCCTCCTCCAAGTCCGACACAGCGTCAGATATCCACTCCTCCTCCAAGTCCGGCACAACCTCAGGCCACTCCTCCTCCAAGTCCGGCACAGCTTCAGGCCACTCCTCCTCGTCCCACTCAGCCCCGTCAGCCGTCTCCGCCGCCTCAGCAATCGCAGAAGAGACACCCCACAGCTATGGTGCGTAGCGGTACCAGTCGAGGTCATAGTACAGGAAGTACAGGCGGAGACAAGCGATATAAATATGGTCCAAACCTCACTACTCCTCTTCCTGTGAGGGCTTACGACAGGACCGAGGAGCAAACCAATGCCATAGTGCAGGCAGAAGTCGACGCCCATTTTGGACCGAAACCGCCACTACTACCAAGGGAGAAAGTGCCTGTGGAAGTAGTTGACCACTTCATTCGTATGGCTCAACCACCAGCTCCTAAGCCTGTTGACACAGACTATGAGCGCCACATCAGGAAGTTACATCGACAACGTCTACAAAAGGAGGCGAGCTCGAGCTCGAGCAAACAACAAGCAGCTGTCGAAAAATGCGGGAAAACCGTTGCCCAGCTAGGAGAACAGGTGGCGCAATCGACCCCCCCCCCCCCCCGCTTGTTGTGCCGCCAACAACACGTGATAGTACGCGCGCCCAATATTATTGTGGCCAAACAGTTTACGTTCCTGAGGTGGGCGATGTGGTAA >TAE05236G002 ATGCAGGCTGAAATGCTCAAGATCACTGTTGGACAACTCCTCGATATCGAGCCCATGTCTCCGCTTAGAGAGGAGGAAATAAAACAGAAATATGTCCAGGGCCAACCTTTGGTCGAGACCGAGGAGGTCAAGAACCTCCCAACGAGAATGTATGAATTGCATGATTGGTACATGAAAATTACCAAGATTTCCAACCGAGAATCCCTCATGGTGCAAGTCGAGGAAGATCATTACTTCAATAAGAAAGCTCTGTCCGTTGAGTATTCAGAACTATTTCGGTTATTCAATCAAGATGCACTCGACAAATCTATCACAAGATGTAGAGAAATGCATGCTAGAGTTCTTGAAGCGCCTCAATANTTGAAGCGCCTCAATAGCAATGAAGATATACTACTTCCTTACAACTTCGACTTCCACTGGATCTTGTTAGACATTAAAGTTGACGAAGAAAAAGTTGAAGTACTGGACTCACTACTTAAAAAAGATAGTGACTACAACATCGTGAAGGGGATAGTCGACAGGGCTTGGGCAAAGTACATCAAGGTGACTACAGGAAAATGGCGACAAAAGCTATGTTGGTATCGACCCAAGGACCTGAAGCAGGCGCCGAGGACTGAAGTGTGTGCATACTACGTTTGCGAGAACATTCGCATGATGGCGTCCGAAAGGAGCAGATCTGATAGACAGGACTGGTTCAAAGAGGTGCGGGACCAGCTCCTACCAACAGAGCGCATACGAGCACTTCAAGAGGAAATAGCGGGATTTTTGCTCGACCAGGTCATAGATCCCAAAGGAGAATACTATTACCCGCTACCGCCCCATGAACCACTTGTCATCGTGCTCCGAAGGCACCAGGGCAACATGTAG >TAE22516G001 ATGGCTCAACCACCAGCTCCCGAGCCTGTTGACACAGACTATGAGCGCCACATCAGGAAGTTAAATCGAGCACGTGTACGTAAGGAGGCGAGCTCGGGATCGAGCAAACAAGAAGCAGCTGTTAAAAAATGCGGGAAAACCATTCCCCAGCTGGGAGAACAGGCGCCGCAATCGATCCCCTCGCTTGTTGTGCCAACAACACGTGACAGTACGCGCGCCCAATATTATTGTGGGCAAACAATTTACGTTCCTGAGATGGGCAATGTGGTAATAACGGAGGAGCATATAATGCAGGCTGAAGTTCTCAAAATCACTGTTGGACAACTCCTCGAGATCGAGCCCATGCCTGTGCTTAGAGAGGATGAAATAAAACGAAAATATGTTCGGGGCCAACCTTTGGTCGAGCCAGACAAGGTCAAGAACCTCCCAACGAGAATGTATGAATTGCATCAATGGTACATGGACATTACTAAGATTTCCGATCGATTGTCCCTCATGGTGAATGTCAAGGAGGATCATTACTACCATGAGAAAGCTGTGTCCGTTGAATATTCTGAACTGTTTCAGTTATACAATCAAGACGCACTCGATAAATCTATCGTCAGTTGCTATTGTCTGATGAAGATGTATGAAATGAGAAAAGGTGGACGCTATGGCATTGGGTTCATTGACCCAAACACTGTTAATGAATACACATGGAAAATAGATGAACGTCATCAAAAGGCCGTAGAGGACAGCATGCTAGAGTTCTTGAAGCGCCTCAAATACAATGAAGATATACTACTTCCTTACAACTTCCAGTGA >TAE31182G002 ATGGAGGAGGAGCAGAGGAAGCGGTACTATGAGCGCCTTCAAGGCCTAGAAGCAAGTCAAGCGGAATTGGCAGTCAAATTCCAGCGGCAGCAGGAGCAGATCGACTCACTTACCCAGCAAAGGGAGTCTCAGCAGCTGCAGCAGCTAGAGAATGATCCAGCATTGAATAGCACCACCCCATCCATGCCGAGAAGCAGCATGGGTTCCGCCTCGGACGATGCAATGCTGGATAGATACCCCGTGGATGACATCACGGAGAACACTAACTGCGAGCTACACGTCAAAATGAAGAACATACCCATTAAGGTGGCGGACGCCGTTGCTTTTACAAATCCCCCCGAGGCAACCTTCCATTGCAACCCGATTCTAGCGGGCTATGCTCGTGTCTTGGTTGATGAGGTGGTGGACCCATATTCGAAGCTACAGCTTGACTATCCTGGAGCCGACTCCTCGTCGAAGTCCGCCACCAAGTCAGCAGACTCCCGCTCCTGCAAGTCCACCAAGTCCGGCAAAGTGTCAGTCCACTCCTCCTCCAAGTCCGGCAAAGTGTCAGGCCACTCCTCCTCCTCCAAGTCCGCCACAGCGTCAGACGTCCACTCCTCCTCCAAGTCCGGCACAACCTCAGGCCACTCCTCCTCCAAGTCCAGCACAGCTTCAGGCCACTCCTCCTCGTCCAACTCAGCCCCGTCAGTCGCCTCCGCCGCCTCAGCAATCACAGAAGAGACACCCCGCAGCTATGGTGCGTAG >TAE32314G002 ATGGCTAGACCACCATCTCCCAACCCTGTTGACTCGGACTATGAGCGCCAATTCAGGAAGGCACATCGAGCACGACTACAGAAAGAAGCGAGCTCGAGCTCGAGCCAACAAGCAGCTGTCAAAAAATGCGGGAAAACCGTTCCCCAGCTGGGAGAACAGGCGGCACAATCGATCCCCCCGCTTGTTGTGCCAACAACACATGAGAGAACGCGTGTCCAATATTATTGTGGGCAAACCGTTTACGTTCTCGAGCTGGGCGATGTGGTAATAACCGAGGAGCATATAATGCAGGCTGAAATGCTCAAGATCACTGTTGGACAACTCCTCGATATCGAGCCCATGTCTCCGCTTAGAGAGGAGGAAATAAAACGGAAGTATGTCCGGGGCCAACCTTTGATCGAGCCCGAGGAGGTCAAGAACCTCCCAACGAGAATGTATGAATTGCATGATTGGTACATGAAAATTACCAAGATTTCCAATCGAGAGTCCCTCATGCTGCAAGTCGAGGAAGATCATTACTTCAATAAGAAAGCTCTGTCCGTTGAGTATTCAGAACTATTTCAGTTATTCAATCAAGATGCACTCAACAAATCTATCGTCAGTTGCTATTGTCTGATGAAGATGTATGAAATGAAAAAAGCTGGACGCTATGGCATTGGGTTCATTGACCCAAATACCGTTAATGAATACACATGGAAATTGGAATGGTGTCAACAAGATGTAGAGAAAAACATGCTAGAGTTCTTGAAGCGTCTCAATAGCAATGAAGATATACTACTTCCTTACAACTTCGAGTTCCACTGGATCTTGTTAGACATTAAAGTTGACGAAGGAAAAGTTGAAGTACTGGACTCACTACTTAAAAAAGATAATGACTACAGCATCGTGAAGGGGATAGTCGACAGGGCTTGGGCAAAGTACATCAAGGTGACTCCAGAAAAATGGCGACAAAAGCTATGTTGGTATCGACCCAAAGCTCCGAAGCAGGCGCCGGGGACTGAAGTGTGTGCATACTACATTTGCGAGAACATTCGCATGATGGCGTCCGAAAGGAGCATATCTGATAGACAGGACTGGTTCAAAGAGGTGCGGGACCAGCTCCTACCGACAGAGCGCATACGAGCACTTCAAGAGGAAATAGCGGGATTTTTGCTCGACCAGGTCATAGATCCCAAAGGAGAATACTATTACCCGCTACCGCCCCATGAACCACTTGTCATCGTGCTCCGAAGGCACCAAGGCAACATGTAG >TAE32917G001 ATGCAGAAGCTCAATGCAAAACTACTAAAGCTAGAGGAACTTGAGAGCCAGCGAGCTGCCGACCAACCATCTCAACGGCACGAAGCTACCCCAGAAGCTACCCCGCCATCTCAGTGGAGAAGCAGCGTGGCTTCCACGGAGCTCCTTCAGCCCGACTTCACGGCTCCTAGCTACCCCATGGATACTATCACGGATGCTCAACATTGCCAGCTTATGACGAAATGGCAGAACCTCACTTTGAAGGCGGTTGTCGGCTCTATTGCACCTCCTCAACCTGACGGAACTTTTCACTGCCGTCCAATTCCACATGGCTATGTTTTTATGACAGTGGATGAAGTAATGGAGGGATTTGAGGAGCTCGAGCTTGACCACCCTACAGGTGAAGGGGAGAATCAGCTGGTTTATGCTCTGAGGAGTACATGTCTATGGCGGAAGGAGTACATCAAGCTTCCAAACTGGACGCCTCCGCCTCCTCCTCCTCCTCCTCCGGCGAGTCAGGGCACTCCGCCTCCTCCGATGAGTGATCAGGGCACTCCGCCTCCTTCTCCGGCTGGTCCAGCGTGTGAGGGCACTCCGCTCCTCCTTCGCCTCCTCCGGCGCATCGGTGCAGTCCGCCTCCTCCTCCGCCTCGTCAGCAACGGTGGAAGACAGACGTCGCCGCTTCGGCTCCTCCACTACGTTAGAGCACTCCGCCTCCTTCTCCGCCTCATCAGCAACGACGGAAGAGAGACGCCACCGCACCGGCGGCTAGCAGTACAAGGAGAGGCGGGAGGAAATTCAGATACGGTCCATCTCTCAAGCCTTTGGAAAAGTTACCATATGAGAGGACCGAGAAGGAAAACGAGGAGATCTCTGTTGCCCAAGTGA >TAE38590G008 ATGGCTGCAATGCTCCAGAAGGTTTGGAAAAAGTTCACTGGAATGGTTCCGGGTCTGCAGAAGGAGCTGCGATTTACACACCCCAAATGCTTGTGGCAGGAATGCGGGAATAATTTATGTGGATACTATGTTTGCGAGTTCATCCGCCACTCGACCTCTGAGCGGGGCTACTCTGAGAAACAATATGAAATGTGGGAGATGCGGGATGAACTCCTACTACATGATCGCATACGAGCAATTCAAGAGGAATTGGCGGGATTCTTTATTGACCACGTCATACATAAAGACGGAGAATGCCATGTGGAAATTGAAGCTGATTTTCGGTAG >TAE53269G001 ATGGCAGACCTATTCAGGAGGTGGAAGAATGAGATGAAAACGTTTGTCGACAAAGAAGAGACACCAGAATTCATCGGCAAATATGAGAATATCAGAGATCACTGGCCTGCATTTGTGGCCCACAAGACATTGGAAAAGAGTAAGAAGTTGTCAGCGACAAACAAGAAAAATGCTGCGAAGAAGAAGCTTCACCATCGCACGGGGTCAGGTGGCTACCTCAAAGCCCGGCCTAAGTGGGCCAAGGCTGAGAATGATCTGCTTGATAAAGGGATCGAACCAGAGACAATGAACTGGCCAGACCGTTGCCGGACTTGGTTCTTCGGGTCTGGCGGAACCTTGGACCCTGTACCAGGGAAGTGCATTTGGACGGACGAGCAAATGAGAATACCAGTCAAGAGGCTTCAGCACTATATCGATGCAGCGCAGCAAGGGACGTTCGTTCCAGACAGAGAGAACGACGAGCTCAGAATGGCCCTCGGGAATCCTGAGCACCCTGGACGGACACGAGGCACGCCAGGCTCCGTTCCGTGGAAGGCTGGTTTTCCGGACGAAGGCGGTTACAAATGCCAGGAGAGGAGGAAAAAAGTGGAGCAGACCCAAATTCAGAAGCTGCACGAAAGGGTTCAAGCGCTAGAGGAACGAGACGTAGCTCGCAGCAAGCGACCTGCTGAAACTACCCCCGAAGCTACCCCGCCATCTCGGCGGAGAAGCAGCGTGGCTTCCATCGAGCTGCTTCAGCCGGAGCATGTCTTGACGGCTCCTGCTAGCTACCCCGTGGATGCTATCACGGAGTCTCAACATTGCCACATTATGACGCAATGGCAGAACTTCAAAGTCAAGGCGGCTGTCGGCTCTGTTCGACCTCCTGAACCCGGCGCAACTTTTCGCTGTCGTCCGATTCCAGAAGGATATGCTAGGGTGACGATGGACGAAATAACGGAGGGATTTGAGGACCTCCCGCTTGACCACCCTACCGGTGAAGGGGCGACTCGGCTGGGTTCTGCTCTGAAAACTCCATGCCTATGGCGGAAGGAGCTCATCAACCTTCCGAACTGGACGCCTCCGCCTCCTCCTCCTCCTCCAGCGAGTAAGGGCACTCCGCCTCCTCCTCTGCCTCCTCCTCCGGCGCGTGATCAGGGCACTCAGCCTCCTTCTCCGGCGCCTGGTGGCACTCCACCTCCTCCTCCGGCGAGTGATCAGGGCACTCAGCCTCCTTCTCCGGCGCGTGGCGGCACTCCGCCTCCTTCTTCGCCTACGCCGGCGCGCCCGAGCAGCCAGCCTCCTCCTTCTCCGCCTCGTCAGCAAGGGCGGAAGAGACCCGCCGCCGCTCCGGCTGCTCCGGCGCGTCGTAGTCCTTCTCTTCCGCCTCGTAAGCAAGGAAAGAAGACAGCCACAGCCGCTCCGTCTGCTCTGCTGGCGTCTAGCAGTACAGACAGAGGCGGGAGGCAATACAGATTCGGTCCTTCTCTGAAGACTCCAGAGAAGTTACCATACGAGAGGGCCGAGGAGGAAACCACGAAGATCGTGCGAGCCGAAGTGACGAACTTCTTTGAAGGGGTGAAAGCAAAGAAACATCCACCTCCGGAGGAGAAGGTAGATCTGGTGAAAGCGAAGCGCACTCTGGCTGCCCTGACAAAACCACCAAAGTCTCCGCCGAAAGGCAACTATGAGCGCATTATTGCAAAGAAATTTGTCGAAGTGGAGCGGTCGGGAAGTACTGTCAGTGATCAAAGGTTAAAAGAACGACAAGCTGGGAAAAAAATTGCCCAGCTCGGCGAACAAGCGAACCAATCGTGCCCCCCGCTCAAGGTGTCTAGCGACATCGTCGCTAATGATCCGAGGATGGTGCCCGGTTATAGAAATCTTGGAGATTACCTGCCCGACGATGTACATTATGATTTCTTGGAGGTGGATGAACACAAATACCATTACGGGAAGTCTCTCGTCAAAGATGAAAGATCTCTAACAACGATGATGCGAAGATTACATGATTGGTACATAGAAACCTGCAGAGAGTCCGGGGGGAGGAATACTTTGACGCTGAGAGTTAAAGAGGAGCATGACCTCGTTGGAGTTGAAATGTTGAATGTTCCATTTGAGGAGTTCTTCCAGTTTTTCAATCAAAAGGCCCTCGATAAATCAACGATCACTTGCTACTATCTATTGAAGATCGCCGAATTGAAGGAAAGACAAATCGGTGATATTGGATTCATTAACACAAATCTCATAGATGCAACTGAGGTTAAATATCATGCCAAAAATACCGAGGCCAACTTGCTACGATCGTTGGTAATAAATGAAAACAAAGATATAATACTCTTTCCTTACAACTTCAACTTCCACTATATTCTCCTAGAGATTAAGCTTGAGCAGGGACTAGTAACCGTCTTAGACTCGAGACGAAAAGATCCCCAGGACTATGCGGACATGACTCAAATGCTCGAGAAGTAA >TAE55383G001 ATGGAAGGTTGGTTTCCGGACGCAGGGGGATACAAAACCCATGAGAGGAGGAAGAAACTGGAGCAGGGCCAACTGCAGGCGCTGCACGAAAGGGTAATGGGGCTAGAGGAACGAGAAAAGGAACAAGAAGCAGCAGATCGCAGCAAACGACCTGCCGAAACTTCCCCCGAAGCTACCCCGCCATCTCAGCGGAGAAGCAGCGTGGCTTCCACCGAGCTGCTTCAGCCGGAGCATGTCTTGACGGCTCCTGCCAGCTATCCCCTGGATGCTATCACGAAATCTCAACATTGCCACATTATGGCGCGATGGATGAATTTGAAGGTCAAGGCGGCTGTTGGCTCTGTTTATCCTACTGGATCCGGAGCAACTTATCACTGTCGGCCGATTCTAGAAGGATATGCTAAGGTGATGATGGATGAAATAACGGAGGGATTTGAGGACCTCGTGCTTGACCACCCTACAGGTGAAGGGGAGACTAGGCTGGGTTCTGCTCTGAAGACTCCATGCCTATGGTGGAAGGAGCTCATCAACCTTCCGAACTGGACACCTCCACCTCCTCCTCCTCCTCCGGCGAGTCAGGGCACTCCGCCTCCTCCACCGCCTCCTCCTCCGGCTAGTGACGATCAGGGCACGCGTGGCGGCACTCTGCCTCCTTCTCCGGCGCGTGGCGGCACTCCGCCTCCTTCTCCGCCTGCACCGGGGCTCCCGAGCAGCCAGCAGCCTCCTCCTTCTCCGCCTCGCCAGCAAGGGCGGAAGAGACCCGCCGCCATCCCGGCTGCTCCAGCGCATCGTACTCCTTCTCCTCCGCCTCGTAAGCAAGCACGAAAGAAGACAGATGCCGCAGCCGCTTCGTCTGCTCCGGCGTCTTGCAGCACAACCAGAGGCGGGAGGCAATACAGATACGGTCCACCTCTCAAGCCTCTAGAGAAGTTACCGTACGAGAGGACCGAGGAGGAAAACGATACGATTGTGCGGACCCACGTGAAGGAGTTCTTTGAAGGGGTGAAAGCAAAGAGACATCCACCTCCGGAGGAGAACGTAGATTCGGTGAAAGCAAAGCGCACTATCGATGCCCTGAGGAAACCACCAAAGTCTCCGCCGAGAACCAACTATCAGCGCATTACTGAACAGACATTTCTCGAAGCCCAGCGCTCGGGAAGTACTGTCAGTGATAAAAGGTTAAAAGAACGAGCAAAGGGGGAAAAAATTGCCCAGCTCGGCGAACAAGCACAACAATCGTGCCCCCCACTCAATGTGTCTAATGCTCCGGGGACGGTGGCCGGTTATGACAATCTTGCAGATTACCTGCCTGACGATCAACTTCCTGATTTCTTGGAGGTGGACGGACACAGATACGAGTACGGGAAGCCTCTCGTCAAAGATGAAAAATTTCTGACAACAATGATGCGAAGATTCCATAATTGGTACATGGAAACCTGCAGAGAGTCTGGGGGTACGAATGCTTTGTATCTGAATATTAAAGAGGAGCACGACCTCGTTGCAACTGATCTGTTGATTGTTCCATTTGATGAGTTCTTCGCGTTCTTCAATCAAAAGGCCATCGATAAACTAATGGTCTTTTGCTACTGTCTGTAA >TAE56074G002 ATGGAGGAGGAGAAGAAGAGGAAGCTGGAGGAGGAGCAGAGGAAGCAGGACGCGGAACACCTTCAAGGCCTAGAAGCAAGGCACGTGGACTTGGCATTCAAATTCCAGCAGCAGCAGCAGATCGACTCACTTAGCCAGGAAAGGGGGTCTCAGCAGCGGCAGCAGCAAGCGGATGATCATCCAGCATTGGATAGCATCGTCCCATCCATGCCGAGAAGCAGCGTTGGTTCCGCCCCGGGCGACGCACTGCTGGATACATACCCTGTGGATGACATCATAGAGAACACTAACTGTGAGCTACACTACAAAATGAAGAACATATCCATGAAGGTGGCGAACGTCGTTGCTTTTACAATTACCCCCGAAGCAACCTTCCATTGCGCCCCGATTCCAGAGGGCTATGCTCGTGTCTTGGTTGATGAGGTGGTGGGCCCATATTCCGGGCTAGAGCTTGACATTTCTGGAGGTGACGACGAGCAAACACTGGGAGAGGCCATACATCGTTTCATCCTATGGAAAAAGGATTGCATCATCTTTCGAAGTCCACCGACACCGCGTCTGCCGACTCCTCCTTGA >TAE57900G002 ATGCAGAAAAATGATCTTTGGACTGAGTTGAAGTCAAATTTCACCCTACCGCCAGAGGATAATCCAGAGAACCCAGTTAAAGAGCAATTAATCAAGTCTTTTGCTCTTAAGAGGATGGCAGAACTATTTAGGAGGTGGAAGAAAGAGTTGAATAAGTTTGTCGAAAATAATGAGACACCAGAATTCAAGGGCAGATATGAGAAGATCAGAGATCACTGGCCCTCATTTGTGGCCCACAAGACATCGGAAAAGAGTAAGAATATGTCGGCGACAAACAAGCAAAATGCTGCGAAGAAGAAGCTTCACCATCGCACGGGGTCAGGTGGCTACCTCGTAGCCCGGGCTAAGTGGGCCAAGACTGAGAATGATCTGGTTGATAAAGGGATCGAACCAGAGACAATTAGCTGGACAGACCGTTGCCGGACTTGGTTCTTCGGGGCTGGCGGAACCTTGGACCCTGTAACAGGGAAGTGCATTTGGACGAACGATCAAATGGGCATAACAGTCGGGAAGCTTAAGCAGTATATCGAAGCAGCGCAGCAAGGGAAGTTCTTTCTAGACAGAGAGAACGACAAGATCACAATGGCCCTCGGGAATCCTGAGTATCCTGGACGGACACGAGGCACGCCAGGCTCCATTCCATGGAAGGTTGGGTTTCTGGACGCAGGCGGTTACAAATCCCATGAGAGGAGGAAAAAAGTGCAGCAGACCCAAATGCTGGCGCTGCAAGCAAGGGTAGACGCGATAGAGCAACGAGAAGCAAATCGCAGCAAACGTACTGCCGAAGCTTCCCCCGAAGCTACCCCGCCATCTCAGCGCAGAAGCAGCGTGGCTTCCACCGAGCTGCTTCAGCCGGAGCATGCCTTGACGGCTCCTGCCAGCTATCCCTTGGATGCTATCACGGAGTCTCAAAATTGCCACCTTATGACGCAATGGATGAATTTGAAGGTCAAGGCGGCTGTTGGCTCTGTTTATCCTACTGAACCCGGCGCAACTTTTCACTGCCGGCCGATTCCAGAAGGATATGCTAGGGTGATGGTGGATGAAATAACGGAGGGATTTGAGGACCTCCAGCTTGAGCACCCTACCGGTGAAGGGGAGACTCGGCTGGGGTCTGCTCTGAAGACTCCATGCCTATGGCGGAAGGAGCTCATCAACCTTCCGAACTGGACGCCTCCGCCTCCTCCTCCTCCTCCGGCGAGTCAGGGCACTCCGCCTCCTCCACCGCCTCCTTCTCCGGCGAGTGATGATCAGGGCCCTCGGCCGGCTCCTTCTCCGGCGCGTGGCGGCACTCCGCCTGCGCCGGCGTGCCCGAGCAGCCAGCCTCCTCCTTCTCCGCCTTGTCAGCAAGGGTGGAAGAGACCCGCCGCCGCTCCAGCAGCTGCTCCGGCGCATCGTAGTCCTTCTCCTCCGCCTCGTAAGCAAGTAAAGAAGACAACCGCTTCGTCTGCTCGGCCGGCGTCTAGCAGTACAACCAGAGGCGGGAGGACATACAGATTCGGTCCTTCTCTGAAGAGTCCACAGAAGTTACCATACGAGAGGACCCCGGAGGAGAACACGAAGATTGCGCGAACCGAAGTGGATGACTGGTTTCAGGGGTTGAAAGCAAAGAGACATCCACCTCCGGCGGATAAGGTAGATCCGGTGAAAGTGAAGCGCACTCTGGCTGTCCTGGCAAAACCACCCAAGTCTCCGCCGAAAGGCAACTATGAGCGCATTATTGCAAAGACATGGGCCGAAGCGGAGCGGTCGGGAAGTACAGTCAGTGATCAAAGGCTGAAAGAACGACGAGCATCTGGGAAACAAATTGCCCAGCTCGGCGAACAAGCGAAGCAATCGTGCCCCCCGCTCAAGGTGCCTAGCGACATCGTCGATCCGAGGATGGTGCCCGGTTATGGCAATGTTGACGATTACCTACCCGACAATGTACATTATGATCCCATGGAGGTGCAGATACACAGATACGAGTACGGGAAGCCTCTCGTCAAAGATGAAAAATCTTTAACAACGATGATGCAAAGATTACATGATTGGTACTTAAAAATCTACAGAGAGTCTGGGGGGAGGAGTACTTTGTATGCGAGAGTTAAACCAGAGCATGACCTCGTTGGAATTGAACTGTTGCCTATTCCATTTGAGGAGTTCTATCAGTTTTTCAATCAATTGGCCCTCGATAAAACAACGACCACCTGCTACTGTCTATTGAAGATCGCCGAATTGAAGAAAAGACAAATGGGTGATATTGGGTTCGTTAACACATATCTCATAGATGCAACTAAGGTTGAACATCGTCCTGGAGATACCGAGGCCAACTTGCTACGATCATTCAAAAAAAATGAAAACAAAGATATAATACTCTTTCCTTACAACTTCAATTTTCACTATATTCTCCTAGAGATTAGGCTTGAGCAGGGAGTAGTAACCGTCTTGGACTCTAAACGAAAAGATCCCCAGGAGTATGCGGACATGACTGAAATCCTCAAGAACATAGATGATGTTGCAGAAAATTTTGCAATGGAGATGATGATGCAGAAATGCCGCCCACCATTGCCGATGCATATTGCAACAACACCCCCTTCGTTCGTCGTCATCGCAATTGCAACACAGAGGCGGCCCATGATGATTGGGAACTGCATGGAGGAGGTCGGCGGGGTTGTGCCAAACTCGGGTGCTTCGCTGCGGCCAATGGCCCTGCAGCGGTCGACGGTCGTGGTGAAGGCAGTCGACGAGTTGGCGAACTGCGGCACCTCACTAGTGCATGCGACCTCTCCATGTTATGCATGCGACCTCTCCATGTTCGTGAGTTCCTGA >LOC_Os01g55470 ATGTTGAGCGATAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAAATCCGGTAGCAACAAGCAGCCAGACGCTTCTAGTGAAGAAATGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCTCGCGATGATGATCTGGACTACATACCTATGGAACAGGCTGATGGGAAGCCCGTCGAGCCACCGATAGTGCGGTCCAAGTTTAGCAACGCATGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACGGTGGACGACAACATCAAGACATTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCAAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACAAATATCGCAGGCTGACTGGGATACGTTTGTTGCGGATCATACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAAAAGAACAGATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCTGCCGGCAAACCCCTGCTGGTAGACCCCAAGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATAAGGGAGACATACTATTCGAGGCTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGTACAGTTCGCCCCACGGAGGGAGCGAGACCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACGAGTTGGAAGGTAGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCAGACAAAATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCCTTTCCAAGGTTATTCCCTAATGGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAACAGTGTAGGCTCAGTGCAGACAACTCCCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAATGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGATCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTTGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGACCGCGGCCGTTCCAGCAGCAGAATCTTCAACTCCATCCTCATCACAGGCAAGGACAGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGTCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAGCCGCCTCTCCCGGCCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAGCTAAACAGCATGCTCCCCCGGCTCCACCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAACAAGTGCACATGCCAGATGGTACTACATCCGAACCGAAGTCTAATCCTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGAAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAATTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCTCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCCAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGATGTTAATCTCGTTGTGGCGTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACGACACACCGTAGAGCTGAGAGAGGACTGCGAGCAATTGGTTGGCAAGACCCCTGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCGTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGCAGCTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGCGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCATAA >LOC_Os01g19110 ATGAAGCCTCGGAGGATCCCTATGCCTACTATCAGGAGGGAGATGAAGACGAAGGCGTCCACTATGAATCCGTGTGTACCAAACTACTTGATCCAGGGAAATGGTACTGTTTACACGATTGACTCCTGTTATAAAAACGGGGGTCTACACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCTAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCATTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACTGTCAACATATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGAAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAATATTGCCACTGTCTTGCAGACCAAATCATCACCACAAGAGAGCTCAATTTTATTCGCATGAGGGATAACCTGACCATGCACAAAGGAATTTATCGCGGCGGTTCAACAACAACTCATGGGATTCATCAACGAACAAATCCTTGA >LOC_Os01g35210 ATGTCGAACGAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTCCGGTAGCAATAAGCATCCAGGCGCTTCTAGTGAAGAAACGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAAACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCATCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCGTACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCAAAGAAGAACAAATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGAGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCATTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCTGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTCAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTCCTAAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGACCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAACTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAAGAAGTGCACATACCAGATGGTACTACATCCGAACCAAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGACAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os01g64150 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGTGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCATTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACAACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCATCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCGCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACATCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAACATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAACCGTAG >LOC_Os01g24530 ATGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCTGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACATCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAATGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAACGAGAACGAGCGAACGAACGTGAACGAGCTAGGGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGTGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCAGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACTGAACTTCGATACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGTGATCAGATACGAGAGGCTGCGCGACGACTACGCTCAACCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATATGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGAGCTAGAGTTCCGGGTATCGATGTCGCGTCCCAAAACGACTCTAAAATACATCCTCGAAATTATGCCTAG >LOC_Os01g19070 ATGGCTGATCGCGATGAGGAACAGATATTGTACGATTCAATCGTGGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTATTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACTTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGTAGAACAGTTTCAGAGCTTCAAGGGAGAGTTGTACAAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCTCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATATGA >LOC_Os01g71910 ATGGCTGATCGCGATGAGGAACAGATACTGTACGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCAGAGGGGAACGAGGAGGGGAACGTGGAGAGGAATGCGGAGGGGAACGAGGAGGAGGCTAGTGGAAGTCATCCCTCCGCTGGACAGAAGAGGGCACGCAGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGCAGACGGCCGACCTAGTGCCCCGGCAGAAGCAACCAAGAATTTTTGTGGCTATAGCGTCGCAATACCGAAGTGGGAGGAGATGGAGGCAAGAATGATTGAGAGGGGTATCGAACCAGCCACCGCTAAATGGCCAGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTGGTCTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGAAGCCTCTTCTCATGGCACGTTCCAACCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTACAGACTCTCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATTGGATTCAAGGAGGACATCCACACGTACAAGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGTCCGGAAGGTGGATGAACGCATGGCAGCACATCGGTCACACGATCCCCAGCCATACATACCTCCTCCAATGGTCAGCCCATCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGAATCACATAGCATGGACGCCATGCAAACCCAGGACGAAACCACCTGCCCCGTTGATGAGATCACGCAACGGACACCATGTAAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTGGCGTCGGGAATGGCCATCCCAACGGACATTTCAGGGACTTACCACTACTGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGTGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCGGTACATCATCCTCCCTGGGCAACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCGTCTCCTCCTGCACCATCTCCTCCGGCTCCTCTGCCACCTCCTCCTGCACCATCTCCTCCGGCTCCTCTACCACCTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCTCCTCCGCCTCCACCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCTCCTGCCAGCACAAGGGCAACGAAGAAGGCCAAAGTTGACACCACCAAAAACAAGGAGCCGCCGTACGGTTGCAGTCAAGAGGAGCTTGACGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTAACCCGAGCGTGAAGAATTTCTTCAAGGGAATATCCACCGCAAACAAGGAGGCCTTAAAGCTATCGGACTATGACCGAACACTTAGGAAAGCCTATTACAAGAAGTCCAATCCAGTTCCTCAGCTTGGAAAACAACCACACCAAGTGGTCGAGCCGTTGGTGACCGGCGAAGACTTTGGCATAACGGATTTCATTTCGGACACCGGTCTAACTGTGGCTCTGTTGGTTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAGGCCTGAGCGGCTGCAGTCCCTACCGACACAAATGTATAAATTCCATGAACGGTACATGGAAATGAGCGCCAATGGTAGAGAGATGTTCGGAGCGAGGATTAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTATGGATCCATTTCAAGGATGTCTTCGATCTGTACCATCGGGACGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGCTCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTTCATACTATTGTCGTACAACACAGAATTCCACTGGGTCCTGTTCTTTTTCGACTTGGACGCATGCAGAGTCACTGTGTACGAGGAGAAGGTTTTTGACAAAGGTCTTCCAACTGATAGACAGTGTGCAAAGCAGGATAAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCCCACTGCCTATCAAACCAAATATACACCACACGAGAGCTCGATCGTATTCACATGAGGGAAAAACTCCCACATAAGGAATTTATCACGGCTGTTCAAGAACAACTGATGGGGTTCATCAACGAAGAAGTCCTTAATCCCGATGGTGAATTCTACTACGACGGATCGACAATTCATAACGTCGGTCCTTCCTCTTCTGACGTAACACCGGCGTCGAAGTCGTAG >LOC_Os01g33630 ATGCCGCCGCCGCCACGGCCCCACAACGCCACGCCGCCGCCGCCGTTGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAAGGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGAGACAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACATGGCTGACCGTGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCACCAAGAACTATCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGAGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCAGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCATGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTTGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGTCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGAACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCGCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCATGCTCCGCCAGCACCGTCTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCTGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACCCAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os01g32574 ATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACTGGCCACCGCTAAATGGCTGGATCGATCGAAGTGCTGGTACTATGCTCACGGTGGAATGCTCAACCCAGTTGATGGCTCCCTGGTCTTCAGCGATCAGATACGCGAGGCTACGCATCGACTAACGGACGCAGTGGAAGCCTCTTCGGGGGGCACGTTCCGACCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACAAACAAGAGGGAAAGGAGTGATTCCTTGGAAGATTGGATTCAAGGAGGACATCCACACGTACAGGAGTCAGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGTAGATCTTGAGTACAGGGTATCGAGCTACGAGCTAAGCATGCAAGAGGAGGCGGCAAGGAAGGTTGGTGAACACATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCTTCAGGCAATCGTAGCAGCTGCGCCTCCACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAAATCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCGACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTGGAAGGTGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGCACCGTCTCCACCTCAGGCTCCTACACCAACTCCTCCTCAGGCTCCTACACCAACTCCTCCTCAGGCTCCTACACCAACTCCTCCGCAAGCTCCTCATCCGGTACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCATGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCACAAAAAACAAGGACCCGGGAATGGAGATTCAAAGGGCCCGACGGCGGGGGGGTTTTGATACTGGATTCATTGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCTTGAAGGCGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCAGAAGTTCAATTTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGTATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGCGGTTAAAGAACAACTCATGGGATTCATCAACGAATAA >LOC_Os01g69820 ATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGAGCTGTACAAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAAAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACCGCCAATTGGCCGGAACGATCAAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGTGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCATGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTTCTTGGAAGATTGGTTTCAAGGAGGATATCCACACGTACAGGAGTCGGATGAGGAGTAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCCAGGTATCGAGCTACGAACTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCATAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTACAAAAACTTATCAATAAAGGTGCCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGTAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCTGCAAGCTCCTCTTCCGGCACCTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTATGATTGCACGCAACAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAACAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGAAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGACGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTAAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGGCACCGGTAGAGAGATGATCGGAGCAAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAAGGTTTTCGATACTGGATTCATCGACCCTCAAAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCAGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAAGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCACATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATTAACGAAGAAATCCTTAATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACTACGTCGAAATCGTAG >LOC_Os01g04140 ATGGCAAGAAACAAAGACAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCAATGCCGAAGTGGGAGGAGATGGAGGCAAGTTTGATTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATAGATCGAAGTTTTGGTACTATGCTCACGGTGGAATGCTTAACCCAGTTGATGGATCCCTTGTCTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGTAGCCTCTTCTCAGGGCACATTCCGACCCGACAGAGAGAAGGATGAGCTGTCACTCGCCCTACAGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATTGGATTTAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATCCCATCAGACAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTCGGATCACAGAGCATGGACGCCATGCAAACCCATGACGAAACCACCTGCCCCGTTGATGAGATCACGCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTGGCGTTGGGAATGGCCATCCCAACGGACCCTTCCGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGAAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATCATACTATGGCGCAAGCGGTACATCATCCTTCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTGCACCATCTCCTCCGGTTCCTCCGCCACGTCCTCCTGCACCATCTCCTCCGGCTCCTCTGCCACCTCCTGCTGCACCATCTCCTCCGGCTCCTCCGGCTCCTCCAACTCCTCCGCCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCACCTGCCCGCACAAGGGCAATGAAGAAGGCGAAAATTGATGCCACCAAAAACAAGGAGCCACCGTACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAGGTGAAGAGTCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTTCACAACAAACAAGGAGGCGTTACAGATATCGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCTGTTGGTGACCGGCGAAGATTTTGGCATAACGGAATTCATTGCAGACACCGGTCTAACTGTGGATCAGTTGATGTACAAATTCCATGAACGGTACATGGAAATGAGTGCCAAGGGTAGAGAAGATGTTCTCATGATCCATTTCAAGGATCTCTTCGATCTGTACCAGTTGGACGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTCTACGATACTAGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTATGAGAAAGACATAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTACATACTACTGCCGTACAACACAGGAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCAAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCACGTATTCACATGAGGGATAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTTATGGGATTCATCAACGAAGAAGTCCTTAATCCCGACGGTGAATTCTACTACGACGGATCGACAATTCATAACGTCGGTCCTTCCTCTTATGACATAACGCCGGCGTCGAAGTCGTAG >LOC_Os01g24170 ATGACCCCCCACAAGAAGCGTGATGCGTACAAGGATAAACTAAGAGACGAAGGGGCTGCAGATTTTGAAAGGCAAATGATGAATTTCTGCGTCAAGCACATGCTTTTGCCTGCCCCCGCAACCAAACAACCTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGCCGCTACAACCATTGCTATCCCTGGGAGAACATATAATAAAGAGTTCATACCCGATGCATATGCCAAAGTGCAGCCGCAATTGGTCCACGAAGGGTTTGAGTCCTACGACATAGACTTCCCTACTCCAGATGGTGTATCCGTACTTGGGGATATGGTCGAACTTGTCACGTCCTGA >LOC_Os01g46330 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGAGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACGCTTCCTGCGGGTACAGAGGACAAAGTGAAACGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACAAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTATTCGGCGTTCAGATACGAGAGGCTGCGCAACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCCGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCGCAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACAAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCATGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAGTTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCACACATATCTACGAACTATACCAGCTGGACGCCGTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCACATGGAGAGAAAGACTTAGGCGGAAATTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os01g27660 ATGTCGAACGATAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAAATCCGGTAGCAACAAGCAGCCTGACGCTTCTAGTGAAGAAACGTGGTGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCTCGCGATGATGATCCGGACTACATACCTATGGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGCTCGGAACAGGAGAGAGGAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACATACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACATACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCGTTGAGCCACCGATAGTGCGGTCCAAGTTTAGCAACGCCTGTGGTACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACGGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCACAGGTCAGGGGGAGAGATTACACACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTCACGGATTATGGACATATATCACAGGCTGACTGGGATACGTTTGTTGCGGATCATATAATAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCTGAGCTCGCGAAGAAGAACAGATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGTGGGAGATCGAGCAAAGATTTTCCGCGGCCGGCAAACCCCTGCTGGTAGACCCCATGGTGGAACGTAGCAAGAACTGGGTTTGGGTGCGCAGCACAGGTAAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGCGAGACCAGCTTTACTGCGGCGTTGGGGACCGCCGAACACTCTGGACGTCTGAAAACCCGACAGCCTTTCCAAGGTTATTCCCTAATGGCCAACAACCCACACAATCTGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAACTCCCTTCCCTGTGGATAGTATAACTGGACCAACTCCCTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAATGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCATTCCCTGAGGATTACGCAAGGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCAGTTTCATAAGCGTCGCCATCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCGAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCGTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGAGAGGACTGCGAGCAATTGGTTGGCAAGACCCCTGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACACCGACAAAGATTTCTTAATGGCCCCCTACGCGTTCACAGACAACTACATATTATTCCTTGTATATCAGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTGTCGATCGCCAGTCTTCTAACTACTGATAAAACAATTGTTTTCTTCAAACAGAGCACACAATGCTACAAACAACCACCAGGAACCAACTTGTGCGGTTATTACGTGTGTGAGATGCTCAGAGTAAATGGGAGGTACAAAACAATCGGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACGACACTACGATCTTGAACGTGGCCGCTGACCTCTACCGATTCATCCGCGCGATGTCTGCAATACAAGAGGTCTCTTCTATGACAACCAGAGTGAACTCGCAATGGACAACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATGACATGTACACTACTTATACATATGATGAAAAAACTGTGGCACCTGTATTATATATTTCGTATGTAAATTACGATTGA >LOC_Os01g63530 ATGCCGCCGCCGCCACGGCCCCACAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCACGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAATGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCTAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCTATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCCCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os01g36766 ATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCACTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGTGTCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCAGATAGAGAGAGGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACAAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGTATCGAGCTACGAGTTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCAATGATCCCCAGCCGACCATTTCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGACATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAAGTCGAAGTTGAGTTGGTCGAAGGCGCGTACAAAGATCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACTGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCGGGCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCCGTCACCTTCAAAGTCAAGGGCTCCCCAAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCAGGGTACGATTGTACGCATGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTACAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTTGATGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCACAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCAGAAGTTTAAATTTCCTTGCGCAAAGCAAAAGAAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCAATTTTATTCGCATGAGGGATAACCTGACCACGCACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os01g46100 ATGTCGAACGAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTCCGGTAGCAATAAGCATCCAGGCGCTTCTAGTGAAGAAACGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCAAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCATCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCGTACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAAATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGAGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCATTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTCAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGACCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAACTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAAGAAGTGCACATACCAGATGGTACTACATCCGAACCAAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGACAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCCCGGAAGGCACTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGACAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os01g25670 ATGGCGGGAAGCTATCCTTGGGATCACAATGGATGGTGGACAGAACCATCATTGTTTAATATGAATACTGAAGCGGGAGATGAAGCCACGGAAGATCCTTATGCCTACTACCAGGAGGGAGACGAAGATGATGGCGTCCAGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCAGCGGTTCAAGAACAACTCATGGGATTCATCAATGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTATCTTCTGAGCTAGCAGCGACTACTGCTACGTCGAAATCGTAG >LOC_Os01g18200 ATGGGGGGAAAGAGGGAGGGAATCACGGGGAATATTTCCCCCCTCTTGATTGCACGCGGGGCGGACGGGAGCGGCGGGATTCGCGGCGGCGGCGGCGCTAGGACACGGGCGAGGCGGCGGGAGCGGCGGGAGGTAGGGGATGACGGAATGGAGATTCAAAGGGTCCGACGGCGGAGGGTCTATGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCTTAACGCAGCAGCATTTCAAGACGTACATACTACTGCCGTACAACACAGAAGTCACTGTATATGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCAAACTAATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCAGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCATGTGCAAAGCAGGACCAGGGAACTAACTTATGCGGCTACTACATATGCGAGTATGCCCACTGCCTATCAAACCAAATATGCATAACACGAGAGCTCGATATACAAGACATGGTTTTCTTCTATTTTCTCATTTATTCTCTTGCCACATCATTTTTCATCCTAGATGGCACCTTATTTAATGATATGGATAACATCCTAGTCATTGAGTTGGGAATGGCCTAA >LOC_Os01g24420 ATGGCGACCTCCCCGAGCGACGACGACGACTGGAACAACGGCGAAGCATGGCTGGAGCGACGGCGACGACAGCGGCGCGAGGTCCACGGCGCTAGGGCTCTTCTGACGGCGAGAGACGAAGGCGAGGAACCGGACATCTATAAGGACCCAAATCCTGCAAAGGACCCTGTTGAGGAGACCCTCGTGAATGACACGGCCAAAGATAAGTCTGAAGTGCCTAGAGTACTCAGAAGCCACGACTCCAAGAAAAAGGATGAACACAAGGAGAAGTACATGGTTCGATGGGAGATGAGAAGGTTTCATACATGGTACATGGAAGCCAGCAAGAAAGGCCTACCTAATTTAACTATTCAATCACCGGCAAATGCTTTTGCCGGTGAAGGATTCTTCTGGCTTGATTTCAATGATCTGCACGCCATCTATCGTCGGGAAAAGACGGACATAAACTACGTTCCTGCATGGTGCTTGATGCAATCCATAGATGCTAAGAAGATCGGTGAACCTATTGGATTTCTGGATCCAATAAAGATCTGTCAAACTCAGCATACCATGACATTATCACCAAATTCTGACCAGCTCAAGGGCAAGACTCCTGCAGAGATAGCGGAATACAAGAAGAGCTTGCACAAGCAGAAGATGATTATTGTCGCACAGTGCATCGGACGAGCCTTCTTGCACTTCCAAAATAAGAGAGTCATCAAGGCCACGTACAACTTCAAGGGCACTATCCTCTGTGGGTACTACGCATGCGAATACCTCCGGGTTACTGGGAGGTATAGGGTTAACGCAGAGGATTTGCCTAGTATTGAGCGTCGAGAAGGATTCGACGATATGAGCATTAAAAATGTGCAACAGGACCTCTGCCACTTCATCCACCGCATGTGTTGTCATGTCTTAGGCAAGTTCTTTGACCCAGACAACATCCTTGATGAGGACACAAGTAGCTCAGATATAACCATGGTTACCTTATGTATTAATCAAACAAAGAGTTCATATTGGGCATTCCTCCGAGGGAGCGCTTGGATTAATCGCCGAGGTTTTGAGATGGATGCTCTGATGAACCGGTCCCGCGCCTTCGCGGAGGCGGTGGTGATCATGGTGTGCCCGGTGCTCCTCGCCGTGGCCCTCAAGAAGGTCGACCTGAAGAGCCAGGAGCGCAGCCGCGCCGTGCCGATCTTCATGCTTGTCATGGCGGCCCTCACCCTGGCATTCGGCACCGTCCCCTTCCTGGCTCTGTCCCTCTCCAAGAGGTTCAGCGACCACAGGTGGAGACTCCCCGCCAAGGCGACCACCTGGCTGGCTCCCTCGTCGTGCGCCTGCCTCGTCGGCCTCGCGTGCTGGATCATACACCTCATCCTCTCCGCGCGCTGGGCTTACGCGTTCCCGGCCATGGGCACCGTGTTCGGCCTCTGCATCGTGATCCACTCCGTCCGCTACTGCCGTGCAGGGGGTGACCTGGCTAACCTGGTACATCCTGGTGATGTGTTGCATACTACCGATGAGTTAACTGACAGAAAAAGGAGAGAGGCTTTGCAGAAGGCGATGGAAGGCAAGCTGGACGAGTCGCTGGAGTTCTTGGCGGGGGTCACGGCGCTGCTGTTCCTGGGGCTGGAAGGGCTAGCGTTGGAGGGCCAGATCAATGGCGGACAGGGTCGTCTCGCCGCGCCCATGGGGCTATGCTTCTTCGCCTGCTTGTTTGGCGCGTGCTTCGTGCTCGTTCAGACCATTCCGCCTTCACCACCACCGTCCGCGACCGACACAAGCCTCCGTGCCAACATCGTGAGAAATCTCCCTGCCATATGTGGCATGTTCATGGCTTGTGCCATCGCCGTGGTCATGTTCTCGATCATGGTCGTGCTCGTGAAGCTACTGGCGCTGATGCTGCTCTCGCCGCTCTTCCTGATCTTGCTGGTACATGCATTCGATCTGGTCTTCCCCGGAGGCGGCGGCGGCGGCGGAGGAGGAGAGGACGATGTCGTGAAGCCGGCGTCGCTGGAGCTGAGCAAGGTCGCGTTCACCGGGTTCCTGACCGTGGCGATATCTGCCAGGACGACCAGCCGTGGCCCGCTCAGCACGTCCACCCAGTGGTTCCTCATCTTTGCAGCGTCGGCCATTGTTTCGGGCTTCGCTTGGAGGCTCCTGACGCAGGCCAAAGTTGGGAAAAGTGCCAATGTAGCTTCCTTCTGCACGCATTTGTGCATCGTGCTTGCAACGGTGCCATTTACAGTTATGGCCGGACAAGCTCTGCACTGA >LOC_Os01g27080 ATGCCGCCGCCGCCACGCCACGCTGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGGACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGTAGCGAACAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACATCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACAAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGATGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAATGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAGGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCAAAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os01g24130 ATGTCCGAGCTCGCGAAGAAAAATAGATATCCCCATAGATTGGGGTCAAGTGGATACGCTGGGCACGTCGATCAATGGCGGGAGACCGAGCAAAGATTTGCAGCGGCCGGCAAACCACTACTGGTAGACCCCATGGTGGAACGTAGTAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCGGACATAGAACAAGTGACTACTAATTTGCAGCAGATCGTCGAGAAAGAAAGAGCAGGACAGTTTGTCCCACGGAGGGAGCGAGACCAGCTTACTGTGGCGTTGGGGACCGCCGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGCCAAGTTGGAAGATAGGCTTTCCACATGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCATACAAAATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGTAGCTAAAAACCCGACAGCCTTTCCAAGGTTATTCCCTGATGGCCAGCAACCCACACAATCCACACAGCAAACAACTAATGCACCCAGTAGTGTAGGATCAGTGGAGACAACTCCCTTCCCTATGGATGGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCTATCGGCCGCGCTAGAAAGACTAAGGAGGTTGCAACTGGTTTAGCGATACCCGGATGTCAATTACACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGTATGCAATTCATGAAGCTGATAGAACTGGATCACCGGTTGGATACATCGATCCAACAAGAATATGCAAAAGACAACACACCGTAGAGCTGAGAGAGGACTACGAGCAAATTGGTTGGCAAGACCCCTCAAGAAAAGGAAGAATATGTGAAGCAATTGCACAACAGGAAGAAGCTAGAAGTAGCAACATACTTAGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACGCGTTGACCACACAAGTACTACCGCAAAAGAGGCGGACCCAGTACATATTCCATCCCAGAAGCAGTTACCCATCATGACTGGCTGGCCGCGTTACAAACAACCACCAGGAACCAACTTGTGCGGTTATTACGTGTGCGCGATGCTCAGAGTAAACGGGAGGTACAAAACAACCAGTAACCAAATCCCCGAAATCCCATATATTGCACAACAAATCAACAACGGTACTACCTGGAACGTGGGCGCTGACCTCTGCCGATTCCTCCGTCGTGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACAAGAATGAACTCGCAATGAACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATGA >LOC_Os01g24510 ATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTTATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTAAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTAACAAGGTTTTAGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTAACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCGGCGACTACTACTACGTCGAAATCGTAG >LOC_Os01g20190 ATGCCGACGCCGACCTCGTCACGACACGACGCCGCGCCACGAGATGCCACGACGCCGCACGCCGCCGCCGCGCCACGCCGATGCCGTGCGCGGCGCCACGCCGCCGCCGCGCCGCCCCGCCGCCGCTCCACTGCCGCCACACTGCCGTCCCGCTGCCGCCACACCGAGAACGTGAACGAGCGAACGAACGTGAATGAGAACGAGCAAACGAACGTGAACGAGAACAAGATGGCTGATCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTATTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGGACACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGTTGGACAGAAGAGGGCACGTGAGCAACGAGGTGCCACGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATGTACGTCACAACGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGTGGAGATCATGAGAGCTTTGTCCCAGATTTAGAGAAAGAGATGCTGTGGACTACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGAGCTGTACAAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCATTGCATATAAGACAGCTGAACAAGGGCAGGTGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTTAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGTCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCGGATAGAGAGAGGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCAATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTACGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAATCCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGTGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCAGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCGGGCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCTAAAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCAGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTAGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACACGAGTGCCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCTATTAAACTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAAGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCAACGTCTCTATTATGAGTTGCTGGATTTTATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGACGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGAAGGGAACTAACTTGTGCAGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCAATTTTATTCGCATGAGGGATAACCTGACCACGCACAAGGAATTTATCGCTGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACAACGGAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os01g19710 ATGGCCGATAGTATTAAAGGGACTGAAGAGAAGGGTTTAGGGGAGCAAGAGCAGTCCCTTGCTGTTGTGGTTGCTCTAGAACCAACGGTCCCACCGGAAAGTAGTTCCGACAGCGACATAGCTAACGAAGACGAGGAGTACTCGTCGCCAAACGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGGCGACGGTGAAGAAGGCGACAAGGACTACATTCCCCCTAAAGAAGGGTTCCCGGATGGATCAGAGGCAGCAGTGTGGAATTGTGCACTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAACCACCTTGAACAAGAAATTTGTGAAGACAGGACGCACACCATTTTCGACATATACCAACATAACCCCGAATCAGTGGGACGACTTTCTGACGTTGAAGAACTCCCCGGAAGAAATTCAAAGGAGCCAAAAGTATGCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCTGTGGGATATGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGAGGCAACCTGTACCAATGGAGGAGTGGATACAGAGATCAAGGAACTGGGTAAGAGCTAGAACTCCGAAGATCACGGATGAAGGAAAAGTATCATTTGAAAATCCGGAGCTGCATAGCGTTGCCGATAAAATAGAAAATTTATCCAGTTCACAAAAGAAAGGATCTTTCAAGCCTAAAAGGGAGAAAGATGTGCTAAGTACGGCGCTGGGTACTCCTGAGCATGGGGGAAGGAAGCGTGAAGCGTACAAGGATAAACTTAGAGACGAAGGGGCTGGGGAGTTTAAAGGGCAAATGATGGATTTCTGCGTCAAGCACATGCTTTTGCCTCGCCCCGAAACCAAAGAACCTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCGATTGGACGCTCCGGGAAAACTCTTGAGGCCGCTACAGCCATTGCTATCCCTGGGAGAACATACAATGAAGAGTTCATACCCGATGCGTATGCCAAGGTGCAGCCGCAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTTCCCGACTGCAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACCGACGCCACTCAAAAACCTGTGGTGCCTAAACCAGGGTTGGGAAAACCTCCGAGACCTCCTAAGAGGAAGGTGACTAATAAGGCGGAGGAACCCGAGATGCATAAGGAAAATCCAGTGCCGGAAGTGCCACCGGAGATTGCATTGCCGGAGGCAGCCATGGAGATTGCAACCGCCGGAGGCAGCCATGGAGATTCCAGTGCCGGATGTGCCCATGGAGATTACAGTGGCAGAACCAGAGAGCCAGAAATATTTGAAGACCCTTCTCCTGCGAAAGACCCCGAGGTGCAAGAGACCACGGTCCCTGAGAAGGCCACTACCAGTTCTGAGGTGCCACGAGTGCTTAGGAGCCACGACTCCAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACCATCTTCAGAGGAGGTAAGGAACGTGCCAAGCTTAGAGATGACGACCACCAGAAGGCTGCTGAACTAGCCGGGCCAACATACTTCGCAACCGATGATTGCCCGGAAAAGTACAAACATGGGAAAGCATTCTTGCTGGAATGGGCACTGAAAGAAGGACCATGGGAGATGAGAAGGATGCAATACATGGATGCTAAGAAGAAAAAAGAACCCATCGGCTTCTTGGATCCAACTCGGATCTGCCAAACACAGCATACGGTGAGGCTAGCACCAGGGTCTGACCAGCTGAAGGGCAAGAATCCAAAAGAGATAGCAGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCGCACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTTATGGCCGCTTATAATTTTAAGCAAGTCCGGGTTAATGGACGGTACAGGACTAACGCGGAAGATTTGCCAAGATTAGAATGTCGAACAAGCTTTGACGATACAGGTATCACAAATGTCCAGTGTGATCTGTGCCACTTCATCCACCATAAGTGCTGTCATGTGAAAGGAGATTTCTTTGACCCAGAGGGTGCCCTAGCGGCAAGTGATAAATTCAAGGATATTCGGGAGTGGAACACTGCTATGCCATAA >LOC_Os01g36400 ATGGTGTACTGGCGCAGAACAAGGGCACGCGGAGATCACGACAGGTTTGTCCTAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTCACCCTTCCTGCGGGTACAGAGAACATAATGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAGTTCCAGAGATTCAAGGGAGATCTCTACCATAAATACATCCTGAAGGGGCAGACACCGAACTTCAACACATTCCCGAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTATAAGACAGGGCAACAAGGGCAAGCGATGATGGACAGAAACAAAGAAAATGCTGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCAATGCCAAAGTGGGAGGAGATGGAGGCAAGCTTGATTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGAATCGATCGAAGTTCTGGCACTATGCTCACGGTGGAACGCTTAACCCCGTTGATGGCTCCCTAGTGTTCAGTGATCAGATACGCGATGCTGCAAGTCGACTAACGGACGTAGTGGAAACCTCTTCTCAGGGCACGTTTCGACCCGACAAAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCCCGAGCATCTAGGACGAACGCGAGGGAAAGGCGTGGTTCCTTGGAAGATTGGATTCAAGGAAGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGATCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTCGATGAATGCATGGCCGCACATCAGTGCCAGGATCCCCAGCCGTACATTCCTCCTGTAATGGTCAGCCCCTCAGGCAATCGAAGCAGTTGCGCCTCAACGGGCAGGACGAAACCACCTGCCCCGTTGATGAAATCACGCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGTGTACGAGGACCTCGAGTTGGACTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGTGGTACAACATCCTCCCTGGGAGACAAGCGGCGTCTCGTGCACCATCTCCTCCTCAGGCTCCTGCACCGTCTCCTCGTCAAGCTCCTGCACCGTCTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCAAGCTCATGCGTCGTGTCCTCCTCAGGCTCCTCGTCCGGCACCTTCCAAGTCAAGGTCTCACCAAGCTCCACCGCCTGCCCGCACAAGGGCAACGAAGAAGATGAAAGTTGACGCCGCAGAAAACAAGGTGCCGCCGTACGATTGCATGCAAGAGGAGCTTGACGGTTATGTGGCAGCAAAAGTGAAGAAGCAAGTGAAGCCTCGGAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGCCAAGAACTTCTTCAGGAGTATGTCTGCACCAGCCAAGGAGGTCATAAAGCTAACGGACTATGAGCGAACACTTAAGAAAGCATATTATGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGGTCGAGCCGTTGATGACCGGGGAAGAAATTGGAATAAAAGAATTTATTTCTGACACCGGGCTAACTAGGGCTCAATTGCTTAGCGGCGCACCAATCCCAAAGGCGGAAGTGAAATACCAATACGAACTCGGTAAACCGCTTGTGAAGCCTGAGCAGCTGCAGTCCCTACCGACACAGATGTACAAATTCCATCAACTGTACATGGAAATGAGTGCGGAAATGAGCGCCACCGGTAGAGAGATGATCAGAGCGAGGATCAAGCACACGGACTTCTTGCAAGGAGAAGATGTTCTCTGGATCAATTTCAAGGGTATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTCTTCTGAGTTGTTGGATTTTATTCCACTGGGTCCTTTTACTCTTCGACTTGGAGGCATGCAGAGTCAATGTCTATGACTCAATGAATAAAAAAGAGTCTACTTTTGACAAGTGTGCAAAGCAAGACCAGGGAACTAACTTGTGCGGCTACTACGTATGCGAGTATTGCCACTGCCTTACAACCCAAATCTACACCACAAGAGAGCTCAATGTTATTCACATGAGGGATAACCTCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAGTCCTTGATCCCGAGGGTGAATTCTACTATGACGGAAATACAATTCATAAGTCGTTAGCTTCTGAGATAACGATTACTACGTCGAAGTCGTAG >LOC_Os01g39464 ATGCCGCCGCCGGCACGCCACGCCGCCGCCGCATGCCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCGCCTTCGCCGCCGCGCGCGCAATGCCGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACAAGAGGGCACGCGGGCAAGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATACCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCATACTCCAGAGCATCCAGGACGAACACGAGGGAAATGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAAGTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGTAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTAGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAATCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAATTTCTTCAGTGGTATGTCTACACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACACTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGGAAGACATGACGAGAGAAGAATTTATTATTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTAAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTAATGGAGATTCAACGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTTGCAATGCTCGACCAATATCCGCAGGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTACCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAATGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCAGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACATAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os01g35254 ATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACCGCCAATTGGCCGGAACGATCGAAGTTCTGGTATTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAAGAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCGGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGCAGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTACAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCAGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAATGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACACAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGTTGGTGACCGGGGAAGACATGACGATAGAAGAATTTATTATTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGCATCAGGGACCCGGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGGAATCTACGAAGTATACCAGCTAGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCGAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCGCAGGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCACAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCTGTCATTTGGTCCGCGGCAACTGGAGAGAAAGACTTAGGCGGAGGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCAGAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCACAAGGGGGAGGTGCCTCATTGGACTATCATGGACGAGACATCAATATTTGGGAGGGACAAAGAGAAGAATTGGGTGATATCTAAGCTGACAGAGTCTAGTATTCAACAAAACATAAAAATTGTTTCAGTCATTGGATTAGGCGGCTCCGGTAAAACTACTCTCGCGAAGCTAGTCTTTAACGATGGTAACACAATAAAGCAGCATTTTGAACTTATACTGTGGGTTCATGTGTCACGAGAATTTGATGTTGAGAAGCTTGTCGAGAAGTTGTATGAAGCTATTGCTGGAGACAAGCCTAACCATCTCCCATTGCAGCGTGTGAGCAGAACAATCTCAGACAAGCTGGCTGGGAAGAAGTTCCTAGTTGTAATGGATGATGTTTGGACGGAAGACCACGCTCACTGGGAGCAATTCATGGTACATCTGAAGAGTGGTGCTCCTGGAAGTAGCATTTTACTCACTGCTCGTAGTAGAAAAGTTGCGGAAGCGGTAGATTCCACATATACATTTGACATGCCATTCTTGTCTGAGGATAACAGCCAGAAAGTGTTCGAGCAAAATTTAGGAAGCGCAGCGATTGGTTTGGACCCTGAATTCCTACAAATCGGGACAGAAATTATGAAGAAATGCAGTGGTGTGCCCCTTGCAATTAAAGTTCTTGCAGGTGTCCTCCGTGGAATGAAAGGAATAGAAGAATGGCAATCCATAAGAGACAGTAATTTGTTAGATGTTGAGGATGAAGAACGTAAAATATTTGCTTGCTTATTGTTGAGTTATATTCACCTACCACATCATCTAAAGCGGTGTTTTTTACATTGTTCTATATTTCCAAGAGGATATGTAATCAAAAGGCGCCATTTAATTTCACAATGGATTGCCCATGGCTTCATCCCGACAAACCAAGCTCAACAACCTGAAGATGTTGGAATTGGCTACTTTGATTCCCTTCTGAAAGTGGGTTTTCTTCAAGATCAAGAGCAAGATCACAGTGACGAGGTGACATGCAAAATGCATGACCTGATTCATGATCTCAGTAGAAAAATTTTACAGGATGAATTTGTGTCCGGAATAGAAACTATCGATCAAACAAAGAAGTGCAGGTATTTATCATTGACTTCGTGCAGTGGGAAGGTTGATAGGAAACTATATGACAAGGTCCGTGCATTCTATGTTTCTAGGTGTAAACTTGCATCTGACAGGACTATGAACAAGCAGCGTTGCATCCGCACAGTTATATTGAAGTATATGAATATTGATTCATTGCATCTGTTCGTATCCAACTTTGAATACATGGGCTATCTTGAAATCAGCAATGTTAATTGTGAAGCACTCCCAGACGCTATCTCACATTGTTGGAACTTGAAAGCTCTTCATGTGATAAAGTGCACCAGACTTGCAAATTTACCTGAGTCTATTGGTAAGCTTAAGAAGCTTAGAACTCTAGAATTGAATGTTGCTTGGAACGTCAAGAGTTTACCTCAGTCTATCGGTGATTGTGATAGTCTTGGAAGCTTATACCTAGAAAATTGTGGAATCAAAGATATGCCAAATTCCATTGAAAAATTAGAAAATTTAAGGGTCCTTAGTTTTGTGTACTGCACGGATTTGCAGCAACTGCTACCGTCAGAACCATATGGGAAGCTTCGCAACTTACAGACCATCACTTTAACATTTTGTACGGCTTTTAAACACCTGCCACAGTGCATCACTTTATTGGGTCATCTACAATATGTAGACCTTTCATGTTGTACTGAGCTTAGAGAATTGCCTGAAGGCATAGGCGCCTTGAAAAAGCTTGAAGTTTTGAATCTAGAGAGATGCAGGAGATTGTGTGGCCTGCCAGCAGGTTGTGGGCAACTGATTCGTTTACAGCAGTTGGGCTTGTTTGTTATAGGAGATAGGACTAAGCATGCAAGGATCTCAGAGCTTGAAAAGCTTGATAAGCTTAATGGAGAATTGCAGATAAAAAATATTAAACATGTGAAGGATCCATTTGATGCAGAAATGGTTCACTTGAAGAGAAAGAATGGCATACGGAAGTTGTCATTGGATTGGTCTTCAAGGTGGGAGTTTGGGGCTAGTCATATGGAAGAAAAGCTTTCTGTCGAAGAAAGGACAGAAGAAGAGTTATCTATTATATACTAA >LOC_Os01g22140 ATGGCCGATAGTACTAAGGGGACTGAAGAGAAGGGTTTAGGGGAGCAAGAGCAGTCCCTTGCTGTTGTGGTTGCTCCGGAACCAATGGTTCCACCAGAAGATAGTTCTGGCAGCGATATAGCTCACGAAGCGATCCTTGTCCAAGCCCAAGCCCGAATAGAAGGAAAAAGGGCGACGGTGAAGAAGGCGACAAAGACTACATTCCCCCTAAAGAAGCGAGGCAGCAGTGAGGAATTGTGCACTGCAAACAATGGCCAAGTCTTGGCATGGTTGGAAAACCACCTTGAACACGAAATTTGTGAAGACGGGACGCACACCGTTTTCGACGTATGCCAACATAACCCCGAATCAGTGGGACGACTTTCTGACGTTGAAGAACTCCCTGGAAGAAATTCAAAGGAGCCAAAAGTATGCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCACTTAGGCTCCGTGGGATACGCACCAAAGTTGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAACCGGTACCAATGGAGGAATGGACACAGAGATCAAGGAACTGGGCAAGAGCTAGAACTCCTAAGATCACGGATGAAGGAAAAGTATCGTTTGAAGATCCGGTGCTGCAGAGCGTTGCCGATAAAATAGAGAATTTATCCAGTTCACAGAAGAAAGGATTTTTCAAGCCTAAGAGGGAGAAAGATGTGCTAAGTACGGCGCTGGGTACTCCTGAGCATGGGGGAAGGGTTCGAGGTGTGTCGAGCAAGATGAGTTGGAAGGAAGGGTTCAAACATGACCCCCACAAGAAGCGTGAAGCGTACAAGGATAAACTTAGAGACGAAGGGGCTGCGGAGTTTGAAAGGCAAATGATGGATTTCTGCGTCAAGCACATGATTTTGCCTCACCCCGAAAGCAAAGAACCTGAGCCAGATTACCCCTTCGATGACCTCAAGGCGAATACACCCTGCAGATTGCATGTTCCCATTGGACGCTTCGGGAAAACTCTTGAGGCCGCTACAGCCATTGCTATCCCTGGGAGAACATACAACGAAGAGTTCATACCCGATGTGTATGCCAAGAATCACATATCCTTTGGATTGGGCACTGACGCCACGCAAAAACCTGTGGTGCCAAAACCGGGGTTGGGAAAATCTCCGAGATCTCCTAAGAGGAAGGTGACTGATAAGGTGGAGGAACCCGAGATGCAAAAGGAAAATCCAGTGCGGAAAGTGCCACCGAAGATTGCAGTGCCAGAGGCAGCCATGGAGATTCCAGTGCCGGAAGTGCCCATGGAGATTACAGTGGCAGAACCAGAGGTGCAATTTGTGGCATCAGTCGGGATGCAATACATGGATGCTAAGAAGACAAAAGAACCTATCGGCTTCTTGGATCCAACTCGGATCTACCAAACACATCATACCGTGAGGCTAGCACCAGGGTTAGACCAGCTGAAGGACAAGACTCCAAAAGAGATAGCTGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCGCACACGATCATTATATCTGTTTACTCATCCACCCTAAAGACAGAACCGTGGTAGTCTTGGACCCTCTCGATTACAAACACCAGTCATACAAAGAATTTCTAACAATCTTACAGTATGCGTACCAGTACTACAAGTTCAAGGGTGGAGAACAGACCCGAACAAGGGAGAAGCTGCTATGTTACAAGCAACTGCGAGGAACGGTCCTTTGCGGGTATTACGCTTGCGAATTCCTTAGAGTTAATGGGAGGTACAGGACTAACGCGGAGGATTTGCCAAGATTAGAATGTCGAACAAGCTTTAACGATACATGCATCAAAAATGTCCAGCGTGATCTGTGTCACTTCATCCACCATGAGTGCTGTCATGTGAAAGGATATTTCTTCGACCCAGAGGGTGCCTGTCACGCCCGGAATTTCTATCCAAAATTCCAAACGCTTACATGTATGTAA >LOC_Os01g63320 ATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACGCTCGGAAAGTAAACGTCGCAATGCTCGACCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTACCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGAAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTTATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTATTACGTCGAAATCGTAG >LOC_Os01g38810 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATAAAAGAGGCTGAGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGTTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGATGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACATGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTTGTGGAGATTATGGGTACCCCATACCCACACGGCATGGTTATCCGACTAGTTATAGGGGATAACTTATATCTATGTAATATGTAA >LOC_Os01g29710 ATGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGATGAACACGTCAACATGTTTCTTGTATCAACAGATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGAAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGATAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAATGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTACACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCACTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGACCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACTAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCTCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTACACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGATTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os01g74210 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAATACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAAATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGTCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGAGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCTGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCAAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCAGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTAGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACTTCGAAATCGTAG >LOC_Os01g24200 ATGGAGATTACAGTGGCAGAACCAGAGGTGCAAATTGTGGCATCAGTCGGGACATATATAGAAGAAGTAGTACGATTGGAATGGGACGGTACAGAGCCAGAAATATTTGAAGACCCTTCTCCTGCGAAAGACCCCGAGGTGCAAGAAACCCCGGTCCCTGAGAAGGCCACTGACAATTCTAAGGTGCCTAAAGTGCTTATGAGCCACGACTCCAAGTCTAAAGATGAGAACAATGAGAAGTTCATGGTAACCATCTTCAGAGGGGATTTCGAAGATCTCCATGCCATATATCATCGGGACAAGATGAACGTCAACTATGTTGCTGTTAGGTGCATGATGCAATACATGGATGCTAAGAAGAAAAATAAACCTATCAGCTTCTTGGATCCAACTCGGATCTGTCAAACACAACATACCGTGAGGCTAGCACCAGGGTCAGATCAGCTGAAGGGCAAGACTCCACAAGAGATAACTGAATACAAGAAGGGCTTGCACAAGGAGAAACGATCATTATATCTATTTAATCATCCACCAGAAGGATGGAACCGTGGTAGTCTTGGACCCTCTCGATTACATACACCAGTCATACAAAGAATTTCTAACAATCTTACAGTATGTCACAAGCAACCTATAGGAACTGTCTTTTGCGGGTATTACGCGTACGAATTCCTCAGGGTTAATGGGAGGTACAAGGTTAACGCGGAGGATTTGCTAAGAATAGAACGTCGAACGAGCTTTGACAATACAAGCATCACGAATGTCCAGCGCGATCTGTGCCAATTCATCCACCATGAGTGTTGTCATGTGAAAGGAGAGTTTTTCGACCCAGAGGGTGCCCTATCTACAAGTGACGAATTCAAGAAATTTCGAGAGTGGAGCACTACTATGCCATAA >LOC_Os01g20170 ATGGCCCCCAATCCATTTTACACCGAGTGGGGGCAAATGCCCCCTTTTCATATTTTGTGCGCTAAGTTAGTCCATGCTATTTTCCTTCCATCAATTGCAATCAAGACCAAAAAGTCATTTCAATATATAATCTTTGACACTGGCACCAATGCTCCACCGAAACCACCGAGACCTCCTCTAAAGAAACCGTTGAATGATAAGGCGAAAGAACATGAGCTACCTAAGGGCACTGAAGGGCCATCTACATCGGCAATAGTGTTGATCGTGTCGGAAAAAGAACTGGATGTGCAAGTTGTGCCGGAAAATGAACCGAAGAAATCGAAGTCGCACCAAGTTTGGAATGTTGAAACAGAGACAGATGTGTATGAGGACCCATGTCCTGCCAAAAATGACGTGGAGAACACCCCGGTCGATAACAATGGCACTGACAAGTCTGAAGTGCATAGAGTGCTCAGAAGCCACAACTCCAAGTCTAAGGATGATCAAAAGGATAAGTGGATGGTATCCACCTTCAGAGAGGAGAAGACAAAGGAACCTATCAGATATCAAGATCTAACAAGGATCTGTCAAATACAACATACCGTGACGCTATCACCAAACTCCGAGCAGCTCAAGGACAAGACGCCTAAAGAGATAGTGGAATACAAGAAGGGCTTGCACAAGACCAAGTTGCTTACTATCGCACAATACATTGGACAAGCCTTCATGAAATTTCAACATAAAAGAATCATCATGGTTGCGTACAACTTTAAGTAA >LOC_Os01g20080 ATGCTCGAGATGTTCACGCTACCCGCGGGTACGGAGAACATAGTGAAACAGTGGACTCTGAAGAAAATGGCAGAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGACTAACACTGAACTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGACAAGGCAACAAGGGCAAGCGATGATGGCCAGAAACAAAGACAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGTGTTGCAATGCCGAAGTGGGAGGAGATGGAGGCAAGTTTGATTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTTTGGTACTATACTCACAGTGGAACGCTTAACCCAGTTGATGGCTCCCTTGTCTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACACAGTGGTAGCCTCTTCTCAGGGCACATTCCGACCCGATAGAGAGAAGGATGAGCTGTCACTCGCCCTACAGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATTGGATTTAAGGAGAACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGTGAAGATTGCAGATCTTGAGTACAGGGTATCAAGCTACGAGCTCAGCATACAAGAGGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCGCACATCGGTCCCAGGATCCCCAGCCGTACATTCATCCTGCAATGGTCAGCCCATCAGGCAATCATAGCAGCTGCGCCTCAACGGGGCAGGTCGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAAACCACCTGCCCCGTTGATGAGATCACGCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTTGCGTCGGGAATGGCCATCCCAACGGACTCTTCCGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCAAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTATGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGAGAGGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCAAGCGTGAAGAACTTCTTCAAGGGAATGTCCACAACAAACAAGGAGGCGTTACAGATATCGGACTGTGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCCCTCACCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCGAAGATTTTGGCATAACGGAATTCATTTCAGACACCGGTCTAACTGTGGATCAGTTGATTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAAACCTGAACAGCTGCAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAACGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCTGACTTCTTGCAAGGAGAAGATGTTCTCTGGATCCATTTCAAGGATCTCTTCGATCTGTACCAGTTGGACGCCTTGACGTCTCTCTTCTGA >LOC_Os01g38790 ATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCAAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGTGGAAGTTCAAATTTCTTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAAGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAACTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os01g63330 ATGCCGCGCGCGGCGCCACGCCGCCGCCGCGCCGCCCCGCTGCCGCCACACCGAGAACGTGAACGAGCGAACGAACGAGAACGTTGTCGGACGAACGTGAACAAGCCAACGAACGTGAACGTGAAATGCAATTATAGGCAGATGGCTGATCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACAAGGATCCAAACCAGGATTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGGGCACATGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTTAGTATGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGAGCTGTACAAGAAATATATCCTGAAGGGGCAGACACCAAACTTCGACACATTTCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGTCGACTAACAAACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCGGACAGAGAGAGGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACAAACACGAGGGAAAGTGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCAGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCAATAATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAATCCACCTGCCCCGTTGATGACATCACTCAGTGGACAACATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGTAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCACAGGCGCTACATCATCCTCCCTAGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCATCCTCATGCTCCAGCACCGACTCCACCTCAGGCTCCTGCACCGACTCCTCCTCGGTCTCCTGCACCGACTCCTCCTCGGTCTCCTACACCGACTCCTTCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAATTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTTAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGTTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGATGATAAAAGAATTTATTACTGATACCGGTCTAACTACGGATCAATTGCTAGGAGTCACACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTTCCTACCTACACAAATGTACAAGTTCCATCAGTTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACATGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTATAA >LOC_Os01g24890 ATGGCCAAGTCTTGGCGTGGTTGGAAAACCACCTTGAACATGAAATTTGTGAAGATGGGACGCACACCGTTTTCGATGTATGCCAACATAACCCCGAATCAGCGGGACGACTTTCTAACGTTGAAGAACTCCTCGGAAGAAATTCAAAGGAGCCAAAAGTATGCAGAGTTGGTCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCCGCAGGATACGCACCAAAGGTGGAGCGGTGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAATCGGTACCAATGGAGGAATGGACACAGAGATCAAGTAACTGGGTAAGAGCTAGAACTCCTAAAATCACGGATGAAGGAAAAGTATCGTTTGAAGATCCGGAGCTGCAGAGCGTTGCCAATAAAATGGAGAATTTATCAAGTTCACAGAAGAAAGGATTTTTCAAGCCTAAGAGGAAGAAAGATGTGCTAAGTACGGCGCTGGGTACTCCTGAGCATGGGGGAAGGGTTCGAGGTGTGTCGAGCAAGATGAGTTGGAAGGAAGGGTTCAAACATGACCCCCACAAGAAGCGTGAAGCGTACAAGGATAAACTTAGAGATAAAGGGGCTGTAGAGTTTGAAAGGCAAATGATGGATTTCTGCGTCAAGCACATGATTTTGCCTCGCCCCGAAACCAAAGAACCTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCCATTGGACGCTCCGGGAAAACTCTTGAGGCCGCTACAGCCATTGCTATCCCTGGGAGAACATACAACGAAGATTTCATACCCGATGCGTATGCCAAGGTGCAGCCGCAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTTCCCGACTACAGATGGTGTATCCGTACTTGGGGTTGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACTGACGCCACGCAAAAACCTGTGGTGCCAAAACTGGGGTTGGGAAAACCTCCGAGACCTTCTAAGAGGAAGGTGACTGATAAGGCGGAGGAACCCGAGATGCAAAAGAAAAATCATGTGCCGGAAGTGCCATCGGAGATTGCAGTGCCTGAGGCAGCCATGGAGATTCCAGTGCCGGAAGTGCCCATGGAGATTACAGTGGCAGAACCAGAGGTGCAATTTGTGGCATCAGTCGGGTCAGAAATAGAAGAAGTACCAGGATTGGAATGGGACGGTACAGAGCCAGAAATATTTGAAGACCATTCTCCTGCGAAAGACCCCGAGGTGCAAGAGACCACGGTCCCTGAGAAGGCCTCTACCAGTTCTGAGGTGTCTAGAGTGTTTAGGAGCCACGACTCCAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACCGTCTTCAGAGGGGGTAAGGAACATGCCAAGCTCAGAGATGATGACCCCTATAAGGCCGCTGAACTAGTCGGGCCAACATACTTCGCAACCGATGATTGCGCGGCTGAGTACGAACATGGGAAAGCACTCTTGCTGGAATGGGCACTGAACAAAGGACTATGGGAGATGAAAAGGTTACATACCTTCTACATGCAGGCCAGCAAGAAAGGCTTGGGCAATATAACAGCCCGATCACCGGCAGATTGTTTCGGCGAAGAAGGTTACGTATGGCTAGATTTCTCAGATCTCCACGCCATATATCGTCGGGATAAGATGGACGTCAACTACGTCGGTGTTTGGATGCAATACATGGATGCTAAGAAGACAAAAGAACCTATCGGCTTCTTGGATCCAACTCGGATTTGCCAAACACAACATACCGTGAGGCTAGCACCAGGGTCAGACCAGCTGAAGGGCAAGACTCCAAAAGAGATAGCTGAATACAAAAAGGGCTTGCACAAGGAGAAATTGATTACTGTTGCACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTTAACGATCTTTATATCTGTTTACTCATCCACCCTAAAGATGGAACCGTAGTAGTCTTGGACCCTATCGATTACAAACACCAGTCATACAAAGAATTTCTAACAATCTTACAATTACTTGCGTACCAGTACTACAAGTTCAAGGGTGGAGAACAGACCCGAACAAGGGAGAAGCTGCTATGTCACAAGCAACCACGAGAGACGGTCCTTTGCGGGTATTACGCTTGCGAATTCCTTAGAGTTAATGGGAGATATAGGACTAACGCGGAGGATTTGCCAAGATTAGAATGTCGAACAAGCTTTGACGATACATGCATTAAAAATGTCCAGCGTGATCTGTGCCACTTCATCCACTATGATTGCTGTCATGTGAAAGGAGATTTCTTCAACCCAGAGGGTGCCCTAGCCACAAGTGACGAATTCAAGGATCTTCGGGAGTGGAACAGTGCTATAACATAA >LOC_Os01g70030 ATGACCTATAGACTTAGCAACTATTTCTTGTGTGAACAGATGGCTGATCGCGATGAGGAACAGATACTGTACGATACAATCACGGAGGGAAGCAACCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGCGATGCGGAGGGGAACCAGGAGGGGAACGTGGAGAGGGATGTGGAGAGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGCTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCCGTGAATAAGCTAGAGGGTCGGCACATCATAACGGAAGTGGACGAAGACGGCCGACCTAGTGCCCCGGCGGAAGCAGCCAAGAACTACGTACGACACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGCAGAACAAGGGCACGCGGAGAACATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTAAAGGAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCATTGCATATAAGACAGGCGACTATAGCATTGCGATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGAATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCCCTGGTCTTCAGCGATCAGATACGCGAGGCTGCGCGTCGACTAACGGACGCAGTGAAAGCCTTTTCTCAGGGCACGTTTCGACCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGATGATTCCTTGGAAGATTGGATTCAAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCAAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCATTCAGGCAATCATAGCAACTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGAACCCTTCAGGTACTTACCACTGCAGGCCGATTCTAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTGGAAGGCGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTTCACCGACTCCTCCTCAGGCTCCTACACCGACTCCTCCGCAAGCTCCTCGTCCGGCACCTTCCAAGTCAAAGGCCCCCCAAGCTCCAGCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAACTTGACGCTACAAAAAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTATGTGGCATCAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGCCAGGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTTAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAAGAGATCGAGCCGTTGGTGACCGGTGAAGATTTTGGAATACAAGAATTTATTAATGACACCGGGATAACTACGGATCAATTGCTACGAGGCGCACCAATCAAAAAGCCTGAGCAGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAACTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGGGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGGCATTCTCTGGATCAATTTCAAGGGTATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTATATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGTGGGGGGTTTTCAATACTGGATTCATCGACCCTCGGAAAGTAAACGTCACAATGCTCGACCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAATTCCACTGGGTCCTTTTACTCTTCGATCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCTGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAATTTTCCTTTTATTCCCATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCATAGGTCATTAGCTTCTGAGATAACGACTACTACTACGTCGAAATCGTAG >LOC_Os01g08730 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGACAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGTATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTACTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGACGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGCGGTACATCATCCTTCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGTCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTATGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACATGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os01g19960 ATGAAGGCAATTTCGCAGAAGGTCATCAATCCGGATATATTAGAAGCCCTGCAGAATGATGTGGTGCAATGTCTTGTCAGCTTTGAGTTGATATTTCCACCTTCATTTTTCAATATAATGACGCATCTGCTTTGTCACCTTGTCAAAGAGATCGGTATTCTCGGTCCTGTGTACCTACACAACATGTTTCCTTTCGATAGGTACATGGGCGTTCTGAAGAAGTATGTTCGTAACCGTGCTCGTCCAGAGGCAAGCATCGCCAAGGGGTATGGAACAGAGGAGGTCATTGAATTCTGCGTAGAATTTATCGACGACCTTCGCCCAATCAGGGTACCTGAGTCACGCCATGAAGGGAGACTACGGGGAAAGGGGACTCTCGGAAGGAAAGCAATAATGACGGTAGACAACAATTTATTATGTAAAGCCCGTTTCACGGTTCTGCAACAATCTTCATTGGTGGCTCCCTACATCGAGGAGCACTTGGCTCTAGTTCGCGCCAGAAACATCGACATGAAGAGCACGAACCAGAACAGTGTTGTTCGTATCGATGCCATGGGACACGATGGTACAACTGGCACGTATTACGGTACCATCGAGGACATATGGGAACTTGACGATGGACCTCTCAAGGTCCCTCTGTTCCGGTGCCAATGGGTTAGGTTGACTGGTGGAGGCGTAACGATTGATGACAGTGGGATGACAACGGTTGACCTTAACAAGGTTAAGGAAGGAAAAAAGGGCAAAGGGCCTGACGAGCCGAAGCGCCACGTGGTTCTCCCAGGAAAAAGAAAAATCGTCGGAGTAGAGGACAAGACTGACGAGGATTACGATCAGTTTGATGGGCAACAGCCTTTCATAGTGACGATTGACCCTAGCATCCTCCTATCAAATGAAGACACCCCTTACTCACGTAGCGATCACAAGGAAGGAACAATAGTGAGGAGAAAATGGCTGATCGCGATACTATACGATACAATCGCAGAGGGAAGCAGCCAGTACTGTAACGAAGAAGAGGGGAATGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGGGAACGAGGAGGAGGAGGCTAGTGGAAGTCATCTCTCCGCTGGACAGAAGAGGGCACGCGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGAAGACAGCCGACCTAGTGCCCCGGCAGAAGCAGCCAAGAATTTTGTACGCCACAGCGGTTGGGTTGTGAGGGACAACGTGCCTGTCAGCACGGTGTACTGGTGCAGAACAAGGGCACGCGGGGATAATGACAGCTTTGTCCCAGACTCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTCACGCTACCCGCGGAACAGTTCCAGAGCTTCAAGGGAGATCTCTATAAGAAATACATCCTGAAGGGACTAACACCGAACTTTGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTATAAGACAGGGCAACAAGGGCAAGCGATGATGGCCAGAAAAAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTAGGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGTATGGACACACATCGGTCCCAGGATCCCCAGCCGTACATTCCTCCTGCAATGGTGGCGTCGGGAATGGCCATCCCAACGGACCCTTTCAGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAACCCACGCCATTATACTATGGCGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTGCACCATCTCCTCCGGTTCCTCCGCCACGTCCTCCTGCACCATCTCCTCCGGCTTCTCAGCCACCTCCTCCTGCACCATCTCCTCCGGCTCCTCCACCTCCTCCGCCTCCTCCACCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCTACCGCCTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGTTGATGTCACTAAAAACAAGGAGCCACCGTACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTGCAAGGGAATGTCCGCAACAAACAAGGAGGCGTTACAGATATCGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCGAAGATTTTGGCATAACGGAATTCATTTCAGACACCGGTCTAACTGTGGATCAGCTGATTCGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAAACCTGAACAGCTGCAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCTTGACTTCTTGCAAGGAGAAGATATTCTCTGGATCCATTTCAAGGATCTCTTCGATCTGTACCAGCTGGACGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTCTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTATGAGAAAGACACAGAGGACAATCTTGTCCATCTCCTAATGCAGCAGCATTTCAAGACGTACATACTACCGCCGTACAACACAGAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCAAACTGATAGACAGGGCTTGGGATCAGTTCCGCCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCATGTGCAAAGCAGGACCAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTTTGCCCACTGCCTATCAAACCAAATATGCACAACACGAGAGCTCGATGACTTCTCTAATTAA >LOC_Os01g07820 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCTGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATAGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGTAGTGGAGGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGTAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGTCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACAGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGAGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os01g08070 ATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAACACCGTCTCCACCTCAGACTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCGGGCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCAGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCAGGAAGTTCTTTAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGAAATGACGATAGAAGAATTTATTACTGACACCAGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCTCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACATCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTTAAATTTCCTTGCGGAAAGCAAAAGCAGGGAACTAACTTGTGCTGCTATTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGTATGAGGGATAACCTGACCACACACAAGGAATTTATCGTGGCGGTTCAAGAACAACTTATGGGATTCATCAACGAACAAGTCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTACGTCGAAATCGTAG >LOC_Os01g28420 ATGGAGAGGGATGTGGAGGGGAACCAGGAGGGGCACATGGAGAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGCTGGACAGAAGAGGGCACGCAGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGTCACCGCTAATTGGCCGGAACAATCGAAGTTCTGGTACTATGCTCATGGTGGAACGCTCAACCCAGCTGATGGCTCCCTGACTCCAGAGCATCTAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTTCAGGGTATCGAGCTACGAGCTCGGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCATATCAGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAAACCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCTAACGGACCCTTCAAGTACTTACCACTACAGGCCGATTCCAGCAGGATACTCCAAAGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATTCTATGGCGCAAGCGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCAGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCCAGAAAAGAACATTCCTATAGACCCGAGTGTCAAGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACATTCAAGAAAGCATCTTCTAGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGATTTTGAAATACAAGACTTTATTAATGACACCGGGCTAACTACGGATCAATTGCTACGAGACGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCTTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCAGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAAATATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTACTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGTTTTCGATACTGGATTCATCGACCCTCGAAAAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGTGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGACTACTATGTGTGCGAGTATTGCCACTGCCTTGCACACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACTTGATCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAATAA >LOC_Os01g10390 ATGGCTGATCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGTAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAATATTTGAACGAGGAAGGGAACGTGCAGAGGGATGCGGAGGGGAACCAGGAGGGGCACGTTGAAAGGGATGTGGAGGGGAACCAGGAGGAGGGGGATAGTGCAAGTCAACCCTCCGCTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGACGAAGACAGCCGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATGTATGTCATAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGCAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGCGATGATGGAAAGAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCTGAAGTGGGAGGAGATGGAGGCTAGGTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGTCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCGGATAGAGAGAGGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTATGGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATAGCCGCACATCGGTCCAATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGAAAACTGTAGCAGCTGCGCCTCAACAGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAAGACGAATCCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATTAATAAAGGTGGCGTCGGGCATGGCCATCCCAATGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGTGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCAATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTAGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCACCATCTCCTCCTCAGGATCCTGCACCGTTTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCATCGACTCCTCCTCAGGCTCCTGCATCGACTCCTCCTCGGTCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCATGCCCACAGAAGGGCAACGAAGAAGGCGAAAATTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTAAAGAAAGCATCTTCTGGAAAGTCCAAACTAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGAGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAATGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACACAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACATAG >LOC_Os01g32100 ATGGCAGAACAGTTTCAAAGCTTTAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGATACATTCCCAAAGCTAAGAGATCACTGGGACAAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAAGCGATGATGGGAAGAAACAAAGAAAATACCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGTAGATCTTGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAATGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATGCCTCCTGCTATGGTGGCGTCGAGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCTATTATTCTATGGCGCAAGCGGTACATCATCCTCCCTAGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGCTCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCAACTCCTCCTCAGGCTCCTACACCGACTCCGCAAGCTCCTCTTCCGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTATGATTGCACGCAAGAGGAGCTTGATGCTTACGTGGCATCAGAAGTCAGGAGACAATTCAAGCCTCGAAGTCTAGAAAAGAAGATTCCTATAGACCCGAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTCAAAAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGATTTTGGAATACAAGACTTTATTAATGACACCGGGCTAACTACGGATCAATTGCTACGAGACGCACCAATCGAAAAGGCAGAAGTGAAATACATGTACGAACTCGGTAAACTGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACAGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTTGATACTGGATTCATCGACCCTCGGAAAGTAAACGTTGCAATGCTCGACCAATATCCGCAAGCCACAAAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATATTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTACACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGGACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACAGAAATACAATTCATAGGTCCTTAGCTTCTGAGATAGCGACTACTACTACGTTGAAATCGTAG >LOC_Os01g21490 ATGGCGCAGCGGCTTTCTCTGAGGTGGATGAGAATGGCCGGACGACGACGATGGTTGAAGCGGCGGCGCACCGGTGCGTGCTCCAGGGCGTCGTCGGCGTGGTCGCGTTCCGGTGGCTGTGATGCACAAAACGGGAGGTGGTCAAAAGAGAAATGGTTCGGCACTGTGTGGAGAGATGGGAACGCGAAAGAGATGGAGGTGACCTTGACTCAAACGGAGATGGCGAAGGTCGTCGTCACTACGACCGGCGGCGAGGTTGAGGATGACGGAGAGGCTGAGGACCTCTCCCTCAGCTTCTTCAGCTTCAAAGAATTTACTCCCCCGCAAGCTCCTCTTTCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCTAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACTAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCATCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACAAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os01g28184 ATGCCGCCGCCGCCTTCGCCGCCGCGCGCGCAATGCCACCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCACGCCGCCGAGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAATGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACATGAATGAGAACGAGCGAACGAACGTGAACGAGCTAGGGAACATGGCTGACCGCAATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAAGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGAAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACTCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAACCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCTAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGAACTATAAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCATGAGCTGCTGCAGTCCCAACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTTATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACAGAAACACAATTCACTGGTCCTTACCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os01g25120 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGTACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGTAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCTGAAGCCACCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGTGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGCCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACTGGTGAACAAGGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATACCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCTTCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAATTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTTAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAATCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAATCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGACCAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGATGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTAAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os01g18190 ATGGCCAGAAACAAAGACAATGCCACCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCAATGCATAAGTGGGAGGAGATGGAGGCAAGTTTGATCGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTCTGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGTAGCCTCTTCTCAGGGCACATTCCTACCCGACAGAGAGAAGGATGAGCTGTCACTCGCCCTACAGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATTGGATTTAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGTGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGTATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCGCACATCGGTCCCAGGATCCCCAGCCGTACATTCATCCTGCAATGGTCAGCCCATCAGGAAATCGTAGCAGCTGCGCCTCAATGGGGCAGGTCGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAAACCACCTGCCCCGTTGATGAGATCCTGCAGCGGACATCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTGGCGTCGAGAATGACCATCCCAACGGACCCTTCCGAGACTTACCACTACAGACCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATCATACTATGGCGCAAGCGGTACATCATCCTTCCTGGGCAACAAGCGGCATCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTGCACCATCTCCTCCGGTTCCTCCGGCACGTCCTCCTGCACCATCTCCTCCAGCTCCTCCGCCACCTCCTGCTGCACCATCTCCTCCGGCTCCTCCGCCTCCACCATGTCCGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCGTCGCCTGCCCGCACAAGAGAAACGAAGAAGGCAAAAGTTGACGCCACCAAAAACAAGGAGCCACCGTACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAGGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCACAACAAACAAGGAGGCGTTACAGATATCAGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACTAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCGAAGATTTTGGCATAACGGAATTTATTTCAGACACCGGTCTAACTGTGGATCAGTTGGTTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCAGTAAACCACTTGTCAAACCTGAATAG >LOC_Os01g31960 ATGGCTATCCCTGGCCGCATTCATCATGAGGATTATATTCCAGATGATTATGCGAAAATGCAACCACAACATGTGAATGAAGGGTTCAAGACATACGATTTAGACTTCCTGACATGTGATGGTTTAGCTGTACTTGGGGATGCGGTGGAATATATAATACTATGGCACAAAAAGGATATAATCTTTGGGACCTCCATCGATGCTCCGCTGAAACCACCAACACCTCCACAAAAGAAATCGGCCCCTCATGAGGTTGAAAAAGATAGCAAAGAACATGAGGTGGCACCTTGTGATGGACACATTGAAAAAATGGTTGATGAACTTGCTAGAGAGGAATACATTCCAACGGATGAAGTACCGGCGAAGTTTGAAAATGGAAAGTCGTCTGGTCCAATCACATGCTTGAAGAAGGTCCACAGGAGATGA >LOC_Os01g22200 ATGGCCATCCCAACGGACCATTCAGCACCATCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCGCAAGCTCCTCGTCCGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGATGCCGCCAAGAACAAGGACCCAGGGTACGATTACACGCAAGAGGAGCTTGACGCTTATGTGGCATCAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCAAGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTTCCCTCAGCTTAGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGATTTTGGAATACAAGAATTTATTAATGACACCGGGCTAACTACGGATCAATTACTACGAGGCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCGAGCCTGAGCAGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAACTGTACATGGAGATGAGCGCCACCAGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTATCTGGATCAATTTCAAGGGTGTCTACGAACTATGCCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCAGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACATTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTACACCGTCAACGTATACGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGTGGAAGTTCAATTTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGCGGTACAAGAACAACTCATGGGATTCATCTACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACTGA >LOC_Os01g18550 ATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCGATGGTGAGCCCTTCAGGCAATCGTAGCAGCTGCGCCTCAACAAGGCAGGTAGAATCACAGAGCATGGACGCCATGCAAACCCAGGACGAAACCACCTGCCCTGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATAAAGGTGGCGTCGGGTATGGCCATCCCAACGGACCCTTCGGGGACTTACCACTGCAGGCCGATTCTAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTGAAAGGCGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCGATACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCTGCCATATCCTCCTCAGGCTCCTGCACCGTCTCCTCCTCATGCTCCAGCACTGTCTCCACCTCAGGCTCCTGCACTGACTCCTCCTCAGGCTCCTACACCGACTCCTCCGCAAGCTCCTTGTCCGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCAAAAAACAAGGACCCAGGAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAGTATCCACAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAGTTAGCTTTTATTGTCTTCCTATACCAAATTTCATCCCCGTACGAACATGCTAAGTGTTTCATATGTAATGCATCTGACGCACATTGCAGATTCCACTGGGTCCTTTTACTCTTCGACTTGGAGGCCTGCACTGTCAACGTAAATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAAGTTTTCGAACTTATAGACAGCGCTTGGTATCGGTTCCGTCATTTGGTCCGTGGCAAATGGAGAGAAAAGTTTAATTTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTATGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCACATGAGGGATAACCTCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTGATGGGATTTATCAACGAACAAATCCTTAATCCCAAGGGTGAATTCTACTACAACAGAAATACAATTCATATGTCCTTAGCTTCTGAGATAACGACTAGTACTACGTCGAAATTGGAGTTAGCTAGGACATCATAA >LOC_Os01g28070 ATGGCCATCCCAACGGACCCTTCAGGGACTTACCACTGTAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGCATCTACGAGACACAAGCCACGCCATTATACTGTGGCGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCATGCACCATCTCCTCCGGTTCCTCCGCCACGTCCTCCTGCACCATCTCCTCCGGCTCCTCAGCCACCTCCTCCTGCACCATCTCCTCCAGCTCCTCCGGCTCCTCCACCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCGCCTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCACAACAAACAAGGAGGCCTTAAAGCTATCGGACTATGACCGAACACTTCAGAAAGCCTATCATAAGAAGTCCAAACCAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGCTGATTGGAGGTGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCACGCCTGAGCAGTTGCAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAAGAGAAGATATTCTCTGGATCCATTTCAAGGATGTCTCCGATCTGTACCATCTGGACGCCCTCGACGTCTCTCTTCTAAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCAACAGCGGGGGGTTTATGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTTCATACTACTGCCGTACAACATAGAATGA >LOC_Os01g34360 ATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTATATGGAGATGAGCGCCACCGGTAGAGGGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATATCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACATAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCAAACTTATAGACAGGGCTTGGTATCGGTTCCGTCTTTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATGGGTCCTTAGCTTCTGAGGTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os01g29850 ATGCATAAGGAAAATCCAGTGCCGGAAGTGCCACCGGAGATTGAAGTGACGGAGGTGCCCATGGAGATTGCAGTGCCGGATGTCCAAATAGAGATTAAAGTGGCAGAACCAGAGGTGCAATTTGTGGTATCAGTCGGGACAGATATAGAAGAAGTACCAGGATTGCAATGGGACGGTACAGAGCCAGAAATATTTGAAGACCCTTCTCCTGCGAAAGACCCCGAGGTGCAAGAGACCCCGGTCCCTGAGAAGGCCACTACCAGTTCTGAGGTGCCTAGAGTGCTTAGGAGCCACGACTACAAGTCCAAATATGAGAACAAGGAGAAGTTCATGGTAACCGTCTTCAGAGGGGGTAAGGAACGTGCCAAACACAAAGATGATGACCCCCAGAAGGCCGCTGAACTAGCCGGGCCAACATACTGGCTAACTGATGATTGCCCGGAAAAGATGCAAAACATGGATGCTAAGAAGAAAAAAGAACCTATTGGCTTCTTGGATCCAACTCAGATCTGTCAAACACAGCATACCGTGAGGCTAGCACCAGGGTCAGACCAGCTGAAGGGCAAGACTCCAAAAGAGATAGCTGAATATCAGAAGGGCCTGCACAAGGAGAAGTTGATTACTGTCGCACAGTACATTGAACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTCATAATTTTGACGATCATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGACCCTCTCGATTACAAACACCAGTCATACAAAGAATTTCTAACAATCTTACAGTATGTGTACCAATACTACAAGTTCAAGGGTGGAGAACAGACCCGAATAAGAGAGGAGCTGCTATGTCACAAGCAACCTAGAGGAACTGTCCTCTGCGAGTATTACGCGTGGGAATTCCTTAGGGTTAATGGGAGGTATAGGGTTAACGCAGAGGATTTGCCAAGATTAGAACGTCGAACAAGCTTTGACGATACAGGCATCACAAATGTCCAGCATGATCTGTGCCACTTCATCCACTCTGAGTGCTGTCATGTGAAAGGAGATTTCTTCGACCCAGATGGTGCCCTAGCGACAAGTGACGAATTCAAGGATCTTCTGGAGTGGAACACTGCTATGCCATAA >LOC_Os01g33609 ATGGCCGATAGTACTAAAGGGACTGAAGAGAAGGGTTTAGGGAAGGGAGAGCCATCCCTTGCTGTTGTGGTTGCTCCGGAACCAACGGTCCCACCGGAGGATAGTTATGACAGCGACGTAGCTGACGAAGACGATGAGTACTCGTCGCCAATCAATCCTTGTCCAAGCCCAAGCCTGAAGAGAAGGAAAAAGGGCGACGGTGAAGAAGGCGACAAGGACTACATTCCCCCTAAAGAAGGGGAAACGGTGCCATGGCGATCAAAATGGCAGCCAAAGAAAAAAGATCTGTCGAAAGACGATGAGGTACCAGCTAACACAACCGGCTCAAAGAAAAGCGAACGGCCAGCAAAGGCGATGAAAAGGAAGGGCGAGAGAAGCGTGAATAGAAAGGATGAAGGGTTCCATGTTGTTAGCCATGTTTCGCCAAAAGGAGAGCCGCTCGCCCCTAAGACGGCACGTGCGAAATTCAGTTCACAGTGTGGCATAATAGTAAGGGAAAAGATCCCCATCACGGTCAAGGACTGGGATCATAAGAAAGGATTTTTGAAGCCTAAGAGGGAGAAAGATGTGCTAAGTACGGCGCTGGGTACTCCTGAGCATGGGGGTAGGGTTCGAGAAGTGACGTCCAAGATGAGTTGGAAGGAAGGGTTCAAACATGACCCCCACAAGAAGCGTGAAGCATACAAGGATAAACTTAGAGACGAAGGGGCTGCGGATTTTGAAAGGCAAATGATATTGCACGTTCCCATTGGACGCTCCGGGAAAACTCTTGAGGCCGCTATAGCCATTGCTATCCCTGGGAGAACATATAATGAAGAGTTCATACCCGATGCGTATGCCAAAGTGCAGCCGCAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTTCCCTAATGCAGATGGTGTATCCCACAAGAATGACATATCCTTTGGATTGGGCACCGACGCCATGCGAAAACCTGTGGTGCCAAAACCGGGGTTGGAAAAACCTCCGAGACCTCCTAAGAAGAAGAACCAAAGGTGCAATTTGTCATCAGTCAGGACAGAAATAGAAGAAGTACCAGGATTGGAATGGGACGGTACAGAGCCAGAAATATTTGAAGACCCTTCTACTGCGAAAGACCCCGAGGTGCAAGAGACCACGGTCCCTGAGAAGGCCAGTACCAGTTCTAAGGTGCCTAGAGTGCTTAGGAGCCACGACTCCAAGTCCAAAGATGAGAACAAGGAGAAGTTCAAGGTAACCGTCTTCAGAGGGGGTAAGGAACGTGCCAAACTCAAAGATGATGACCCCCAGAAGGCCGCTGAACTAGCTGGGCCAACATACTTGGCAACTGATGATTTCCCGGAAAAGATGCAATACATGAATGCTAAGAAGAAAAAAGAACCTATCGGCTTCTTGGATCCAACTCGGATCTGTCAAACACAGCATACCGTGAGGCTAGCACAAGGGTCAGATCAGCTGAAGGGCAAGACTCCAAAAGAGATAGCTGAATACAAGAAGGGCTTGCACAACGAGAAATTGATTACTGTCGCACAATACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTTAATTTAAGTCCGTTGCCAAGATTAGAACATCGAACAAGCTTTGACGATACAGGCATCAAAAATGTCCAACGTGATCTGTGCCACTTCATCCACCATGAATGCTGTCATGTGAAAGGAGATTTCTTCGACCCAGAGGGTGCCTTAGCGACAAGTGATGAATTCAAGAATCTTCGGGAGTGGAACACTGCTATGACATAA >LOC_Os01g46554 ATGCCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCGCCTTCGCCGCGCGCGCGCGCAATGCCGCCGCCGCCACGCCACGCCACGCCACCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCACAACGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGACAACGTGAACGAGAACGAGAACGATCGAACGAATGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAACGAACGTGAACGAGCTAGGGAACATGGCTGACCGCGATGAGAAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAAAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCAAACCGGCAACAGCCAATTGGCCGAAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGTTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCATTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTTCCCTGCAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCATGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCATTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGTGCAGCATTACAAGACGTTTATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os01g24270 ATGGACACTGCTACGTCTGCACCTGAACGTACGGATACATCCATAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAATTTACAACATGATTGCTCTCGATCAGGATGGGAAGCCCGTCGAGCCACCGATAGTGCGGTCCAAGTTTAGCAACACCTGTGGCACTCTAATCAGGACGCGTTGTCCCATTAATGTCAAGTTATGGGAAACGGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTACCCTCCTGGATCCGATCTAAATCGGGATTATGATCAGAAGAATCTGCCACCGTTCACGGAATTTGGACATATATTGCAGGCTGACTGGAATACGTTTGTTAAAGATCATACAACAGTTGAAGCATTGGCTTTGAGGAAAAAAAATGTCAGACCTCGCGAAGAAGAACAAATATACCCATAG >LOC_Os01g25060 ATGTCGGGCAAGACAGCTCTGGCGGGCACAGAACCAACGGTCAATAAACCTGACGGGCAGGACAGCTCCGTCGGGCACAGAACCGATGTCACTAACAATCCCCAACACGAAAAAGATGTCGGGAAGGTACCGGAGTCGAGCGAGGAATCGTGGCGCACACTGAGCGACCCATTTGAGCTAGAACTAGCGCAATTGCAGTATGAAAGACCTGAGGATGACCCGGATTATATTCCTATCGAGCAGGCGACACAGCGACCTCGGGACCACCGCGAACGGACACGACGACGAGCGGGGGAGCTTGTCCAAAGAAAAAAACGTGGCGAGAAGGGCAGGAACCTCATGTCGAAGGAGACGTACTACATTCTTGCTCTCGACGATGACGGCAAACCCGTCGAGCCGCAACATAAGAATAAGACTCCATTTGAAGAATTGGGCACCATTTTAGCAGCTGAGTGGGACAAGTTCGTGGCCAAGATGACAACTCCTCAAGCTCTAGAAAGGAGGAAGAAGATGTCGGACCTGGCGAAGAAGAACATATATCCACACGGGTTAGGGTCAAGTGGATACGCCGGTCACGAGAAGAAATGGCAAACTACGGAAGAAAAGTTTGCGGCCGAAGACAAACCTTTGATTGTGCAGCCCCTAAATAAGCAAACTAGAAATTGGGTGTGGGCAAGAACTTCGGGGCAAGTGACAGAAGAGGGTGAGATGCTGTTGGACTGTCCGGACATCCAGAACGTGACCACGTCTCTCCAACAAATCGTCCAGAAGGAAGACCGGGTCAGAGGAAAGTCGTGCAGGATGAATTGGAACGTAGGGTTTCCACAGGAAGCCCAAAGTTACAAGAAGCGCGACGCCTACAAGGCCAAGATGCGCCAGGAAATCACAGATCAAGTCATACAACAAGTCACCCAACAATTCTACAGTCTTGCCGCACAACATCCTCAAGCCTTCCCTGACCTGGTTCCTCATGGTTCGCAGTCGACACAGATCCCAAGCTCTGTCGGGTCGGTAGAAAATACAACCTACCCGATAGATAGTATAACTGGTCCGACACCATGCAGCCTTGTCGTTCCGATAGGGAGAGCGGGAAAAACAAAGGAGGTTGCGTCTGGATTGGCGATACCGGGGAGACAGTTCCATAACAGCCCAATTCCGGCGGACTATGCAAGGGTTCAGGTCGCACGTGTTAATGGCGACCAGATGTCATTGGAGCTTGACATCCCAACACCAGAGGGGATTGAACTTCTCGGGGATGCGCCGTCTCCTGCTCCTCAGTCGTATCTTGCTCTACCCCTTGACGAACATGTGCCACCTCCACAGCCAGATACATCAAAGGAGCAGCCAAAAACCTGTGAAGCCCGCAAGCTCATACCCATTATGGTATCCGCATACAACAAGGAAAAAATGGTAGAGTATAAGACACGGATGGTTTTGCAATCTTTCAAGGGTCGAGGGGGTCCGCTAAAGCCAATTGGACCTTATCAGTATTCGGACGCACAGATGAGCGTTGTAGGTCTTACTGACAAAATGCAATCTTGGACCTCCGATGAAGTGCCTAAGGAGTATGAATATGGCAAGCCGTTTTTGCCGTTCAACTTGATGTGTGAACTCCCATGGCCAATGAGGTTGATGCATGAGTGGTACTTGAGGGCAAGTGAGTTAGGTCTCGGGATGATTACTGTGCATGTCCCGGAAGGCGCTTTCAAGGATGGACCTAACGCAAACTTCGCCTTCAGTTTCAAGGACCTCCACGCATTCTTTAAGATGGATAAAATGAATATCAATCTCGTCGGCGCATGTTATTCTAACTTCCAAAATTCCATCAAGTCACAATGGGTAGACGCTGAAAGAACCGGGGCCTCAATCGGTTACGTAAATCCAACGATGGTTTGCGAGACGGCCCACACTGTGCGGATATCGGAGGATAGTGCGGTACTAAAGAATAAGACACCTCAGGAGAAAAATGATTACATCAAGCGTCTGCATAAGAGAAAGATGGCCGAGGTGGGAAATTACTTGGCCACCTCATTTCTCGCACATTCCGACAAACGAGTCATCATGGTCCCCTACCACTTTGGAGCACATGGCCGTTATAAGAAACATGGCGGGTACGTAAAGAATGCAAGTAGAGAGAAACTGTACATAAGGGGACATTGGCCGTGTTATAAGCAACCTAGCTTGACGAACCTATACGGTTATTACGTGTGCGAGATGCTCAGGGTTAATGGGAGATACAGAACTGAGTTTACAGATCTTCCGAGTATCCCTTATAGCACAAGCCGGTTCGATCAGAAAACGCTTATCAACTTGTGCGCGGACTTGTGCCGGTTCATTCGTCGCGACATCTGCAATCATCTAGGAGAGTTCCATGATCCTCATAGCGAACTTGCTACGGACCCCAAATTCAAGAATCTAAGAGAGTGGGAGAGGCAACATGCTGTGGACTAA >LOC_Os01g21480 ATGGTGAGCCCCTCAGGCAATCGCAACAACTGCGCTTCTACAGGGCAAGTAGGAGAACAGGGTGCAGAAGCTGCAGCAGGGCCCTCTCACGACAAACCACCCTACCCGGTTGATGAAATCACGCGGAGGACACCGTGTGACATGCATATTCCCTTTAGGAACTTATCAATCAAGGTGGCGTCGGGCATGGCCATACCAGTGGACCAAAATGGGACATTTCATTGCAGGTCGACTCCACCTTGGTACTCAAAGGTCGAAGTTGAACTGGTGGAAGAAGGCTTCGAGGATCTCGAGCTAGACATCCCAGAAGGAGACAGGGAGACGAAACTAGGAGACACAGCCCCACACCATTATACTATAGTGCAAAAAATGGCGTACGACTGCACTCCCGAGGAGACTGACAAGATCATAAGAACAGAAGTGAAGGCGCACTTCAAGCCAGGGAGTCTAAAAAAGAAGACTCCTATAGACCCGTCAGCTAAGAAGTTCTTTCAGAAGATGAGCGCACCAATCACACATACCTTACTATCGGACTATGACCGATCAATAACGAAGTCTTTTAAGAAGACAAGAGGAAAGTCCAAAGATGTCCCTCAGCTCGGAAAGCAACCAAAACAAGCAGTTGAGCCATTGTTACCACCTGATGAAAAGGAGATAAGACTATTTATGGCAGAGATGGGTCTAAAGAGGGAGCAATAG >LOC_Os01g18260 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGAAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTACAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGTTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCCAGCTCCACCGCTTGCCCACATAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACTGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os01g03590 ATGTACCAGAAGTATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTCGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACCGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCGGACAGAGATAGGGACGAGCTGACAGTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCCGGGTATCGAGCTACGAACTCAGAATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCATCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACACCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTACAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTTAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTAGATTACCCTGGAGGAGACGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGATGCCACCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACATTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGAAGGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAATGCATATTCTGGAAAGTCCAAACTAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGGAAGACATGACGATAGAAGAATTTATTATTGACACTGGTCTAACTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACCTGGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGGAATCTACGAAGTATACCAGCTGGACGCCCTCGATGTCTCTATTATGAGTTGCTGGATTTTGTAA >LOC_Os01g19590 ATGGCCAGAAACAAAGACAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCAATGCCAAAGTGGGAGGAGATGGAGGCAAGTTTGATTGAGAGGGGTATTGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTTTGGTACTATGCTTACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTTGTCTTTAACGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGTAGTGGTAGCCTCTTCTCAGGGCACATTCCGACCCGACAGAGAGAAGGATGAGCTGTCACTCACCCTACAGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATTGGATTTAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCAAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTATGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCGCACATCGGTCCCAGGATCCCCAGCTGTACATTCATCCTGCAATGGTCAGCCCATCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTCGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAAACCACCTGCCCCGTTGATGAGATCACGCAGCGAACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTGGCGTCGGGAATGGCCATCCCAACGGACCCTTTCGGGACTTACCACTGCAGGCCGATTTCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAACACGCGTATGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGATGAGACGCATCTACGAGACACAAGCCACGCCATCATACTATGGCACAAGCGGTACATCATCCTTCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTACACCATCTCCTCCGGTTCCTCCGCCACGTCCTCCTGCACCATCTCTTCCAGCTCCTCCGCCACCTCCTGCTGCACCATCTCCTCCGGCTCCTCCGGCTCCTCCGCCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCGCCTGCCCGCACAAGGGCAACGAAGAAGACGAAAGTTGACGCCACCAAAAACAAGGAGCCACCGTACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAGGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCACAACAAACAAGGAGGCGTTACAGATATCGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCGAAGATTTTGGCATAACGGAATTCATTTCAGACACCGGTCTAACTGTGGATCAGCTGGTTGGAGGCGCACCAATCCCAAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTTAAACCTGAACAGCTGCAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTCTGGATCCATTTCAAGGATCTCTTCGATCTGTACCAGTTGGACGCCCTCGACGTCTCTCTTCTAAACGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCAGAGGGTCTACGATACTGGGTTCATCGACTCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTACATACTACTACCGTACAACACAGAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCAAACTGATAGACAGGGCTTGGAATCGGTTCCGTGAATTGGTCCGCGGGACTTGGACAGAAAAACTTGGACGGAGGTTTCATTTTCCAGTGAATACATGCATGATCCAAAATTATATTGAATTAAATCTCTAA >LOC_Os02g21600 ATGTCGAACGATAAGGTTCCATCGAACGCGCCAATAGCTCCTCAAGAAGGTAACGCTCCTCAAAAATCTGGTAGCAACAAGCAGCCTGACGCTTCTAGTGAAGAAACATGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCTCGCGATGATGATCCGTACTACATACCTATGGAACAGGCCGATGGGAAGCCCGTCGAGCCACCGATAGTGCGGTCCAAGTTTAGCAACACCTGTGGCACTCTAGTCAGGACGCGTTTTCCCATTAATGTCAAGTTGTGGGAAACGGTGGATGACAACATCAAGACACTTCTTTGGAATGAGTTGCAGAAGTATTTTGTGTACCCTCCTGGATCAGAGTTAATATCGACATATGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGGAAAAAACTTGCTCATGTCATGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATTCACGAATGGTATATCAAGGCATCTAGGAAGGGTCTCGGTTTCATAAGCGTCGCCGTCCCGGAAGGTGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGTGTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACATCGTAGAGCTGAGAGAGGACTGCGAGCAATTGGTTGGCAAGACCCCTAAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGACTTAATGGTCCCCTACGCGTTCACAGACCACTACATATTATTCCTTGTATATCCAAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAAACATTTATGGAATTCCTCACTATTTTGAATTTAGCACATAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTACATCCCAGAAGCAGTTATCTGTCAGGACTGGCTGGCTGTGCTACAAACAACCACCGGGAACCAACTTGTGCGGTTATTACGTGTGCAAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCAAAATCCCATATATTGCACAACAATTCAATGACAATACTATCTTGAACATGGCCGCTGACCTCTGTCGATTCATCCATCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTAG >LOC_Os02g37740 ATGAAGGTGGCGTCGGGCATGGCCATCCCAACAGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGGCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGATGCCGCCAAGATCAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGTGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAAGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTACCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACAAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os02g54400 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCGACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTTAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATAGCCATCCCAACGGACCCTTTAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGTACCTCGAGCTGGATTACCCTACAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCGCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGTGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTTCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTTAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCTCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os02g17160 ATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTGTATTATGAGTTGCTGGATTTTAATGGAGATTCAAGGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os02g36010 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACACGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCAAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATACAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAATTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTAACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os02g16590 ATGGCGGCTCTCACCGTCGCACGGTGGGAATGGCGCTCCGGCGGCGAACCTCGACGGAGGAGGGGTGGACGGGGTGGATCTCGGTCACGTGAACTCGACGGCGGCGACGGTGCGATGGCTGATCGCGATGAGGAACAGATATACAATCGCAGAGGGAAGCAGCCATACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGGGAACGATGAGGAGGAGGCTAATGGAAGTCATCTCTCCGCTGGACAGAAGAGGGCACGCGGACAACGAGGTGCCCCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGAAGATGGCCGACCTAGTGCCCCGGCAGAAGCAGCCAAGAATTTTGTACGCCACAGCGGTTGGGTTGTGAGGGACAACGTGCCTGTCAGCACGGTGTACTGGCACAGAACAAGGGCACGTGGGGATAATGACAGCTTTGTCTCGGACTCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTCACGCTACCCGTGGGTACGGAGAACATAGTGAAACAGTGGACTCTGAAGAAAATGGCAGAACAGTTCCAGAGCTTCAGGGGAGATCTCTACAAGAAATATATCCTGAAGGGACTAACACCGAACTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGCCAGAAACAAAGACAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCATCGCAATGCCGAAGTGGGAGGAGATGGAGGCAAGTTTGATTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTTTGGTACTATGCTCACGGTGGAACGCTTAACCTAGTTGATGGCTCCCTTGTCTTTAGCGATCAAATACGCGAGGGCACATTCCGACCCGACAGAGAAAAGGATGAGCTGTCACTCGCCCTACAGACTCCCAAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCTTGGAAGATTGGATTTAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGTGAAGATTGCAGATCTTGAGTACAGGGTGTCGAGCTACGAGCTTAGCATGCAAGAAGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCGCACATCGGTCCCAGGATCCCCATCCGTACATTCATCCTGCAATGGTCGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAAACCACCTGCCCCGTTGATGAGATCACACAGCAGACACCTTGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTGGCGTCGGGAATGGCCATCCCAACGAACCCTTCCAGGACTTACCACTACAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGAAAGCCGCGTACGACGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATCATAGTATGGCGCAAGCGGTATATCATCCTTCCTAGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCTCCGCCACCTCCTGCTGCACCACCTCCTCCGGTTCCTCCGCCACGTCCTCCTGCACCATCTCCTCCGGCTCCTCTGCCACCTCCTGCTGCACCATCTCCTCCGGCTCCTCCGGCTCCTCCGCCTCCGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCGCCTGCCCGTACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCACCAAAAACAAGGAGCCACCATACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAGGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCACAACAAACAAGGAGGCGTTACAGATATTGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCGCTCGGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGATGACCGGCGAAGATTTTGGCATAACGGAATTCATTTCAGACACCGGTCTAACTGTGGATCAGTTGGTTGGAGGCGCACCAATCTCGCAGGCGGAAGTGGCATACAAGTTTGAACTCAGTAAACCGCTTGTCAAACCTGAACAACTGCAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCGAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTCTGGATCCATTTCAAGGATCTCTTCGATCTGTACTAG >LOC_Os02g51230 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCTTCGCCGCCGCGCGCGCAATGCCGCCGCCGCCACGCCACCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGATCGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAATGAACGTGAACGAGCTAGGGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTTCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGTTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCTAGCATCGACTCCTCCTCAGGATCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCACCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACCCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAGAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACATCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTTAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGCTAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACTGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os02g14550 ATGGCCGATAGTACTAAAGGGACTGAAGAGAAGGGTTCAGGGGAGCAGGAGCAGTCCCTTGCTGTTGTGGTTGCTCCGGAACCAACGGTCGCACCGGAAGGTAGTTCCGACAGCGACGTAGGTGACGAAGACGAGGAGTACTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGGCGACGGTGAAGAAGGCAACAAGGACTACATTCCCCCTAAAGAAGGGGAAACAACGCCATGGCGATCAAAACGGCAGCCGAAGAAAAAAGTTCCGTCCAAAGACGACGACGTACCAGCTAACACAACCGGCACAAAGAATAGCGAACGGTCAGCAATCACGAAGAAAAGGAAGGGCGAGAGAAGCGTGAATAGAAAGGATGAAGGGTTCCATGTTGTTACCCATGTTTCGCCTAAAGGAGAGCCGCTCGACGCTAAGACGGCACGTGCGAAATTCAGTTCACAGTGTGGCATAATATTAAGGGAAAAGATCCCCATCACGGTCAAGGACTGGGATCATGTATCAAATGGGGATAAGGAAGTCCTATGGAAAGAGTTGAAGAAAATCTTCCAGTTCCCGGATGGATCAGAGGCAGCATCTTGGCGTGGTTGGAAAACCACCTTGAACAAGAAATTTGTGAAGACGGGACGCACACCATTTTCGACGTATGCCAACATAACCCCCAATCAGTGGGACGACTTTCTGACCTTGAAGAACTCTCCAAAAGAAATTCAAAGGAGCCAAAAGTATGCAGAGTTGGCCAAGAAGAACAAATTTCGTCATCGCTTAGGCTCCGCGGGATACGCACCAATGGTGGAGCAGTGGACTAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAACCGGTACCAATGGAGGAGTGGACACAGAGATCAAGGAACTGGGATAAACTTAGAGACGAAGGGGGTGCGGAGTTTGAAAGGCAAATGATGGATTTCTACGTCAAGCACATGATTTTGCCTCGCCCCGAAACCAAAGAATCTGAGCTAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCCATTGGACGCTCCGGGAAAACTCTTGAGGCCGCTACAGCCATTGCTATCCCTGGGAGAACATACAATGAAGAGTTCATACCCGATGCTATGCCAAGGTGTAGCCGCAAGTGGTTCACGAAGGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACCGACGCCATGCAAAAACCTGTGGTGCCTAAACCGGGGTTGGGAAAACCTTCGAGGCCTCCTAAGAGGAAGGTGACTGATAAGGCGGAGGAACCAGAGATGCAAAAGGAAAATCCAGTGCTGGAAGTGCCACTTGAGATTACATTGCCGGAGGCAGCCATGGAGATTGCACCGCCGGAGGCAGCCATGGAGATTCCAGTGCCGGATGTGCCCATGGAGATTACAGTGGCAGAACCAGAGCCAGAAATATTTGAAGACCCTTCTCCTGCGAAAGACCCCGAGGTGCCACGAGTGCTTAGGAGCCATGACTCCAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACCGTCTTTAGAGGGGGTAAGGAACGTGCCAAGCTCAGAGATGACGACCCCCAGAAGGCTGCTGAACTAGCCGGGCCAACATACTTCGCAACCGATGATTGCCCGGAAAAGTACGAACATGGGAAAGCACTCTTGCTGGAATGGGCACTGAAAGAAGCACCATGGGAGATGAGAAGGTTACATAACTTCTATATGGAGGCCAGCAAAAAAGGCTTGGGCAATATAACAGCTCGATCACCGGCAGATTGTTTCGGCAAAGAAGGTTACGTATGGCTAGATTTCTCAGATCTCCACGCCATATATCGTCAGGATAAGATGGACGTCAACTACGTTGGTATTTGGTGCATGATGCATTACATGGATGCTAAGAAGAAAAAAGAACCCATCGGCTTCTTGGATCCAACTCGGATCTGCCAAACACAGCATACCGTGAGGCTAGCACCAGGGTCTGACCAGCTGAAGGGCAAGAATCCAAAAGAGATAGCAGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCGCACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTTAATGTCACAAGCAACCGCAAGGAACGGTCCTTTGCGGGTATTATGCGTGCGAATTCCTTAGGGTTAATGGACGGTACAGGACTAACGCGGAGGATGATGGGTGAGTGGGCCCGGTCTAGGAGAGGCAGGACGTTACATAATGGTATCACAAACTATGCCCAAGAAAAACTGCCAGGTGTAAGTGGGCCTAGCCTCACCGACCGGGAAATCCTTGAAAAACTGACAGATATAAGTGGGCCTGGCCTCACCGATCGGAAAATCCTGGGAGAGGCAAGAAAAACTGCCAGATGTAAGTGGGCATAG >LOC_Os02g17740 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAACCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAATGTGCCTGTCAGTACGGTGTACTGGCGAAGAATAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAGGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGATGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCTACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACATAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCATCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGTTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACATGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os02g25370 ATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGAACATAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATACATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGATGAGTTCGTTGCTTATAAGACAAGTCAACAAGGGCAAGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGATCAGGCGGCTATAACATCGAGATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGCCCTTCAGGCAATCGAAGCAGCTGCGCCTCAACGGGGCAGGCCGATTCCAGCAGAATACTCCAAGGTCGAAGTTGAGTTGGTGAAAGCCACGTACGAGGACCTCGAGTTGGACTACCCTGTAGGAGACGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCGCAAGCTCCTCGTCTGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAAAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCCTGATGCTTATGTGGCATCAGAAGTAAGGAGACAATTGAAGCCTCGAAGTTCAGAAAAGAAGATTCCTATAGACCCGAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGCGGACTATGAGCGAACACTTAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGAATTTGGAATACAAGATTTTATTAATGACACCAGGTTAACTACGGATCAATTGCTACGAGGCGCGCCAATCGAAAAGGTGGAAGTGAAATACATGTACGAACTCAGTAAACCGCTTGTCAAGCCTAAGCAGCTGCAGTCCCTACCGACACAAATGTACAAATTCCATCAACTGTACATGGAGATAAGCGCCACCGGTAGAGAGATGATCGGAGCGATGATCAGGGACACGGACTTCTTGCAAGGAGAAGATATTCTCTGGATCAATTTCAAGGGTATCTACGAACTATACCAGCTGGACGCCCTCGATGTCTCTATTATGAGTTGTTGGACTTTAATGGAGATTCAAAGGGCCCGACGGTGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACATCACAATGCTCGACCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGATGTTCATACTATTGCCATACAACACAGAGTTAGTTTTTACTGTCTTCCTACCAAATTTCATTCCCGTACGAACAAGCTAA >LOC_Os02g37620 ATGCTCGAGACGTTCACGCTACCCGCGGGTACGGATAACTTAGTGAAACAGTGGACTCTAAAGAAAATGGCAGAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATGCATCCTGAAGGGACTAACACCGAACTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAATTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGCCAGAAACAAAGAAAATGCCGCCAAGAAGAAATACCATCACTACTTGGGGTCAGGCGGATATAGCGTCGCGAAGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTTGTCTTCAGCGATCAGATACGCGAGGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCGCACATCGGTCCCAGGATCCCCAGCCGTACATTCATCCTGCAATGGTCAGCCCATCAGGCAATCGAAGCAGCTGCGCCTCAACGGGGCAGGTCGGATAACAGAGCATGGACGCCATGCAAACCCAGGACGAAACCTCCTGCCCCGTTGATGAGATCACGCAGCGGACACCATGTGGCGTCGGGAATGGCCATCCCAACGGACCCTTCCGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCAAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGGGACGATGAGACGCATCTACGAGACACAAGCCACGCCATCATACTATGGCGCAAGCGGTACATCATCCTTCCTGGGCGACAAGCGGCATTTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTGCACCATCTCCTCTGGCTCCTCCGCCACCTCCTGCTGCACCATCTCCTTCGGCTCCTCCGCCACCTCCTGCTGCACCATCTCCTCCGGCTCCTCCGCCTCCTCCGCCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCGCCTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCACCAAAAACAAGGAGCCACCATACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAGGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCAAAACAAACAAGGAGGCGTTACAGATATCGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACTAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCGAAGATTTTGGCATAACAGATTTCATTGCAGACACCGGTCTATCTGTGGATCAGTTGGTTGGAGCCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCACTTGTCAAACCTGAACAGCTGGAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCAACGGTAGAGAGATGTTCGGGGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGACGATGTTCTCTGGATCCATTTCAAAGATCTCTTCGATCTGTACCAGTTGGACGCCCTCGACGTCTCTCTCCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTCTACAATACTGGGTTCATCGACCCTCGGAAAATCAACTCCGAAATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTACATACTACTGCCGTACAACACAGAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCAAACTGATAGACAAGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTTACTTTCCATGTGCAAAGCAGGAACAGGGAACTAACTTATGCGGCTACTACATATGCGAGTATGCCCACTGCCTATCAAACCAAATATGCACAACACGAGAGCTCGATCGTATTCACACGAGGGATAATCTCCCACACAAGAATTTTATCACGGCTGTTCAAGAACAACTAATGGGATTCATCAACGAAGAAGTCCTTAATCCCGACGGTGAATTCTACTACGACGGATCAATAATTCATAACGTCGGTCCTTCCTCTTCTGACATAACGCCGGCGTCGAAGTCGAAGTCGTAG >LOC_Os02g24300 ATGAGCACCAGCGGTAGGGAGATTATCGGAGCGAGGATCAAGAACGCCGACTTCTTACAAGGAGAAGATGTTCTCTGGATCAATTTTAAGGATATCTACGAACTATACCAGCTAGACGTCGTCGACGTCTCTCTTCTGAGCGCATGGATTTTGGCTTGGTATCGGTTCTGTCATTTGGTCCGCGGCACTTGGAAAGAAAAACTTAGCCAGAGGTTCAAATTTCCATGTGCAAAGCAGGAAGAGGGAACTAACTTGTGTGGCTACTACGTATGTGAGTATTGCCACTGCTTTGCAACTCAAATCATCACCACAAGAGAGCTCGATGTTATTCACATGAGGGACAACCTCACACACAAGGACTTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAAAGAACAAGTCCTTAATCCCGAGGGTGAATTCTACTACGACAAATCTACAATTCATAAGACGTTATCTTCTGAGATAACGACTACGTCGAAGTCGTAG >LOC_Os02g07100 ATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCAACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACACATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATGAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCGCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTACACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAACTTGGAGGGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTATGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACACCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCAAACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCATCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCATAG >LOC_Os02g53930 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAACCGTAG >LOC_Os02g15330 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGATTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGCTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCCGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCATCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACATAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCAGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGTTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATTAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACATCTCTATTATGAGTTGCTGGATTTTATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAATTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os02g30390 ATGGCTGATAGTACTAAAGGGACTGAAGAGAAGGGTTTAGGGGAGCAAGAGCAGTCCCTTGCTGTTGTGGTTGCTCCGGAACCAACGGTCCCACCAGAAGATAGTTCCGGCAGCGACGTAGCTCACGAAGACGATGAGTACTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGGCGACGGTGAAGAAGGCGACAAAGACTACATTCCCCCTAAAGAAGGGGAAACGGCGCCACGGCGATCAAAACGGCAACCGAAGAAAAAAGTTCCGTCGCAAATTGACGAGGTACTAGCTAACACAACCGGCTCAAAGAAAAGCGAACGGTCAGCTAAGGCAAAGAAAAGGAAGGGCGAGAGAAGCGTGAATAGAAAGGATGAAGGGTTCCATGTTGTTACCCATGTTTTGCCAAAAGGAGAGCCGCTCGCCCCTAAGACGGCACGTGTGAAATTCAGTTCACAGTGTGGCATAATATTCCCGAATGGATCAGAGGCAGCAGTGAGGAATTGTGCACTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAACCATCTTGAACACAAAATTTGTCAAGACGGGACGCACACCGTTTTCGATGTATGCCAACATAACCCCGAATCAGTGGGACGACTTTCTGGCGTTGAAGAACTCCCCGGAAGAAATTCAAAGGAGCCAAAAGTATGCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGTTCCGCGGGATACGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAACCAGTACCAATGGAGGAATGGACACAGAGATCAAGGAACTGGGTAAGAGCTAGAACTCCTAAGATCACGGATGAAGGAAAAGTATCGTTTGAAGATCCGGAGCTGCAGAGCGTTGCTGATAAAATAGAGAATTTATCCAGTTCACAGAAGAAAGGATTTTTCAAGCCTAAGAGGGAGAAAGATGTGCTAAGTACGGCGTTGGGTACTCCTGAGCATGGGGGAAGGGTTCGAGCCATTGCTATCCTTGGGAGAACATACAACGAAGAGTTCATACCCGATGCATATGCCAAGGTGCAGCCGCAAGTGGTCCACGAAGGGTTTGAATCCTATGACATTGACTTCCCGACTGCAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACGTATCCTTTGGATTGGGCACCGACGCCACGGAAAAACCTGTGGTGCCAAAACCGGGGTTGGGAAAACCTCCGAGACCTCCTAAGAGGAAGGTGACTGATAAGGCGGAGGAACCCGATATGCAAAAGGATAATCCAGTGCCGGAAGTGCCACCGGAGATTGCAGTGCCGGAGGCAGCCATGGAGATTCCAGTGCCGGAAGTGCCCATGGAGATTACAGTGGCAGAACCAGAGGTGCAATTTGTGGCATCAGTCGGGTCAGAAATAGAAGAAGTACTAGGATTGGAATGGGACGGTATAGAGCCAGAAATATTTGAAGATCCTTCTCTTGCGAAAGACCCCGAGGTGCAAGAGACCATGGTCCCTGAGAAGGCCACTACCAATTCTGAGATGCCTAGAGTGCTTAGGAGCCACGACTTTAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACCGTCTTCAGAGGGGGTAAGGAACGTGCCAAGCTCAGAGATGATGACCCCCAGAAGGCCGCTGAACTAGCCGGGCCAACATACTTCGCAACCGATGATTGCCCGACTGAGTACGAACATGGGAAAACACTCTTGCCGGAATGGGCACTGAACGAAGTACCATGGGAGATGAAAAGGTTACATACCTTCTACATGCAGGCCAGCAAGAAAGGCTTGGGCAATATAACAGCTCGATCATCGGCAGATTGTTTTGGCGAAGAAGGTTACGTATGGCTAGATTTCTCAGATCTCCACGCCATATATCGTCGGGATAAGATGGACGTTAACTACGTCGGTGTTTGGTGCATGATGCAATACATGGATGCTAAGAAGACAAAAGAACCTATCGGCTTCTTGGATCCAACTCAGATTTGCCAAACACAACATACCATGAGGCTAGCACCAGGGTCAGACCAGCTGAAGGGCAAGACTCCAAAAGAGATAGCTGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCGCACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGCCAAAATAAGAGAGTCGTCATGGCTGCTTATAATTTTAACGATCATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCGTGTGCGTACCAGTACTACAAGTTCAAGGGTGGAGAACAGACCCGAACAAGGGAGAAGCTGCTATGTCACAAGCAACCGCAAGGAACGGTCCTTTGCGGGTATTACGCTTGCGAATTCCTTAGAGTTAATGGGAGGTACAGGACTAACGCGGAGGATTTGCCAAGATTACAATGTCGAACAAGCTTTGACGATACAGGCATAAAAAATGTCCAGTGTGATCTGTGTCACTTCATCCACCATAAGATGTCATGTGAAAGGAGATTTCTTCGACCCAGAGGGTGCCCTAGCCACAAGTGA >LOC_Os02g25520 ATGGCTGATCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTATTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGAGCACGTGGAGAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGCTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCCGCAAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGACGAAGACGGCCGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGCAGAACAAGGGCACGCAGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGATGTGGACCACAATGCTCGAAACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCAACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAAAAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCTGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCATCGTGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCCCTGGGCACGTTCCGACCGGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGAGAAATGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTATAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGTAGGCCGATTCCAGCAGGATACTCCAAGGTCAAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGCTCCTGCACCGACTCCTCCTCAGGCTCCTACACCGACTCCTCCTCAAGCTCCTCTTCCGGCACCTTCCAAGTCAAGGGCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACACCGCCAAGAACAAGGACCCAGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATTAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCAGGAACTTCTTCAGGGGTATGTATGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTCAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACTAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGATTTTGGAATACAAGACTTTATTAATGACACCGGACTAACTACGGATCAATTGCTACGAGACGCACCAATCGAAAAGGCGGAAGTGAAATACATAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTTGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGATGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGTGCGCAAAGCAAAAGCAGGGAATTAACTTGTGCGGCTACTACATGTTCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTTGATTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCATAGGTCCTTATCGTCTGAGATAGCGACTACTACTACGTCAAAATCGTAG >LOC_Os02g13250 ATGGCCGATAGTACTAAAGGGACTGAAGAGAAGGGTTTAGGGGAGCAGGAGCAGTCCCTTGCTGTTGTGGTTGCTCCGGAACCAATGGTCCCACCGGAAGGTAGTTCCAACAGCGACGTAGGTGACGAAGACGAGGAGTACTCATCGCCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGGCGACGGTGAAGAAGGCGACAAGGACTACATTCCCCCTAAAGAAGGGCCTAAAGGAGAGCCGCTCGCCCCTAAGATGGCACGTGCGAAATTCAGTTCACAGTGTGGCATAATAGTAAGGGAAAATATCTCCATCACGGTCAAGGACTGGGATCATGTATCGGATGGGGATAAGGAAGTCCTATGGAAAGAGTTGAAGAAAATCTTCCAGTTCCCAGATGGATCAGATGCAGCAGTGAGAAATTGTGCACTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAACCACCTTGAACAAGAAATTTGTGAAGACGGGACGCACACCATTTTCGACGTATGCCAACATAACCCCCAATCAGTGGAACGACTTTCTGACCTTGAAGAACTGGCCGGAAGAAATTAAAAGGAGCCAAAAGCTCCGCGGGATACGCACCAAAGGTGGAGCAGTGAACAAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAACCGGTACCAATGGAGGAGTGGACACAGAGATCAAGGAACTGGAAAATTTATCCAGTTCACAAAAGAAAGGATATTTCAAGCCTAAAAGGGAGAAAGATGTGCTAAGTACGGCGCTGGGTACTCTTGAGCATGGGGGAAGGGTTAGAGAAACTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTACACGTTCCCATTGGACGCTCCGGTAAAACTCTTGAGGCCGCTACAGCCATTGCTATCCCTGGGAGAACATACAATGAACAGTTCATACCCGATGCGTATGCCAAGGTGCAGCCACAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTACCCAACTGCAGATGGTGTATCTGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACCGACGCCACGCAAAAACCTGTGGTGCCTAAACCGGGGTTGGGAAAACCTCCGAGGCCTCATAAGATTAAGGTGACTGATAAGGCGGATGATCCAGAGATGCAAAAGGAAAATCCATTGCCGAAAGTGCAACCGGAGATTGCATTGCCGGAGGCAGCCATGGAGATTGCACCGCAGGAGACAGCCATGGAGATTCCAGTGCCGGATGTGCCCATGGAGATTACAGTGGCAGAACCAGAGAGCCAGAAAATATTTGAAGACCTTTCTCCTGCGAAAGACCCCGAGGTGCCACGAGTGCTTAGGAGCCACGACTCGAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACCGTCTTCAGAGGGGGTAAGGAACGTGCCAAGCTCAGAGATGACGACCCCCAGAAGGCTGCTGAACTAGCCGGGCCAACATACTTCGCAACCGATGATTGCCCGAAAAAGTACGAACACGGGAAAGCACTCTTACCGGAATGGGCACTGGAAGAAGCACCATGGGAGATGAGAAGGTTACATAACTTCTACATGGAGGCCAGCAAGAAAGGCTTGGGCAATATAACAGCTCGATCACCGGCAGATTGTTTCGACGAAGAAGGTTACGTATGGTTAGATTTCTCATATCTCCACGCCATATATTGTCGGGATAAGATGGACGTCAACTACGTCGGTGTTTGGTGCATGATGCAGTACATGGATGCTAAGAAGAAAAAAGAACCCATCGGCTTCTTGGATCCAACTCGGATCTGCCAAACACAGCATATCGTGAGGCTAGCACCAGGGTCTGACCAGCTGAAGGGCAAGAATCCAAAAGAGATAGCTGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTAATGTCGCACAGTACATTGGACGAACCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTTAACGATCATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGATCCTCTCAATTACAGTCACAGGCAATACAAAGAATTTCTAACAATCTTACAGTATGCATACCAATACTACAAGTTCAAGGGTAGAGAACAGACCCGAACAAGGGAGAAGCTGCTATGTCACAAGCAACTGCGAGGAACGGTCCTTTGCGGGTATTATGCGTGCGAATTCCTTAGAGTTAATGGACGGTACAGGACTAACGCAGAGGATTTGCCAAGATTAGAATGTCGACCAAGCTTTGACGATACAGGTATCACAAATGTCCAGCGTGATCTGTGCCACTTCATCCACCATGAGTGCTGTCATGTCAAAGGAGATTTCTTTGACCCAGAGGGTGCCCTAGCGGCAAGTGACGATTTCAAGGATCTTCGGGAGTGGAACACTGCTATGCCATAA >LOC_Os02g16120 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAATTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGATCAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACACTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCACACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCAGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os02g56780 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTATCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGCAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCGCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCTAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGTGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCAACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAATCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os02g15490 ATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAGGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAATGGACCCTTACGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGATGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCTAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGTTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGGCCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACTGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGTCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os02g30770 ATGGATTTGTATATTAAATTGTCAGTTTGTGTACCTCGGCTGATTCCTGGACGAGGATTTTATGCACAAATTAGTTCGGAAATTACTAGTGAATTTCCCGGCGTGACAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACATACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAAGGTATTGAGCTACGAGCTTAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATTGTGAGCCCTTCTGGAAATCGTAGCAGTTGCGCCTTAACGGGGCAGGTAGTATCACAGAGCATGGACACCATGCAAACCCATGATGAAACCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCTAGCAGGATACTCCAAGGTCGAAGTTGAGTTGATCGAAGGCGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACACCATTATACTATGGCGCAAGCAATACATCATCATCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGCTTCAGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCAATGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCAAGCTCCTCGTCCAGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACACCGCCAAGAATAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTATGTGTCATCAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCCAGAAAAGAAGATTTCTATAGACCCGAGTGTCAAGAACTTCTTTAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTCAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGATTTTGGAATACAAGAATTTATTAATGACACCGGGCTAACTGTGGATCAATTGCTACGAGGCGCACCAATCGAAAAGGCGGAAGCGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCCACACAAATATACAAGTTCCATCAACTGTACATGGAGATGAGCACCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGTATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTATTCCCCTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAATTTTCCTTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGTGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCATAGGTCCTTAGCTTCTGAGATAACGACTACTACTACGTCGAAATCGTAG >LOC_Os02g01420 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTATCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGTTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCACACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTAAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os02g19240 ATGGCCGATAGTACTAAAGGAAATGAAGATAACTTATCTGTAGGGGAGGTGGAGTCTTCACATCCGACAGTGGAGCTATCCCTTGCTATTGTGGTTGCTCCGAAACCAACGGTGCCGCCGTCCAATGGTTCCGACAACGACGTAGCTGACGAGGATGATGAGTACTCCTCGCTAAGTGATCCTTGTCCAAGCCCGAAATGA >LOC_Os02g33990 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACTATCGAACGAACAAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAACGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACAAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTGCGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCAACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATTCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGAACTTGAGCTGGATTACCCTGGAGGAGACGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGACACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTACCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGATATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTAAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os02g28370 ATGGCTGATCGCGATGAGGAACAGATACTATACGATACAAACGCAGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGCGATGCGGAGGGGAACGAGGAGGGAAACGATGAGGAGGAGTCTACTGGAAGTCATCCCTCTGCTGGACAGAAGAGGGCACACGGACAACGAGGTGCCGCAAAGAAGATAGAGGGTCGGCACATCGTAACTGAGGTGGACGAAGACGGCCGACCTAGTGCCCTAGCAGAAGCAGCCAAGAATTTTGTACACCACAGCAGTTGGGTTGTGAGGGACAACGTGCCTGTCAGCACGGTGTACTGGCGCAGAACAAGGGCACGCAGGGATAATGACAGCTTTGTCCCGGACTCAGAAAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTCACGCTACCCGCAGGTACGAAGAACATAGTGAAACAGTGGACTCTGAAGAAAATAGCAGAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCTTGAAGGGACTAACACCGAACTTCGACGTATTCCAAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGCCAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCAATGCCGAAGTGGGAGGAGATGGAGGCAAGTTTGATTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAAGCCAGTTGATGGCTCCCTTGTCTTCAGTGATCAGATACGCGACGCTGCCAGTCGACTAACGGACGCGGTGGAAGCCTCTTCTCAGGGCACATTCCGACCCGACAGAGAGAAGGAAGAGCTGTCACTCGCCCTACAGATTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCGTGGAAGATTGGATTTAAGGAGGACATCCACACGTATAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGAAGATGGCAAGGAAGGTGGATGAACGTATGGCCGCACATCGGTCCCAGGATCCCAGTCGTACATTCCTCCTGCAATGGTCAGCCCATCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGATACTCGAGGGTCGAAGTTGAGCTGGTAGAAGCCGCGTACAAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGACACGCCATTATACTATGGTGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCATCTCATGCACCATCTCCTCTGGCTCCGCCATCTCCTCCTGCACCATCTCCTCCGGTTCCTCCGCCACGTCCTCCTGCACCATCTCCTCCGGCTCCTCTGCCTCCTCCGCCTCCTCCACCTCCACCGTGTCTGCCTGCACCACCCAAGACAAGGTCTCGCCAAGCTCCACCGCCTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGTTGATGCCACCAAAAACAAGGAGCCACCGTACGATTGTAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTTGAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTACTTCAAGGGAATGTCCGCAACAAACAAGGAGGCCTTATAG >LOC_Os02g45720 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAGCCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTAGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGAGGAACGCATGGCCGTACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCAGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTGTTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATTGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTTCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCGATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGAACTATGAGCGAACGCTGAAGAAAACATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTATGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGAGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCAGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAATGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os02g19250 ATGGACAAGTCGTGGCGTGGTTGGAAAAACACATTGAACACAAAATTCGTGAAGACGGGCCGGACACCATTTGAGACATATGCCAATATAACACCGACACAGTGGAACGACTATGTTAAGTTGAAGACCTCCCCGAAAGAAATTGCCAAGAGCAAGAAGTTTGCTGAGTTGGCCAAGAAGAACAGATTTCCTCATCGCTTAGGCTCCGGGGGGTATGCACCAAAGGTGGCGCAGTGGGCAAAAGAGGAGGAAGAAATGAGGAAGGCGGGGCTTCAGGGTAGGGTTCGAGGTGTATCGTCCAAGCTCAGTTGGAAGGAAGGGTTCAAACATGACCCCTACAAGAAATGTGACGCCTACAAGGATAGCCTAAGGGATGAAGGGGCTAAGGAATTTGAAAGGCAAATGATGGATTTCTGCATTAGGCATCTTATTTTGCCTGACCCCGCAACCAAAGAACCTGAGCCAGATTACCCCTTTGATGACCTGAAGGAGAATACACCCTGTAAGTTGCACGTTCCAATTAGATGCTTTGGAAGAACTCTTGAGGCCGCTACAGCCATTGCTATCCCTGGCAGAACATATAACGGAGAGTTCATACCCGATGAGTATGCCAAAGTGCAGTCGCAAGTGGTCCACCAAGGGTTTGAGTCGTACGACATCGACATCCCTACTCCTGATGTGCAAGATGTGCCCATGGAGATTTCAGTGCCACAACTAGATGTGCAACTTCTGGCAATAGTCGGTACAGATATAGAAGTTATACCAGGTTTGGAATGGGACGGTACAGATCTAGAAATCTTTGAAGTCCCTAATCCTGCGAAAGACCCTGAGGTGCAAGAACCCCCGGTCAATGACAAGGCCACTGAGAAGTCTGAAGTGCCTAGAGTGCTTAGGAGCCACAATTCCAAGTCCAAAGATGATCAAAAGGAGAAGTTCATGGTATCCGTCTTTAGAAGGGATGCTTTCGGCGGCAACGGTTACTTCTGGCTAGATTTTGAAGATCTCCACGCCATATATCGTCGGGAAAAGATGGACGTCAACTATGTCGCTGCTGGGTGCCTGATGCAATACATGGATGCTAAGGAGAAAAAAGAACTTATCGGATTCCTGGATCCAATTAGGATCTGTCAAACACAACATACCCGATCATTACATCTGTTTAATCATCTACCCGAAGCACGGAACCGTGACAATCTTGGACCCTCTCGATTATCGTCACCAGTCATACAGAGAATTTCTAACAATCTTACAATATGTCACAAGCAACCTAGAGGCACTGTCCTCTATGGGTATTACGCGTGCGAATTCCTCAGGGTTAATGGGAGTTGCCAAGAATAG >LOC_Os02g24310 ATGGCTGATCGCGATGACAAACATATACTATACGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACCTGAACGAGGAGGGGAACGTGGAGAGTGATGCAGAGGGGACTGAGGAGGGGAACAAGGAGGCGGAGGCTAGTGGAAGTCAATCCTCCGCTGGACAGAAGAGGGCACGCGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGAAGACGATCGACCTAGTGCCCCGGCTGAAGCAGCCAAGAATTTTGTACGACACAGCGGTTGGGTTGTGAAGGATAACGTGCCTGTCAGCAAGGTGTACTGGCGCAGAACAAGGGCACGCGGGGATTATGACAGCTTTGTCCCGGAATCAGAGAAAGATACGATGTGGATCACAATGCTCGAGACGTTCACGCTCCCTGCGGGTACGGAGAACATAGTGAAACAGTGGACTCTTAAGAAAATGGTAGAACAATTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGGCTGACACCGAACTTCGACGTATTCCCGAAGCTAAGGGATCATTGGGACGAGTTCGTCGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGACAGAAACAAAGAAAATGCCGCCAAGAAGTACCATCACCTCTTGGGGTCAGATGGCTATAGCGTCACAATGCTGAAGTGGGAGGAGATGGAGGCCGGCTTGATTGAGAGGGGTGTCGAACCGGCCACCGCTAAATGGCTGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCTGTTGACGGCTCCCTGGTGTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGATGTAGTGGAAGCCTCTTGTCAGGGCACGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGCATGGCCGCACATCGGTGCCATGATGCCCAGCCATACATTCCTCCTGTAATGGTCAGCCCCTCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCGTGCAAACTCAGGACGAAACCACTTGCCCCATTGATGAGATCACGCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTTACGTCGGGAATGACCATCCCAACGGACCCTTCAGGGACTTACCACTGCAGGCTGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAACTGGTGGAAGCCGCGTACGAGGAACTCGAGTTGGACTACCCTGGAGGAGACGGTAAGACGTATCTACGCGACACAAGCCACGCCATTATACTATGGCGCAAGCGCTACATCATCCTCCCTGGGCGACAAGCGGTGTCTCGTGCACCATCCCCTCCGGCTCCACCATCTCCTCCTCAGGCTCCTGCACCGTCTCCTACTGATCAGGCTCCTGCACCGTCTCCTCCTCAGGCTCCTGCATCGACTTCTCCTCAGGCTCCTCTGCCATGTCCTCCGGCACCTTCCAAGTCAAGAACTCACCAAGCTCCACCGCTTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCTGCCAAGAACAAGGAGCCACCGTACGATTGCACGCAAGAGGAGCTCGACGCTTACGTGGCAGAATAA >LOC_Os02g25560 ATGGCAGACCGCGATGACGAACAAATCCTGTTAGACGCGATCGTAGAGGGCAGCAATCAGTACTGGGTGGATGAGGAGGGGAACGAGGATCCCAACCAATACCTGAATAAGGAGGGCCACGAAGAGGGTAACCAGGAGGCTAACCAGAAGGGGACTGATAGCCAACCGTCGGCCGGACAGAACAGCCCACGCGGGAAAAGAGGTCCCGCGAAGAAGCTGGAGGGAAGGCACATTATTACTGAGATTGCCCCAGACAGCGAACCAGTAGCCCCGGCAGGTATAGGCCGAAAGTTTGTGAATCATAGCGATTGGGTCGTGAGAGACAACGTCCCCATCAGCATAATGTACTGGCGTCGAACAAGGTCCCGCGGGGATGAAGATAGTTTTCTCCCTGACACAGAGAAAGATATGCTGTGGACAACCATGCTAGAGACATTCACGATCCATGAGGCAAATCGTCCAAGATGCAAAGAATGGACCCTCAAGAAAATGTCAGAACTGTTCCAAAGCTACAAATCTGATTTGTACAAGAGATACATCGTCAAGGGCTTGACACCTGATTTCAAACAGCATAAGAAGCTAAGGGATCACTGGGATGTGTTTGTGGCCTATAAGACTGGAGCGCAAGGGCAAGCACAAATAGAAAAGAACAAAGCCAATGCAGCTAGGACGAAATACCATCACCGGCTAGGGTCAGGCAGATATGGAAAGGCAATCCCCAAGTGGGACAAATTGGAAGCCGACTTGATACCACGGGGTACCGAGCCGGCAATGGCTAAATGGCCTGAGCGATCAAGGAACTGGTTCTATGCACATGGTGGATCTCTCAATCCAGTTGATGGCTTCCTCATATTCGGCGATGAGATCCGAGAAGTAGCCCACCAACTTCAGGATGCAGTTGAAGCCTCTATGCAAGGGACTTTCAGGCCAGACAGAGAGAGAAGGACGAGCTCACCCATGCACTACAGAATCCTGAGCAGCCAGGACGAACGCGGGGCAAAGGCATCGTTCCTTGGAAATATGGATTCAAAGTGGACATCCACACGTATAGGAGTCGGATTAGGAGCAATAGGGATACCGAGGCTAAGATCGTTGATCTTGAGTACAGGGTGTCCACCTACGAGGCAAGGATGCAAGAGGAGGTTACGAGACAGGTGGACCAACGCTTGGCCAATGGACACCCTGCAATATGCATACTCCCTTCAGGAATTGTCTATCAAGGTGGCGTCGGGCATGGCCATACCCACGGACCCTTCGGGTACATACCATTGCAGGCCCATTCCACCTGGATACGCGAAGGATCTCGAGCTTGACATCCCCGGAGGTGACGGGGAGACGAAACTTGGAGACACAGCCCAAGCCATCATACTCTGGCGGAAGAAGTACATCGTGTTTCCCGGGCAAGAAGGTTCGTCCGCTCCTCCTTCCCCACCGCAAGCACCGTCTCCTCCACCTCCTCAGTCTCCTTTGGCTCCTTCGGCTACACCGTCACCTCCCGCTCCTCCGCCTTCACCACCTCCTCCATGTGTACCTGCTGCCAAGTCTGCACCGTCGGGTCCGCGGGAAACGACTCCTCGGCCTGCACTAGCTACCAAGTCTACACCGTCAAGGTCCCGCCCGTATGAGCCCATGCTGTCAAGACCGAAGAAGAAAGCCAAATCTGACGAGCCAAGGCTCCCCGCTCTCAAGAAAAGGGCGTATGACTTGACTCCGAAGGAGCTCGATGAAGCCGTTAGAGCGGAAGTTAGGGAGCAGTTGAAGCCACAGAGTCCGGAAAAGAAGATCCCTATACCCCCGGCGGTTCAAGATCACTTTATTAAGATGGCCGAACCGAGCAAACAGGTCGTAGTTTCTGACTACGATCGAACATTGAGGAAGGCTCTTAAAGCCAAGCCAGTAGCAGTGAAGTGTAGAAAGGAAGTCCCTCAGCTGGGATTCCACTGGGTCCTTCTTCTTTTCGACCTTGAGAGATCCAAAATCCATGTCTACGATTCAATGGATAAACCAGAGAAAACTTTCGCACATATTTTCGAAGTGATAGATAGGGCATGGATTCGGTTCCGTACATTGGTCCGCGGGATTTGGAATGAAAAACTCACCCGGATGTTCAATTTTCCGTGTGCAAAGCAAGAACAAGGGACTAACTTGTGCGGCTACTACGTCTACCATTACATGCACTGTTTAGCACACCAAATCAGGACTGGCCAGGACCTCGAAATGATTTACATGATAGATAGCCTCACCCACGATGATTTCATAAGGGCTGTTCAAGAACAGATGATGGGATTCATCAATGAGCAGATTATCGATCCCACAGGAGAATTCTATTACGATGGAAAGCCTATTCATCAAACCGGTCCTTCTTCTTCCGATGCCACGAAGTCGTAG >LOC_Os02g08280 ATGGCTGACCACGATGAGGAACAGATATTGTATGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATAAAGAAGAGGGGAATGGGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGTGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACACGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTTAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTCTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCAGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGAGTTGTACAAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCATTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGAAGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTTTCGAACCGGCAACCGCCAATTGGTCGGAACGATCGAAGTTCTGGAGTCGGATGAGGAGTAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCCGGGTATTGAGCTACGAACTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACTGTAGCAGCTGCGCCTCAACGGGGCAAGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCTGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTACAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCATCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCAGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGCGTACGATTGCACGCAAGAGGAGCTTGACACTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTTAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTAGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATAGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTATTGATACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTTTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGATAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGATCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAATTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGACCAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGATCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACTACGTCGAAATCGTAG >LOC_Os02g37730 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGCCACGCCACGCCACCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCACAACGCCACGCCGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAAGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAATTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAAATGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTTGA >LOC_Os02g21720 ATGGCCGATAGTACTAAAGGGACTGAAGAGAAGGGTTTAGGGGAGCAAGAGCAGTCCCTTGCTGTTGTGGTTGCTCCGGAACCAACGGTCCCACCGGAAGGTAGTTCCGACAGTGACGTAGCTGACGAAGACGAGGAGTACTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGGCGACAGTGAAGAAGGCGACAAGGACTACATCCCCCCTAAAGAAGGGGAAATGGCGCCATGGCGATCAAAACGGCAGCCGAAGAAAAAAGTTCCGTCGAAAGACGACGACGTACCAGCTAACACAACCGGCACAAAGAAAAGCGAACGGTCAGCAAAAGAGAAGAAAAGGAAGGGCGAGAGAAGCGTGAATAGAAAGGATGAAGGGTTCCATGTTGTTACCCATGTTTCGACTAAAGGAGAGCCGCTCGCCCCTAAGACGGCACGTGCAAAATTCTGTTCACAGTGTGGCTTAATAGTAAGGGAAAAGATCCCCATCACGGTCAAGGACTGGGATCATTTCCCGGATGGATCAGAGACAGCAGTGAGGAATTGTGCACTGCAAACAATGGCCAAGTCTTGGAGTGGTTGGAAAACCACCTTGAACAAGAAATTTGTGAAGACGGGACGCACACCATTTTCGACGTATGCCAACATAACCCCGAATCAGTGGGACAACTTTCAGACGTTGAAGAACTCCCCAGAAGAAATTCAAAGGAGCCAAAAGTATGCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCCGCGAGATATGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAACCGGCACCAATGGAGGAGTGGACACAGAGATCAAGGAACTGGGTAAGAGCTAGAACTCCGAAGATCACGGATGAAGGAAAAGTATCGTTTGAAAATCTGGAGCTACAGAGCGTTGCCGATAAAATAGAAAATTTATCCAGTTCACAAAAGAAAGGATCTTTCAAGCCTAAAAGGGAGAAAGATGTGCTAAGTACGGCGCTGGGTACTCCTGAGCATGGGGGAAGGGTTCGAGGTGTGTCGAGCAAGATGAGTTGGAAGGAAGGGTTCAAAAATGACCCCCACAAGAACCGTGAAGCGTACAAGGATAAACTTAGAGACAAAGGGGCTACGGAGTTTGAAAGGCAAATGATGGATTTCTGTGTCAAGCACATGCTTTTGCCTTGCCCCAAAACCAAAGAACCTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCCATTAGACGCTCCGGGAAAACTCTTGAGGCCGCTACAGCCATTGCTATCCTTGGGAGAACATACAATGAAGAGTTCATACCCGATGCGTATGCCAAGGTGCAGTCGCAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTTCCCGACTGCAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACCGACGCGACTCAAAAACCTGTGGTGCCTAAACCGGGGTTGGGAAAACCTCAGAGACCTCCTAAGAGGAAGGTGACTGATAAAGCGGAGGAACCCGAGATGCAAAAGGAAAATCCAGTGCCGGAAGTGCCACCGAAGATTGCATTGCTGGAGGCAACCATAGAGATTGCACCGCCGGAGGCAGCCATGGAGATTCCAGTGCCGGATGTGCCCATGGAGATTACAGTGGCAGAACCAGAGGTGCAATTTGTGGCATCAGTCGGGTCAGAAATAGAAGAAGTACCAAGATTAGAATGGGACGGTACAGAGCCAGAAATATTTGAAGACTCTTCTCCTGCGAAAGACCCCGAGGTGCAAGAGACCACGGTCCCTGAGAAGGCCACTACCAGTTCTGAGGTGCCACGAGTGCTTAGGAGCCACAACTCCAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGCACTGAAAGAAGGACCATGGGAGATAAAAAGGTTACATACCTTCTACATGGAGGCCAGCAAGAAAGGCTTGGGCAATATAACAGCTCAATCACCGGTAGATTGTTTCGGCGAAGAAGGTTACGTATGGCTAGATTTCTCAGATCTCCACGCCATATATCGTCGGGATAAGATGGACGTCAACTACGTCGGTATTTGGTGCATGATGCAATACATGGATGCTATGAAGAAAAAAGAACCCATCGGCTTCTTGGATCCAACTCAGATCTGCCAAACACAGCGTACAGTGAGGCTAGCACCAGGGTCTGACCAGCTGAAGGGCAAGAATCCAAAAGAGATAGCAGAATACAAGAAGGGCTTGCACATGGAGAAATTGATTACTGTCGCACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTTAACGATCATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCATGTTAGTCTTGGACCCTCTCGATTACAGTATACGACATCCATACAGTGCATACCAATACTACAAGTTCAAGGGTGGAGAACAGACCCGAACACGAGAGAAGCTGCTATGTCACAAGCAACCGCGAGGAACGGTCCTTTGCGGGTATTATGCGTGCGAATTCCTTAGGGTTAATGGACGGTACAGGACTAACGCGGAGGATTTGCCAAGATTAGAATGTCAAACAAGCTTTGACGATACAGGTATCACAAATGTCCAACGTGATATGTGCCACTTCATCCACCATGAGTGCTGTCATGTGAAAGGAGATTTCTTCGACCCAGAGGGTACCCTAGCGGCAAGTGACGAATTCAAGGATCTTCGGGAGTGGAACACTACTATGCCATAA >LOC_Os02g17110 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGTAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCGCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCATCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCATTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os02g30750 ATGAACGTGAACGAGAACGTGAACGAACGAAATATGGCTGATCGCGATGAGGGACAGATATTGTACGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGAGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGGGCACGTGGAGAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGCTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGACGAAGACGGCCGACCTAGTGCCCCGGTGGAAGCAGCCAAGAACTACGTACATCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTATGGTGTACTGGCGCAGAACAAGGGCATGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTATGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAATTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATCAGACAGGTCAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCAGTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGATCGATCAAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCTCTGGTCTTCAGCGATCAGATACGCGAGGCTGCGCATCGACTAACGGACGTAGTGGAAGCCTCTTCTTAG >LOC_Os02g05570 ATGTCGAACGAAAAGGTTCCATCGAACACACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTCCGGTAGCAATAAGCAGCCAGACGCTTCTAGTGAAGAAACGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCATCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCGTACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAGATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGCGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAATTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCATTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAATGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTCAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGACCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAACTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAACAAGTGCACATACCAGATGGTACTACATCCGAACCAAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGACAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGACAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os02g28650 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTATTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGATAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCATAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACACGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACTGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAAGGCATGTTCCAACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGGTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTACAGGCTGATTCCAGCAGGATACTCGAAGGTCGAAATTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGATGCATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGTCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTTGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCAGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTAAGCTAGCAGCAAGTACTACTACGTCGAAATCGTAG >LOC_Os02g49290 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATTGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGAACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCTTGCCCACATAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTTTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os03g25200 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGAGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACAAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTATTCGGCGTTCAGATACGAGAGGCTGCGCAACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCCGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCGCAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTTGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCATGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGACAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAAACAGGAGATCGAGCCGTTGGTTACCGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAATTCCATCAGCTGTACATGGAGATGAGCGCCGCCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCATTGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTAATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATGA >LOC_Os03g27520 ATGGTGCAAAAGCTGCTCATGTCGATGGAATCACGCCGCCGGCAGGTGGACAAACTGCATGCATCGACGTCTCGACGATGGATTCGATGCCACCAGCGCACAGACTTGCTGATGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGAATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTTGCGATGCCGAAGTGGGAGGAGATGGAGGTTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCAAAGTTCTGGTACTATGCTCACAGTGGAACTCTCAACCCAGCAGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGTCGACTAACAGACGCAGTGGAAGCCCCTTCTCAGGGCACGTTCCGACCGAACAGAGAGAGGGACGAGCTGTCACTCACCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGAGGTAGGATCACAAAGCATGGACGCCATGCAAACCCAGGACGAATCCACCTGCCCCATTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCAATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGTGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATGCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCGCAGGCTCCTGCACCGACTCCTCCTCGGTCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCTCAAGCTCCACCGCGTACCCACAGAAGGGCAACGAAGAAGGCGAAAATTGACGCCGCCAAGAACAAGGACCCGGGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGACAGAAGAATTTATTACTGACACCAGTCTAACTACAGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATTGGAGCGAGGATCAGGGACACAGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACTAG >LOC_Os03g07680 ATGGCTGATCGCGATGAGGAACAGATACTATATGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGGGAACGATGAGGAGGAGGCTAGTGGAAAGAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTCACGCTCCCTGCGGGTACAGAGAACATAGTGAAACACTGGACTCTTAAGAAAATGGCAGAACAGTTCCAGACCTTCAAGGGAGATCTGTACCGGAAATACATCCTGAAGGGGCAGACACCAAACTTCGACGTATTCTCGAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTACAAGACAGGTCAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCCGATCGATCGAAGTTCTGGTTCTATGCTCACGGTGGAACGCTCAACCCAGGTGATGGCTCCTTGGTCTTCAGCGATCAGATACGCGAGGCTGCGAATCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCCGACAGAGAGAAGGACGAGCTGTCACTCGCTCTACAGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATGGGATTCAAGGAGGACATCCACACATACAAGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTCGAGTACAGGATATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCCCAGAAGGTGGATGAACGCATGGCAGCACATCGGTCACACGATCCCCAGCCGTACATACCTCCTCCAATGGTAGCGTCAGGAATGGCCATCCCAACGGACATTTCAGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGTGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCTGGCTCCTCCGCCTCCTCCGCCTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCACCTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCTCCTCCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAGGTCTCACCAAGCTCCACCTCCTGCCAGCACAAGGGCAACGAAGAAGGCCAAAGTTGACACCACCAAAAACAAGGAGCTGCCGTACGATTGCAGTCAAGAGGAGCTTAATGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAATTTCTTCAAGGGAATGTCCACCGCAAACAAGGAGGCCTTAAAGCTATCGGACTATGACCGAACACTTAGGAAAGCCTATTACAAGAAGTCCAAACCAGTTCCTCAGCTTGGAGAACAACCAGACCAAGTGGTCGAGCCGTTGGTGACCGGCGAAGACTTTGGCATAACGGATTTCATTTCGGACACCGGTGTAACCATGGCTCAGTTGGTTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCGACACAAATGTACAAATTCCATGAACGGTACATGGAGATGAGCGCCAATGGTAGAGAGATGTTCGGAGCGAGAATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTATGGATCCATTTCAAGGATGTCTTCGATCTGTACCATCGGGACGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCAGGGGGTTTACAATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGCTCGACATGTACGAGAAAGACACAGAGGACAATCTTGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTTCATACTATTGCCGTACAACACAGAAGTCACTGTGTATGACTCAATGAATAAAGAGGAGAAGGTTTTTGACAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCATGTGCAAAGCAGGACAAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCCCACTGCCTATCAAACCAAATATACACCAAACGAGAGCTCGATCGTATTCACATGAGGGAAAAACTCCCACATAAGGATTTTATCACGGCTGTTCAAGAACAACTTATGGGGTTCATCAACGAAGAAGTCCTTAATCCCGATGGTGAATTCTACTACGACAGATCGACAATTCGTAACGTCGGTCCTTCCTCTTCTGACGTAACGCAGGCGTCGAAGTCGTAG >LOC_Os03g40500 ATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCATTGCATATAAGACAGGTCAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAATGCTCAACCCAATTGATGGCTCCCTGGTCTTCAGCGATCAGATATGCAAGGCTGCGCGTCGACTAACGGACGTAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCTGAGAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAATACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGATTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGATGCGAAGATTGCAGATCTTGAGTACAGGCTGACCATTCCTCCTGCAATGGTGAGCCCTTCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAAACCACCTGCCCTGTTGATGACATCACTCAGCGGACACCATGTAAGCTGCATATTTCCTTCAAGAATTTATCAATAAAGGTGGCGTCGGGCATGGCCATACCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTGGAAGGCACGTACGAGGACCTCGAGTTGGATTACCATAGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCTGCCATCTCCTCCTCAGGCTCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTTCACCGACTCCTCCTCAGGCTCCTACACCGACTCCTTCGCAAGCTCCTCGTCTGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACAAAGAAGGCGAAAGTTGACGCTGCAAAAAATAAGGACCCGGGGTACGATTGCACGCAAGAGGATCTTGACGCTTTTGTGGCATCAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTACCAGGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAAGAGGCCATAAAGCTATCGGACTATGAGCGAACACTTAAGAAAGCATCTTTTGGAAAGTCCAAACCAGTCCCTCAGCTTAGAGAGCAACCAAACCAAGAGATCGAGCCGTTGGTGACCGGTGAAGATTTGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACATGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATCTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGTGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCACAAGGGTGAATTCTACTATGACGGAAATACAATTCATAGGTCCTTAGCTTCTGAGATAACAACTACTACTACGTCGAAATCGTAG >LOC_Os03g60020 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACAAAAGACGTGTTGTTGGAGTCGTCCGTCAAGCCTGAGTGGAAGAGCTAGCCCTAGAAGGAATTGGAGCAGGCAAATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATACTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCGGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCAACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAATGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCAACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGCATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAAGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATATTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os03g54020 ATGCCGCGCGCGGCGCCCCGCCGCCGCTCCGCTGCCGCCACTCCGTCGTCCCGCTGCCGCCACACCGAGAACGTGAACGAGCGAACGAATGTGAACGAGAACAAGAAAAGACGTTGTCGGAGTCGTCCCTCAAGCCGGAGTGGTAGAGCTAGCCCTCGAAGGAATTCGCGCAGGCAAGAGACATGTTTCCTGTATGAACAAATGGCTGATCGCGATGAGGAACAGATATTGTACGATATAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTATTTGAACGAGGAAGGGAACGTGGAGAGGGATGCAGAGGGGAACCAGGAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGAAGGAGGTTAGTGGAAGTCAACCCTCCATTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCCCCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATACATTAACCCTTCCCGCGGGTACAGAGGACAAAGTGCAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAATGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATAGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAATGCTCAACCCAGCTGATGGCTTACTGGGCACGTTCCGACCGGACAGAGAGAGGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACATACAGGAGTCAGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCAGGGTATCGAGCTACGAGTGCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGTATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTACAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAAGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAATCCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCATAGGCGGTACATCATCCTCCCTGGGCGACAAGCAGCGTCTCGTGCACCATCTCCTTTGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCTACCTCAGGCTCCTGCACCGACTCCTCTTCAGGCTCCTGCACCAACTCCTCCTCGGGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCTTGCCCACACATGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAATATTCCTATAGACCCGAGTGTCAGAAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGTTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTAGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCATTGGTGACCGGTGAAGAAATGACGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAACCTGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATAAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACATAGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTAGACGCCCTCGACATCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAATGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGAATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATTGGTTCCGTCATTTGGTCCGCGGCAACTGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTTTATTCGCATGAGGGATAACCTGACCACACACAAGAAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAAGTCCTTAGCTTCTAAGCTAGCGACTACTACTACGTCAAAATCGTAG >LOC_Os03g20820 ATGCCGCCGCCGCCGTCGCCACGCCGCCGCGCCAACCGCCGCCCTGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATACCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACAGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTTTCCCGTTGATGACATCACTCAGCGGACATCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTAGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os03g49040 ATGGCCGATAGTACTAAAAGGACTGAAGAGAAGGGTTTAGGGGAGCAGGAGCAGTCACTTGCTGTTGTGGTTGCTCCGGAACCAACGGTCCCACCGGAAGGTAGTTCCGACAGCGACGTAGGTGACGAAGACGAGGAGTGCTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGGCGACGGTGAAGAAGGCGACAAGGACTACATTCCCTCTAAAGAAGGGTTCCCGGAAGGATCAGAGGCAACAGTGAGAAATTGTGCACTACAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAACCACCTTGAACAAGAAATTTGTGAAGACGGGACGCACACCATTTTTGACGTATGCCAACATAACCCCCAATCAGTGGGACGACTTTCTGACCTTGAAGAACTCCCCAGAAGAAATTAAAAGGAGCCAAAAGTATGCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCCGCAGGATACGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAACCGGTACCAATGGAGGAGTGGACACAGAGATCAAGGAACTGGGTAAGAGCTAGAACTCCGAAGATCACGGATGAAGGAAAAGTATCGTTTGAAAATTCGGAGCTGCAGAGCTTTACCGATAAAATAGAAAATTTATCTAGTTCACAAAAGAAAGGATATTTCAAGCCTAAAAGGGAGAAAGATGTGCTAAGTACGGCGCTGGGTACTCCTGAGCATGGGGGAAGGGTTCGAGGTGTGTCGAGCAAGATGAGTTGGAAGGAAGGGTTTAAAAATGACCCCCACAAGAAGCGTGAAGCGTACAAGGATAAACTTAGAGACGAAGGGGCTGCGGAGTTTGAAAGGCAAATGATGGATTTCTGCGTCAAGCACATGATTTTGCCTCGCCCCGAAACCAAAGAAACTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCCATTGGACGCGCCGGTAAAACTCTTCAGGCCGCTACAGCCATTGCTATCCCTGGGAGAACATACAATGAACAGTTCATACCCGATGCGTATGCCAAGGTGCAGCCACAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTACCCGACTGCAGATGGTGTATCCGTACTTGGGGATGCAGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACCGACGCCACGCAAAAACCTGTGGTGGATAAACCGGGGTTGGGAAAACCTCCGAGGCCTCCTAAGAGGAAGGTGACTGATAAGGCGGATGATCTAGAGATGCAAAAGGAAAATCCAGTGCCGGAAGTGCCACCAGAGATTGCATTGCCGGAGGTAGCCATGGAGATTGCACCGCCGGAGACAACCATGGAGATTCCAGTGCCGGATGTGCCCATGGAGATTACAGTGGCAGAACCAGAGGTGCAATTTGTGGCATCAGTCGGGTCAGACAAAGAAGAAGTACCAGGATTGGAATGGGACGGTACAGAGCCAGAAATATTTGAAGACCCTTCTCCTGCGAAAGACCCCGAGGTGCCACGAGTGCTTAGGAGCCACGACTCCAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACCGTCTTCAGAGGGGGTAAGGAACGTGCCAAGCTCAGAGATGACGACCCCAAGAAGGCTGCTGAACTAGCCGGGCCAACATACTTCGCAACCGATGATTGCCCGGAAAAGATGCAATACATGGATTCTAAGAAGAAAAAAGAACCCATTGGCTTCTTGGATCCAACTCAGATCTGCCAAACACAGCATACCGTGACGCTAGCACCAGGGTCAGACCATCTGAAGGGCAAGAATCCAAAAGAGATAGCAGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCGCACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTTAACGATCATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGATCCTCTCGATTACAGTCACAAGCAATACAAAGAATTTCTAACAATCTTACAGTATGCATACCAATACTACAAGTTCAAGGGTGGAGAACAGACCCGAACACGGGAGAAGCTGCTATTGCCAAGATTAGAATGTCGAACAAGCTTTGACGATACAGGTATCACAAATGTCCAGCGTGATCTGTGCCACTTCATCCACCATGAGTGCTGTCATGTCAAAGGAGATTTCTTTGACCCAGAGGGTGCCCTAGCGGCAAGTGACGAATTCAAGGATCTTCGGAAGTGGAACACTGCTATGCCATAA >LOC_Os03g27860 ATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGTGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTAGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAAAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACATCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGTTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACATTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAATGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACAAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTAGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTACCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGAAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os03g46280 ATGGCCGATAGTACTAAAGGGACTGAAGAGAAGGGTTTAGGGGAGCAAGAGCAGTCCCTTGCTGTTGTGGTTGCTCCGGAACCAATGGTCCCACCGGAAGGTAGTTCCAATAGCGACGTAGCTGACGAAGACGATGAGTACTCGTCGCCTACCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGATGACGGTGAAGAAGGCGACAAGGATTACATCCCCCCTAAAAAAGGGTTCCCGGATGGATCAGAGGCAGCAGTGAGGAATTGTGCACTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAACCACCTTGAACAAGAAATTTGTGAAGACGGGACGCACACCGTTTTCGACGTATGCCAACATAACCCCGAATCAGTGGGACGACTTTCTGACGTTGAAGAACTCCCCGGAAGAAATTCAAAGGAGCCAAAAGTATGCAAAGTTGGCCAAGAAGAACGAATTTCCTCATCGCTTAGGCTCCGCGGGATACGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAACCGGTACCAATGGAGGAGTGGACACAGAGATCAAGGAACTGGGTAAGAGCTAGAACTCCGAAGATCACGGATGAAGGAAAAGTATCGTTTGAAGATCCGGAGCTGCAGAGTGTTTCCGATAAAATAGAGAATTTATCCAGTTCACAAAAGAAAGGATTTTTCAAGCCTAAGACGGAGAAAGATGTGCTAAGTACGGCGCTGGGTACTCTTGAGCATGGGGGAAGGGTTCGAGATGTGTCGAGCAAGATGAGTTGGAAGGAAGGGTTCAAAAATGACCCCCACAAGAAGCGTGAAGTGTACAAGGATAAACTTAGAGACGAAGGGGCTACAGAGTTTGAAAGGCAAATGATGGATTTCTACGTCAAGCACATGATTTTGCCTCGCCCCGAAACCAAAGAACCTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACTCTGCAGATTGCACGTTCCCATTGGATGCTCCGGGAAAACTCTTGAGGCTGCTACAGCCATTGCTATCCCTAGGAGAACATACAATGAAGAGTTCATACCCGATGCGTATGCCAAGGTGCAGCCGCAAGTGGTCCACGAAGGGTTTGAATCCTACGACATTGACTTCCTGACTGCAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTTTGGCACAAGAATGACATATCCTTTGGATTGGGCACCGACGCCACGCAAAAACCTGTGGTGCCTAAACCGGGGTTGGGAAAACCTCCGAGACCTCCTAAGAGGAAGGTGACTGATCAGGCGGAGGAACTCGAGATGCAAAAGGAAAATCCAGTGCTAAAAGTGCCACCGGAGATTGCAGTGCCGGAGGCAGTCATGGAGATTCCAGTGTCGGATGTGCCCATGGAGATTATAGTGGCAGAACCAGAGGTGCAATTTGTGGCATCAGTCGGGTCAGAAATAGAAGAAGTACCAGGATTGGAATGGGACGGTACAGGGCCAGAAATATTTGAAGACCCTTCTCCTGCGAAAGACCCCGAGGTGCAAGAGACCACGGTCCCTGAGAAGGCCACTACCAGTTCTGAGGTGCCTAGAGTGCTTAGGAGCCACGACTCTAAGTCCAAAGATGAGAACAAAGAGAAGTTCATGGTAACCGTCTTCAGAGGGGGTAAGGAACGTGCCAAGCTCAGAGATGACGACCCCCAGAAGGCCGTTGAACTAGCCGAGCCAACATACTTCGCAACCGATGATTGCCCGGAAAAGATGCAATATGTGGATGCTAAGAAGAAAAAAGTACCTATCGGCTTCTTGGATCCAACTCAGATCTGCCAAACACAACATACCGTGAGGCTAGCACCACGGTCTGACCAACTGAAGGGCAAGAATCCAAAAGAGATAGCTGAATATAAGAAGGGCTTGCGCAAGGAGAAATTGATTACTGTCGCACAGTATATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCATCATGGCCGCTTATAATTTTAACGATCATTATATCTGTTTACTTATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGACCCTCTCGATTACAGACACCAGTCATACAAAGAATTTCTAACAATCTTACAGTATGCGTACCAGTACTACAAGTTCAAGGGTGGAGAACAGACCCAAACAAGGGAGAAGCTGCTATGTCACAAGCAACCGCGAGGAACGGTCCTTTGCAGGTATTACACTTGCGAATTCCTTAGAGTTAATGAGAGGTACAGGACTAACGCGGAGGATTTGCCAAGATTAGAACGTCGAACAAGCTTTGACGATACAGGCATCACAAATGTTCAGCGTGATCTGTGCCACTTCATCCACCATGAGTGCTGCCATGTGAAAGGAGATTTCTTCGACCCAGAGAGTGCCCTAGCCACAAGTGACGAATTCAAGGATCTTCGGGAGTGGAACAGTGCTATGCCATAA >LOC_Os03g51290 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGTTAGTGGTAATCAACCCTCCGTTGGACAGAAGAGGGCATGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACACGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGTTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCTGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGATGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATACCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCTTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACAGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCTGGCACCTTCAAAGTCAGGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTTTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACAGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGGCTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGATTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGAGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGAGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os03g43280 ATGGCTGATCGCGATGAGGAACAGATACTGTACGATATAATCGCATCGGGAAGCAGCCAGTACTGGAACGAGGAAGAGGGGAACGAAGATCCAAACCAGTACTTGAACGAGGAGGGGAACGCAGAGAGGGATGCAGAGGGGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGAGGCTAGTGGAAGTCATCCCTCCGCTGGACAGAAGAGGGCACGCGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGCAGACGGCCGACCTAGTGCCCCGGCACAAGCAGCCAAGAATTTTGTACGCCACAGCGGTTGGGTTGTGAGGGATAACGTGCCTGTCAGCAAGGTGTACTGGCGCAGAACAAGGGCACGCGGGGGTGATGACAGCTTCATCCCGGAATCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTCACGCTCCCTGCGGGTACAGAGAACATAGTGAAACAGTGGACTCTTAAGAAAATGGCAGAACAGTTCCAGACCTTCAAGGGAGATCTGTACCGGAAATACATCCTGAAGGAGCAGACACCGAACTTCGACGTATTCCCGAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTACAAGACAGGTCAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCACCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCATCGCGATGCCAAACTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGACCACCGCTAAGTGGCCTGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAGCCCAGTTGATGGCTCCTTGGTCTTCAGCGATCAGATACGCGAGGCTGCGAATCGACTAACGGACGCAGTCGAAGCCTCTTCTCAGGGCACGAGTCGGATGAGGAGCAAGAGAGATACTGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTATGAGCTCAGCAAGCAAGAGGAGGTGGCCCGGAAGGTGGATGAACGCATGGCAGCACATCGGTCACACGATCCCCAGCCGTACATACCTCCTCCAATGGTCAGCCCATCAGGCAATCATAGCAGCTGCGCCTCAACGGGGCAGGTAGTATCACATAGCATGGACGCCATGCAAACCCAGGATGAAACCACCTGCCCCGTTGATGAGATCACGCATCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTGGCGTCGGGAATGGCCATCCCAACGGACATTTCAGGGACTTACCACTGCAGACCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGTGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGATGCCAGCACAAGGGCAATGAAGAAAGCCAAAGTTGACACCACCAAAAACAAGGAGCCACCGTACGGTTGCAGTCAAGAGGAGCTTGACGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCAGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAATTTCTTGAAGGGAATGTCCACCGCAAACAAGGAGGCCTTAAAGCTCTCGGACTATGACCGAACACTTAGGAAAGCCTATTACAAGAAGTCCAAACCAGTTCCTCAACTTGGAGAACAACCACACCAAGTGGTCGAGCCGTTGGTGACCGGCGAAGACTTTGGCATAACGGATTTCATTTCGGACACCGGTCTAACCATGGCTCAGTTGGATGGAGGCGCACCAATCCCGAAAGCGGAAGTGGCATACAAGTTTGAGCTCGGTAAACCGCTTGTCAGGCCTGAGCAGCTACAGTCCCTACCGACACAAATGTATAAATTCCATGAACGGTACATGGAAATGAGCGCCAATTGTAGAGAGATGTTCGAAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTATGGATCCATTTCAAGGATGTCTTCGATCTGTACCATCGGGATGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGATGGCGGAGGGTTTACGATACTGGGTTCATCGACCCTCGAAAAATCAACACCGAAATGCTCGACAAGTACGAAAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAATTCCACTGGGTCCTGTTCTTTTTCGACTTGGACGCACGCAGAGTCACTGTATATGACTCAATGAATAAAGAGGAGAAGGTTTTTGACAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGATGGAGGTTTCATTTTCCATGTGCAAAGCAGGACAAGGGAACTAACTTATGTGGCTACTACGTATGCGAGTTTGCCCACTGCCTATCAAACCAAATATACACCACACGAGAGCTCGATCGTATTCACATGAGGGAAAAACTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGGTTCATCAACGAAGAAGTCCTTAATCCTGATGGTGAATTCTACTACGACGGATCGACAATTCGTAACGTCGGTCCTTCCTCTTCTGACGTAACGCAGGCGTTGAAGTCGTAG >LOC_Os03g47320 ATGGCTGACTGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGTACAAAAGAGGGCACGCGGGCAACGAGGTGTAGCGAAGAAGCTTGAGGGTCGGCACATCATAACAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCACGGGTACAGAGGACAAAAGCTTTAAGGGAGAGCTGTACAAGAAATATATCCTGAAGGGGCAGACACCGAACTTCAACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCACCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAACTTGATTGAGAGGGGTATCGAACCGGCAACCGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGGCACGTTCCGACCGGACAGAGATAGGGATGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGTGGACATCCACACGTACAGGAGTCGGATGAGGAGTAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCCGGGTATCGAGCTACGAACTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCCACATATTCCTTACAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACTAACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTTCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGTACTATGAGCGAACGCTGAAGAAAGCATATTCTGGAAAGTCCAAAACAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACAAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACAGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACTAG >LOC_Os03g42540 ATGCCGGACCTTAGCTTATTGGCAACGAAGAAGGCAAAAGTTGACGCCACCAAAAACAAGGAGCCGCCGTACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCATGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCACAACAAACAAGGATGCCTTAAAGATATCGGACTATGACCGAACACTTCAGAAAGCCCATCACAAGAAGTCCAAACTAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCAAAGATTTTGGCATAACGGATTTCATTTCAGACACCGGTCTAACTGTGGATCAGCTAATTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGAGAAGATGTTCTCTGGATCCATTTCAAGGATCTCTTCGATCTGTACCATCTGGACGCCCTCAACGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTCTACGTTACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACATAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTACATACTACTGCCGTACAACACAGAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCTGCAGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCACGTATTCACATGAGGGATAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGATTCATCAACGAAGAAGTCCAAAATCCCAATGGTGAATTCTACTACGACGGATCGACAATTCATAATGTCGGTCCTTCCTCTTCTGACATAACGCCGGCGTCGAAGTAG >LOC_Os03g27720 ATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGATCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTTGGCTTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGTGGCAACTGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os03g48464 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCGTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAATAGCCAATTGGCCGGAACGATCGATGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAGGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACATGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os03g29290 ATGTCGAACGATAAGGTTCCATCGAACGCACCAATAGCGTCTCAAGAAGTTAACGCTCCTCAAAAATCCGGTAGCAACAAGCAGCCAGACGCTTCTACTGAAGAAACGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCTCGCGATGATGATCCGGACTACATACCTATGGAACAGGCTATGGTAGTCCGACACCGCTCGAAACGTAAAGCCGGGAGGAACAGGAGAGAGGAAGAAGTTGAGATGGACACCGCTACGTCTGCACTTGCACCTGAACGTACCGGGAGTGGGAGAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCGTCGAGCCACCGATAGTGCAGTCCAAGTTTAGCAACACCTGTGGCACTCTAGTCAGGACGCATTGTCTCATTAATGTCAAGTTGTGGGAAACGGTGGATGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTCATGGATTATGGACATATATCGCAGCTGAAGCATTTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAGATATCCCCATAGATTAGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGCAAACCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTTGAGAAAGAAAGATCAGGACTGTTCGTCCCACGGAGGGAGCGAGACCAGCTTACTGCGGCATTGGGGACCGCCGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACGAGTTGGAAGGTAGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAAAGACAAATACAAAGAACAACTATCAGACAAAATCTATGCGCAAGTGAAGGAACACTTCTACTTGTTGGCAGCTGAAAACCTGACAGCCTTTCCAAGGTTATTCCTTGATGGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAACTCCCTTCCCTGTGGATAGTTTTTCTGGACCAACTCCGTGCAGTCTCGTCGTATCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGATGTCAATTCCACAACACGGCAATCCTTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTACACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGGACCGCAGAGACATAATCCTGACCGCGGCCATTCCAGCATTGATATCGACATACGACCCAAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAAAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAAGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTTATAAGTGTCGCCGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATAGGATATTTTTTATCTCTTTCCGAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCGTTTTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTCGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGAGAGGACTGCGAGCAATTGGTTGGCAAGACCCCTAAAGAAAAGGAAGAATATGTGAAGTCATTGCACAAGAGGAAGAAGTTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCTGACAAAAATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTTCTTGTATATCCAAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCGAAATAGGTGGACCAGTACATATTCCATCCCAGAAGCAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGCGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAATGACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATAGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATGA >LOC_Os03g45810 ATGGCCGATAGTACTAAAGGGACTGAAGAGAAGGGTTTAGGGGAGCAGGAGCAGTCCCTTGCTGTTGTGGTTGCTCCGGAACCAACGGTCCCACCGGATGGTAGTTCCGACAGCGACGTAGGTGACGAAGACGAGGAGTACTCGTCACCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGGCGACGGTGAAGAAGGCGACAAGGACTACATTCCCCCTAAAGAAGGGGAAACGGCGCCACGACGATCAAAATGGCAGCCGAAGAAAAAAGTTACTTCGAAAGACGAGGACGTACCGGCAAACACAACCGGCACACAGAAAAGCGAACGGTCAGCAAAGGCGAAGAGAAGGAAGGGTGAGAGAAGCGTAAATAGAAAGGATGAAGGGTTCCATGTTGTTACCCATGTTTTGCCTAAAGGAGAGCCGCTCGCCCCTAAGACGACACGTGCGAAATTCAGTTCACAGTGTGGCATAATAGATCATGTAACGGATGGGGATAAGGAAGTCCTATGGAAAGAGTTGAAGAAAATATTCCAGTTCCCGGAAGGATCAGAGGCAGCGGTGAGAAATTGTGCACTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAACCACCTTGAACAAGAAATTTGTGAAGACGGGACGCACACCGTTTTCGACGTATGCCAACATAACCCCCAATCAGTGGGACGACTTTCTGACCTTGAAGAACTCCCCGGAAGAAATTAAAAGGAGCCAAAAGTATTCAGAGTTGGCCAAGAAGAACAAATTTTCTCATCGCTTAGGCTCCGCGGGATACGCACCAAAGGTGGAACAGTGGACAAAAGAGAAGGAGGAAATGAGGAAGAAGGGGCAACCGAGCGTTGCCGATAAAATAGAAAATTTATCCAGTTCACAAAAGAAAGTATATTTTAAGCCTAAAAGGGAGAAAGATGTGCTAAGTACGGCGCTGGGTACTCCTGAGCATGGGGGAAGGGTTCGAGGTGTGTCGAGCAAGATAAGTTGGAAGGAAGGGTTCAAAAATGACCCCCACAAGAAACGTGAAGCGTACAAGGATAAACTTAGAGACGAAGGGGCTGCGGAGTTTGAAAGGCAAATGATGGATTTCTGCATCAAGCACATGATTTTGCCTCGCCCCGAAACCAAAGAAACTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCCATTGGACGCTCCGGTAAAATTCTTGAGGCCGCTACAGCCATTGCTATCCCTGGTAGAACATACAATGAACAATTCATACCCGATGCGTATGCCAAGGTGCAGCCACAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTACCTGACTGCAGATGGTATATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATTCTTTGGATTGGGCACCGACGCCGGGGAAAAACCTGTGTTGCCTAAACTGGGTTTGGGAAAACCTCCGAGGCCTCCTAAGAGGAAGGTGACTGATAAGGCGGATGATCCAGAACTTGGTAAGGAAAATCCAGTGCCGGAAGTGCCACCGGAGATTGCATTGCCGGAGACAGCCAAGGAGATTGCACCGCCGGAGACAGCCATGGAGATTGCACCGCCGGAGACAGCCATGGAGATTCAAGTGCCGGATGTGCCCATAGAGATTACAGTGGCAGAACCAGAGGTGGAATTTGTGGCATCAGTCGGGTCAGACAAAGATGAAGTACCAGGATTGGAATGGGATGGTACAGAGCCAGAGATATTTGAAGACCCTTCTCCTGCGAAAGAACCCGAGGTGCCACGAGTGATTAGGAGCCACGAATCCAAGTCCAAAGATGCGAACAAGGAGAAGTTCATGCTAACCGTCTTTAGAGGGGGTAAGGAACGTGCCAAGCTCAGAGATGACGACCCCCAGAAGGCTTCTGTGCTAGCCGGGCCAACATACTTCGCAACCGATGATTGCCCGGAAAAGTACGAACATGGGAAAGCACTCTTGCCGGAATGGGCACTGAAAGAGGCACCATGGGAGATGAGAAGGTTACATAACTTCTACATGGAGGCCAGCAAGAAAGGCTTGGGCAATATAACAGCTCGATCACCGGCAGATTGTTTCGGCGAAGAAGGTTACGTATGGCTAGATTTCTCATATCTCCACGCCATATATCGTCGGGATAAGATGAACGTCAATTATGTCGGTGTTTGGTGCATGATGCAATACATGGATGCTAAGAAGAAAAAAGAACCCATCGGCTTCTTGGATCCAACTCGGATATGCCAAACACAGCATACCGTTACGCTAGATCCAGGGTCAGACCAGCTGAAGGGCAAGAATCCGAAAGAGATAGCAGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCGCACACGATCATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCATGGTAGTCTTGGATCCTCTCGATTACAAACACAAGCAATACAAAGAATTTCTAACAATCTTACAGTATACATACCAATACTACAAGTTCAAGGGTGGAGAACAGACCCGAACACGGGAGAAGCTGCTATGTCACAAGCAACCGCGAGGAACGGTCCTTTGCGGGTATTATGCGTGCGAATTCCTTAGGGTTAATGGACGGTACAGGACTAACGCGGAGGATTTGCCAAGATTAGAATGTCGAACAAGCTTTGACGATACAGGTATCACAAATGTGCAGCGTGATCTGTGCCACTTCATCCACCATGAGTGCTGTCATGTCAAAGGAGATTTCTTCGACCTAGAGGGTGCCCTTGCGGCAAGTGACGAATTCAAGGATCTTCGGGAGTGGAACACTGCTATGCCATAA >LOC_Os03g31910 ATGCTCGAGACATTCACCCTTCCCGCGGGTATAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGACAGACACCGAACTTCGACACAATCTCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTCAACAAGGAGAGAAGGACGAGCTATCACTCGCCCTGCAGACTCCAGAGCATCTGGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGATTCAAGGAGGACATCCACATGTACAGGAGTCGGATGAGGAGCGAGAGAGATACCGAGGCGAAGATTGCAGATCTTAAGTATAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCAGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGGCATCGGGCATGGCCATCCCAACGGACCGTTCAGGTACTTACCACTGCAGGCTGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTGGAAGGCGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGTGGTACATCATCCTCCCTGGGCGACAAGCGGTGTCTCGTGCACCATCTCCTCCGGCTCCACCATCTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGGCACCTTCCAAGTCAAGGGCCCTCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCAAAAAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACACTTATGTGGCATCAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGCCAGGAACTTCTTCAGGGGTATGTCTACACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTTAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATAGAGCCGTTGGTGACCGGTGAAGATTTTGGAATACAAGAATTTATTAATGACACCGGGCTAACTACGGATCAATTGCTACGAGGCGCACCAATCGAAAGGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAACTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATTAGGGACACGGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGGTATTTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCAGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATACTCGACCAGTATCCGCAAGCTACAGAGGAAAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACATTCATACTATTGTCGTACAACACAGTGTTAGTTTTTACTGTCTTCCTATACCAAATTTCATTCCCGTACGAACATGCTAAGTGTTTCATATGTAATGCATCCGACGCACAATGCAGATTCCACTGGGTCCTTTTACTCTTCGACTTGGAGGCCTCCACCGTCAACGTGGTTCCGGAGACCGTCCGCCAGTCGCCGTCGTCCCCAGGTCATCCCTCACCGCCGTTCGCCATCGCCCCCTCGTGCCGGCTGAACCCCGATTCCGGCTCTCCTGACGCTCCGGTGTACTTTGAAATAGTCGCCGAGGCTCCTCTAGCAGCAGAGCAAGCCATGATATTTTTGTACCTTGCTCCTTTGATAGCTTGGGATATAACAAGACTAGATGTTGGTCTAGAGATTGCTTAG >LOC_Os03g30080 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGAACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTTGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAACGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTTCGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCTGGCTTCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACATAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACTCGGGGTACGATTGCACGCAAGAAGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTTGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCATCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os03g39570 ATGGCCGATAGTACTAAAGGGACTGAAGAGAAGGAAGATAGTTCTGACAGCGACGTTGCTCACGAAGACGATGAGTACTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCCTGAAGAGAAGGAAAAAGGGCGACGGTGAAGAAGGCGACAAGGACTACATTCCCCCTAAAGAAGGGCCCGAGCTAATTCGAAACTTTCATGTATACCTTCTCGTAGGAAACGGCGCCACAGCGATCAAAAAGACAGCTGAAGAAAAAGTTCTGTCGCAAATTGACGAGGTACCAGCTAACACAACCAGCTCAAAGAAAAGCGAACGGTCAGCTAAGGTGAAGAAAAGGAAGCGCGAGAGAAGCGTCAATAGAAAGGATGAAGGGTTCCATGTTGTTACCCATGTTTCGCCAAAAGGAGAGCCGCTCGCCCCAAAGACGGCACGTGCGAAATTCAGTTCACAGTGTGGCATAATAGTAAGGGAAAAGATCCCCATCACGGTCAAGGACTGGGATCATGTATCGAATGGGGATAAGGAAGTCCTATGGAAAGAGTTGAAGAAAATCTTCCAATTCCCGGATGGATCAGAGGCAGCATGGGACGACTTTCTGACGTTGAAGAACTCCCCGGAAGAAATTCAAAGGAGCCAAAAGTATGCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCCACGGGATACGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAACCGGTACCAATGGAGGAATGGACACAGAGATCAAGGAACTGGGTAAGAGCTAGAACTCCTAAGATCACGGATGAAGGAAAAGTATCGTTTGAATTTCCGGAGCTGCAGAGCGTTGCCAATAAAATAGAGAATTTATCCAGTTCACAGAAGAAAGGATTTTTCAAGCCTAAGAGGGAGAAAGATGTGCTAAGTACAGGGCTGGGTACTCCTGAGCATGGGGGAAGGGTTCGAGATGTGTCGAGCAAGATGAGTTGGAAGGAAGGGTTCAAACATGACCCCCACAAGAAGCGTGAAGCGTACAAGGATAAACTTAGAGACGAAGGGGCTGCGGAGTTTGAAAGGCAAATGATGGATTTCTGCGTCAAGCACATGATTTTGCCTCGCCCCGAAACCAAAGAACCTGAGCCAGATTACCCCTTCGATGACCTCAAAGAGAATACACCCTGCAGATTGCACATTCCCATTGGACGCTCTGGGAAAACTCTTGAGGCCGCTATAGCCATTGCTATCCCTGGGAGAACATACAACGAAGAGTTTATACCCGATGCGTATGCCAAGGTGCAGCCGCAAGTGGTCCACGATGGGTTTGAGTCCTACGACATTGACTTCTCGACTGCAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACTGACGCCACGCAAAAACCTGTGGTGCCAAAACTGGGGTTGGGAAAACCTCCGAGACCTCCTAAGAGGAAGGTGACTGATAAGGCGGAGGAACCCGAGATGCAAAAGGAAAATCCAGTGCCGGAAGTGCCACCGGAGATTGCAATGCCAGAGGCAGCCATGGAGATTCCAGTGTCGGAAAGCCAGAAATATTTGAAGACCCTTCTCCTGCGAAAGACCCCGAGGTGCAAGAGACCACGGTCCCTGAGAAGGCCACTACCTGTTCTGAGGTGCCTAGAGTGCTTAGGAGCCACGACTCCAAAGTCCAAAGATGAGAACAAGGAGAGGTTCATGGTAATCGTCTTCAGAGGGGGTAAGGAACGTGCCAAGCTCAGAGATGATGACCCCCAGAAGGCCGCTGAACTAGCCGGGCCAACATACTTCGCAACCGATGATTGCCCGGCTGAGTACGAACATGGGAAAGCACTCTTGCCGGAATGGGCACTGAACGAAGTACCATGGGAGATGAAAAGGTTACATACCTTCTACATGCAGGCCAGCAAGAAAGGCTTGGGCAATATAACAGCTCGATCACCGGCAGATTGTTTCGGCGAAGAAGGTTACGTATGGCTAGATTTCTCATATCTCCACGCCATATATCGTCGGGATAAGATGGACGTCAACTACGTCGGTGTTTGGTGCATGATGCAATACATAGATGCTAAGAAGACAAAAGAACCTATCGGCTTCTTGGATCCAACTCGGATCTGCCAAACACAACATACTGTGAGCCTAGCACCAGGGTCAGACCAGCTGAAGGGCAAGACTTCAAAAGAGATAGCTGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCGCACAGTACATTGGACGAGTCTTCTTGCACTTTCAAAATAAGAGAGTTGTCCTAGCCGCTTATAATTTTAACGATCATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGACCCTCTCGATTACAAACACCAGTCATATAAAGAATTTCTAACAATCTTACAGTATGTCACAAGCAACCACGAGGAACTGTCCTTTGCGGGTATTACGCTTGCTAATTCCTTAAAGTTAATGGGAGTTGCCAAGATTAGAATGTCGAACAAGCGTTGA >LOC_Os03g47330 ATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTAACAAGGTTTTCGAACTTATACACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGTAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTATGACGGAAACACAATTCACCGAAATATCCGTAACCGACAGCTCAAAGGATGGTTCACAGGAACCCGTCTTACCCTTGATGAGGCAAAGGAAGTACTTGAATGGCGAACAATGACATGTGGAGTCCTTATTTGCCACAAGAATGGGAGGTGGGGCAACAGTACACCAAGAGATGAGGCCGTGGAATTGTTCAATGCTTTACAGATTGTAAGCAATAATGGTGCGTTTGAACGCCTCGGTGTAATGGTTTGGCCTAGCCAGGGTTTCAAAAACCGCCGGGGGCCCGGTTACCGCCACCCGGCGGTACGGCGGTTACCGGCGGTAACCGCGGTAACCGCGCAAAACCGCGACAAATTTACAAATCGAAATTTGAATTCAAAAATTCGGGCAAACCGCGCGGTTTGGCGCGGTTACCGTGCGGTTTGA >LOC_Os04g26000 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAATCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGTTCAGATACGAGAGGCTGCGCAACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCCGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCCACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCGCAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGTGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCACAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGCCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATAATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCACACATATCTACGAACTATACCAGCTGGACGCCGTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCACAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCCCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCAATTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os04g29900 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCATCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAGGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGAAGAGGAGGTTGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGA >LOC_Os04g19000 ATGCAGGGGAACGTGGAGAGGGATGTGGAGGGGAATGAGGTGGGGAACAAGGAGGAGGAGGCTAGTGGAAGTCAATCCTCCGCTGGACAGAAGAGGGCACGCGGACAACAAGGTGCCACGAAGAAGTTAGAGGGTCAGCACATCATAACTGAGGTGGACGAAGACGGCCGACCTAGTGCCCCGGCAGAAGTAGCCAAGAATTACGTACGACACAGCGGTTGGGTTGTGAGGGATAACGTGCCTGTCAGCAAGCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACACTTAACCCCGTTGATGGCTCCCTGGTGTTCAGTGATCAGATACGCGATGCTGCAAGTCGACTAACGGACGCAGTGGAAACCTCTTCTCATGCCACATTCCGACCCGATAGAAAGAAGGACAAGCCGTCACTCGCCGTGCAGACTCCCAAGCATCCAGGACGAATGCGAGGGAAAGGCGTGGTTCCTTGGAAGATTGGACTCAAGGAGGACATCCACACGTATAGGAGTCAGATGAGGAGCAAGAGAGATACCGAGGCTAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACAAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGCATGGTCGTACTTCGGAGCCAGGATCCCCAGCCGTACATTCCTCCTGTAATGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGCCGATTCCACCAGGATACTTGAGGGTCAAGCCGCGTATGAGGATCTCGAGTTGGACTACCCTGGAGGAGATGGCTCCTGCGCCGTGTCCTCTGGCATCTTCCAAGTCAAGGTCTCTCCAAGCTCCACCGCCTGCCCGCACAAGGGCAACGAAGAAGAATGTTGCCGGCACCAAAAACAGGAGCCATCGTATGATTGCACGCAAGAGGAGCTTGACACTTATGTGGCAGCAGAAGTGAAGAGGCAATTGAAGCCTCGGAGTCCAGAAAAGCAGATTCCTGTAAACCCGAGTGCCAAGAACTTCTTCAAGAAGATGTCGGGACCGGTCAAGGAGGTCTTAAAGCTAACGGACTATGAGCGAACACTTAGAAAAGCTTATTTTGGAAAGTCCAAACCAGTCCCTCAGCTTGCAGAGCAACCAAACCAGGAGGTCGAGCCATTGGTGACCGAAATGAGCGCCAACGGTAGAGAGATGTTCGGAGCGAGGATCAAAAACTCCGACTTCTTCCAAGGAGAAGATGTTCTTTGGATCCATTTCAAGGGTATCTATGAACTATACCAGCTGGACGCCCTTGTCGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCAACGGTGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTTTTTGAACTTGTAGACAGGGCTTGGGATCGGTTCCGTACCCAGGTTCGTGGCACTTGGAAAGAAAAACTTAGCCGGAGGTTCAAATTTCCATGTACAAAACAGAGCCAGGGAACTAACTTGTGCGGCTACTACGTATGCGAGTATTGCCACTGCCTTACAACCCAATTCTACACCACAAGAGAGCTCGATGTTATTCACATGAGGGACAACCTCACACACAAGGAATTTATCGCGGCTGTTCAAGAACAACTCATGGGATTCATCAACGAACAAGTCCTTGATCCCGATGGTGAATTCTACTAA >LOC_Os04g03710 ATGGCTGATCGCGATGAGGAACAGATACTGTACGATACAATCGCATCGGGAAGTAGCCAGTACTGGAACGAAGAAGAGGGGAATGAGGATCCAAACCTGTACTTGAACGAGGAGGGGAACGCGGAGAGGGATGCAGAGGGGAACGAGGAGGGGAACAAGAGGGCACGCGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACACAGACGGCCGACCTAGTGCCCCGGTACAAGCAGCCAAGAATTTTGTACGCCACAACGGTTGGGTTGTGAGGGATAACGTGCCTGTCAGCAAGGTGTGCTGGTGCAGAACAAGGGCATGCGGGGGTGATGACAGCTTTGTCCCGGAATCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTCACGCTCCCTGTGAGTACAGAGAACATAGTGAAACAGTGGACTCTTAAGAAAATGGCAGAACAGTTCCAGACCTTCAAGGGAGATCTATACCGGAAATACATCCTGAAGGGGCAGACACCGAACTTCGACGTATTCCCGAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTACAAGATAGGTCAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACTACTTGGGGTCAGGCGGCTATAGATCGCGATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAAGGGTATCGAACCAGCCACCGCTAAATGGCCTGATCGATCGAAGTCCTGTTGATGGCTTCTTGGTCTTCAGCGATCGGATACGCGAGGCTGCGAATCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCCGACAAAGAGAAGGACGAGCTGTCACTCGCCCTACAGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATGGGATTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATTGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCCCGGAAGGTGGATGAACGCATGGCAGCACATCGGTCACACGATCCCCAGCCGTACATACCTCCTCCAATGGTCAGCCCATCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGTATCACATAGCATGGACGCCATGCAAACCCAGGACGAAACCACCTGCCCCGTTGATGAGATCACGCAACGGACACCATGTGAGCTGCATATACCCTTCAAGAACTTATCAATCAAGGTGGCGTCGGGAATGGTCATCCCAACGGACATTTCAGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGTGTACGAGGACCTCGAGTTGGACTACCTAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCGGTACATCATCCTCCCTGGGCAACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCGTCCGCCACCTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCTCCTCCTGCACCATCTCCTCCGGTTCCTCCGCCACCTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCTCCTCCGCCTCCTCCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAGTTGGTTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAGGCCTGAGCAGCTGCAGTCCCAACCGATACAAATGTACAAATTCCATGAATGGTACATGAAAATGAGCGCCAATGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTATGGATCCATTTTAAGGATGTCTTCGATCTGTACCATCGGGACGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAATGGTGATTCAAAGGGCCCGACGGCGGGGGGTTTACAATACTGGGTTCATCGACCCTAGGAAAATCAACACCGAAATGCTCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTTCATACTATTGCCGTACAACACAGAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGGTTTTTGACAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCAGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCATGTGCAAAGCAGGACAAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCTCACTGCCTATCAAACCAAATATACACCACACGAGGGCTCGATCGTATTCACATGAGGGAAAAACTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGGTTCATCAACGAAGAAGTCCTTAATCCCAATGGGTTACCTGAAGTGTTGAGCGTGAGAGAGAACCGAATCCACCAAATGCATACCAGTCGAAGCTGGGATTTTCTTGGAATGGACTACATGCAGCCAAATAGCCTTCTTGCTAAAGCTAATTATGGGGACGACATTATCATCGGTGTTATTGACTCAGATCTTGTTTCATATAAGAATTGTCTTTTTATCTCTAAACTAGCACGTATTACGCCCGAGTCACCCAGCTTCGCTGATGATGGATATGGCCCTCCTCCATCCAAATGGAAAGGAATTTGCCAAGTCGGCCCCTCGTTTGAGGGCAAAAGTTGCAACCGAAAACTTATCGGTGCACGGTGGTACATCGATGACGATAATCTAGATAGCATGAGCAAGAATGAAATTCTATCTCCTAGGGATGTGCATGGCCATGGCATGCACATGGCCTCGACAGCCGGTGGCAACATCGTTCACAATGCTAGCATTTTTGGTCTAGCTACCGGGACAGTTCGGGGTGGTGCGCCTTGTGCACGAGTAGCCATGTACAAAGCTTGTTGGTCCGGGGGCGGGTGCTCAACCGCTGGCCAGTTGAAAGCTATGGATGATGCTGTCCATGATGGTGTTGATATACTATCACTTTCTATTGGTGGTCCATTTGAAAATTATGGAACCTTGCACGTCGTTGCCAAGGGCATACCAGTTGTGTACTCAGCTGGGAATGATGGACCCATCACTCAGACGGTGGAAAACTCATCGCCATGGCTGCTAACTGTTACTGCAGCCACTATGGATCGGTCATTCCCTGTGGTTATCACATTGGGAAATAATGACAAATTTGTGGCACAGTCCTTTGCAACTTTAAGTCAGTTCAGTGAGATACAATTTTACGAGCGTGAGGACTGCAATGCTGAGAATATCAACAGCACGGTGAAGGGGAAGATCGTCTTCTGCTTCTTCGGAACGATGTTCGATCCGGAGCCAGATTACTACAACATCACCAAGGCAACGGGGGAGAAAGGAGGAATAGGGGTGATCTTGCCTAAGTACTGTAAAGATGGGTTTAACGTGGATTGCCTCTCTCGGTTCCACGATATGTTCCTATCCGAACTATCTATCTGTTTAACACCCCCGGCAATCCCAACACGGGAACCAGGTTGA >LOC_Os04g08804 ATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGACGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAATCTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCGTCGAACCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTCTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACATTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCATACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAGATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGTGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATAAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGCGAGATCAGCTTACTGCGGCGTTGGGGACGGTTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATACACAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCCTTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAACTATCTTCCATGTGGATAGTATAACTGGACCAACTCCGTGTAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTCAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGTAGGATCTTCAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGGTCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAGCTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAACAAGTGCACATACCAGATGGTACAACATCCGAACCGAAGTCTAATACTTTGGAACTGAGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTAAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGAGAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGATAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACGACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os04g05980 ATGGCCATCCCAACGGATATTTCAGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGATGGTGGAAGCCGTGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGATGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCGGTACATCATCCTCCCTAGGCGACAAGCGGCGTCTCGTGCACCATCTCTTCCGGCTCCGCTGTCTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCACCTCCTCCTGCACCATCTCCTCCGGTCCCTCCGCCACCACCTCCTGCACCATCATCTCCGGCTCCGCCGTCTCCTCCTGCACCATCTTCTCCGGCTCCTCCGCCACCTCCTCCTGCACCATCTCCTCCGGATCCTCCACCTCCTCGGCCTGCTCCTCCACCGTGTCCGCCGGCACCTCCCATGACAAGGTCTCGCCAAGCTCCACCTCCTGCTAGCACAAGGGCAACGAAGAAGGCCAAAGTTGACACCACCAAAAACAAGGAGCCGCCGTACGGTTGCAGTCAAGAGGAGCTTGACGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAATTTCTTCAAGGGAATGTCCACCGCAAACAAGGAGGCCTTAAAGCTATCGGACTATGACCGAACACTTAGGAAAGCCTATTACAAGAAGTCCAAACCAGTTCCTCAGCTTGGAGAACAACCACACCAAGTGGTAAAGCCGTTGGTGACCGGTGAAGACTTTGGCATAACTGATTTTATTTCGGACACCGGTCTAACCATGGCTCAGTTGGTTGGAGGCGCACCAATCCCGAAGGCAGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAGGCCTGAGCAGCTGCAGTCCCTACCGACACAAATGTACAAATTCCATGAATGGTACATGGAAATGAGCGCCAATGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTATGGATCCATTTCAAGGATGTCTTTGATCTGTACCATCGGGACGCCCTTGACGTCTCTCTTCGGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGCTCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAATGCAGCAGCATTTCAAGACGTTCATACTATTGCCGTACAACACAGAAGTCATTGTGTACGACTCAATGAATAAAGAGGAGAAGGTTTTTGACAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCGGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCACGTATTCACATGAGGGAAAAACTCCCACACAAGGATTTTATCATGGCTGTTCAAGAACAACTGATGGGGTTCATCAACGAAGAAGTCCTTAATCCCGATGGTGAATTCTACTACGACGGATCGACAATTCGTAACGTCGGTCCTTCCTCTTCTGACGTAACGCAGGCGTCGAAGTCGTAG >LOC_Os04g23250 ATGCCGCCGCTGCGCCACGCCGCCACCGCGCCGCCACGCCGCCGCTCCGCTGCCGCCACTGCTGCCCCGTCATTGCCGAAGATGGCTGATCGTGATGAGGAACAAATACTGTACGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAACAAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGAGGAATGTGGAGAGGGATGTGGAGGGGAACGAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGCTGGACAGAAGAGGGCACGCGGACAACGAGGTGCCGCGAAGAAGCTAGAGGGTCGACACATCATAACAGAAGTGGACGAAGACGGCCGACCTAGTGCCCCGGCAGAAGTAGCCAAGAAGTACATACGACACAACGGTTGGGTTGTGAGGGATAACGTGCCTATCAGTACGGTGTACTGGCGCAGAACACGGGCACGCGGAGATCACGAGAACTTTGTCCCAGATTCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGAACATAGTGAAAAGCTTCAAGGGAGATCTCTACCAGAAATACATCTTGAAGGGGCTGACACCGAACTTCAACACGTTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTACAAGGCAGGGCAACAAGGGCAGGCGATGATGGACAGAAACAAAGAAAATGCCACCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCATCGCGATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGGTTGAGAGGGGTATCGAGCCGGCCACCGGTAAATGGCCGGATCGATCGAAGTTCTGGTGCTATGCTCACGGTGGAACGCTTAACCTAGTTGATGGCTCCCTGGCATTCAGCGATCAGATACGCAAGGCTGCCAGTCGACTAACGGATGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCCGACAGAGAGAAGGAGGGCAAGGGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGATATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGCATGGCCACACATCGGTCCCAGGATCTCCAGCCGTACATTCCTCCTGCAATGGTCAGCCCATCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCATCGGGAATGGCCATCCCAACGGACCCTTCAGGGACGTACCACTGCAGGCCGATTCCAGCCGGATACTCCAAGGTCAAAGTTGAGTTGGTTCAAGCCGTGTACGAGGACCTCGAGTTGGACTACCCTGGAGGAGGCGTGACTCCTCCTCAGGCTGTTGCGCTGACTCATCCTCAAGCTCCTCGTCCGGCACCTTTCAAGTCAAGGTCCCACCAAGCTCCACCGCCTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCAGAAAACAAGCCGCCGCCATACGATTGCATGCAAGAGGAGCTTGATGCTTATGTGGCAGCAGAAGTCAAGAGGCAATTGAAGCCTCGAAGTTCAGAAAAGAAGATTCCTATAGACCCGACTGCCAGGAAGTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTTAAGAAAACATATTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGGTCGAGCCGTTGGTGACCGGTGAAGAATTTGGAATAAAAGAATTTATTTCTGACACCGGGCTAACTACGGATCAATTGCTACGAGGCGCACCAATCCCAAAGGCAGAAGTGAAATACAAGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGCTACAGTCCCTACCGACACAGATGTACAAATTCCATAAACTGTACATGGAAATGAGCGACACCGGCAGAGAGATGATCAGAGCAAGATATTCTCTGGATCAATTTCAAGGGTATCTACGAAGTATACCAGCTGGACGCCCTCGACGTCTGTATTATGAGTTGTTGGATTTTATTCAAAGGGCTCGATGGCGGGGGGTTTTCGATAATGGATTCATCGACCCTCGAAAAGTAAACGTCTCAATGATCGACAAGTATCCGCAAGCCACAGAGGACAATCTCGTATATTTCCTGAAGGCGCAGCATTACAAGACATTCCACTGGGTCCTTTTACTCTTCGACCTAGAGGCCTGCATAGTCAATGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACCAGGTTTTTGAACTTATAGGCAGGGCTTGGTATCGGTTCCATCATTTGGTCCACGGCAATTGGAAAGAAAAACTTAGGCGGAAGTTTAAATTTCCTTGCGCAAAGCAAGAACAGGGAACTAACTCGTGCAGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCATACGAAATCATCACCACAAGAGAGCTCGATGTTATTCGCATGAGGGATAACCTCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGAATTCATCAACGAAAAAGTCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCATAGGTCGTTAGCTTCTGAGATAACGACTACTACGTCGAAGTCGTAG >LOC_Os04g31600 ATGTCGAACGAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTCCGGTAGCAATAAGCAGCCAGGCGCTTCTAGTGAAGAAACGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCATCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGTACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCCCAGGCTGATTGGGACACGTTTGTTGCGGATCGTACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAGATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGCGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCTTTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTCAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCTTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGACCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAACTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAACAAGTGCACATACCAAATGGTACTACATCCGAACCAAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTAACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCCCGAAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGACAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCTGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCTGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCTGAAATCCCATATATTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTTGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os04g43900 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACTACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCATGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAGGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGTAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTACAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACTGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCAACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATTGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCACAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os04g04100 ATGGGTCCGACAGCGACGTACCCAACGAGGACGATGAGTACTCGTCACCAAGTGATCGTTGTCCAAGCCCGAAACGGTGGTAAAAGGATGAGGGTGAACAAGGTGATAAGGACTACATTCCCCGTGAGAAAGGGGATGCAATACATGGATGCTAAGAAGCTAAAAGAACCTATCGGATTTCTAGATCCAACTAGGATATGTCAAACACAGCATACCGTGCAGCTATCACCACAGTTAGAGCAGCTGAAGGACAAGACTCCCGAAGAGATAGCTGAATACAAGAAGGGATTGCACAAGCAGAAACTGATTAATGTCGCACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGGGTCGTCCTGGCCGCTTATAATTTTAACGATCATTACATCGGTTTAATCATCTACCCGAAGCACTGCACCGTGACAGTCTTGGACCCTCTCGATTACTCTCATGACTCATACAAACAATTTCTAACAATCTTACAATATGCGTACAAGTACTACAAGTTCAAGGGTGGAGAACAGATTCGATCAAGGGAGAAGCTGCTAGTACATACATATTGGCCGTGTCACAAGCAACCTAGAGGCACTGTCCTCAGCGGGTATTACGCATGCGAATTCCTAAGGGTTAATGGGAGGTACAGGGTTAACCCAGAGGATTTGCCAAGGGAGGAGCAACAAACAAGCTTTGACAATACAGCCATTAAAAATATCCAGCGCGATCTCTACCACTTCATCCACCGTGAGTGCTGTCATGTGGAAGGAAAGTTCTTCGACAAAGAGGGTGCCCTAGCTACAAGTGACAAATACAAAAATCTTCGGGAGTGCAGCAATGCTATGCCATAA >LOC_Os04g23280 ATGACCTATAGACTTAGCAACTATTTCTTGTATGAACAGATGGCTGATCGCGATGAGAAACAGATACTGTACGATACAATCGTGGAGGGAAGTAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCAGAGGGGAACCTGGAGGGGAACGTGGAGAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTAGAAGTCAACCCTCCGCTGGACAGAAGAGGGCACGCGGGCAACAAGGTGCCGCGAAGAAGCTAGAGGGTCAGCACATCATAACGGAAGTAGACGAAGACGGCCGACCTAGTGCCCCGGCGGAAGCAGCAAAGAACTACGTACGACACAGCGGTTGGGTTGTGCAGGATAACGTGCCTGTCAGTACGGTGTACTGGCGTAGAACAAGGGCACGCGGAGATCATGAGAGCTTTCTCCTAGATTCGGAGAAAGAGATGTTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTAAAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAAATTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTACATATAAGACAGGTCAACAAGAGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAGGAAGAAGTACCATCATCACTTGAGGTCAGGCGGCTGTAGCGTCGCGATGCCGAAGAGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGGACCGGCCACCTCTAAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGTTGATGGTTCCCTGGTCTTCAGCGATCAGATACGCGAGGCTGCGAGTCGACTAACGGACGCAGTAGAAGCCTCTTCTCAGGGCACGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCATATCGGTCCCATGATCCCCAACCGACCATTCCTCCTGCAATGGTGAGCCCTTCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATACCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAACAGGATACTCCAAGGTCGAAGTTGAGTTGGTGGAAGGCGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGGTGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTACTCAGGCTCCTGCACCGTCTCCTCCTTATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTTAGGCTCCTACACCGACTCCTCCGCAAGCTCCTCGTCCGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCAAAAAACAAGGACCCGGGGCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAATCCCTACCCACACAAATGTACAAGTTCCATCAACTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGTATCTACGAACTATACCAACTGGACACCCTCGACGTCTGTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCAGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCTGCATTATAAGACGTTCATACTATTGCCGTACAACACAGAATTCCACTGGGTCCTTTTACTCTTCGACCTTGAGGCCTGTACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGGGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAATTTTCCTTTTATTCGCATGAGGGATAACCTGATCACACATAAGGAATTTATTGCGGCGGTTTAA >LOC_Os04g44010 ATGGCCATCCCAACGGACCCTTCGGGGACTTACCACTGCAGGCCGATTTCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTGGAAGGCGTGTACGAGTACCTCGAGTTGGATTACCCTGGAGGAGACGGCTCCTACACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTACACCGACTCCTTCGCAAGCTCCTCGTCCAGCACCTTCCAAGTCAAGGGCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGATGCCGCAAAAAACGAGGACCCGGGGGGTATGTCTGCACCTGCCAAGGAGGCTATAAAGCTATCGGACTATGAGCGAACACTTAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACTGGTGAAGATTTTGGAATACAAGAATTTATTAATGACACCGGGCTAACTACGGATCAATTGCTACGAGGCGCACCAATCGAAAAGGCGGAAGTAAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAACTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTGTAAGGGTATCTACGAACTATACCAGCTGGACACCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAGTATCCATTCCACTGGGTCCTTTTACTCTTCGACTTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGATAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAATTTTCTTTTTATTCGCATGAGGAATAACCTGATCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCATAGGTCCTTAGCTTTTGAGATAACGACTACTACTACGTTGAAATCGTAG >LOC_Os04g07980 ATGGCTGATCGCGATGAGGAACAGATACTGTACGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGAGAACGTAGAGAGGGATGCGGAGGGGAACGAGGACGGGAACGAGGAGAAGGAGGCTAGTGGAAGTCATCCCTCCGCTGGACAGAAGAAGGCACATGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGAAGACGGCCGACCTAGTGCCCCGGCAGAAGCAGCCAAGAATTTTGTACGCCACAGCGGTTGGGTTGTGAGGGATAACGTGCCTGTCAGCAAGGTGTACTGGCGCAGAACAAGGGCACGCGGGGATAATGACAGCTTTGTCTCGGAATCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTCACGCTCCCTGCGGGTACGGAGAACATAGTGAAACAGTGGACTCTTAAGAAAATGGCAGAACAGTTCCAGAGCTTCAAGGGAGATCTGTACAAGAAATACATCCTGAAGGGACTAACACCAAACTTCGACGTATTCCCAAAGCTAAGGGGTCATTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGTCAAAAACAAGGAAAACGCCGCCAAGAAGAAGTACCATCACCACTTGGTGTCAGGCGGCTATAGCGTCGCAATGCCGAAGTGGGAGGAGATGGAGGCAAGAATGATTGAGAGGGTTGATGGCTCCCTGGTCTTCGGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCCGACAGAGAGAAGGACGAGCTATCACTCGCCCTACAGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATTGGATTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGGGACGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGCGTCGGGAATGGCCATCCCAACGGACATTTTAGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTTGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCGTCTCCTCCTGCACAATCTCCTCCGGTTCCTCCGCCACGTCCTCCTGCACAATCTCCTCCGGCTCCTCCGCCACCTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCTTCCTCCACCTCCACCTCCACCTCCACCGTGTCCGCCTGCACTTCCCAAGACAAGGTCTCGCCAAGCTCCACCTCCTGCCAGCACAAGGGCAACGAAGAAGGCCAAAGTTGACGCCACCAAAAACAAGGGGCCGCCGTACGATTGCAGTCAAGAGGAGCTTGACGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAAGTTCTTCAAGGGAATGTCCACCAGAAACAAGGAGGCCTTAAAGCTATCGGACTATGACCGAACACTTAGGAAAGCCTATTACAAGAAGTCCAAACCAGTTCCTCAGCTTGGAGAACAACCAAACAAAGAGGTCGAGCCGTTGGTGACCAGCGAAGACTTTGGCATAACGGATTTCATTTCGGACACCGGTCTAACTGTGGCTCAGTTGGTTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAGGCCTGAGCAGCTGCAGTCTCTACCGACACAAATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCGAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTATGGATCCAATTCAAGGATGTCTTCGATCTGTACCATCTGGACGTCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACACCGGGGGGTTTACGATACTGGGTTCATCTACCCTCGAAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTTCATACTACTGCCGTACAACATAGAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGGTTTTTGACAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCGGTTCCATCAATTGGTCCGTGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCATGTGCAAAGCAGGACCATGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCCCACTTCCTATCAAACCAAATATACACCACACGAGAGCTCGATCGTATTCACATGAGGGAAAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGGTTCATCAACGAAGAAGTCCTTAATCCCGATGGTGAATTCTACTACGACGGATCGACAATTCATAACGTCGGTCCTTCCTCTTCTGACGTAACGCCGGCGTCGAAGTCGTAG >LOC_Os04g11370 ATGGCCGATAGTACTAAAGGGACTGAAGAGAAGGGTTTAGGGGAGGAAGAGCAGTCCCTTGCTGTTGTGGTTGCTCCGGAACCAACGGTCCCACCAGAAGATAGTTCCGACAACGACGTAGCTGACGAAGACGATGAGTACTCGTTGCCAAGTGATCCTTGTCCAAGCCCAAGCCCAAAGAGAAGGGAAAAGGGCGACGGTGAAGAAGGCGACGAGGACTACCTTCCCCCTAAAGAAGGGATAAGAAGGGAAAAGATCCCCATCACAGTCAAGGACTGGGATCTTGTATCAAATGGGGACAAGGAAGACCTATGGAAAGAGTTGAAGCTCTGTGGGATACGCTCCAAAGGTGGAGCAGTGGACAAAAGAGAAGGAAATGAGGAAGGCGGGGCAACTGGTACCAATGGAGCAATGGACACAGAGATCAAGGAACTGGCCATTGCTATCCCTGGAAGAACATATAATGAAGAGTTCATACCCGATGCGTATGCCAAAGTGCAGCCGCAAGTGGTCCACGAGGGGTTTGAGTCCTACGACATAGACTTCCCTACTCAAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGGAAAACCTCTGAGACCTCATAAGAGGGAGGTGACTGATAAGGCGGAGGAACCCGAGATGCATAAGGAAAATCTAGTGCCGGAAGTGCCACCGGAGATTGCAGTGCCGGAGGTGCCCATGGAGATTCAAATGGCGGATGTGCCCATGGAGATTACAGTGGTAGAACCAGAGGTGCAATTTGTGGCATCAGTCGAGACAGAAATTGAAGAAGTACCAGGATTGGAATGGGATAGTACAGAGCCAGAAATATTTGAAGACCCTTCTCCTGCGAAAGACCCCGAGGTGCAAGAGACCACGGTCCCTGAGAAGGCCACTACCAGTTCTGACGTGCCTAGAGTGCTTAGGAGCCACGACTCCAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACTGTCTTCAGAGGGGGTAAGGAACATGCCAAACTCAGAGATGATGACCCCCAGAAGGCCGCTAAACTAGCCGGGCCAACATACTTGGCAACTGATGATTGCCCGGAGAAGTACGAACATGGGAAAGCACTCTTGCCGGATTGGGCACTAAACGAAGGACCATGGGAGATGAGAAGGTTACATACCTTCTACATGGATGCCAGCAAGAAAGACTTGGGCAATATAACAGCTCGATCACCGGTAGATTGTTTCGGTGAAGAAGGTTACGTATGGCTAGATTTCTCATATCTCCACGCCATATATCGTCGGGATAAGATGGACGTCAACTATGTCGGTGTTTGGTGCATGATGCAATACATGGATGCTAAGAAGAAAAAAGAACCTATCGGCTTCTTGGATCCAACTCGGATCTATCAAACACAGCATACCGTGAGGCTTGCACCAGGGTCAGACCAGCTGAAGGGCAAGACTCCAAAAGAGATAGCTGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCGTACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTTAAAGTTAATGGGAGGTACAGGACTAACACGGAGGATTTGCCAAGATTAGAACATCGAACAAGCTTCGACGATACAGGCATCAAAAATGTCCAGCGTGATCTGTGCCACTTCATCCACCATGAGTGCTGTCATGTGAAAGGAGATTTCTTCGACCCAGAGGGTGCCCTAGCTACAAGTGACGAATTCAAGGATCTTCGGGAGTGGAACCTATGCCATAATGCGGACGGCCGCCCCGCCTACCAAGATCGGCGATCTTCACAGTCGTTGGCTTACATGCAGACGGCCGCCCCGCCTGTGAAGACCGTTTTCAGCCACTTGCGATAA >LOC_Os04g29910 ATGAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTAGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGTGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCAGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAACAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os04g16120 ATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGTATGGGAAGCCCGTCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTTAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCGGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCACAGGCTGACTGGGACACGTTTGTTGCGGATCATACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGTGAAGAAGAACAGATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCACAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAAACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTAGTCCCACGGAGGGAGCGAGATCAGCATACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAATTATAAGAAGAGAGACAAATACAAAGAACAACTATCAGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCCTTTCCAAGGTTATTTCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGTAGTGTAGGCTCAGTGCAGACAACTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCCTGCAGCAGGATCTTCAACCCCATCCTCGTCGCAGGCAATGACTACTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCAGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGGCCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAGCTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAACAAGTGCACATACCAGATGGTACTACATCCGAACCGAAGTCTAATACTTTGGAACTGAGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGACAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCAGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACATACCGTAGAGCTGAGAGAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGATGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACGACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os04g12390 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAGGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTTGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACAGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCGTGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTGTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGTATTAATGGTCTTGACACTTCAGCGTGTGAAGATAGGGCCGTGGGGTGGAACTGGAGGCCATGCTTGGGATGAGGGAGGCCATGGTGCCAGTGCTGGCGGTTACACCGGTGTACGCCGAATGAGTATAGGGTCTTCCTGGTGTGTCAGCTCAATGTTGTTTGAATACGACGACAATGGCAAACGTGTGAAAGGTACCCTGCAAGGAGAGGGAGGCAATGGAATACCCGAGGAGGAGCTCGACTTCCATGGGGAGGTGTTGACGCACATGTGCGGCTACCATGACAACCACCTCATCCGGTGGTTGCAGTTCAGGAGCAACCGGAACAGGACGTTCGGACCATACGGCAATCTTGGAGAAGACAGAGCTGGATGGACGCGGTTCGAGGTCTCCATGGAGCACTCGGGGTCCATCGTCGGCTTCTGCGGCCGGAGTGGCAACTTCACGGACGCCATCGGCGTTTACGTCGCCGTCTGGAATCCCGAGAGGTTCTATGATAGCATGCGCAGGCAGGGCGTCCGCGTTTACCGGGCGTCGCCTCTGCGCATGGACCTGCGTCAAATAGAAGAAGAGAAAAAGAAGGAAGAAGTGGAACGTGGGCGCCTACAGAAGGAGATCAAGGAGGGGCGAGAAAGTCTTCGGAAGTTACGATTGAAGCTTGGAGTGGATGTGCCGCAGCAGGATCAGGAAATCGTGCAGCAACTGGAACGCGGGCGTCAGGGAAAACGCCAGACAATAGAGGAGCTGCAAGTGGAGCATGAGCAACTGGAACGGGAACGAGGGCGCTTGCTTCTACTGCAGCAAGTGGATGAGCAACTGGAACGGGAATTGCGCAGACACACCTATTGA >LOC_Os04g26420 ATGGCTGACCGCGATGAGGAACAGATGTTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGTGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACATCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGATATATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCACGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGAGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGATGA >LOC_Os04g23260 ATGAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCACGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGACTCCTCCTTATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCCCTGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCACCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACACCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCCTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCAATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGAAGATCGAGCCGTTGGTCACCGGGAAAGACATGACGATAGAAGAATTTATTATTGACACCGGTCTAACTACGAATCAATTGCTAGGAGTTGAACCAATAGAAAAGAAGGAATTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGGGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACCCGGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGGAATCTATGAAGTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTATTCCACTGGGTGCTTTTACTTTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGATGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACTACGTCGAAATCGTAG >LOC_Os04g06010 ATGGCTGGCGACGAGATTGGGATGGCGGCGAGGAGGGAGCAGCTCAGACCAGGGACAGCCGGGACGACAGCGAACGGCGGCTGTAGATCAAAAGACGGCGGCATCCCATTGGTTCACGGCGAGGATGGCTTCCGGCGAGATTTCGGCGCAAGGGAGCCGGCTGCCGGGCTTCTCCTCCTCCTTGCGAATCCAACGAGGAGATTGAGAGGATTCCATTCCCGTAACTACTTTGGAAAGAGGAGCAACGGGGAGGTCGGATTTGGAAGGAGGAGGCGGTGGCAACAGGACACGGGATGGCCGGCTCGGCTCTGTCCAGAGGTTGAAGAAGGCAATGACAATACTCGAGGATCGAAGTTAAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCTTGGAGGAGACGACTCCTCCTCAGGATCCTGCACAGACTCCTCCTCAGGCTCGTGCACCGACTCCTCCTCAGGCTCCTGCGCCGTGTCCTCCAGCACCTTTCAAGTCAAGAACTCACCAAGCACCACCGCCTGCCCGCACAAGGGCAACAAAGAAGGTGAAAGTTGACGCCGCCGAGAACAAGGAGCCACCGTACGATTGCACGCAAGAGGAGCTTGACGCTTACATGGCAGCAGAAGTGAAGAGGCAATTGAAGCCTCAGAGTCCAGAAAAGAAGATTCCTATAAACCCGAGTGCCAAGAAGTTCTTCAGGAGTATGTCGGCACCAGCCAAGGAGGCCATAAAGCTAACGGACTATGAGCAAACACTTAAGAAAGCATATTATGGAAAGTACAAACAAGTCCCTAAGCTTGGAGAGCAACCAAACCAGAAGTTGCTTAAAGGCGCACCAATCCCAAAGGTGGAAGTGAGACACAAGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTTCCTACCGACACAGATGTACAAATTCTATCAACGGTACATGGAGATGAGCGCAAGCGGTAGGGAGATGATCGGAGCGAGGATCAAGAGCTCCGATTTCTTACAAGGGGAAGATATTCTCTGGATCAATTTCGAGGATATCTACGATCTATACCAGCTGGACGCCCTCGACGTATCTATTTTTAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGCCTACAGAGTCAATGTCTATGACCCAATGAATAAAGATAAGTCTACTTTTGACCAGGTTTTTGAATTGATAGACAGGGCTTGGTATCGATTCCGTCATTTGGTCCGCGGCAATTGGAAAGAAAAACTTCGGCGGAAGTTCAAATTTCCTGTTATTCATATGAGGGATAACCTCACACACAAGGAATTTGTCGTGGCGGTTCAAGAACAACTCATAGGATTCATCAACGAACAAGTCCTTGATCCTGAGGGTGAATTCTACTACGACGGAAATACAATTCATAAGCCGTTAGCTTTTGAGATAACGACTACTATGTCGAAGTCCTAG >LOC_Os04g22840 ATGGAGTTGGGTCGACCGGGGTGTCCAGTTGATCGGCTTCCGGATTCACTGCGGCATGAAAGGGGGGCCTGCCCGTTGCCTGCTGGGGACGGGGCGAACCCTAAGAGCTTCAAGGGAGATCTGTACCAGAAATACATCCTGAAGGGGCAGACACCGAACTTCAACACATTCCTGAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTACAAGATAGGTCAACAAGGGCAGGCTATGATGGAAACAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGCGAGGAGATGGAGGCAAGCTTGCTTGAGAGAGGTATCGAACCGGTCACCGCTAAATGGCCGGATCGATCAAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGTTGATGGCTCCTTGGTCTTCAGCGATCAGATACGCGAGGCTGCGAGTCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCACGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGAAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGTAAGGAAGGTGGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGATGAGCCCTTCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATCCAAACCCAGGACGAAACCACCTGCCTCATTGATGACATCACTCAGCGGACACCATGTGAGGTGCATATTCCCTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCTAACGGACCCTTCAAAGACTTACCACTGCAGGCCGATTCCAGTAGGATACTCCAAGGTACCTGCACCGTCTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTACACCAACTCCTCCGCAAGCTCCTCGTCCGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAAGGCAATGAAGAAGGCGAAAGTTGACGCCGCCAAAAACAAGGACCCGGGGTACGATTGCACGCAAGAGAAGCTTGACGCTTATGTGGCATCAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCCAGAAAATAAGATTCCTATAGACCCGAGTGTCAAGAACTTCTTCAGGGGCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTTGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCAACACAAATGTACCAATTCCATCAACTGTACATGGAGATGAGCGCCACTAGTAGAGAGATGATCGGAGTGAGGATCAGGGACACAGACTTCATGCAAGGGGAAGATATTCTCTGGATCAATTTTAAGGAATGGAGATTCAACGGGCCCGACAGCGGGGGGGTTTTTGATACTGGATTCGTCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTTAAAGCGCAGCATTACAAGACGTTTATACTATTGCCGTACAACACAGAGGCTTGGTATCGGTTCCGACATTTGGTCCGCTGCAAATGGAGAGAAAGACTTAGGCGGAAGTTTAACTTTCATGTTATTCACATGAGGGATAAGCTCACACATAAGGAATTTATCGCGGCGGTTCAAGAACAACTTATGGGATTCATCAACGAATAA >LOC_Os04g21370 ATGTCGGGCCAAACGGGGGATGGCAAAGATGGTGATAAGGGAGATACGTTTCCTTATGACTATCCATCCACATCTACTTCTTATCGATCACTATATACTATTCCTAGTATATCCAAAGGACCATTTGTTCGTAGCATTGGACCCAACACACTACGACAAGGAAACGTTCATGGAGTTCCTCACTATTCTGATTTTATCCCGTCAATCCCTTACGTAGCAAATCGGTTCGACGACACAATTATATGGAACATGTGCGCTGAGCACTGCCGTTTCACCCATCATGATGCCTACAATGCACTTGGGCTATTCTACGAAAAGGAGAGTCAAATCGCAATAAAAGACATATTCAACCCACTAGGAGAGTGGGAGGAAGAACATATATAG >LOC_Os04g07170 ATGCCGCCGCCGGCACGCCACGCCGCCGCCTTCGCCGGCGCGCGCGCAATGCCGCCGCCGGCACGCCACGCCGCCGCCACCGTCGCCACGCCGCCGCAACGCCACGCCGCCGCTGCCGTCGCCACGCCGCCGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGTGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTTCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGTGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGTATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCACGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGATGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCCCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAATGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTAAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAACAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCAGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGAAGTAGCAAGGAAGCAAATTAAGGCAAAGGAGGATGACTTGGAGGATGCGAGGAAGGCGATTTTAATGATCATAAATGCTGCTAATACATACCAACAAGTAGCAGAGAAGAAAATTAAGGATAAGGTGGAGGAACTGAGGGTCCTTGGGGTTCAAAAGGCAGATATGGATGGGAGGATAGCATCGTTGGAGTCTAGGCTCGAGGCAGCTCTAGTGAAGAATCAGGAATTGGAGTCTACTTATGTTAAGGCGTTGATTGAAAATGATAGGCTTTGGTCAGTCATTGAGAGGCTCATGATGGGCGCACTAGTTGAGGGGATCTCCGAATATCGTGAGCTTGAAAAGGCAGAGGTTCGAGCACCTCACGACAGCTTGCGACAATTATTCATCTTCCTCCTTGCACCCGCATTGCCAATTAGCCTAAAAGGTCCTAGCCACCAATCTTTGCAACCAACATGCACCAAAGAAGCTAGTGAAGGCGACGTGAGCGATGTGGACAACAACGGTCCAGCAGAATCAGGGAAATGTGCCATCTCCATTTCACAGGGCTGGGAATCCTCGATGCTATGGAAGGTATATTTGATTGTTCTTGAGAAGGCCAAGTTAATACCAACTAAGAGGTTGATCTCCTGGGAGTCAGTGACTCAGTGGAAGATTAGAAATTTCCACCTACCAAGTTGTTGTTGA >LOC_Os04g26310 ATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGCACGGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCTCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGGTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTAGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACAGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAAAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCAATTTTATTCGTATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os04g40230 ATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGATTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACATGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCACCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGTGGGGTATCGAACCGGCCACCGCTAATTGGCCGGACCGATCGAAGTTCTGGTACTATGCTCATGGTGGAACGCTCAACCTAGCTGATGGCTCCCTGGTCTTCGGCGATCAGATACGCGAGGCTGCGCATCGACTAACAGAAGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCGGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAAACTCTAGAGCATCCAGGACGAACACGAGGGAAATGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAACAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCTAG >LOC_Os04g06690 ATGGCTGACCGCGATGTGGAACAGATATTGTACGATACAATCGCGGAGGGAATCAGCCAGTACTGGAATGAAAAAGAGGGGAACGAGGATCTAAACCAGTACTTGAACGAGGAAGGGAACATGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACAAGGTGCAGCGAAGAAGCTTAAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACATCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTATGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTACGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATCCTAAAGGGGCAGACACCGAACTTTGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCATTGCATATAAGACAGGTGAACAAGGGCAAGCGATGATGGAAATAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCAAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACCACCAATTGGTCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCGGACAAAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGACGAAGATTGCAGATCTAGAGTTCCGGGTATCGAGCCACGAACTCAGAATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACACATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGGTGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCATACGAGGACCTCGAGCTGGATTACCCTGGAGGAGATAGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGACGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTATCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACACTTACGTTGCATCAGAAGTCAAGAGACAATTCAAACCTCGAAGTCTAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGATCAATTGCTAGGAGTTGAACCAATAGTAAAGGCGGAATTGAAATACATGTACGAACTCAGTAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCTTACCCACACAAATGTACAAGTTCCATCAGCTGTACATAGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGCACCCGGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGGAATCTACGAAGTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATAGAGATTCAAAGGGCCCGAAGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGATGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTTGACCTGTCGGCCTGCACCGTCAATGTATATGACTCAATGGATAAAATAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAACTGGAGAGAAAGACTTAGGCGGAGGTTCAAATTTCCTTACGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTTGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGACCTACGGGAGAGGTGGGGCCGTTGTATGCGGGATGGGATGAGGCCGTCGGTGCCAGAGCTAGGAAGCTGCTAGGTGGTGACGGGGTGGCCCGAGGTGGGGAGATGGAGGAAGACTCCCTTACTCCGGCAAGGCCATGGTTGCAGCTGCTGCGGCACAGATGA >LOC_Os04g03610 ATGGCCGATAGTACTAAAGGGACTGAAGAGAAGGGTTTAGGGGAACAGGAGCAGTCCCTTGCTGTTGTGGTTGCTCCGGAACCAACGGTCCCACCGGATGGTAGTTCCGACAGCGACGTAGGTGACGAAGACGAGGAGTACTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAATGGCGACGGTGAAGAAGGCGACAAGGACTACATTCCCCCTAAAGAAGGGGAAACGGCGCCACGACGATCAAAACGGCAGCCGAAGAAAAAAGTTCCTTCAAAAGACGAGGACGTACCGGCAAACACAACCGGCACACAGAAAAGCGAACGGTCAGCAAAGGCGAAGAGAAGGAAGGGCGAGAGAAGCGTAAATAGAAAGGATGAAGGGTTCCATGTTGTTACCCATGTTTCGCCTAAAGGAGAGCCGCTCGCCCCTAAGACGGCACGTGCGAAATTCAGTTCACAGTGTGGCATAATAGTAAGGGAGAAGATCTCCATCACGGTCAAGGACTGGGATCATGTAACGGATGGGGATAAGGAAGTCCTATGGAAAACTTTGAAGAAAATCTTCCAGTTCCCGGAAGGATCAGAGGCAGCGGTGAGAAATTGTGCACTGCAAACAATGGCCAATTCTTGGCGTGGTTGGAAAACCACCTTGAACAAGAAATTTGTGAAGACGGGACGCACACCGTTTTCGACATATGCCAACATAACCCCCAATCAGTGGGACGACTTTCTGACCTTGAAGAACTCCCCGGAAGAAATTAAAAGGAGCCAAAAGTATTCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCCGCGGGCTACGCACCAAAGGTGGAACAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAACCGGTACCAATGGAGGAGTGGACACAGAGATCGAGGAACTGGTGTCACAAGCAACCGCGAGGAACGGTCCTTTGCGGGTATTATGCGTGCGAATTCCTTAGGGTTAATGGACGGTACAGGACTAACGCGGAGGATTTGCCAAGATTAGAATGTCGAACAAGCTTTGACAATACAGGTATCACAAATGTGCAGCGTGATCTGTGCCACTTCATCCACCATGAGTGCTGTCATGTCAAAGGAGATTTCTTCGACCCAGAGGGTGCCCTAGTGGCAAGTGACGAATTCAAGGATCTTCGGGAGTGGAACACTGCTATGCCATAA >LOC_Os04g04200 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATATAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGTGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCATACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATACCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCATACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAAGAGGTGGCAAGGAAGGTTGATGAACGCATGTCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTATCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGTGGTACATCATCCTCCCTGGACGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCATCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTATGATTGCACGCAAGAGGAGCTTGACGTTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCATTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTTTTATTCGCATGAGGGATAACCTGATCACACACAAGAAATTTATCGCAGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTATCTTCTGAGCTAGCAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os04g11580 ATGACGAGGGTCTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTACGTTCATAGTACTGTCGTACAACACAGATGTGCAAAGCAGGACCAGGGAACTAACTTATGCGTCTACTACGTATGCGAGTATGCCCACTGCCTATCAAACCAAATATACACCACACGAGAGCTCGATCGTATTCACATGAGGGATAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTAATGGGATTCATCAACGAATAA >LOC_Os04g26360 ATGACGACGACGGGAACGACGGCGGCGCACGGCTGGAGCGACGGCGGCGACGGCGGCTCGAGGTCTCACGGCGCTAGGGCGTTTCCGGCGACGAGAGGCGAAGGCGAGGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCTAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGAAAGACATGACGATAGAAGAATTTATTATTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTGAAATACATGTACGAACTCGGTAAATCGCTTGTCAAGCCCAAGCTGGTGCAGTCCCTACCCACACAAATGTACAGGTTCCATCAGCTGTACGTGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACTTGGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGGAATCTACGAAGTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGACTTTATTCCACTGGGTGCTTTTATTCTTCGACCTGTCGGCCTGCACCGTCAATGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTACGTCATTTGGTCCGCGGCAACTGGAGAGAAAGACTTAGGCGGAGGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCAGTGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os04g13380 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGAGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCTGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGTTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAACGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGTCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAATCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGATCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os04g02960 ATGTCGAACGAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTCCGGTAGCAATAAGCATCCAGGCGCTTCTAGTGAAGAAACGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCATCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTTAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCGTACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAAATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGAGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCATTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTCAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGACCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAACTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAAGAAGTGCACATACCAGATGGTACTACATCCGAACCAAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCATAGAGCTGAGACAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTGTCACGCCTGAGTCAGCAAGCTTTGCCGATACTGGATATGACCCCCCGCCAAAAAAATGGAAAGGGATTTGCCAGGTTGGCCCATCGTTTGAGGCCATAAGTTGCAACCGGAAGTTTATCGGTGCACGGTGGTACATCGATGACGAGATTCTAAGTAGCATATCCGATAACGAGGTTCTTTCTCCTAGGGATGTCGAAGGCCACGGCACGCACACAGCCTCAACGGCTGGCGGCAACATCATCCACAATGTTAGCTTTCTGGGGCTAGCTGCAGGGACAGTTCGGGGTGGAGCGCCCCGTGCACGATTAGCCATATACAAGGCCTGTTGGTCCGGTTATGGCTGCTCCGGTGCCACCGTGTTGAAAGCCATGGACGACGCTGTCTATGATGGTGTTGATGTCTTATCACTTTCTATAGGTGGTACAAAAGAAGATGTGGGAACCCTACATGTCGTCGCTAATGGTATCTCGGTTGTCTACGCTGGTGGAAACGATGGTCCCATTGCTCAGACGGTGGAGAACCAATCACCATGGCTAGTAACGGTCGCTGCAACCACCATTGATCGGTCCTTGCCTGTGGTTATCACCTTGGGAAACGGCGAAAAGTTGGTGGCGCAATCCTTTGTCCTCCTGGAAACTGCAAGTCAGTTCAGTGAGATACAGAAGTACACAGACGAGGAATGCAATGCCAACAATATTATGAACAGCACGGTGAAGGGGAAAATAGCCTTCTGCTTCATGGGAGAGATGTTGAATAATAAGCAGCAGACATCATACCCTGATGTCACCACGGCAGTGGCAGCCAAAGGAGGCAGAGCACCGGACATTGCTGCACCAGGGGTTTCGATTTTAGCCGCTGCTCAGATTCCATATTACAAAGGTGTTTCCTACCATTTCGATTCTGGAACATCTATGGCTTGCCCCCATGTAGCTGGGATCATTGCGGTGCTCAAGTCCATTCATCCAAAATGGTCACCTGCGGCTCTCAAATCCGCAATCATGACAACAGACTACTCCATCCCGCTCGCTGGCGTGCACCAGCGATCGGGAGAGCAGGTCTCCGGAACCTCTGCCTTTGACGTCCTGCACCGGGAGAAGGCGGCAATAAGGCACTGTGATTTTACTATGGCTGATTTTGCCGATGCACTGAGGCCGGATAAATTCACCGGTGTGCATTTTAAGAGATGGCAGATCAGGGTCACTCTGTGGCTGACAGCTATGAAATGCTTCTGGGTGAGTACTGGCAAACCTGAAGGAGTTCTTACTGCTGAACAGCAGAAGCAATTCGAGGAAGCCACTACTCTATTTGTGGGATGCATTCTTAGCGTTCTTGGCGATCGTCTGGTCGAGGTGTATATGCATATGACCGATGCTAAGGAGTTGTGGGATGCACTGAATACTAAATTCGGTGCTACTGATGCTAGCAATGATCTGTATATCATGGAGCAGTTTCATGACTACAAGATGGCTGACAACCGTTCTGTAGTCGAACAGGCTCATGAGATACAAACCATGGCTAAAAGTTTCGGTACTGCACTCAAACACAAGAGACAGGAATACTCCGTTGAGGGGTTGATAGCGTCTCTTGATGTTGAGGAGAAAGCTCGGGAAAAAGATGCCGCGTCTAAGGGCGATGGTGGGCAGTCCAGCGCCAATGTTGTGCACAAGGCCCAGAACAAGAGTAAGGGGAAATACAAAGCTCAGCAGACCACCAACTTCAAGAAGCAGAAGAAGAACAACAACAATCCTAATCAGGATGAGAGGACTTGCTTTGTGTGTGGCCAAGTTGGTCATCTGGCTAGGAAGTGTCCACAGCGCAAGGGGATGAAGGCACCTGCAGGGCAGACTTCTAAGTCTGCTAATGTGACCATTGGCAACACTGGAGATGGAAGCGGGTATGGTAATTTACCTACTGTTTTTTCAGTTAATCAATCTACTAATTGGTGGGTTGATACTGGGGCCAATGTACATGTTTATGCTGACATCTCATTGTTTTCTTCTTATCAGGTCGCACGGGGTTCCACCGTCCTAATGGGGAATGGGTCACATGCTTCTGTTCATGGTGTTGGCACGGTAGATCTGAAGTTTACTTCGGGAAAGATCGTGCAGCTGAAGAACGTGCAGCATGTCCCTTCTATCGACAGGAATCTTGTTAGTGGCTCCCGTCTGACTAGAGACGGATTTAAGTTGGTTTTTGAGTCTAATAAAGTAGTCGTGTCTAAACATGGATATTTTATTGGTAAAGGTTATGAGTGCGGAGGCCTGTTCCGCTTTTCCCTTTCTGATTTCTGCAATAAGTCTGTGAACCATATTTGTGGCAGTGTGGATGATGAGGCTAATGTTTGGCATTCACGTTTATGTCATATTAATTTTGGCTTGATGTCTCGGCTTTCCAGCATGTGTTTAATTCCTAAGTTTTCCATTGTCAAAGGTTCTAAGTGCCATAGTTGTGTGCAATCGAAGCAACCTCGCAAGCCTCACAAGGCTGCCGAGGAGAGAAACTTGGCACCACTAGAACTCCTACATTCAGATCTTTGTGAAATGAATGGGGTGTTGACGAAGGGTGGAAAACGATATTTCATGACATTCATTGATGATGCTACTAGATTTTGCTATGTGTACTTGTTGAAAAAGAAAGACGAGGCTCTAGACTATTTTAAAATTTATAAGGCAGAAGTTGAAAATCAACTTGACAGAAAGATAAAAAGGCTTAGGTCTGATCGTGGTGGAGAGTTTTTCTCGAACGAGTTTGACTTATTCTGTGAGGAACATGGCATCATACATGAGAGGACGCCTCCCTATTCTCCCGAGTCTAATGGGATTGCTGAAAGGAAGAACTGCACACTGACTGACTTGGTGAATGCCATGTTGGACACCGCGGGACTGCCTAAGGCATGGTGGGGGGAGGTATTGTTGACCTCAAATCATGTGTTAAACAGAGTTCCTAACAGAAATAAGGACAAAACACCATATGAGATATGGATTGGTAGAAAACCATCACTTTCTTATTTGCGCACATGGGGGTGCTTGGCGAAAGTCAATGTACCAATAACGAAGAAGCGCAAACTTGGACCTAAGACTGTGGACTGTGTCTTTCTGGGATATGCTCATCATAGCATTGCCTATAGATTTTTAATAGTTAAATCCGAGGTACTGGACATGCATGTTGGTATAATTATGGAGTCTCGTGATGCTACCTTCTTTGAGAGCTTTTTCCCAATGAAGGATACACATAGTGGTTCGAACCAACCCTCTGAAATAATTCCCAGTTCAATCATACCACCAGAACAAACTGAACATACACATGAACTTGTCTCTGAGGAGGATGTCAGTGAAGCTCCTCGAAGGAGTAAGAGACAAAGGACGGCTAAGTCTTTTGGTGATGATTTTACTGTGTACCTCGTGGATGACACTCCTAAGTCAATTTCAGAAGCATATGCATCTCCTGATGCAGACTACTGGAAGGAGGCTGTCCGTAGTGAAATGGATTCCATTATCGCTAACGGGACTTGGGAGGTGACAGAGCAACCCTATGGGTGTAAACCTGTGGGGTGCAAGTGGGTGTTCAAGAAGAAGCTTAGGCCTGACGGTACTATTGAAAAGTACAAGGCTCGGCTTGTTGCTAAGGGCTATACTCAGAAAGAAGGCGAAGATTTCTTTGACACTTACTCACCTGTTGCTAGATTGACCACAATTCGTGTGCTACTTTCCCTAGCAGCCTCACATGGTCTTCTCGTTCATCAAATGGACGTTAAGACAGCTTTTCTTAATGGAGAGCTGGATGAGGAGATCTATATGGATCAACCTGATGGGTTTGTAGTTGAAGGTCAAGAAGGCAAAGTGTGCAAATTGTTGAAGTCTTTGTATGGTCTGAAACAAGCTCCTAAGCAATGGCATGAGAAATTTGACAAAACATTGACATCTGCAGGCTTTGGAGTCAATGAGGCAGATAAATGTGTGTATTATCGCCATGGTGGGGGTGAGGGAGTTATTTTGTGCTTGTATGTTGACGACATACTGATATTTGGGACAAACCTTGAGGTGATAAATGAGGTTAAATCATTCTTGTCTCAAAATTTTGATATGAAAGATTTGGGAGTAGCTGATGTTATCTTAAACATTAAGCTAATTAGAGGTGAGAATGGGATTACACTCTTGCAGTCCCATTATGTGGAGAAGATCTTGAATCGCTTTGGCTACATTGATAGTAAGCCTTCTCCAACACCTTATGATCCTAGCTTGTTGCTTCGCAAGAACAAGAGAATTGCTAGGAATCAACTGGAATACTCCCAAATCATTGGCTCGTTGATGTACCTGGCTAGTGCAACTAGGCCTGATATCTCCTTTGCTGTGAGCAAGTTGAGCCGATTTACCTCTAATCCGGGAGATGATCACTGGCGTGCGCTTGAGCGAGTAATGCGCTATCTGAAAGGTACTGTGGAATTGGGGCTTCACTATACTGGGTATCCTGCGGTACTGGAGGGTTATAGTGATTCTAACTGGATCTCTGATGTGGATGAGATCAAAGCCACTAGTGGATATGTTTTCACACTGGGTGGTGGTGCTGTTTCATGGAGGTCTTGCAAACAGACAATTTTGACGAGGTCAACCATGGAAGCAGAGCTAACGGCACTGGATACTGCTACTGTTGAGGCAGAATGGCTGCGTGATCTATTAATGGATCTGCCTGTTGTTGAAAAACCGGTGCCGGCTATCCTTATGAACTGTGACAATCAAACGACATGTGAAAAGACGATTGAAGTCTGTCAGGAAATTAAGAAACTCCGGAGTTATAACGTTGGATTACATCCAAACAGCGAGAAACCTGGCAGATCCCTTCACGAAGGGACTATCACGAAATGTGATAGACAATGCATCGAAGGAGATGGGTTTGAGACCCATTACATTGGAAAAGGCAAATCTCAGTGGGATTTTGAGATTTGGTGGAGGATTGTTGGAATTAATGAATGGGCCTTAGCCAACTCGAAGATTAATTCTTTGGAAAATCACAAAAAGCCCACCTCATGGGATGGCATGCATGTGGAGTTTAGTACCACCTTGCTTATTCTAGGAGAGGGGGACCTCCTTAAAAGGGAGGATGCCCTCCTAGCCACTTGA >LOC_Os04g34850 ATGAATGAGAACGAGAGAACGAACGTGAACGAGAACAAGGTGAATGAACGTGAACGAGAACGTTGTCGGACAAACGTGAACGAGCCAACGAACGTGAACGTGAAATGCAATTATAGGCAGGTGGCTGATCGCGATGAGGAACAGATATTGTACGATTCAATCGCGGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCTAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGTGGGTACAGAGGACAAAATGGAAAGGTGGACTCTAAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGAGCTGTACAAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACCGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCACCAAGAAGAAGTACCATCACCACTTGGGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCACTGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTTAGGAAACCGTAGCAGCTGCGCTTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAATCCACCTGCCCCGTTGATGACATCACTCAACGGACACCATGTGAGCTACATATTCCTTTCAAGAACTTATCAATAAAGGTGGTGTCGGGCATGGCCATCCCAACGGAACCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCAAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTAGAGGAGACGCACCGTCTCCACCTCAAGCTCCTGCACCGACTCCTCCTCGGGCTCCTGCACCGACTCCTCCGCAAGCTCCTCTTCCGACACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCACCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGACCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAAACAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGACATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCAGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAACCCTGAGCTTCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCAACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATATCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTTAATGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCAGTTCCGTCATTTGGTCCGTGGCAAATGGAGAGAAAGACTTAGGTGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGAAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCAATTTTATTCGCATGAGGGATAACCTGACCACGCACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAATAA >LOC_Os04g03350 ATGGCTGATCGCGATGAGGAACAGATACTGTACGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAACGAAGAAGTGGGGAACGAGGATCCAAACCAGTACTTGAACGATCCGGGGAACGTGGAGAGGGATGTGGAGGGGAACGATGAGGGGAACGAGGAGGAGGAGGCTAGTGGAAGTCATCCCTCCGCTGGACAGAAGAGGGCACACGGACAACGAGGTGCCGCGAAAAATATAGAGGGTCGGCACATCATAACTAAGGGGCTGACACCGAACTTCGACGTATTCCCGAAGCTAAGGGATCATTGGGACGAGTTCGCTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGTCAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTGTAGCGTCGCAATGCCGAATTGCGAGGAGATGGAGGCAAGCTTGATTGAGAGGGGTATCGAACAGGCCACCGTTGATGGCTCCCTGGTGTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGAGGCAGTGGAAGCCTCTACGCAGGGCACGTTCCGACCCGACAGAGAGAAGGACGAGCTATCGCTCGCCCTGCAGACTCCCGAGCATCCAGGAAGAACACGTGGGAAAGGCATGGTTCATTGGAAGATTGGATTCAAGGAGGACATCCACACATACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGTAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATACAAGAGGAGGTGGCACGGAAGGTTGCGTCGGAAATGGCCATCCCAACGGACCCTTCAGGGACTTACCACTGCAGGCCGATTCCAGTAGGATACTCGAGGGTCGAAGTTGAGTTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCTGGAGGAGACGGTGAGACGCATCTACACGACACGAGCCATGCCATTATACTATGGCGCAAGCGCTACATCATCCTCCCTAGGCGAAAAGCGGCGTCTCATGCACCATCCCCTCCGGCTCCTCCACTGTCTCCTCCTCATCAGTCTCCTCCACCATCTCCTCCTCAGGATCCTGCACCGACTCCTCCTCAGGCTCTTGCACCGACTCCTCCTCAGGCAACTGCGCCGCGTCCTCCAGCACCTTCCAAGTCAAGAACTCACCAAGCACCACCGCCTGCCCGCACAAGGGCGACGAAGAAGGCGAAAGTTGACGCCGCCGAGAACAAGGAGCCACCGTACTATTGCATGCAACAGGAGCTTGACGCTTACGTGGCAGCAGAAGTGAAGAGGCAATTGAAGCCTCGGAGTCCAGAAAAGAAGATTCCTATAGACCCGGGTGCCAAGAAGTTTTTCAGGAGTATGTCGGCACCAGCCAAGGAGGCCATAAAGCTCACGGACTATGAGCGAACACTTAAGAAAGCATATTATGGAAAGTACAAACAAGTCCATCAGCTTGGAGAGCAATCAAACCAGGAGGTCGAGCCATTGGTGACAGGGCAAGAAATTGGAATAAAAGAATTCCTTTCTAACACCGGGCTAACTAGGGATCAGTTGCTTAAAGGCGCACCAATCCCAAAGATGTACAAATTCCATCAACGGTACATGGAGATGAGCACAAGCGGTAGGGAGATTATCGGAGCGAGGATTAAGAGCTCCGACTTCTTACAAGGGGAAGATGTTCTCTGGATCAATTTCAAGGATATCTACGAACTATACCAGCTGGACGCCCTCGACGTATTTATTCTTAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGATGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACATCGACATGATCACCGACTATCCGCAAGCCATAGAGGACAATCTCGTCAATCTCCTGAAGGAGCAGCATTACAAGAGATTCCACTGGGTCCTTTTACTCTTTGACTTGGAGGCCTACAGAGTCAATTTCTATGACTCAATGAATAAAGATGAGTCTACTTTTGACCAGGTTTTTGAACTGATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAATTGGAAAGAAAAACTTAGGCGGAGGTTCAAATTTCCTGTTATTCACATGAGGGATAACCTCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATAGGATTCATCAACGAACAAGTCCTTTATCCCGAGGGTGAATTCTACTACGATGGAAATACAATTCATAAGCCGTTAGCTTCTGAGATAACGACTACTACGTCGAAGTCGTAG >LOC_Os04g43590 ATGAACGTGAACGAGAACAAACGAACGAACGTGAACGAGCCAACGAACGTGAATGAGAACGAGCGAACGAACGTGAACGAGAACAAGGTTAATGAACGTGAACGAGAACATTGTCGGACGAACGTGAACGAGTCAACGAACGTGAACATGAAATGCAATTATAGGCAGATGGCTGATTGCGATGAGGAACAGATATTGTACGATTCAATCGCGGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTATTTGAATGAGGAAGGGAACGTGGAGAGTGATGCGGAGGGGAACCAGGAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATATACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAAGGCACACGGAGATCATGAGAGCTTTGTCCCAGATTCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAAGCTTCAAGGGAAAGCTGTACAAGAAATATATTCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACACTCAACCCAGCTGATGGCTCACTAGTCCTCGGCGATCAGATACGAGAGGCCGCGCGTCGACTAACAGACGCAGTGGAAGCTTCTTCTCAGGGCACGTTCCGACCGGATAGAGAGAGGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCAAGGCCACACATCTGTCCAATGATCTCCAGCCGACCATTCCTCCTGCAATGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCACGGTCGAAGTTGAGTTGGTCGAAGGCGTGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGCACCGTCTCCACCTCATGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCGGGCTCCTACACTGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCACACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGCTAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTTTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGATGCTCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGTGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGATCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCAGCCTACACCATCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGATAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGTAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCTTTGCGCAAAGCAAAAGAAGGGAACTAATTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCAATTTTATTCGCATGAGGGATAACCTGACCACGCACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATAAACGAACAAATCCTTGATCTCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAGCATCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os04g20450 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAATGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAATGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACGGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCAGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGAAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGTGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGATGA >LOC_Os04g28650 ATGGAAGAAGATGAAGTGGAAGACGACAATATTCTGGACATTGCTCAGTACGCTGGATTTGAAGGAAATCAAACGGGCGAGGAGGAAAGGGATGCTGATGGTAACAACGTTGCGGATGATCTTGGTCAGATGTTGCAGGACGCCAAGGAGGATTGCGAATGTGAAAAGGGGGCCCATAAATTGGACAAGATGTTAGAGGACCACAGAACGTCGTTGTACCCAAGTAACAAAGCTATGTGCTTTCATGAACGCAATTTCGCAGAAGAGATCGGTATTCTCGGTCCTGTGTACCTACACAACATGTTTCCTTTCGAGAGGTACATGGGCGTTTTGAAGAAGTATGTTCGTAACCGTGCTTGTCTAGAGGCAAGCATCGCCAAGGGGTATGGAACAGAGGTGGTCATTGAATTCTGCGTAGAATTTATCGAAGACCTTCGCCCAATCGGGGTACCTGAATCACGCCATGAAGGGAGACTACAGGGAAAGGGGACTCTCGGAAGGAAAGCAATAATGACGGTAGACAACAATTTATTCCGTAAAGCCCATTTTACGGTTCTGCAACAATCTTCATTGGTGGCTCCCTACATCGAGGAGCACTTGGCTCTAGTTCGCGCCAGAAACATCGGTAAGTCCGATGCATGGATTACAAGGCATCACATTGATACTTTCTCCACGTGGCTGCGACAACATCTCATGGGTAATGAGACGATTAACCAACAACTGGCCTTCCTGGCGAGGGGACCATCTAGCTCGATCGCGACATTCCAGGGATATGAAATCAATGGGTACACATTCTACACGAGGGCCCAAGACATGAAGAGCACGAACCATAACAGTGTTGTTCGTATCGATGCCATGGGACACGATGGTACAACTGGCACGTATTACGGTGCCATCGACGACATATGGGAACTTGACTATGGACCTCTCAAGGTTGGATACTCGGACGAACCTTTTGTCCTTGCCAATGATGTAACCCAAGTTTTTTACATCAAGGACATGTCTAGCAAAAGAAAAAAGGGCAAAGGGCCTGACGAGCCGAAGCGCCACGTGGTTCTCCCAGGAAAAAGAAAAATCATCGGAGTAGAGGACAAGACTGACGAGGATTACGATCAGTTTGATGGGCAACCCCCTTTCACGGTGACGATTGACCCTAGCATCCTCCTATCAAATGAAGACACCCCTTACTCACGTAGCGATCACAAAGAAGGAACAATAGTGAGGAGAAAAAACACATATGCAATGAAATTCAAGACACAGCTGCTATTATCTTTAGTCCCGATTCCTAACCCTAACCGGATGGCTGATCGTGAAGAGGAACAGATACTATACGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGGGAACAATGAGGAGGAGGCTAGTGGAAGTCATCCCTCCGCTGGACAGAAGAGGGCACGCGGACAACGAGGTGCCGCGAAGAAGATAGAGGAAGCAGCCAAGAATTTTGTACGCCATAGCAGTTGGGTTGTGAGGGACAACGTGCCTGTCAGCACGGTGTACTGGCGCAGAACAAGGGCACGCGGGGATAATGACAGCTTTGTCCCGGACTCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTCATTCTACCCGCGAGTACGGAGAACATAGTGAAACAGTGGACTCTGAAGAAAATGGCAGAACAGTTCCAGAGCTTCAAGGGAGATCTATACAAGAAATACATCCTGAAGGGACTAACACCGAACTTTGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGTTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGTCAGAAATAAAGACAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCAATGCCGAAGTGGGAGGAGATGGAGGCAAGTTTGATTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTTTGGTACTATGCTCATGGTGGAACGCTTAACCCAGTTGACGGCTCCCTTGTCTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGTAGCCTCTTCTCAGGGCACATTCCGACCCGACAGAGAGAAGGATGAGCTGTCACTCGCCCTACAGACTCCCGAGCATCCAGGACTAACACGAGGGAAAGGCGTGATTCCCTGGAAGATTGGATTTAAGGAGGACATCCACACATACAGGAGTCAGATGAGGGGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCGCACATCGGTCCCAGGAATCCCAGCCGTACATTCATCCTGCAATGGTGGCGTCGGGAATGGCCATCCCAACGGACCCTTCCGGGACTTACCACTGCAGGCCATACTCGAGGGTCGAAGTTGAGCTTGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTAAGACGCATCTACGAGACACAAGCCACGCCATCATACTATGGCGCAAGCGGTACATCATCCTTCCTGGGCGACAAGCGGCGTCTCGTGCACTATATCCTCCGGCTCCGCCATCTCCTCCTCCACCATCTCCTCCGGTTCCTCCGCCACGTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCACCTCCTGCTGCACCATCTCCTCCGGCTCCTTCGCCTCCTCCGCCTCCACCGTGTCCATCTACACCTCCCAAGATAAGGTCTCGCCACGCTGCACCGCCTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGTTGGCGCCACCAAAAACAAGGAGCCACCGTACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGTAGGAGAGGTGAAGAGGCAACTCAAGCTTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGAGTGAAGAACTTCTTCAAGGGAATGTCCACAACAAACAAGGAGGCGTTACAGATATCGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCACTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGTGAAGATTTTGGCATAATGGAATTCATTTCAGACACCGGTCTAACTGTGGATCAGTTGGTTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATATAAGTTTGAACTCGGTAAACCGCTTGTCAAACCTGAACAGCTGCAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCACCAAGGGTAGAGAGATGTTCGGAGCAAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTCTGGATCCATTTCAAGGATCTCTTCGATCTGTACCAGTTGGATGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTCTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACATACATACTACTGCCGTACAACACAGAAGTCACTATGTACGGCTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCAAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCACGTATTCACATGAGGGATAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAAAACAACTGATGGGATTCATCAATGAAGAAGTCCTTAATCCCGACGGTGAATTCTACTACGACGGATCGACAATTCATAACGTCGGTACTTCCTCTCCTGACATAACACCGGCGTCGAAGTCGTAG >LOC_Os04g24960 ATGCCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCACGCCGCACGCCGCCACGCCGCCGCCGCCACCGCCACGCCGCCGCGCCAACCACCGCCCCGATGCCGCCACACCGCCGTGAATGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGGACGAACACGTCAACGTACGTGCCGCGAGAATGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGATCGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAACGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGACTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGTAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCATGGTGGAACGCTCAACCCAGCTGAAGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCATGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACTTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGTGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTGGAAACCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGGCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCTGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTTAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATCAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTTAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATGCTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCACATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTTCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os04g34820 ATGCCTGCGAGGAAGAGTAACGTTCGCTGCGGGGTGAGGGAGGCGAGAAAAGGAGCGCGGGAACCTTTTTCATCGTGCGTGTGCAAGAGAGTGAAGACCGTGATTGGGAAGAAAAAATCGCTCCCTGAAACTCGAGGAGAAAATTGCCGTCGTCTTCTTTGCAGGCTATTGCAAATTCGATGCCTCTCCCGATCAATATCCACGGACCCTTTGGGTACATACCATTGCAAGCCCATTCCACCTGGATACGCGAGGGTCGAGATAGAGCTGGTGGAACGAACCTACGAGGATCTCGAGCTGGACATCCCCGGAGGAGACGGGGAGACGAGACTTGGAGACACAGCCCATGCCATTTTACTCTGGCTGAAGAGGTACATCATGTTTCCCGGGCAAGATGGGGTGTCCACACCTCCATCCCCGCCGCAAGCGCCGTCTCCTCCGCCTCCTCCATCTCCTCCGGCTCCTTTGCCTGCATCGGCTCCTCTGGCTCCTTCGCCTGCACCGGCTCCTCCGCCTCCACCACCTCCTCCGCCTGCACCTGCTGCCAAGTCTGCACCGTCTGGTCCATGGCAAACGACTCCTCAGCCTGCACCAGCTGCCAAGTCTGCACCGACTCCTCAGCCTGCACCGGCTGCCAAGTCAAGGTCCCGCCAATATGAACCTGCGCCGTCAAGGCCTATGAAGAAGGCCAAATCTGACGAGCCAAGGCTCCCAGCTCTCAAGAAAAGGTCGTACGACAAGACTCCGGAGGAGCTCGATGAAGCCGTTAGAGTGGAAGTTAGGGCACAATTGAATCCACGTAGTCCGGAAAAGAAGATTCCTATAGACCCGGAGGCTCAGGAGCACTTTATTAAAATGATGGAACCGGGCAAACCAATCGTAGTTTCTGACTATGATTGA >LOC_Os04g08812 ATGATGATCCGGACTACATACCTATCGAACAGGCCAGTTACCTATTCTGTGCAGATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGACGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAATCTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCGTCGAACCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTCTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGACGCCATCGGCAAGCTCGAGCTCGTCCCACGCGCCGCGTCTGACGCCGTCGCTCTCTGCCCCTCCCCTTGTGCCTGACGCCGTCGGCAAGCTCGAGCTCGTCCGTCATCCCCTCCACCGCCAAGTTCCTCCCCGTGGTCGTCGGCGAGCTCGAGCTCGTCCCCTCAACCGCCAAGCTCCTCCCCGTGGTCGTCGGCGAGCTCGAGCTCATTTCCTCCGCCGTCAAGCTCCTCCCCGTGGTCGCTGGTGCCGGCGAGGTTGA >LOC_Os04g40240 ATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGGTGGATTACCCTGGAGGAGATGGTGAGACGCATCTACGCGACACAAGCCACGCCATTATACTATGGCGCAAGCGCTACATCATCCTCCCTGGGCAACAAGCGGCGTCTCATGCACCATCCCCTCCGGCTCCTGCACCGTCTCCTCCTCAGGCTCCTGCACCGTCTCCTCCTCATCAGTCTCCTGTACCGTCTCCTCCTCAGGCTCCTACACCGTCTCCTCCTTATCAGTCTCCTGTACCGACTCCTCCTCAGGATCCTGCACAGACTCCTCCTCCTGCACAGACTCCTCCTCAGGCTCCTGCGTCGTGTCCTCCAGCACCTTCCAAGTCAAGAACTCACCAAGCACCACCGCCTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCGAGAACAAGGAGCCACCGTACGATTGCACGCAACAGGAGCTTGACGCTTACGTGGAAGCAGAAGTGAAGAGACAATTGAAGCCTCGGGGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGCCAAGAAGTTCTTCAGGAGTATGTCGGCACCAGCCAAGGAGGCCATAAAGCTAACGGATTATGAGCGAACACTTAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGCGAATATTTTGGAATACAAGAATTTATTAATGACACCGGGCTAACTACGGATCAATTGCTAGGAGACGCACCAATCAAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAATCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCAACCGGTAGAGAGATGATCGGAGTGAGGATTAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTTGATGTCTCTATTATGAGTTGCTGGATTTTATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTACACCGTCAACATATATGACTCAATGGATAAAAAAGAGTCTACGTTCGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGATAGAAAGACTTAGGCGGAAGTTCAATTTTCCTTGCGCAAAGCAAAAGAAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGACTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTCATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os04g06100 ATGGACATCTCTAGGGCAAATGAAGGCTACACGAGCTGCGGCCCGGTAGTCGAGATGTTATGGCACAGGGCCGGTGTCCTGCTGCTAGGGGCTCAGTCCTGCCTACCTGTCCCGGGGGTTCCGGCCATAGGTGGGGTTGGGTCGGTACTCTTGTTTATGGCTAGGATGGGTTGGAAACTATGTCATGTCTTCCGTCCGTATACCGTGGTGCTAAAATGTGGAATGGATGGCCTGGGTTGGCTTGGGACGAGCTGGGAGCCAGGGTCGGGTTGCCAGTTCGGTCTGAATCATCGTAGTCCTTGGGTTAAGGCAGAGGTCGGAGATGAAGCTTCGGAGGATCCCTACGCTTACTACCAGGAGGGTGATGAAGACGATGGCGCTCAGAAAGCTTATTATGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGGTCGAGCCGTTGGTGACCGGGGAAGAAATTGGAATAAAACAATTTATTTCTGACACTGGGCTAACTAAGGCTCAGGTGCTTAAAGGCGCACTAATCCCAAAGGCGGAAGTGAAATACCAGTTCGAACTCGGTAAACCGCTTGTTAAGCCTGAGCAGTTGCAGTCCCTACCGACACAGATGGCTTGGGGTCGGTTCCGTCAATTGGTCCGCGGCACTTGGAAAGAAAAACTTAGCCGGAGGTTCAATTTTCCATGTGCAAAGCAGAGCCAGGGAACTAACTTGTGCGGCTACTACGTATGCGAGTATTGCCGCTGCATTGCAACCCAAATCTACACCACAAGAGAGCTCGATGTTATTCACATGAGGGACAACTTCACACATAAGGAATTTATCGCGGCTGTTCAAGAAGAACACATGGGATTCATCAACGAAAAAGTTCTTGATCCCGAGGGTGAATTCTACTATGACAGATCGACAATTTATAAGTCGTTATCTTCTGAGATAACGCCGACGTCGAAGCCGTAG >LOC_Os04g20100 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAAGAGGGTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCTAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCGCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAAACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTTAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACATAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGAAAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os04g05410 ATGGCGATGGTGCGCGGCGCAGCGGTGGCGGCAAGACGCGTCGGCGACGGCAGAGGGGAGGCGAGGCAGCGCGCGGCGCGCGGGGCGCGAGGCAGCTTGGCAGAGGAGGGGCTAGGGCTAGGAAATGCGATGCACGGGGACACGACGGTACGCGGCGTGACGGCGACGGTGATGACGACGGCAGAGGAGGGGGCTGGAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGCTCGACAAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGGTTTTTGACAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCAGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACAGAGGTTTCATTTTCCACGTATTCACATGAGGGAAAAACTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGGTTCATCAACGAAGAAGTCCTTAATCCCGATGATAGGTCTGTCGGGAAAGCTAACATATCTAGGTCATACTGTCTGTCGGTGGATTCCATTAACGACAGGCTACTCAGGGACACACTCTTTCTATCGGTAAAGGTCTTTTCCGACAGATAA >LOC_Os04g05720 ATGGAGATTCAAAGGGCCCGACGATGGGGGGTTTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGCTCGACAAAGTCACTGTGTATGACTCAATGAATAACGAGGAGAAGGTTCTTGACAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCGATTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACAGAGGTTTCATTTTCCATGTGCAAAGCAGGACAAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCCCACTGCCTATCAAACCAAATATACACCAAACGAGAGCTCGATCATATTCACATGAGGGAAAAACTCCCACACAAGGATTTTATCACGGCTGTTTAA >LOC_Os04g29440 ATGCCGCGCGCGGCACCACGCCGCCGCCGCGCCGCGGCACCGCCGCTCTGCTGCCGCCACACCGAGAACGTGAACGAGCGAACGAACGTGAACGAGAACAAGATGGCTGATCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAAGGAAGCAGCAAGTACTGGAACGAAGAAGAGGGGAATGAGGATCCAAACCAGTATTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCGGCGAAGAAGCTTGAGGATTGGCACATCATAACGGAAGTGGAAGAAGATGGACGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATACATTCACCCTTCCCGCGGGTACAGAAGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGTGCGTCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCGGACAGAGAGAGGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCAGGGTATCGAACTACGAGCGCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAAGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAATCCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCCGGCATGGCCATCCCAACGGACCCTTCAGCTTCTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTATGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGTGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCATGCACCATCTCCTCCGGCTCTGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTACTCCTCGGGCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCTGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACACAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAAACAATTCAAGCCTCGAAGTCCAGAAAAGAAGACCCGAGTGTCAGGAACTTCTTCAGGGCCTGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTTGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGATGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGCGGGGTTTTCGATACTGGAATCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTTGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATTGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATTGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAACTGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGTGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGTAGACCTAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCACGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os04g23380 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATGCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCTAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTAGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTAGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGGTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACATAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTACGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACAAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGATCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAATTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os04g29820 ATGACCTATAGACTTAGCAACTATTTTTTGTATGAACAGATGGCTGATCGCGATGAGGAACATATATTGTACGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGGGAACGTGGAGAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGCTAGACAGAAGAGGGCACGCGGGCAACGAGAGGACAAAGTAAAAAGGTGGACTCTAAAGAAAATGGTAGAACAGTTTCAGAGCTTCAAGGGAGATCTGGACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTGAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTCAACAAGGGCTGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCATCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATAGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGTTGATGGCTCCCTGGTCTTCAGCGATCAGATACGCGAGGCTGCGCATCGACTAACGGACGCAGTGGAAACCTCTTCTCAGGGCACGTTCCGACCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGAGACTCCAGAGCATCCAAGACGAACACGAGGGAAAGGGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCAAAGATTGTAGATCCTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACACATGGCCGCACATCGGTCCCATGATGCCCAGTCGACCATTCCTCCTGCAATGGTGAGCCCTTCAGGAAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGATGCCATGCAAACCCAGGACGAAACCACCTGCCCCGTTGATGACATTACTCAGTGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAACAGGATACTCTAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACAAGGACCTCGAGTTGGATTACCCTGGAGGAGACGCTCCTCGTCCGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCTCCCACAAGGGCAACGAAGAAGGCGAAAGTTGATGCCGCCAACAACAAGGAGCCACTGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCAGCAGAAGTGAAGAGGCAATTGAAGCCTCGGAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGCCAAGAAGTTCTTCAGGAGTATGTCGGCACCAGTCAAGGAGGCCATAAAGCTAACGGACTATGAGCGAACACTTAAGAAAGCATATTATGGGAAGTCCAAAAAAGTCCCTCAACTTGGAGAGCAGCCAAACCAGGAGGTCGAGCCGTTAGTGACCGGGCAAGAAATTGGAATAAAAGAATTCATTTCTGACACCGGGCTAACTAGGGATCAGTTGATTAAAGGCGCACCAATCCCAAAGGCGGAAGTGAGACACCAGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCGACACAGATGTACAAATTCCATCAACGGTACATGGAGATGAGCGCCAGCGGTAGGGAGATTATCGGAGCGAGGATCAAGATCTCCGACTTCTTACAAGATGAAGATGTTCTCTGGATCAATTTCAAGGATATCTACGAACTATACCAGCTGGCGCCCTTGACAATGGAGATTCAAAGGGCCCGATGGCGGGGGGTTTACGATACTGGATTCATCGACCCTAGGAAAGTAAACTGTGAAATGATTGCCAAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGAGCAGCATTTCAAAACGCCTGCAGAGTCAAATGTCTATGACTTAATGGATAAAAAAGAGTCTACTTTTGACAAGGTTTTTGAACTTATAGACAGGGCTTGGTATCGGTTCCATCATTTGGTCCGCGGCAATTGGAAAGAAAAACTTAGGCGGAGGTTCAAATTTCGTGTTATTCACATGAGGGATAACCTCACACACAAGGAATTTATCGTGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAGTCCTTGATCCCGAGGGTGAATTCTACTACGACGGAAATACAGTTCATAAGTCGTTAGCTTCTGAGATAACGACTACTACGTCGAAGTCGTAG >LOC_Os04g29360 ATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGCATGGTAGCACATCGGTCCCAAGATCCCCAGCCGTACATACCTCCTCCAATGGTCAGCCCATCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGAATGGCCATCCCAACGGACATTTCAGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGATAGTGAGACGCATCTACGAGACACAAGCCATGCCATTATACTATGGCGCAAGCGATACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCTTCCAGCTCCGCCGTCTCCTCCTGCACCATCTCCTCCGGTTCCTCCGCCACGTCCTCCTGCACCATCTCCTCCAGCACCTCCGCCACCTCCTCCTGCACCATCTCCTCCGGCTCCTCCGGCTCCTCCGCCTCCTCCACCTCCACCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCTCTTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCACCAAAAACAAGGAGCCGCCGTACGATTGCAGTCAAGAGGAGCTTGACGCTTATGTGGCAGGAGAAGTCAAGAGGCAACTCAAGCCTCAGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCATGAAGAAGTTCTTCAAGGGAATGTCCACCACAAACAAGGAGGCCTTAAAGCTATCGGACTATGACCGAACACTTAGGAAAGCCTATTACAAGATGTCCAAACCAGTTCCTCAGCTTGGTGAACAGCCAAACCAAGAGGTCGAGCCATTGGTGACTGGCAAAGACTTTGGCATAACGGATTTCATTTCGGACACCGGTCCAACTGTGGATCAGTTGGTTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTATCAGGCCTGAGCAGCTGCAGTCCCTACCGACACAAATGTACAAATTCCATGAACGGTACATGGACATGAGCGCCAAGCATAGAGAGATGTTCGGAGCGAGGATTAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTATGGATCCATTTCAAGGATGTCTTCGATCTGTACCATCTGGACGCCCTTGACGTCTCTCTTCTAAGCGCATGGATTTTAATGGAGATTCAAAGGGTCCGACGGTGGGGGGTTTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATTGACAAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGGTTTTTGACAAGGTGTTTCAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCACGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTTATTTTTCATGTGCAAAGCAGGACAAGGGAACTAACTTATGCGGCTACGACATATGCGAGTATGCCCACTGCCTATCACACCAAATATACACCACATGA >LOC_Os04g04420 ATGGCAGAACAGTTCCAGACCTTCAAGGGAGATCTGTACCAGAAATACATCCTGAAGGGGCAGACACCGAACTTCGACGTATTCCTGAAGCTATGGGATCACTGGGACGAGTTCGTTGCTTACAAGACAGGTCAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCTAAGAAGAAGTACCATCACCACTTGGTGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAAGGGTATCGAACCGGCCACCGCTAAAGGGCCTGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAATGCTCAACCCAGTTGATGGCTCCTTGGTCTTCAGCGATCAGATACGCGAGGCTGCGAATCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCATGTGGCGTTGGGAATGGCCATCCCAACGGACATTTCAGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTTAAAGTTGAGCTGGTGGAAGCCGTGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACACCATTATACTATGGCGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCTTCTGGCTCCGCCGTCTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCACCTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCTCCTCCTGCAACAGGCTCCTCCGCCTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCACCTCCTCCTGCACCATCTCCTCCGCCTCCTCCGCCTCCTCCACCGTGTCCGCCTACACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCTCCTGCCAGCACAAGGGCAACGAAGAAGGCCAAAGTTGACACCACCAAAAACAAGGAGCCACCGTACGGTTGCAGTCAAGAGGAGCTTGACGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGTCTCGGAGTCTTGAAAAGAAGATACATATTGACCCGAGCATGAAGAATTTCTTCAAGGGAATGTCCACCACAAACAAGGAGGCCTTAAAGCTATCAGACTATGACCGAACACTTAGGAAAGCCTATTACAAGAAGTCCAAACCAGTTCCTCAGCTTGGAGAACAACCACACCAAGTGGTAGAGCCGTTGGTGACCGGCGAAGACTTTGGCATAACGGATTTCATTTCGGACACCGGTCTAACCATCGCTCAGCCTGAGCAGCTGCAGTCCCTACCGACACAAATGTACAAATTCCATGCACGGTACATGGAAATGAGCGCCAATGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTATGGATCCATTTCAAGGATGTCTTCGATCTGTACCATCGGGACGCCCTCGACGTCTCTCTTCTTAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACAGCGGGGGTTTTATGATACTGGGTTCATCGTCCCTCGGAAAATCAACACCGAAATGCTCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTTCATACTATTGCCGTACAACACAGAAGTCACTGTGTACGACTCAATGAATAAAAAGGAGAAGGTTTTTGACAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGAAGGTTTCATTTTCTATGTGCAAAGCAGGACAAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCCCACTGCCTATCAAACCAAATATACACCACACGAGAGCTCGATCGTATTCACATGAGGGAAAAACTCCCACACAAGGATTTTATCATGGCTGTTCAAGAACAACTGATGGGGTTCATCAACGAAGAAGTCCTTAATCCCGATGATGAATTCTACTATGACGGATCGATAATTCGTAACGTCTGTCCTTCCTCTTCTAACGTAACGCAAGCGTCGAAGTCGTAG >LOC_Os04g41670 ATGGCCGATAGTACTAAAGGGACTGAAGAGAAGGGTTTAGGGGAGCAAGAGCAATCCCTTGCTGTTGTGGTTGCTCCGGAACCAACGGTCCCACCGGAAGGTAGTTCCGACAGCGACGTAGCTGACGAAGACGAGGAGTACTCATCGCCAAGCGATCCTTGTTCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGACGACGGTGAAGAAGGCGACAAGGACTACATTCCCCCTAAAGAAGGGGACTGGGATCATGTATCGAATGGGGATAAGGAAGTCATATGGAAAGAGTTGAAGAAAATCTTCCAGTTCCCGGATGGATCAGAGGCAGCAGTGAGGAATTGTGCACTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAACCACCTTGAACAAGAAATTTGTGAAGACGGGACGCACACCATTTTCGACGTATGCCAACATAACCCCGAACCAGTGGGACGACTTTCTGACGTCGAAGAACTCCCCGGAAGAAATTCAAAGGAGCCAAAAGTATGCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCCGCAGGATACGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGAGGCAACTGGTACCAATGGAGGAGTGGACACAGAGATCAAGGAACTGGCATGGGGGAAGGGTTCGAGGTGTGTCGAGCAAGATGAGTTGGAAGGAAGGGTTCAAAAATGACCCCCACAAGAAGCGTGAAGCGTACAAGGATAAACTTAGAGACGAAGGGGCTGCGGAGTTTGAATGGCAAATGATGGATTTCTGCGTCAAGCACATGCTTTTGCCTCGCCCCGAAACCAAAGAACCTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCTATTGGACGCTCCGGGAAAACTCTTGAGGCCGCTACAACCATTGTTATCCCTGGGAGAACATACAATGAAGAGTTCATACCCGATGCGTATGTCAAGGTGCAGCCGCAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTTCCCGACTACAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGTACCGACGCCACACAAAAACCTGTGGTGCCTAAACCGGGGTTGGGAAAACCTCCGGGACCTCCTAAGAGGAAGGTGACTGATAAGGCGGAGGAACCCGAGATGCAAAAGGAAAATCCAGTGCCGGAAGTGCTACCGGAGATTGCATTGCCGGAGAAAGCCAAGGAGATTGCACCGCCGGAGGCAGCCATGGAGATTCCAGTGCCGGATGTGCCCATGGAGATTACAGTGGCAGAACCAGAGGTGCAATTTGTGGCATCAGTCGGGTCAGAAATAGAAGAAGTATCAGGATTAGAATGGGACGGTACAGAGCCAGAAATATTTGAAGACCCTTCTCCTGCGAAAGACCCCGAGGTGCAAGAGACCACGGTCCCTGAGAAGGCCACTACCAGTTCTGAGGTGCCACGAGTGCTTAGGAGCCACGACTCCAAGTCCAAAGATGAGAACAGGGAGAAGTTCATGGTAACCGTCTTCAGAGGGGGTAAGGAACATGCCAAGCTTAGAGATGACGACCCCCAGAAGGCTGCTGAACTAGCCGGGCCAACATACTTCGCAATCGATGATTGCCCGGAAAAGTACGAACATGGGAAAGCATTCTTGCCGGAATGGGCACTGAAAGAAGGACCATGGGAGATGACAAGGTTACATACCTTCTACATGGAGGCCAGCAAGAAAGGCTTGGGCAATATAACAGCTCGATCACCGGCAGATTGTTTCGACGAAGAAGGTTACGTATGGCTAGATTTCTCAGATCTCCACGCCATATATCGTCGGGATAAGATGGACGTCAACTACGTCGGTGTTTGGTGCATAATGCAATACATGGATGCTAAGAAGAAAAAAGAACACATCGGCTTCTTGGATCCAACTCGGATCTGCCAAACACAGCATACGATGAGGCTAGCACCAGGGTCTGACCAGCTGAAGAGCAAGAATCCAAAAGAGATAGCAGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCGCACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTTAACGATCATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGACCCTCTCGATTACAGTCACAAGCAATATAAAGAATTTCTAATAATTTTACAGTATGCATACCAATACTATAAGTTCAAGGGTGGAGAACAGACCCGAATAAGGGAGAAGCTGCTATGTCACAAGCAACCGCGAGGAACGGTCCTTTGCGGATATTATGCGTGTGAATTCCTTAGGGTTAATGGACGGTACAGGACTAACGCGGAGGATTTGCCAAGATTAGAATGTCGAACAAGCTTTGACGATACAGGTATCCCAAATGTCCAGCGTGATCTGTGTCACTTCATCCACCATGAGTGCTGTCATGTGAAAGAAGATTTCTTCGACCCAGAGGGTGTCCCAGCGACAAGTGACGAATTCAAGGATCTTCGGGAGTGGAACACTGCTATGCCATAA >LOC_Os04g25590 ATGGGGCAAGGCGTGCGTCAGACCGCCAGTCGCCACCTAACCCGTGATCTGACCGGTGAGGCTTACCGTGTTCACCCAACCCATTCATGTGGCGCTAACTCCACAAGGGGTCGGGGCGCCTCGGCCCTCGGGGCCGGGGCAGGAGTCACCCGACCCCCCCTCGGGGAAATCAGGAGGAGGGCGGACACCTCACCCTCGGGCCCGACGTCCCCGAAGGTGCCAGGCCACGTGGGCGATTGTGTCTGCCTCAAGCCTCTGGTCACGATACTCCCGGTCCCATATCACCGACAGATTGGATTCAAGGAGGACATCCACACATACAAGAGTCAGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCCCGGAAGGTGGATGAACGCATGGCAGCATATCGGTCACACGATCCCCAGCCGTACATACCTCCTCCAATGGTGGCATCGGTAAAGGACATCCCAACGGACATTTCAGGGACTTACCACTGTAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGTGTACGAGGACCTCGAGTTGGACTACTTAGGAGGAGATGGTGAGACGCATCTACGAGACACAAGCCACGTCCGGTTCATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCTGGCTCCGCCGTCTCCTCCTGCACCATCTCCTCCAGTTCCTTCGCCACGTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCACCTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCTCCTCCGCCTCCTCCACCTCCACCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAGGTCTCACCAAGCTCCACCTCCTGCCAGCACAAGGGCAACGAAGAAGGCCAAAGTTGACACCACCAAAAACAAGGAGCCGCCATACGATTGTAGTCAAGAGGAGCTTGACCCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGACTCCTGAAAAGAAGATACCTATTGACCCGAGCATGAAGAATTTCTTCAAGGGAATATCCACCACAAACAAGAAGGCCTTAAAGCTATCGGACTATGACCGAACACTTAGGAAAGCCTATTACAAGAAGTCTAAACCAGTTCCTCAGCTTGGAGAACAACCAAACCAAGTGGTCGAGCCGTTGGTGACCGGCGAAGACTTTGGCATAATGGATTTCATTTTGGACACCGGTCTAACTGTGGCTCAGTTGGTTGGAGGCACACCAATCCTGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACTGCTTGTCAGGCCTGAGCAGCTGCAGTCCCTACCGACACAAATGTACAAATTCCATGAACGATACATGGAAATGAGCGCCAATGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTATGGATCCATTTCAAGGATGTCTTCGATCTGTACCATCGGGACGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTGGCCCGACGGCGGGGGGTTTACGATACTGGGTTCATTGACCCTCGGAAAATCAACACCGAAATGCTCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTTCATACTATTGCCGTACAACACAGAGTGA >LOC_Os04g21520 ATGGCCGATAGAACTAAAGGGACTGAAGAGAAGGGTTTAGGGGAGCAAGAGCAGTCCCTTGCTGTTGTGGTTGCTCTGGAACCAACGGTCCCACCGGAAGGTAGTTCCGACAGCGACGTAGCTGACGAAGACGAGGAGTACTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCCCAAAGAGAAGAAAAAAGGGCAACGGTGAAGAAGGCGACAAGGACTACATTCCCCCTAAAGAAGGGGAAACGGCGCCACGGCGATCAAAACGGCAGCCGAAGAAAAAAGTTCCGTCGAAAGATGACGACGTACCAGCTAACACAACCGGCACAAAGAAAAGCGAACGGTCAGCAAAAGCGAAGAAAAGGAAGGGCGAGAGAAGCGTGAATAGAAAGGATGAAGGGTTCCATGTTGTTACCCATGTTTCGCCTAAAGGAGAGCCGCTCGCCCCTAAGACGGCACGTGCGAAATTCATTTCACAGTGTGGCATAATAGTAAGGGAAAAGATCCCCATCACGGTCAAGGACTGTCATTATGTATCGAATGGGGATAAGGAAGTCCTATGGAAAGAGTTGAAGAAAATCTTCCAGTTCCCGGATGGATCAGAGGCAGCAGTGAGGAATTGTGCACTGCAAACAATGGCCAAGTCTTGGTGTGGTTGGAAAACCACCTTGAACAAGAAATTTGTGAAGACGGGACGCACACCATTTTCGACGTATGCCAACATAACCCCGAATCAGTGGAACGACTTTCTGACGTTGAAGAACTCCTCGGAAGAAATTCGAAGGAGCCAAAAGTATGCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCCGCGGGATACGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAACCGTTCACAAAAAAAAGATCTTTCAAGCCTAAAAGGGAGAAAGATGTGCTAAGTACAGCACTGGGTACTCCTGAGCATGGGGGAAGAGTTCGAGGTATGTTGAGCAAGATGAGTTGGAAGGAAGGGTTCAAAAATGACCCCCACAAGAAGCGTGAAGCGTACAAGGATAAACTTAGAGACGAAGGGGCTGCGGAGTTTGAAAGGCAAATGATGGATTTCTGCGTCAAGCACATGCTTTTGCCTCACCCCGAAACCAAAGAACCTGAGCCAGATTACCCCTTCAATGACCTCAAGGAGAATACACCCTGTAGATTGCACGTTCCCAGATTAGAATGTCGAACAAGCTTTGACGATAAAGGTATCACAAATGTCCAGCGTGATCTTTGCCACTTCATCCACCATGAGTGTTGTCGTGTGAAAGGACATTTCTTTGACCCAGAGGGTGCCCTAGCAGCAAGTGACGAATTCAAGGATCTTCAGGAGTGGAACACTGCTATGCCATAA >LOC_Os04g51860 ATGAAGGTGGCGTCGGGCATAGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGAACGTACGTGGACCTCAAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCGAGCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGCTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACATGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATTGAGCCGTTAGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACTGGTAGAGAGATGATCGGAGCGAGGATCAGGGACATGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAACTGGATGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAAGGCCCGACGGCGGGGAGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGTGCAGCATTACAAGATGTTCATACTGTTGCCCTACAACACAGAGTTAGTTTAA >LOC_Os04g30590 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACATGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTAAAGGGGCAGACACTGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAATAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTACAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATAACGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACACATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCATTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAAAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACATAAGGGCAACAAAGAAGGCGAAAGTTGACACCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os04g10020 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGATGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAAACAGGAGATCGAGCCGTTGGTTACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCGCCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTATGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTAATCCCAAGGGTGAATTCTACTACGACAGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATGA >LOC_Os04g04170 ATGTCGAACGAAAAGGTTCCATCGAATGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTCCGGTAGCAATAAGCAGCCAGACGCTTCTAGTGAAGAAACGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGAGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGATGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCGTCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCATGTGGCACTCTAGTCAGGACACGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCATACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGTAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGCGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCCTTTCCAAGGTTATTCCCTGATAGCCAACAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAACTACCTTCCCTGTGGATAGTATAACTGGACCACCTCCGTGCAGTCTCATCGTACCAATCGGTCGCGCTGGAAAGACTAAGGAGGTTGCAATGGGTTTTGCAATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGATACAGGTCGCCAAGGTCCATAGCAACCACGTTTCCTTGGAACTAGACATACCTACACTTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCTTTCCTGCAGCAGGATCTTCAACCCCATCCTCATCACAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTTGTCACGACCGGAAATAA >LOC_Os04g04140 ATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGAGAAGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGATCCCCGAAATCCCATATATTGCACAACGATTCAACGACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCTTCGTGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCACAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os04g59530 ATGTACAAGTTCCATCAACTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGTGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGTATCTACGAACTATACCAGCTGGATGCCCTCGACGTCTCTATTATGAGTTACTGGATATTAATGGAGATTCAAAGGGCCCGACGGTGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAGGCTTGGTATCGGTTCCATCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAATTTTCCTTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCATAGGTCCTTAGCTTCTGAGATGACGCCTACTACTACGTCGAAATCGTAG >LOC_Os04g24240 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCTGCTGTCGCCACGCCGCCGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAATGAACACGTCAACGTACGTTGCCACGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACATGGCTGACCGCAATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATTCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAAGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGTGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTTCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGTGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAAAAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGTTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGGTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGATGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTAGAGGAGACGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCTAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTCGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCAGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGATGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os04g11410 ATGGCTGATCGCGATGAGGAACAGATACTATACGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAACGAAGAAAAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGGGAACGATGAGGAGGAGGCTAGTGGAAGTCATCCCTCCGCTGGACAGAAGAGGGCACGCGGACAACGAAGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGAAGACGGCCGACCTAGTGCCCTGGCAGAAGCAGCCAAGAATTTTAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGACAAACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGGAAGCGATGATGGCCAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTTAGGCGGATATAGCGTCGCAATGCCGAAGTGGGAGGAGATGGAGGCAAGTTTGATTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTTGTCTTCAACGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGTAGTCTCTTCTCAGGGCACATTCCGACCCGATAGAGAGAAGGATGAGCTGTCACTCGCCCTACAAACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATTGGATTTAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGCGTGAAGAACTTCTTCAAGGGAATATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATCAAAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTCTGGATCCATTTCAAGGATCTCTTCGATCTGTACCAGCTGGACGCCCTCGACGTCTCTCTTCTGAGCTCATGGATTTTAAATGGAGATTCAAAGGACCCGATGACGAGGGTCTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAGGACGTACATACTACTGCCGTACAACACAGAATTCCACTGGGTCCTGTTATTCTTCGACTTGGACGCATGCAAAGTCACTGTGTATGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCGTCAAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCACATATTCACATGAGGGATAATCTCCCACGCAAGGATTTTATCACGGCTGTTCAAGAACAACTGATAGGATTCATCAACGAAGAAGTCCTTAATCCCGATGGTGAATTCTACTATGACGGATCGACAATTCATAACGTCGGTCCTTCCTCTTCTGACATAACGCCGGCGTCGAAGTCGTAG >LOC_Os04g26070 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGAGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCATTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACAAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTATTCGGCGTTCAGATACGAGAGGCTGCGCAACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCCGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCGCAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCATGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAAGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAAACAGGAGATCGAGCCGTTGGTTACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCGCCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTAATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATGA >LOC_Os04g10960 ATGGCTGACCGCGATGAGGAACAAATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGAGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACAAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTATTCGGCGTTCAGATACGAGAGGCTGCGCAACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCCGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCGCAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCATGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCAGAGGCCATCAAGCTGTCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAAACAGGAGATCGAGCCGTTGGTTACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCGCCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATGA >LOC_Os04g05860 ATGGCGATGGTGCGCGGCGCAGCGGCGGCGGCAAGACGCGTCGGCGACGGCAGAGGGGAGGCGGAGCGGCGCGCGGCGCGTGGGGCGCGAGGCAGCTTGGCAGAGGAGGGGCTAGGGCTATGGAACGCGATGCACGAGGACACGACGGTACGCGGCGTGACGGCGACGGTGATGACGACGGCAGAGGAGGGGGCTGGAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGCTCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTACAAGACGGTCATACTATTACCGTACAACACAGAAGTCACTGTGTACGTCTCAATGAATAAAGAGGAGAAGGTTTTTGACAATGTCTTCCAACTGATAGACAGGGCTTGGGATCAGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACAGAGGTTTCATTTTCCACGTATTCACATGAGGGAAAAACTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGGTTCATCAACGAAGAAGTCCTTAATCCCGATGGTGAATTCTACTACGATGGATCGACAATTCGTAATGTTGGTCCTTCCTCTTCTGACGTAACGCAGGCGTCGAAGTCGTAG >LOC_Os04g15850 ATGGCTGATCGCGATGAGGAACAGATACTATACGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAATGAAGGAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGGGAACGATGAGGAGGAGACTAGTGGAAGTCATCCCTCCGCTAGACAGAAGAGGGCACGTGGACAACAAGGTGCCGCGAAGAAGACAGAGGGTCGGCACATCATAACTGAGGTGGACGAAGACGGCCGACCTAGTGCCCCGGCAGAAGCAGCCAAGAATTTTGTACGCCACAGCGGTTGGGTTGTGAGGGACAACGTGCCTGTTAGCACGGTGTACTGGCGCAGAACAAGGGCACGCGGGGATAATGACAGCTTTGTCCCGGACTCAGAGAAAGAGATGTTGTGGACCACAATGCTCGAGACGTTCACGCTACCCGCGGGTACGGAGAACATAGTGAAACAGTGGACTCTGAAGAAAATGGCAGAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGACTAACACTGAACTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGCTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGCCAGAAACAAAGACAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCAATGCCAAAGTGGGAGGAGATGGAGGCAAGTTTGATTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATAGATCGAAGTTTTGGTACTATGCTCACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTTGTCTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGTAGCCTCTTCTCAGGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTCGGATCACAGAGCATGGACGCCATGCAAACCCATGACGAAACCACCTACCCCGTTGATGAGATCATGCAGCGGACACCATGTGAGCTGCATATTTCCTTCAAGAACTTATCAATCAAGGTGGCGTCGGGAATGGCCATCCCAACGGACCCTTCCGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGTATCTACGAGACACAAGCCACGCCATCATACTATGGCGCAAGCGGTACATCATCCTTCCTGGGAGACAAGCGGCGTCTCGTGCACCATCTCCTCTGGCTCCGCCATCTCCTCCTGCACCATCTCCTCCGATTCCTCCACCACGTCCTCCTGCACCATCTCCTCCGGCTCCTCTGGCTCCTCCGCCTCCTCCGCCTCCACCGTGTCTGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCACCTGCTCGCACAAGGGCAACGAAAAAGGCGAAAGTTGACGCCACCAAAAACAAGGAGCCACCGTACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAGGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCACAACAAACAAGGAGGCGTTACAGATATCGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCGAAGATTTTGGCATAACGGAATTCATTGCAGACACCGGTCTAACTGTGGATCAGTTGGTTCGAGGCGCACCAATCCCGAAGGCGGAAGTGACATACAAGTTTGAACTCGGTAAACCGCTTGTCAAACCTAAAAAACTGCAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTGCATGGAAATGAGCGCCAAATGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACATCTTGCAAGGAGAAGATGTTCTCTGGATCCATTTCAAGGATCTCTTCGATCTATACCAGTTGGACGCCCTCGACGTCTCTCTTTTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACAGAGGAGGGTCTACGATACTAGGTTCATCGACCCTCGGAAAATCAACATCGAAATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTTGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTACATACTACTGCCGTACAACACAGAAGTCACTGTGTATGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCAAACTGATAGATAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGAACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCATGTGCAAAGCAGGACCAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCCTACTGCCTATCAAACCAAATATGCACAACACGAGAGCTCGATCGTATTCACATGAGTGATAATCTCCCACACAAGGATTTTATCACGGCTTTTCAAGAATAA >LOC_Os04g26410 ATGAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGAAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGTGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCATGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTACCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGAACAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCATACACAAGGAATTTATCGTGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAAAACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGACTACTACTACGTAG >LOC_Os04g20460 ATGAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCGTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGCCCCCCCCAGCTCCACTGCCTGCCCACACAAGGGCAACGAAGAAGGAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCATTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGAACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >ChrUn.fgenesh.gene.2 ATGGCAGACCGCGATGACGAGCAAATACTATTAGGCACTATCGCAGAGGGCAGCAGTCAGTACTGGGTGGATGAGGAGGGGAACGAGGATCCCAACCAATACCTGAACGAGGAGGGCAACGAGGAGGGTAACCAGGATGGTGATGGCTCCCTCATATTCGGCGATGAGATTCGAAAAGCAGCCCGCCAACTTGTGAATGCAATTGAAGCCTCTACGCAGGGGACTTTCAGGCCAGACAGAGAGAAGGACGAGCTCACCCTCGCACTACAGAATCCTGAGCATCCAGGACTAATGCGAGGCAAAGGCATCGTTCCTTGGAAATATGGATTCAAAGAGGACATCCACACGTATAGGAGTCGGATGAGGAGCAAGAGGGATACAGAGGCTAAGATCGTCGATCTTGAGTACAAGGTGTCCACCTACAAGGCAAGGATGCAAGAGGAGGTGACAAGACAGGTGGACCAACGCCTTGGCGAGCAGCGTGGAATAGAAACACAAGCGCCCGTCATGGAACTTGTCTATCAAGGTGGCGTCGGGCATGGCCATACCCACAGACCCTTCGGGTACATACCATTGCAGCCCATTCCACATGGATACGCGAAGGTCGAGATAGAGCTGGTGGAACGAACATACGATGATCTCGAGCTTGACATCCCCGGAGGAGACGGGGAGACAAAACTTGGAAACACAGCCCACGCCATCATACTCCGGCGGAAGAAGTACATCGTGTTCCTCGGGCAAGAAGGGCCGTCCGCTCCTCCTTCCCTGCCACAAGCACCGTCTCCTCCGCCTACTCCGCATCCACAGTCTCCTTCGGCTCCTTCGCCTGCACCGGCTCCTCCTGCTCCTCCGCCTCCACAACCTCCTCCGCCTGCACCTGCTGCCAAGTATGCACCATCGGGTCCGAGGGCAATGACTCCTCAGCCTGCACCATCTGCCAAGTCTACACCATCAAGGTCCCGTCCATATGAGCCCACGCCATCAAGGCCGAAGAAGGAAAGGGCGTACGACATGACTCCGGAGGAGCTCGATGAAGCCGTTAGAGCGGAAGTTAGGGAGCAGTTGAAGCCACGGAGTCCGGAAAAGAAGATCCCTATAGCCCCGGCGGTTTAG >ChrUn.fgenesh.gene.44 ATGCCCCGAAGTACCACCGTGATACTGAAAAGGGGAAATCGTGACAAAACTCTTCATATAACCCTCCCTAACCGAACATATCCATCTCAGGTTTTACCCCTTCCTTATTCCAGGTTGGGCAGTCCCCTCTCGTGTCTAAGTAAATCTGGAAATAACAGAGACAAATATTCAGGTACGAACTGCACCATCGCCTCTACCCTTACCGCGTGTCATAAACAACTTAGAGACACTAACTTCTGTGGTTATTATGCATGCGAAGTCCTTACGGTTAATGGGAGGTACAAGACCAACGCAGAGGATTTGCCTAGAATAGAACGTCGAACAAGCTTTGATGATGAAGGCATTGAAAATGTGGAGCGGGACCTCTGCCACTTCATCCACCGCGAGTGA >ChrUn.fgenesh.gene.16 ATGCCGATTATTATTCAAGGCCCCAAGCAACCTGGTAACGACATCGATGTGTACCTAAGACCATTGGTCGAAGATCTGAAACTGTTGTGGAAGAAAGAAGGTGTCCCCGTGTGGGACGAGGACAAACAGGAGGAGTTTAACCTACGAGCGCTGCTGTTCGTAAATATCAACGATTGGCCTGCACTTAGCAACCTATTCGGGCAGTCTAACAAGGGGTACAAGGCTTGCACTCAATGTATGGATTTAACTGAAAGTACGTATCTTAAGCATTGTAGGAAGGTTGTGTACATGGGTCATCGTCGATTCCTTGCTGCAAACCACCCTGTACAGAAGAAAGGCAAGCACTTTGAACATAAGGCGGACCACCGTACGAAGCCTAAACATCGCAGTGGAAAAACAGTGTTTGCTATGTTACCCTATTGGGAATTCTTGGACATCTGCCACGCAATCGACGTGATGCACCTCCCTGAAAACCTTTGCATAAACCTGCTTGGCTTCCTAGATGTATCTGGAAAGCCGAAAGATACACTGGAAGCACGTAATGATCTGAAGCATATGGAACAACGCGGCGACCTTCACCCGGAACCAAAGGAGAAAGGAAGCCATTACTTGAGTCCAGCCAGCTACACTCTTAGCAAGGCTGAGAAGGAAAGTATGTTTGAATGCTTGGAGAGCATCAAGGTACCGTCTGGATACTCCACGAATATAAAGAGAATAATAAGCATTAAGGAGAAGAAGTTCACAAACCTAAAGTCTCATGACTGTCACGTGTTGACGACACAGCTGCTGCCAGTTATAATTTGGGGTATCCTTCCAGACAATGTCCGGGCAACAATAATAAAGCTATGCGCTTTCATGAATGCAATTTCGCAGAAGGTCATCCATCCGGATAGATATGAAGCCCTTCAAAAAGATGTGGTGCAATGTCTTGTCAGCTTTGAGTTGATATTTCCACCTTCATTTTTCAATATAATGACGCATCTACTTTGTCACCTTGTCAAAGAGATCGGTATTCTCGGGCCTGTGTACCTACACAACATGTTTCCTTTCGAGAGGTACATGGGCGTTTTGAAGAAGTATGTTCGTAACCGTGCTCGTCTAGAGGCAAGCATAGCCAAGGGGTATGGAACAGAGGAGGTCATTGAATTCTACGTAGAATTTATTGAAGACCTTCGCCCAATCGGGGTGCCTGAATCATGCCATGAAGGGAGACTACGGGGAAAGGGGACTCTCGGAAGAAAAGCAATAATGACGGTAGACAACAATTTATTCCGTAAAGCCCACTTCACGGTTCTGCAACAATCTTCATTGGTGGGTCCTTACATCGAGAAGCACTTGGCTCTAGTTCGCGCTAGAAACATCGGTAAGTCCGATGCATGGATTACACGGCATCACATTGATACATTCCCCACGCGGCTGCGACAACATCTCATGGGTAACGAGACGATTAACCAACAACTGGCCTTCCTGGCGAGAGGACCATCTGGCTCGATCGCGACATTCCAAAGATATGAGATCAATGGGTACACATTCTACACGAGAGCCCAAGATATAAAGAGCACGATCCAGAACAGGGCTGTTCGTATCGATGCCATGGGACACGATGGTACAACTGGCACGTATTACGGTGCCATCGAGGACATATGGGAACTTGACTATGGACCTCTCAAGGTCCCTCTGTTCTGGTGCCAATGGGTTAGGCTAACTGGTGGAGGCATAACGATTGATGACAGTGGGATGACAACGGTTGACCTTAACAAGGTTGGATACTCGGATGAACCTTTTGTCCTTGCCAACGATGTAACGCAAGTTTTTTACGTGAAGGACATGTCTAGGAAAGGAAAGAAGGGCAAAGGGCCTGACGAGCCGAAGCATCACGTGGTTCTCCCAGGCAAAAGAAAAATCATCGGAGTCGAGGACAAGACTGATGAGAATTATGATCAGTTTGATGGGCAACCCCCTTTCACGGTGACGGTCGACCCTAGCATCCTCCTATCAAACGAAGACACCCCTTACTCACGCAACGATCACAAGGAAGGAACAGTAGTGAGGAGAAATAAAGACGTTGTCGCTCAAGCCGAAGTGTACTTGAATGAGGAGGTGAACGAGGAGGGGAATGTGGAGAGGGATGCAGAGAGGACTGAGGAGGGTACTGAGGAGGGGAACGAGGAGGCGGATGCTAGTGGAAGTCAACCCTTCGCTGGACAGAAGAGGGCACGTGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGAAGACGGCCGACCTAGTGCCCCGGCAGAAGCAGCCAAGAATTACGTACGACACAGCGGTTGGGTTGTGAGGGATAACGTGCCTGTCAGTAAGAGCTTCAAGGGAGATCTCTACCAGAAATACACCCTGAAGGGGCAGACGCTGAACTTCAACACATTCCCGAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGATAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCAATGCCGAAGTGTGAGGAGATGGAGGCAAGCTTGATTGAGAGGGGTATCGAACAGGCCGCCACTAAATGGCCGGATCGATCGAAGATCTGGTACTATACTCACGGTGGAACGCTTAACCCCGTTGATGGCTCCCTGGTGTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCCGACAGAGAGAAGGACAAGCTGTCGCTCGCCCTGCAGACTCCCGAGCATCCAGGAGGAACACGAGGGAAAGGCGTGGTTCCTTGGAAGATTGGATTCAAGGAGGACATCCACATGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGCATGGCCGCACATCGGTGGCAGGATCCCCAGCCGTACATTCCTCCTGTAATGGTCAGCCCCTCTGGCAATCGTAGCAGCTGCGCCTCAACGGGGAAGGTAGGATCACAGAGCATGGATGCCATGAAAACTCAGGACGAAACCACCTGCCCCGTTGATGAAATCACGCAGTGGACACCATGTGAGCTGCATATTCCCTTCAAGAATTTATCAATCAAGGTTGCGTCGGGAATGGCCATCCCAACGGACCCTTCAGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCTGCGTACGAGGACCTCGAGTTGGACTACCCTGGAGGAGACAGCGCACTAATCCCAAAGGCGGAAGTGAGACACCAGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCGACACAGATGTACAAATTTCATGAACGGTACATGGAGATGAGCGCCAGCGGTAGGGAGATTATCGGAGCGAGGATCAAGAACTCCAACTTCTTACAAGGGGAAGATGTTCTCTGGATCAATTTCAAGTATATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGAAGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGAAATGGTCACCAACTATCTGCAAGCCACAGAGGACAATCTCGTCCATCTCCTCAAGGAGCTGCATTTCAAGACGTTCATACTACTGCTGTACAACACAGCATTCCACTGGGTGCTTTTACTCTTCGACTTAGAGGAATGCAGAGTCAATGTCTATGACTCAATGAATAAAGATGAGTCTACTTTTGACCAGGTTTTTGAACTTATAGATAGGGCTTGGTATCGGTTCCGTCATTTGGTCCACGGCACTTGGAAAGAAAAACTTCGCCGGAGGTTCAAATTTGCAGTTATTCGCATGAGGGATAACCTCACACACAAGGAATTTATAGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAGTCCTTGATCCCGAGGTGAATTCTACTACGATGGAAATACAATTCATAAGTCGTTAG >ChrUn.fgenesh.gene.55 ATGGACATCTCTAGGACAAATGAAGGCTACACGAGCTGCGGCCCGGTAGTCGAGATGTCATGGCACAGGGCTGGTGTCCTGCTGCTAGGGGCTCAATCCTGCCTACCTGTCCCGGAGGTTCCGGCCGTAGGTGGGATTGGGTCGGTACTCTTGTCTATGGCTAGGATGGGTTGGAAACTATGTCACGTCTTCCGTCTGTATACCGTGGTGATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGTTTAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGTGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTACGCTCACGGTGGAACACTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCATGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTAGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCTGGCTCCGCCATCTCCTCCTCAAGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCATCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAAACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTACATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTTTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAGGAAACAGAGGACAATCTCGTCCATCTCCTGAAGACGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGATGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCAGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGAATTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACAACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >ChrUn.fgenesh.gene.43 ATGGGAGATCGATGGCGACAGTGGAAATCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTACGGACATATATCGCTGGCTGACTGGGATACGTTTGTTGCGGATCATACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGTGAAGAAGAACAGATATCCCCATAGATTGGGGTCGAGCGGATACGGTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGACCGGTAAACCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCACAACACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGCGAGATCAGCTTACTGCGGCGTTGGGAAGGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACGAGTTGGAAGGTAGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCAGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGTCTTTCCAAGGTTATTCCCTGATGGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAAGCTCAGTGCAGACAACTCGCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGTGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACATGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATACCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAATTTATCTTGTGGCACCGCAGAGACATAATCCTGACCGCGGCCGTTCCTGCAGTAGGATCTTCAACTCCATCTTCATCGCAGGCAAGGACAGCTGCCACTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCTGTCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAATAG >LOC_Os05g15540 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACATGAATGAGAACAAGCGAACGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCAATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGTGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCAAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGTTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAACTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTATGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCAGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGATGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGAATTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTTGCTAGCTAGGACATATAATGGATTGTAA >LOC_Os05g48110 ATGAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAAGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGCCCCCCCCAGCTCCACCACCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTAGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTTCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTATGTCGAAATCGTAG >LOC_Os05g16590 ATGAGGGGCGCGACGTGGAGCGGAGAAGGCGGGGCGGCAGCGGCGGTTGCCGGCGTGGGCGCACGGCTGGAGGTTGGGGACGACCCGACAGAAGAGGGCACGCGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTCAGCACATCATAACGGAAGTGGAAGAAGATGGGCGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGAATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCACAGATTCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCTGGTACAGAGGACAAAAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGCCAGACACCGAACTTCGACACATTCCGAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCTGGAACGATCGAAGTTTTGGTACTATGCTCACGGTGGAACGCTTAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGTTGCGTGTCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCGGACAGAGAGAGGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAATGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGCGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCAGGGTATCGAGCTACGAGCGCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCAGCCGACCATTCCTCCTGCAATGGTGA >LOC_Os05g50880 ATGAACGAGAACGAACACGTCAACGTACGTTACCGCGAGAACGTGAACGAGAACGAGAACGATCAAACGAACGAGAGCGAGAACGAACACGTCAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGTACACGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACAGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTATCAGTACGGTGTACTGGCGAAGAACAAGGGCACGTGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGAGCTGTACAAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTTAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACCGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCAGCTGATGGCTCACTGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTTCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAATCGGATGAGGAGTAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCCGGGTATCGAGCTACGAACTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTACAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGAAGGAGACGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGTACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCCAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCTAGTGTCAGAAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGCAGGCAATCAAGCTATCAGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAAAAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGTGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACTGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTCCGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTATGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGAGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACGAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAAAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACTACGTCGAAATCGTAG >LOC_Os05g27610 ATGGCTGACCCCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTTGA >LOC_Os05g39570 ATGGCTGACCGCGATAAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTAAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCTAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTTCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGTTAGGATCACAGAGCATGGACGCCATGCAAACACTGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCATACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCAGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCAGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAATGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGTTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCGGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACAGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCTCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os05g30370 ATGAAGGTGGCATCGGGCATGGCCATCCCAACAGACCCTTTAGGTACTTACCACTGCAGGCCGATTCTAGCAGGATACTCGAAGGTTGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGCAGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTTAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCACAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGATGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCAGTGTCAGGAACTTCTTCAGGGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGGAAGACATGACGATAGAAGAATTTATTATTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACCCGGACTTCTTGCATGGAGATGATATTCTCTAG >LOC_Os05g18570 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCGCCGTGCGCGCAATGCCGCCGCCGCCGCCACGCCACGCCACGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCTTTAACGAACGAGAGCGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGTGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGATCGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAACGAACGTGAACGAGCTAGGGAACGTGAACGAACAAAAGACATGTTGTCAGAGTCGTCCGTCAAGCCAGAGTGGAAGAGCTAGCCCTAGAAGGAATTGGAGCAGGCAAATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAAGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCATTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAAGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGTGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGAGTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTTAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGAGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGTATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCACACATATCTACGAACTATACCAGCTGGACGCCGTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCCACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os05g29160 ATGAATTACGTGGAAGTCGAAGAGTTGAGAAAGCCTGTCGGCTACCTAAACCCGTGCAGGATAAGTCAGCCAAACCACACATACATGCTAGACGAGAAGAAGCTACCAGAACACATCAAGGCGATGACTCCCGAAGAGAGGACAGCTTACATAGGACAATGGCATCGGGAAAAGTTGCTCGATGTCGCTTCTTACGTAGCTATAGCGCTTGAATCTACGCAGGACAAGGAGTGTGTTTATGCCCCATGTGCCTTTGACGACCATTGGATAGTCTTTCTTCTATATCCAAAGTACAATGAAGTCATCGTCTTGGATTCTCTCGACAAAGACATCAAGACATATCAGGAATTTCTAAGAATTATCGATCTCTTCCAAAATTCTCCAAGTCTGAAAGAGAGCTCGATGATAAATCCATTCAGGACTTTCAGCGGGACATGTGCTACTTCATCCACCATGAGTGCGCACATCAGCTTGGGAAGTTTTTCGACAAGGAAGGAGTTTGGGGCCTGCCGGAGAACGAATCCCTATCTAACTGGAGCAGGAGATTGCTAG >LOC_Os05g18990 ATGAAGCTTGAGGGAAGGCACATCGTTACTGAGATTGCCCCAGACGGCGAACCAGTAGCCCCGGCGGGTATAGGACGAAAGTTTGTGAATCATTGTGGTTGGGTCGTGAGAGACAACGTCCCCATTAGCATAGTGTACTGGCGTCGAACTAGGTCATGCGGGGATGAAGATAGCTTTCTCCCTGACACAGAGAAGGACTTGTTGTGGACCACCATGCTGGAGACATTCACGATCCCTGAGGCAGATCGTCCCAGATGCAAAGAATGGACCCTGAAGAAAATGGCAGAACTATTCCAGAGCTACAAATCAGATTTGTACAAGAGATACATCCTCAAGGGCTTGACACCTGATTTCAACACTGGAGCGCAAGGGCAAGCACAGATAGAAAAGAATAAAGCCAATGCAGCTAAGAAGAAATACCATCACCGGCTTGGGTCAGGCAGATATGGAAAGGCAATCCCCAAGTGGGACAAGTTGGAAGCTGACTTGATAGTAAGGGGTATCGAGCCGGCCACGGCTAATTGGCCTGAGCGATCGAGGAACTGGTTCTATGCACACGGTGGATCGCTCAATCTAGGTGATGGCTCCCTCATATTCGGCGATGAGATTCGAGATGCTGCACGCCGACTTGCGGATGCAATTGAAGCCTCTACGCAGGGGACTTTCCAGCCCGACAGAGAGAAGGACGAGCGCACCCTCGCACTACAGAATCCTGAGCATCCAGGACGAACGCGAGGAAAAGGCGTCCTTCCTTGGAAACATGGATTCAAAGAGGACATCCACATGTATGGGAGTCGGATGAGGAGCAAGAGGGATACAGAGGCTAAGATCGTCGATCTTGAGTACAGGGTGTCCACCTACGAGGCAAGGATGCAAGAGGAGGTGACAAGACAGGTGGACCAACGCCTGGCTGAGCAGCGCGGAATGGAAACACAAGCGCTCGTCATGGTGAGCCCCTCGGGCAACCGCAGCAGCTGCGCATCAACGGGCCAAGTTGGATCAGAGGGCATTGAGGCAGTGGCAGCTCACGAAGCAACCCACTTCCCCGTTGATGATATCACGCAGCGAACACCCTGCGATATGCATACTCCCTTTAGGAACTTGTCTATCAAGGTCGCGTCGGGCATGGCCATACCCACGGATCCTTCGAGTACATACCATTGCAGGCCCATTACACATGGATATGCGAAGCTTAAGAAGTACATCGTGTTTCCCGGGCAAGAACGGCCGCTCGCTCCTCCTTCACCGCCGCAAGCACAGTCTCCTCCGCCATCACCGCCTCGTCAGTCTCCTCCGGCTCCTTCCCCTGCACCACCACCTCCTCCGCGTGCACCAGCTGCCAAGTCTGCACCGTCGGGCCCGCGGGCAACTACTCCTCCACGTGCACCTGCTGCCAAGTCTACACCGTCAAGGTCCCGCCCATATGAACCCACACCATCAAGGCCGAAGAAGAAAGCCAGATCTGACGAGCCACGGCTCCCCGCTCTCAAGAAAAGGGCGTACGACTTGACTCCGGGGGAGCTTGATGAAGCCGTAAGAGCGGAAGTTAGGGAGCAGTTGAAGCCACGTAGTCCAGAAAAGAAGATCCCTATAGCCCCAGAGGTTCAGGATCACTTTATTAAGATGGCCGAACCGGGCAAACCGGTCGAAGTTTTTGACTATGATCGAACATTGAGGAAGGCTCTTAAAGCCAAGCCTTCAGCAGTGAAGTGCGGAAAGGAAGTCCCTCAGCTGGGGCAACAGCCAAGACAAGAGGTTGAACCGTTAGTCATAGAACCGGCACAACTAGAGATATGCAACTTCTTGAAAGATACGGGACTGAGTATGGAGCAGTTGCTAGAGGACGCACCTATCGAAACGGCTCCGGTCATGTACACGTTTAAACTCGGTGAACCGCTAGTCACGCCTGATAAGATCAGAGAGCTACCTACACAGATGTACCGATTCCATCAATTGTACATGGACAAATCAGTGATGGGTAGAGAGATGTTCGGAGCTAGGGTGCGAAACTCAGATTATTACCAACGAGAAGATGTTATTTGA >LOC_Os05g09320 ATGGCTGATCGCGATGAGGAACAGATACTGTACGATACAATCGCAGAGGGAAGTAGCCAGTACTGGAACGAAGAAGAGGGAAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACATGGAGAGGGATGCGGAGGGGAACGAGGAGGAGGAGGCTAGTGGAAGTCATCCCTCCGCTGGACAGAAGAGGGCACGTGGACAACGAGGTTCTGTGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGAAGACGGCCGACCTAGTGCCCCGGCAGAAGCAGCCAAGAATTTTGTACGCCACAGCGGTTGGGTTGTGAGGGACAACGTGCCTGTCAGCACGGTGTACTGGCGCAGAACAAGGGCACACGGGGATAATGACAGCTTTGTCCCGGAATCAGAGAAAGAGATGTTGTGGACCACAATGCTCGAGATGCTCACGCTACCCGCGGGTACGGAGAACATAGTGAAACAGTGGACTCTACAGAAAATGGCAGAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGACTAACACCGAACTTCGACGTATTCCCAAAGCTAAGAGATCATTGGGACAAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGCCAGAAACAAAGAAAATGCCGCCAAAAAGAAGTACCATCACCACTTAGGGTCAGGCGGATATAGCGTCGCAATGCCGAAGTGGGAGGAGATGGAGGCAAGATTGATTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTTGTCTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGCAACTCCCGAGCATCCAGGACGAACACCAGGGAAAGGCGTGATTCCCTGGAAGATTGGATTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGCAAAGATTGCAGATCTTGAGTACAGGGTATCGAGCCGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGCATGGCCGCACATCGGTCCCAGGATCCCCAGCCGTACATTCCTCCTGCAATGGTTAGCCCATCAGGCAATCGTAACAGCTGTGCCTTAACGGGGCAGGTGGTGTCGGGAATGGCCATCCCAACGGACATTTCAGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTAGTGGAAGCTGCGTATGAGGACCTCGAGTTGGACTACCCAGGAGGAAACGGTGAGACGCATCTACGAGGCACAAGCCACGCCATTATACTATGGTGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCACCATCTCCTCCTGCACCATATCCTTCGGTTCCTCCGCCACGTCCCCCTGCACCATCTCCTCCGGCTCCTCCGCCTCCTCCACCTCCACCGTGTCTGCCTGCACCTCCCAAGACAAGGTCTCACCAAGCTCCACCGCCTGCCTACACAAGGGCAACGAAGAAGGCGAAAGTTGACACCACCACAAACAAGGAGCCGCCGTACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAAGTGAAGAAGCAACTCAAGCCTCGGAGTAATGAAAAGAAGATACCTATTGACCCAAGCGTGAAGAACTTCTTTAAGGGAATGTCCATAGCAAACAAGGAGGCCTTAAAGATATCGGACTATGACCGAACACTTCAGAAAGCCTATCACAAGAAGTCCAAACCAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCGAAAATTTTGGAATAACGGATTTCATTTCAGATACCGGTCTAACTGTGGATCAGCTGATTGGAGCCACACCAATCCTAAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCACGCCTGAGCAGCTGCAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTCTGGCTCCATTTCAAGGATGTCTTCGATCTGTACCATTTGGACGCCCTCGACGTCTCTCTTTTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTTTATACTACTGCCGTACAACACAGAAGTCACTGTGTATGACTCAATGAATAAAGAGGAGAAGATTTTTGAAAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCGGTTCCGTAAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGATGGAGGTTTCATTTTCCGCGTATTCACATGAGGGATAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAGAATAA >LOC_Os05g14560 ATGGCTGACTGGAACCTAATACGCGACCAGAAGCGATGTCTCCATCCATTTAAGGTTTTTTTCGTGCGGACAACAAGCAGGGCATCGTTCTGTTCACGGTGGCTGGCTGGCTCACTTCTCGTGGCAAACACGAAGGGGCGCCAGAAGGGAGGCGGCGCCGGTGCGGCCCCGCGGCTAGGAGACGAGCTGCCGCAAGAGATGGATCGGCAATGGATGTACGCTAACCGGCGGTCCCAAGAGTTTATTGACAGCGTGCACTATTTTTTGAGAGTGGCCGAAGCTAACAGGCAAAGGGGTTTTATTTGTTGTCCATGCAATAAGTGTAAGAATCAGAAGGAGTATTCTACAACCAGGACTATTCATTTCCACTTGTTTGAGTCGGGGTTCATGCCAAGCTATAATTGTTGGACATCCCATGGAGAGCAAGGTGTTGAAATGGAAGAAGATGAAGTGGAAGACGACAATATTTCGGACTTTGCTCAGTACGTTGGATTTAAAGGAAATCAAACAGGCGAGGAGGAAATGGATGCTGATGGTAACGACGTTACGGATGATCTTGGTCAGATGTTGCAGGACGCCAAGGAGAACTGCGAAAGTGAAAAGGGAGCCTATAAATTGGACAAGATGTTAGAGGACCACAGAACTTCGTTGTACCCAAGTTGCGAGCAGGGGCACAAAAAGTTGGATACCACTCTGGAGTTCTTGCAATGGAAGGCAAAAAATGGGGTTAGTGACAAGGCATTTGGCGATTTATTGAAACTCGTCAAGAACATTCTTCCGGAGGGAAACAAATTGCCCGAGACAATGTACGAGGCTAAGAAGATTGTCTGCCCGCTAGGACTGGAAGTTCAGAAGATTCACGCATGTCCGAATGATTGTATCCTATATCGCGGTGAGGAGTATGAGAACCTAGAAGCATGCCCTGTTTGCAAAGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATATTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGATCTCGAGCTGGATTACCCTGGAGGAGAAGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCTGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTTCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCTTGCACCGACTCCTCCTCAGGCTCCTGCATCGACTCCTCCTTGGTCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCTGGCACCTTCAAAGTCAAGGACCCCCCAAGCTCCACTGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACACCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCATATAGACCCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAATCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGATACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGATGGCGGGGGGTTTTCGATATTGGATTCATCGACCCTCATAAAGTAAACGTCACAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCACAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGGACCGTCAACTGCGCAAAGCAAAAGAAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCATAAGAGAGCTCAATTTTATTCGCATGAGGGATAACCTGACCACGCACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os05g27130 ATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACGAGACGTTCATACTGTTGCCATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGTGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGAAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCAATTTTATTCGCATGAGGGATAACCTAACTACGCACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os05g27620 ATGAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCAAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCACAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCATGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCTAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATTAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGAAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTATCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCAAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os05g44250 ATGCTCGAGACATTCACCCTTCCCGCGAGTACAGAGGACAAAGTGAAAAGGTGGGCTCTAAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACAAGTTCGTTGCATATAAGACAGGTCAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAAATCTTGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGTACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAAACCACCTGCCCCGTTGATGACATCACTCAGCGGAAAACATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGGCTCCTGCACCGTCTCCTCCTCATGGTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTTAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTACACCGACTCCTCTGCAAGCTCCTCGTCCGGCACCTTCCAAGTCAAGGGCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACAAAAAAGGCGAAAGTTGGCGCTACCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTATGTGGCATCAGAAGTCAGGAGACAATTGAAGCCTCAAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGACCATAAAGCTATCGGACTATGAGCGAACACTCAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGATTTTAGAATACAAGAATTTATTAATGACACCGGGCTAACTACGGATCAATTGCTACGAGGCGCACCAATCGAAAAGGCAGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAACTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATAGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGTATCTACGAACTATACCAGCTGGACGCCCTCGACGTTTCTATTATGAGTTGCTGGATTTTAATGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCGGTATCCGCAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCACAGCATTATAAAACATTCATACTGTTGCCGTACAACACAGAGTTAGTTTAA >LOC_Os05g27450 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATACGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTATAGAAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGCACGCCATGCAATCACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGAACTTACCACTGCAGGCCAATTCCAGCAAGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCAAGTGTCAGGAACTTCTTTAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTATTCCACTTGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGAAAAAAAAGGAGAATTGAAGGTGCCAAGAGGGGGCCGGGGCTTGCGCTCGCGCTTCTGGGAGGGGATTTCTCGCGGGTAATGTCGAAACATGAATTCGGCAATAATAAAAGGGGTAGCGCACGAGACCTAAAAGTGGATGGATATGGAGACAAAGGATTTAGACAGGTTCAGGCCCTCTCAATGAGAGAGGGCCTCCTGCCCACCTTATATAGGATGAGGGCAGGATTACAAGACAGAAATCTTAACCAATACGGCAATATTATCAAACCAGGACTTAAGGCCGTTCCGTAA >LOC_Os05g14000 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACTTCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCTAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCGCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCAGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCAGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAATTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os05g16350 ATGGAGGTGGATGAAGTCGGGGGTCGATGGACATTCTCCAGGGCAAATGAAGGCTACACGAGCTGCGGCCCGGTAGTCGAGATGTCATGGCACAGGGCCGGTGTCCTGCTGCTAGGGGCTCAGTCCTGCCTGCCTGTCCCGGGTGTTCCGGCCGTAGGTGGGATTGGGTTGGTACTCTTGTCTATGGCTAGGATGGGTTGGAAACTATGTCACGTCTTCCGTCTGTATACCGTGGTGAAGAGGAGTTCCTGGAGGATGAAGGCTTTGGTGTCTAGCTCGTGCCTGCCGTCAAGTGCCTGTGGTCGTCGCCCTAGTCTTCCGCTGTTTCTCGTTTGTCTCTATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTAGGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGAAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGTGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCATACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTTTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCAACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCTAGTGTCACGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCAGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGATTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATATTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGGGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os05g03270 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAAGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGATAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCAGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAAAAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCAAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCACGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCTAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCAGACCATTCCTCCTGCAATGGTAAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCTGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACAGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCATGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCATTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTACAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTTGGTAAACCGCTTGTCAAGCCTGAGCTACTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCACACATATCTACGAACTATACCAGCTGGACGCCGTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGAGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCAATTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os05g16580 ATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCGTCTCCTCCGGCTCCACCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCGGGCTCCTACACTGACTCCTCCGCAAACTCCTCTTCCGACACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTACCCACACAAGGGCAACGAAGAAGGTGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGGCCAGAAAAGAAGATTCCTATAGACTCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGATAAAGAAATGACGATAGAAGAATTTATTACTGATACCAGTCTAACTACGGATCAATTGCTAGGAGTCGCACTAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACCTGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCATGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATGATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTTGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCTATTTCCTGAAGGCGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCAGCTATTACGTGTGCCAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCATACACAAGGAATTTATCGTGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCCGCGGCGGCGGAGCAGATGAGGCGTGTCATCGCGTCGTCGGACCGCGACACTGGCCGCGCGCTAACGCCAACCCTGCACCTGCTCCGGCCACGCGCCGCCGCCCGCCCTCTGTGGCCGCGCTCGCCCGCCGTTTTCCACCGCCTCCTGCCACCGACGCTCTGCAGACACGCGCCACTGCCACTCCCCCTCTAAAACAGAAAGAGAAGAGGGGAAAAAAAGGAAAAGAGAAGAAGATTGCTGACTATATGGTTGATCCCACATTTTTTTCACTTACATGTGGGTCTCACATCAATATGCTTTTTTAA >LOC_Os05g42970 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCTAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGATAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCATGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACAACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCTTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATACAAACACAGGACGAATCGACATGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCAAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGCAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCGCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGAAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAAGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTAACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os05g18710 ATGCTTGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGCCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGCGGCTATAGCATCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATTGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGTCGACTAATAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCGGACAGAGAGAGGGACGAGCTGTCACTCGCCCTGCAGACTCCAGATCATCCAGGACGAACACGAGGGAAATGGATGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAAGAGTCGGATGAGGCGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCAGGGTATCGAGCTACGAGCGCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACACATGGCCGCACATTGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAATCCACCTGCCCTGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGACCATCCCAACGGACCCTTCAGGTACTTACCACTACAGGCCGATTCCAGCAGGATACTCCAAGGTCAAAGTTGAGTTCGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTATCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCTTGGGCGACAAGTGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTCCACCATCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCGCCGACTCCTCCTCGGGCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCTGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTTTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAGCCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATCACTGACACCGGTCTACCTACAGATCAATTGCTAGGAGTTGCACCAATCGAAAATACGGAAGTGAAATACATTTACGAACTCGGCAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCAACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCACACTGCTCAACCAATATCCGCAAGACACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGAAGTTCATACTGTTGCCGTACAACACAGAGTTAGTTTAA >LOC_Os05g03950 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACATGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGAGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACATGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACTGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTTCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAACGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCTGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGTTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCATCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACTTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGTATGAGGGATAACCTGACCACACATAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os05g39460 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGATACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCATCCTTCCTGCAGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAAGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCTGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCAAGCAAACACAGGACGAATCGACCTATCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACAGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCAAAGGTCAAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCACAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCACTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACACCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAAACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTATCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os05g26100 ATGGAGAGGGATTCGGAGGGGAACCAGGAGGGGCACGTGGAGAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGCTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGACGAAGACGACCGACCTAGTGCCCCGGCGGAAGCAGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACATGCCTGTCAGTACGGTGTACTGGCGCAGAACAAGGGCATGTGGAGATCATGAGAGTTTTGCCCCAGATTCGGAGAAAGAGATGCTGTGGACAGCAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTATACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGGCAGGTCAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCACTAATTGGCTGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGTTGATGGCTCCCTGAAGATTGGGTTCAAGGAGGACATCCACATGTACAGGAGTCGGATGAGGAGTAAGAGAGATACCGAGGCGAAGATTATAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTTCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGGCGTCAGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACTATTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGACGCGTACGAGGACCTCGAGTTCGATTACCCTGGAGGAGACGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCGCAAGCTCCTCGTTCGGCACCTTCCAAGTCAAGGCCCCCCCAAGCTCCACCACCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCAGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTATGTGGCATCAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTTAGGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTCAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAGACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGATTTTGGAATACAAGAATTTATTAATGACACCGGGCTAACTACGGATCAATTGCTACGAGGCACACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCAGTAAATCGCTTGTCAAGCCTGAGCAGCTGCAATCCCTACCCACACAAATGTACAAGTTCCATCAACTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCAGAGCGAGGATCAGGGACACGGACTTCTTGCCAGGAGATGACATTCTCTGGATCAATTTCAAGGGTATCTACGAACCATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTATTCCACTGGGTGCTTTTACTCTTCAACCTGGAGGCCTGCACCGTCAACGTACATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTGTAGACAGGGCTTGGTATCAGTTCCGTCATTTCGTCCACGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAATTTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCTAAGGGTGAATTCTACTATGACGGAAATACAATTCATAGGTCCTTAGCTTCTGAGATAACGACTACTACTACGTCGAAATCATAG >LOC_Os05g15320 ATGGCCACCACCAAGCCATTCCTCCTCCCTCCCCAACCCACCTCTCCGCCCGCGCGCCCAGGCCCCACCGAGCCCAAGCTAGCTCCGTCGCGTGCTCCGCCGCCGACGCCGACGACCGGTGGCTGGAACCCGCTCGCGGCGCTCGTCGAGGTGCCCGGGGCGCTGTGGCGTGTGGGGAGGCGGCGTTGGGCTCTTCATGGTCACCGGCGCGGCGCTGCTCGCGCTCGCGGTGGCGTGGATCCGTGGGTTCCAGCTGCGCTCCCGCTTCGGCAAGTACCAGGCCCCGTCTTCGAGTTCACCCAGGCCTGCGGGATCTGCGTGGGCACGCCCGTGTGGATACGTGGGGTCGCCGTCGGGAGCATCGTCCGCATCGACTCTTCCCTCCATAGCATCGATGCTTACGCTGAGAATGACATATTCTTTGGATTGGGCACCGATGCCGAGGAAAAACCTGTGTTGCCTAAACCGGGGTTGGGAAAACCTCCGAGGCCTCCTAAGAGGAAGGTGACTGATAAGGCGGATGATCTAGAGATGGATAAGGAAAATCCAGTGCCGGAAGTGCCACCGGAGATCGCATTGCCGGAGGCAGCCATGGAGATTGCATCGCCGGAGACAGCCATGGAGATTCCAGTGCCGGATGTGCCCATAGAGATTACAGTGGCAGAACTAGAGGTGGAATTTGTGGCATCAGTCGGGTCAGACAAAGAAGAAGTACCAGGATTGGAATGGGACGGTACAGAGCCAGAGATATTTGAAGACCCTTCTCCTACGAAAGAACCCGAGGTGCCACGAGTGCTTAGGAGCCACGACTCCAAGTCCAAAGATGCGAACAAGGAGAAGTTCATGCTAACCGTCTTCAGAGGGGGTAAGGAACGTGCCAAGCTCAGAGATGACGACCCCCAGAAGGCTTCTGAGCTAGCCGGGCCAACATACTTCGCAACCGATGATTGCCTGGAAAAGTACGAACATGGGAAAACACTCTTGCCGGAATGGGCACTGAAAGAAGCACCATGGGAGATGAGAAGGTTGCATAACTTCCATATGGAGGCCAGCAAGAAAGGCTTGGGTAATATAACAGCTCGATCACCGGCAGATTGTTTCGGCGAAAAAGGTTACGTATGGCTAGATTTCTCAGATCTCCACGCCATATATCGTCGGGATAAGATGGACGTCAACTATGTCGGTGTTTGGTGCATGATGCAATACATGGATGCTAACAAGAAAAAAGAACCCATCGGCTTCTTGGATCCAACTCGGATCTGCCAAACACAGCATATCGTTACGCTAGCACCAGGGTCAGACCAGCTGAAGGGCAAGAATCTGAAAGAGATAGCAGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCGCACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTTAACGATCATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGATCCTCTCGATTACAATCACAAGCAATACAAAGAATTTCTAACAATCTTACAGTATGCATACCAATACTACAAGTTCAAGAGTGAAGAACAGACCCGAACACGGGAGAAGCTGCTATTACGTACCTATTGGCCGTGTCACAAGCAACCGCAAGGAACGGTCCTTTGCGGATATTATGCGTGCGAATTCCTTATTAACGCGGAGGATTTGCCAAGATTAGAATGTCGAACAAGCTTTGACGATACAGGTATCACAAATGTGCAGCGTGATCTGTGCCACTTCATCCACCATGAGTGCTCTCATGTCAAAGGAGATTTCTTCGACCCAGAGGGTGCCCTAGCGGCAAGTGACGAATTCAAGGATCTTTGGGAGTAG >LOC_Os05g09170 ATGTCGAACGAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTTCTCAAAATTCCGGTAGCAATAAGCATCCAGGCGCTTCTAGTGAAGAAACGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCATCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCGTACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAAATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGAGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCATTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTCAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGACCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAACTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAAGAAGTGCACATACCAGATGGTACTACATCCGAACCAAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGACAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os05g27034 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCAAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAATAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGAAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTACAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTGCACCGTCTCCTTCTCATGCTCCGCCAGCACTGTCTCCACCTCCGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGATGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGAAAGACATGACGATAGAAGAATTTATTATTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACGTGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCAAGGATCAGGGACCCGGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGGAATCTACGAAGTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGACTTTAATGGAGATTCAAAGGCCCCGACGGCGGAGGGTTTTCGGTACTGGATTCATCGACCCTCGGAGAGTAAACGTTGCAATGCTCGACCAATATCCGCAGGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTACCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAATGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAAGGTTTTCGAACTTATAGACAGTTTATTCGCATGAGGGATAACCTAACCACACACAAGGAATTTATCGCAGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os05g14410 ATGGCCGATAGTACTAAAGGGACTGAAGAGAAGGGTTTAGGGGAGCATGAGCAGTCCCTTGCTATTTTGGTTGCTCCGGAACAAACGGTCCCACCGGAAGGTAGTTCCGACAGCGACGTAGGTGACGAAGACGAGGAGTACTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGGCGACGGTGAAGAAGGCGACAAGGACTACATTCCCCCTAAAGAAGGGGAAATGGCGCCACGGCGATCAAAACAGGAGCCGAAGAAAAAAGTTCCGTCGAAAGACGACGACGTACCAGCTAACACAACCGGCACAAAGAAAAGCGAACGGTCAGCAAAGGCGAAGAAAAGGAAGGGTGAGAGAAGCGTGAATAGAAAGGATGAAGGGTTCCATGTTGTTACCCATGTTTCGCCTAAAGGAGAGCCGCTCGCCCCTAAGATGGCACGTGCAAAATTCAGTTCACAGTGTGGTATAATAGTAAGGGAAAAGATCTCCATCACGGTCAAGGACTGGGATCATGTATCAAATGGGGATAAGGAAGTCCTATGGAAAGAGTTGAAGAAAATCTTCCAGTTCCCGGAAGGATCAGAGGCAGTATGGGACGACTTTCTGACCTTGAAGAACTCCCCGGAAGAAATTAAAAGGAGCCAAAAGTATGCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCCGCGGGATACGCACCAGAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAACCGGTACCAATGGAGGAGTGGAAACAGAGATCAAGGAACTGGGTAAGAGCTAGAACTCCGAAGATCACGGATGAAGGAAAAGTATCGTTTGAAAATCCGGAGCTGCAGAGTGTTGCTGATAAAATAGAAAATTTATCTTGTTCACAAAAGAAAGGATATTTCAAGCCTAAAAGGGAGAAAGATGTGTTAAGTATGGCGCTGGGTACTCCTGAGCATGGGGGAAGGGTTAGAGGTGTGTCGAGCAAGATGAGTTGGAAGGAAGGGTTCAAAAATGACCCCCACAAGAAGCGTGAAGCGTACAAGGATAAACTTAGAGACGAAGGGGCTGCGGAGTTTGAAAGGCAAATGATGGATTTCTGCGTCAAGCACATGATTTTACCACGCCCCGAAACCAAAGAAACTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCCATTGGATGCTCCGGTAAAACTCTTGAGGCCGCTACAGCCATTGCTATCCCTGGGAGAACATACAATGAACAGTTCATACCCGATGCGTATGCCAAGGTGCAGCCACAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTACCCGACTGCAGATGGTGTATCCGTACTTGGGGATGTGGTCGATCTTGTAATTCTCTGGTACAAGAATGACATATCCTTTGGATTGTTCACCGACGCCACGCAAAAACCTGTGGTGCCACCGGAGATTGCATTGCCGGAGGCAGCCATGGAGATTGCACCGCCGGAGACAGTCATGGAGATTCCAGTGCCGGATGTGCCCATGGAGATTACAGTGGCAGAACCAGAGGTGCAATTTGTGGCATCAGTCGGGTCAGACAAAGAAGAAGTACCAGGATTGGAATGGGATGGTACAGAGCCAGAAATATTTGAAGACCCTTCTCCTGCGAAAGACCCCGAAGTGCCACGAGTGCTTAGGAGTCACGACTCTAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACCGTCTTCAGAGGGGGTAAGGAACGTGCCAAGCTCAGAGATGACGACCCCCAGAAGGCTGCTGAACTAGCCGGGCCAACATACTTCACAACCGATGATTGCCCGGAAAAGTATGAACATGGGAAAGCACTGTTGCCGGAATGGGCACTAGAAGAAGCACCATGGGAGATGAGAAGGTTACATAACTTCTACATGGAGGCCAGCAAGAAAGGCTTGGGCAATATAACAGCTCGATCACCGGCAGATTGTTTCGGCGAAGAAGGCTACGTATGGCTAGATTTCTCAGATCTCCACGCCATATATCTTCGGGATAAGATGGACGTCAACTACATCGGTGTTTGGTGCATGATGCAATACATGGATGCTAAGAAGAAAAAAGAACCAATTGGCTTCTTGGATCCAACTCGGATCTGCCAAACACAGCATACCGTGACGCTAGCACCAGGGTCAGACCAGCTGAAGGGCAAGAATCCAAAAGAGATAGCAGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCACACAATACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTATCGATCATTATATCTGTTTACTCATCCACCCTAAAGATGGAACCGTGGGTTAATGGACGGTACAGGACTAACGCGGAGGATTTGCCAGGATTAGAATGTCGAACAAGCTTTGACGATACAGGTATCACAAATGTCCAGTGTGATCTGTGCCACTTCATTCACCATGAGTGCTGTCATGTCAAAGGAGATTTCTTTGACCCAGAGGGTGCCCTAGCGGCAAGTGACGAATTCAAGGATCTTCGGGAGTGGAACACTGCTATGCTATAA >LOC_Os05g34410 ATGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGAAATGATCAGCAAGTATCTGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGTGCAGCATTACAAGATGTTCATACTATTGCCGTACAACACAGAGTTTTTGAACTTATAGACAGGGCTTGGTATCGGTTCTGTCATTTGGTCCGCAGCAAATGGAGAGAAAGACTTAGGCGGAAGTTTAAATTTCCTTGCGCAAAGCAAGCACATGGAACTAACTTGTGCGGCTACTACGTGTACGAGTATTGCCACTGCCTTGCAGACCAAATCATCAACACAAGAGAGCTCGATGTTATTCGCATGAGGGATAACCTCACACAGAAGGAATTTATCGCGGCGGTTCAAAAACAACTCATGGGATTTATCAACAAACAAATCCTTGATCCCGACGATGAATTCTACTACGACGGAAATATAATTCATAGGTCGTTAGCTTCTGAGATAACGACGACTACTACGTCGAAGTCGTAG >LOC_Os05g10400 ATGCCTCCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCTGCCGCCGCCGTCGCCACGCCGCCGCCGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCACCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAACGAGCTAGGGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGCTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATAAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCAGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTAGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAAACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCTAG >LOC_Os05g27860 ATGCTCGAGACATTAACCCTTCCCGTGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCAACACATTACCAAAGCTAAGGGATCACTGGGATGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGTGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGCTGATGGCTCCCTGGTCTTTGGCGATCAGATACGCGAGGCTGCGCGTCGACTAACAGACGCAGTGGCAGCCTCTTCTCAGGGCACGTTCCGACCGGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTTATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTATAGGAGTCGGATAAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTTCAAGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATTGGTCCCATGATCCCCAGCCGACCATTCCTCTTGCAATGGTGAGCCCGTCAGGAAATCGTAGCAACTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACACCATGCAAACCCAGGTCAAAACCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAAGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCTTGGAGGAGACGGTGAGACGCATCGACGAGACACAAGCCACGCCATTATTCTATGGCGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGTCTCCTACACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCCAAGTCAAGGGCCCCCCAAACTCCACCGCTTGCCCCCACAAGGGCAATGAAGAAGGCGAAAGTTGACGCCGCCAAAAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACACTTACGTGGCATCAGAAGTCAGGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTACCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTCAAGAAAGCATCTTCTAGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGATTTTGGAATACAAGACTTTATTAATGACACCGGGCTAACTACGGATCAATTGCTACGAGACGCACCAATCGAAAAGACAGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGTGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTTCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCATAGGTTCTTAGCTTCTGAGATAGCGACTACTACTATGTCGAAATCGTAG >LOC_Os05g48100 ATGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACAAACACGTCAACGTACGTTGCCGCGACAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAACGAACGTGAACGAGCTAGGGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGAAGACACCAAACTTTGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAAGAGTCGGATGAGGAGCAAGAGAGATACCGGGGCGAAGATTGCAGACCTAGAGTTCCGAGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGAAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCTAG >LOC_Os05g35880 ATGGCTGACCGCGATGAGGAACAGATATTGTACGCTACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGTTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGAGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACAAACTCGAGGGCAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCAACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGGCACATGCCATGCCATTATTCTATGGCGCAGGCGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACAATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAAAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTTAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAAAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGAAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCTCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTTGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGAGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGGATTCTACTACAACGGAAACACAATTCATCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAACCGTAG >LOC_Os05g27140 ATGAACGAGCCAACGAACGTGAATGAGAACGAGAGAACGAACGTGAACGAGAACAAGGGGAATGAACGTGAACGAGAACGTTGTCGGACGAACGTGAATGAGCCAACGAACGTGAACGTGAAATGCAATTATAGGCAGATGGTTGATCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTATTGGAACAAAGAAGAGGGGAACGAGGATCCAAACCAGTATTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGGGCGCGTGGAAAGGGATGTGGAGGGAACCAGGAGGAGAAGGCTAGTGGAACTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATGTACGTCACAGCTGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTATGGACCACAATGCTCGAGACATCCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCCGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGAGCTGTACAAGAAATATATCCTGAAGGGGCAGACACAGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGACGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTGGCGTCGGGCATGGCCATCCCAACGGATCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTTAGGCTCCTGCACCGACTCCTCCTCGGTCTCCTACACCGACTCCTCTGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCACAGAAGGGCAACGAAGAAGGCGAAAATTGACGCCGCCAAGAACAAGGACCCGGGGTAAAGAATCTTCCGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGGGCCGTTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAACTGTACATAGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGACGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATAGATAAAAAAGAGTCTACGTTTGACAAGATTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGTGCGCAAAGCAAAAGAAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCAATTTTATTCGCATGAGGGATAACCTGACCACGCACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os05g10230 ATGCCCGCCACACCGCCGTTAACGAATGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCATCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACTGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAGGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTTGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCACACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATTAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAGCACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCAATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGTAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os05g19700 ATGGAGATTCAAAGGACCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCATAGAGGACAATCTCATCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGTGTGCTTTTACTCTTCGACCTGGAGGCCTGCATCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGGACTTATAGACAGGGCTTGGTATCAGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCAGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATGAATTTATCGTGGCGGTTCAAGAACAACTCATGGGATTTATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAAAACAATTCATAGGTCCTTAGCTTCTGAGATAGTGACTACTACTACGTCGAAATCGTAG >LOC_Os05g27690 ATGGCTGATCGCGATGAGGAACAGATACTGTATGATACAATCGCAGAGGAAAGCAGCCAGTCCTGGAACAAAGAAGAGGGGAACGAGGATCCAAACCGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCAGAGAAAGAGATGCTGTGGACCACAATGCTTGAGACATTCACCCTTCCTGCGGACTCCCGATCATCTAGGACGAACACGAGGGAAAGGGGTGATCCTTGGAAGATTGGATTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATTCAAGAGGAGGTGGCAAGGAAGGTGGATAAACGCATGGCCGCACATCGGTCCCAGGATCCCCAGCCGTACATTCCTCCTGCAATGGTCAGCCCATCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGTCGCCATGCAAACTCAGGACGAAACCACCTACCCCGTTGATGAGATCACTCAGCGGACACCATGTGAGCTACATATTCCCTTCAAGAACTTATCAATCAAGGTGGTGTCGGGAATGGCCATCCCAACGGACCCTTCAGGGACTTACCACTGCAGGCCGATTCCTGCAGGATACTCGAAGGTCAAAGTTGAGTTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGTGCAAGCGGTACATCATCCTCCCTGGGCGAGAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGATTCTTCCTCAGGCTCCTACACCGACTCCGCATCAGGCTCCTACTCAAGCTTCTGCAGTGACTCCTCTTCAGGCTCCTGCGCCGACTCCTCCTCAAGCTCCTTGTCCATCTCCTTCCAAGTCAAGGTCCCACCAAGCTCCACCGCCTGTCCGCACAAGGGCAACAAAGAAGGTGAAAGTTGACGCCGCCGAAAACAAGGAGCCGGCGTACAATTGCATGCAAGAGGAGCTTGACGCTTATGTGGCAGCAGAAGAGGCTATAAAGCTATCGGACTATAAGCGAACACTTAAGAAAGCATATTCTGGAAAGTCCAAACCAATCCCTCAGCTTGGAGAGCAACCAAACCAGGAGGTTGAGCCGTTGGTGACAGGTGAAGAATTTGGAATAAAAGAATTTATTTCTGACACCGGGCTAACTACGGATCAATTGCTACGAGGTGCACCAATCCCAAAGACGGAAGTGAAATACAAGCATGAACTCAGTAAATCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCGACACAGATGTACAAATTTCATCAATTGTACATGGAAATGAGCGCCACCGGTAGAGAGATAATTGGAGCGAGGATTAGGGACACGGACTTCTTGCTAGGAGAAGATATTCTCTGGATCAATTTCAAGAGTATCTACAAACTATACCAACTGGACGCCCTCGACGTCTCTATTATGAGTTGTTGGATTTTAATGGAGATTCAAAGGGCCCGACGGTGGGGGGTTTTCGATACTAGATTCATCGACCCTCGGAAAGTAAACGTCTCAATGATCGACAAGTATCCGGAAGCAATAGAGGACAATCTCGTCCATCTCTTAAAGGCGCAGCATTACAAGACATTCATACTATTTCCGTACAACACACAGTTAGTTTTTACTATCTTCCTACCAAATTTCATTCCCGTTATTCGTATGAGGTATAACCTCGCACACAAGGAATTTATCATGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAGTCATTGATCCCCAGGGTGAATTCTACTACGACGGAAATACAATTCATAAGTCGTTAGCTTCTGAGATAACGACTACTACATCGAAGTCGTAG >LOC_Os05g51250 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGCCACGCCACGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACATGGCTGACCACGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCAGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATTGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCAAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGAAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATGACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAACTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os05g24480 ATGACGCCTGAAGAAATAGCGGAATACAAGAAGGGCTTGCATACGATCAAGTTGCTTACTATGAAGCAACCTAAAGGCAGTACCCTCTATGGTTATTACACATGCAAATTTCTCAGTGTTAATGTGAGGTACAGGACCAACGCAGAGGATTTGCCTAGAATCAAACATCGAACAAGCTTTGACGATAAAGGCATTAAAAATATGCAGCAGGACCTCTGCCACTTCATCCATTGCGAGTGCTGTCATAAGGATGTAAGGATGGACGGTTCTTCAACACAGAAGACAGCCTAG >LOC_Os05g18900 ATGAAGAGCACGAACCAAAACAGCGCTGTTCGTATCGATGCCATAGGACACGATGGAACAACTGGCACGTATTACGGTGCCATCGAGGACATATGGGAACTTGACTATGGTCCTCTCAAGGTCCCTCTGTTCCGGTGCCAATGGGTTAGGTTGATTGGTGGAGGCGTAATGATTGATAACAGTGGGATGACAACGGTTGACCTTAACAAGGTTGGATACACGGACAAACCTTTTGTCCTTGCCAATGATGTAACGCAAGTCTTTTACGTGAAGAACATGTCTAGCAAAGGAAAGAAGGGCAGAGGGTCTGACGAGCCTAAGCGTCACGTGGTTCTCCCAGGCAAAAGAAAAATCGTCGGAGTTGAGGACAAGACTGACGAGGATTACGATCAGTTGGATGGGCAACCCCCTTTCGCGGTGACGATTGACCCTAGCATCCTCCTATCAACTGAAGACACCTCTTACTCACGTAGCGATCACAAGGAGGGAACAATAGTGAGGAGAAAAAAAGACGTTGTCGTCGTCGTCTCTCAAGCCGGAGTGATGGCTGATTGCGATGAGGAAAATAAATTGTACGATACAATCGCAGAGGGAAGTAGCCAGTATTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGGGCACGTGGAGAGAGATGTGGAGGGGAACCAAGTGGAGGAGGCTAGTGGAAGTCAACCCTCCGCTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTCAGCACATCATAACGGAAGTGGACGAAGACGGCCGACCTAGTGCCCCGGCGGAAGCCGCCAAGAACTACGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCTTGTCAGTACGGTGTACTGGCGCAGAACCAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATTTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGATAGGTCAACAAGGGCAGGAGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGTTGATGGCTCCCTGGTCTTCAGCGATCAGATACGCGAGGCTGCGCGTCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCCGACAGAGAGAAGGATGAGCTGTCACTCGCCCTGAGCCGGATAAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGACCGCACATCAGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAAATCACCTGCCCTGTTGATGACATCACTCAGCGGATACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTAAGTTGGTCGAAGGCGCGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTCAAGAAAACATCTTCTGGAAAGTTCAAACCAGTCCCTCAGCTTGGAGAGCAATCAAACCAGGAGATTGAGCCGTTGGTGATCGGTGAAGATTTTGGAATACAAGAATTTATTAATGACACCGGGCTAACTACGGATCAATTGCTACGAGGCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTATGAACTTGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAACTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGAAGGAGATGACATTCTCTGGATCAATTTCAAGGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGCTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCTGCGGCAAATGGAGAGAAAGACTTAGGTGGAAGTTCAATTTTCCTTGCGCAAAGCAAAAGCAGTTTATTCACATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCATAGGTTCTTAGCTTCTGAGATAGCGACTACTACTAGGTCGAAATTGTAG >LOC_Os05g09340 ATGTCGAACGAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTCCGGTAGCAATAAGCAGCCAGGCGCTTCTAGTGAAGAAACGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCATCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCGTACAACAGCGGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAGATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGAGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCATTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTCAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGACCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAACTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAAGAAGTGCACATACCAGATGGTACTACATCCGAACCAAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGACAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATTTTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os05g33330 ATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os05g29820 ATGGCTGATCGCGATGAGGAACAGGTACTATACGATACAATTGCAGAGGGAAGCAGCCAGTGCTGGAACGAAGAAGAGGGAAACGAGGATCCAAACCAGTACTTAAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAATGATGAGGGGAACAATGAGGAGGAGGCTAGTGGAAGTCATCCCTCCGCTGGACAGAAGAGGGCACGCGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGAAAACGGCCGACCTAGTGCCCCGGCAGAAGCAGCCAAGAATTTTGTACGCCACAGCGGCTGGGTTGTGAGGGACAACGTGCCTGTCAGCACGGTGTACTGGCGCAGAACAAGGGCACGCAGGGATAATGACAGCTTTGTCCCGGACTCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTCACGCTACCCGCGGGTACGAAGAACATAGTGAAACGGTGGACTCTGAAGAAAATGGCAGAACAATTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGACTAACACCGAACTTCGACGTATTCCCAAAGCTAAGGGATCAATGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGCCAGAAACAAAGAAAATGCCGCCAAGAAGATGTACCATCACCACTTGGGGTCAGGCGGATATAGTGTCGCAATGCCGAAGTGGGAGGAGATGGAGGCAAGTTTGATTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTTTGGTACTATGCTCACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTTGTCTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGTAGCCTCTTCTCAGGGCACATTCCGACCCGACAGAGAGAAGGATGAGCTGTCACTCGCCCTACAGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATTGGATTTAAGGAGGACATCCACACATACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAATGTGGATGAACGTATGGCCACACATCGGTCCCAGGATCCCCAGCCATACATTCATCCAGCAATGGTCAGCCCATCAAGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTCGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAAACCACCTGCCCCATTGATGAGATCACGCAGCGGACACCATGTGAGCTGCATATTCTCTTCAAGAACTTATCAATCAAGGTGGCGTCGGGAATGGCCATCCCAACGGTCCCTTCCGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGATACAAGCCATGCCATTATACTATGGCGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCTGCCATCTCCTCCTGCACCATCTCCTCCGGTTCCTCCGCCACGTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCTCCTCCACCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCATCGCCTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCACCAAAAACAAGGAGCCACCGTACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCTTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCGCAACAAACAAGGAGGCATTACAGATATCGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCGAAGATTTTGGCATAACGGAATTCATTTCAGACACCGGTCTAACTGTGGATCAGTTGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTCTGGATCCATTTCAAGGATCTCTTCGAGCTGTACCAGCTGGACGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTATTGGAGATTCAAAGGGCCCGATGGCGAAGGGTCTACGATACTGGGTTCATCGATCCTCGGAAAATCAACACCGAAATGATCGATAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTACATACTATTGCCGTACAACACAGAAGTCACTGTGTACGACTCAATGAATAAAGAGAAGATTTTTGACAAGGTCTTCAAATTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGAATTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCATGTGCAAAGCAGGACCAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCCCACTGTCTATCAAACCAAATATGCACAATACGAGATTTCGATCGTATTCACATGAGGGATAATCTCCCACACAAGGATTTTATCACGGTTGTTCAAGATCAACTGATGGGATTCATCAACGAAAAAATCCTTAATCCCGATGGTGAATTCTACTACGACGGATCGACAATTCATAACGTCGGTCCTTCCTCTTCTGACATAACGCCGGCGTCGAAATCGTAG >LOC_Os05g30360 ATGGAGATTCAAAGGGCCCGACGGCGGAGGATTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATATTATTGCCGTACAACACAAAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACGAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGTGGCAACTGGAGAGAAAGACTTAGGCGGAGGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGTGAGTACTACTACTACGTCGAAATCGTAG >LOC_Os05g14460 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCAGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCAAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGAATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCACCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTTGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGACGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTAGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCAGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os05g25170 ATGGCCGATAGTACTAAAGGGACTGAAGAGAAGGGTTTAGGGGAGCAGGAGCTGTCCCTTGCTGTTGTGGTTGCTCCGGAACCAACGGTCCCACCGAAAGGTAGTTCCAACTGCGACGTTGGTGATGAAGACGAGGATTACTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGGCAACAGTGAAGAAGACGACAAGGACTACATTCCCCCTAAAGAAGGGGAAACGGCGCCACGGCGATCAAAACGGCAGCCGAAGAAAAAAGTTCCGTCCAAAGACGACGACGTACCAGCTAACACAACCGGCACAAAGAAAATCGAACGGTTAGCAATCACGAAGAAAAGGAAGGGCGAGAGAAGCGTGAATAGAAAGGATGAAGGGTTCCATGTTGTTACCCATGTTTCGCCTAAAGGAGAGCCGCTCGCCCCTAAGACGGCACGTGCGAAATTCAGTTCACAGTGTGGCATAATAGTAAGGGAAAAGATCCCCATCACGGTCAAGTACTGGGATTATGTATCGAATGGGGATAAGGAAGTCCTATGGAAAGAGTTGAAGAAAATCTTCCAGTTCCCGGATGGATCAAAGGCAGCAGTAAGAAATTGTGCACTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAACCACCTTGAACAAGAAATTTGTGAAGACTGGACGCACACCATTTTCGACGTATGCCAACATAACCCCCAATCAGTGGGACGACTTTCTGACCTTGAAGAACTCCCCAGAAGAAATTCAAAGGAGCCAAAAGTATGCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCCGCGGGATACGCGTGTTCACAAAAGAAAGGATATTTCAAGCTTGAAAGGGAGAAAGATGTGCTAAGTACGGCGCTGGGTACTCCTGAGCATGGGGGAAGGGTTCAAGGTGCGTCGAGTAAGATGAGTTGGAAGGAAGGGTTCAAAAATGACCCCTACAAGAAGCGTGAAGCGTACAAGGATAAACTTAGAGACGAAGGGACTGCGGAGTTTGAAAGGCAAATGATGGATTTCTGCGTCAAGCACATGATTTTGCCTCGCCCCGAAACCAAAGAACCTGAGCCAGATTACCCCTTCGATAACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCCATTGGACGCTCCGGGAAAACTCTTGAGGCCGCTACAGCCATTGCTATCCCTGGGAGAACATACAATGAAGAGTTCATACCCGCTGTGTATGCCAAGGTGCAGCCGCAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTTCCCGACTGCAGATGGTGTATCCGTACTTGGGGATGCAGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACCGACGCCACGCAAAAACCTGTGGTGCCTAAACCGGGGTTGGGAAAACCTCCGAGGCCTCCTAAGAGGAAGGCAGCCATGGAGATTGCACCGCCGGAGGCAGCCATGGAGATTGCACCACCGGATGTGCCCATGGAGATTACAGTGGCAGAACCAGAGGTGCAATTTGTGGCATCAGTCGGGTCAGACAAAGAAGAAGTACCAGGATTGGAATGGGACGGTACAGAGCCAGAAATATTTGAAGACCCTTCTCCTGCGAAAGACCCCGAGGTGCCACGAGTGCTTAGGAGCCACGACTCCAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACCGTCTTCAGAGGGGGTAAAGAACGTGCCAAGCTCAGAGATGACGACCCCCAGAAAGCTGCTGAACTAGCCGGGCCAACATACTTCGCAACCGATGATTGCCCGGAAAAGTACGAACATGGGAAAGCACTCTTGCCGGAATGGGCACTGAAAGAAGCACCATGGGAGATGAGAAGGTTACATAACTTCTACATGGAGGCCAGCAAGAAAGGCTTAGGCAATATAACAGCTCGATCACCGGCAGATTGTTTCAGCGAAGAAGGTTACGTATGGCTAGATTTCTCATATCTCCACTCCATATATCGTCGGGATAAGATGGACGTCAACTGCGTCGGTGTTTGGTGCATGATGCAATACATGGATGCTAAGAAGAAAAAAGAACCCATCGGCTTCTTGGATCCAACTCGGATCTGCCAAACACAGCATGCCGTGACGCTAGCACCAGGGTCAAACCAGCTGAAGGGCAAGAATCCAAAAGAGATAGCAGAATACAAGAAGGGCTTGCATAAGGAGAAATTGATTACTGTCGCACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCACTTATAATTTTAACGATCATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGACCCTCTCGATTACAGTCACAAGCAATACAAAGAATTTCTAACAATCTTACAGTATGCATACCAATACTACAAGTTCAAGGGTGGAGAACAGACCCGAACACGGGAGAAGCTGCTATGTCACAAGCAACCGCGAGGAACGGTCCTTTGCGGGTATTATGCGTGCGAATTCCTTAGGGTTAATGGACGGTACAGGACTAACGCGGAGGATTTGCCAAGATTAGAATGTCGAACAAGCTTTGACGATACAGGTATCACAAATGTCCAGCGTGATCTGTGCCACTTCATCCACCATGAGTGCTGTCATGTGAAAGGAGACTTCTTCGACCCAGAGGGTGCCCTAGCGGCAAGTGACGAATTTAAGGATCTTCGAGAGTAG >LOC_Os06g42500 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGAATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCAGCCGAAGCCACCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACACGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGATGGAACGCTCAACCCAGCTGATGGCTCACTGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACATACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATATGAGCTGTATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTACCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTCGACGCTTACGTTGCATCAGAAGTCAAGAGACCATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGTGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAATAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTTCTGAAGGCGCATCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAAGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTATCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os06g32280 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACAAGGAAGGAAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCACGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCCCAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAATGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTGAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAACGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCTCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAACCCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTATGGATCAATTGGTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAAATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGACACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCAATTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACACGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAATGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os06g33870 ATGAAGCCTGGCATATATCTGATCAGGACTAACGTGCCATCTCTGGGAGGTAACACGCTAGCTCCAGCTGGGGACGAGCGCCTAGAAGCCCTCGTCCTGACGGGACGGGGCGAGGCATTCCACTGGGTCCTTTTACTCTTCGACTTGGAGGCCTGCCCCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGATTTTCGAACTGATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAGTGGAGAGAAAGACTTAGGCGGAAGTTTAATTTTCCTTGCGCAAAACAAGCCCAGGGAACTAACTTGTGTGGCTACTACATGTGTGAATATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCACATGAGGGATAACCTCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTAGATCCCAAGGGTGAATTCTACTACGATGGAAATACAATTCATAGGTCCTTAGCTGCTGAGATAATGACTACTACTACGTCGAAATCGTAG >LOC_Os06g24230 ATGAAGGAGATCGTCACACAACAGAAGGATGGGATATTCGTGCCAGACAGAGAAGTGGACCAACTGTCAGTTGCTTTGGGAACCTCGGAGCACGGAGGCCGCGTTCGAGGAGTCTCCTCAAAGGCTAGTTGGAAGGATGGCTTCAAAGAAGATGCTGCTAGCTACAAGAAACGTGATCGATATAAGGAGGAGTTAGTGGCTAGCTGTAGGGCAGCAACATTGCAAGAATGCATAAGATTTTTTAACCGAAACCCGGAACTTCAGCAACGCGTTGATAGGATGCAAGATGCGTTTCCTATGCCCGATGTCCCTAGCTATCCAGTCGATGATATAAAGGAAGATACTCCTTGCAGACTGCTTATTCCGGTTAGAAGGACAGGAAAGACAATTCAGGTTGCAACTGGAAGGGCAATGCCAGGGCGCAGATTTCATTGCCAAGATATACCAGATGACTATGCCAAGGTAGAGGTGCGGACGGTAAATGAGGATCACAGGATGTACGAGATAGACTTTCCAACACCCGAGGATATCGTGTACCTTGGAGATGCAGTTGACCAGATAATACTATGGCACAAAAAGGATATTCAATTAGGATCAACGGATTCTCCGCCAAGGATACTGCGGTCACTATGTCATGCCTTGCAGCTTGCACATCCAATGCCTGAGCAACTAGAGCCTGAGCAGCCAATGCTTGATAAAGCAGAGCTTGAAAGGGAAGAAGAGGTTGTACAAGAAAGGGAAAAGGAGGTTGTACAAGAGAGGGAAGAAGAGGCTGTAGAAGAGCACAAAGAAAAAAGTGCGCCCAAGAAAAAGTTTGTGGTAAAGGCATTCCCAGGAAGGAAGAGAGATATCAAGGGGAAAGCAAAGGATGTTTATGATAAAAGGAAAGCAAAAGGCCTGAAAATAAGCTTGGATAAAACTTTGAGTTTTATTCCTACTGTTGATGTGCCAGAACTATTTGAGAATGGCAAAGCATTCCTCCCCACATGGGAATTAGAAGAAGGACCTTGGCAATTAAAAAGGTGGCATGAATGGATGAATTACGTCATAGCAGAACAGATGCGTGAGACTGTCGGCTTCCTAGACCCTTGCCTTATAAGTAAGCCGAACCACACCTTCACGCTAGATGAGAAGAGGGTACCGGCACATGTTGCGGCCATGACTCCCGAAGAGAGAGATGCATACCTGACAGAAAGGCATCAAGCTAAAATTCGCGATGTGGCTACTTACGTAGCTATAGCACTTGAATCAATGCAGGGCAAAGAATGCATCTACGCCCCATACGCCTTTGACGACCACTGGATTACTTTTCTTCTATATCCAAAGTATAACGAAGTTATAGTCTTGGATTCTCTTGATAAAGACATACAATCATATCAGGAAATCCTCAGAATCTTCGATCTTGCATATAAAAGGTATTACCAGGTAGGCGGACAACGGCGAAACGACAGAGATCAAATATACATCCGCAATAAGTGGCCGCTTCTAAAATTCCCCAAGAGTGATAGGGAGCTGGATGATAAATCCATTCAGAATATACAACGAGACTTGTGCTATTTCATTCACAATGAATGTTGTCACCAGCTTGGGAGGTTTTTTGATAAAGAAGGGCTTTTGGGCTTGCCAGAAAACGATATTCTTTCTAACTGGAGCAAGCATGCAATTTAA >LOC_Os06g34000 ATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTACTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCACCTCAACGGGGCAGGTAGGATCACAGAGTATGAACGCCATGCAAACCCAGGACGAATCCACCTGTCCCATTGATGACATCACTCAGCGGACACCATGTGAGTTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCACAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCCCCTCCTCAGGATCCTGCACCGTCTCTTCCTCATGCTCCAGCACCGCCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCGGGCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCTCCCAAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGATGTCTAGAAAAGAAGATTCCTATAGACCCGAGTGTCAGGAACTTCTTCAGGGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGGTGCAGTCCCTACCCACACAAATATACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCAATGGATCAATTTCAAGGGAATCTACGAACAATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGAAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGACAACTGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCCCGGCGGTTCAAGAACAACTAATGGGATTCATCAATGAACAAATCCTTGATCCCAAGGGTGAATTCTAA >LOC_Os06g19510 ATGAGTTGGAAGGAAGGGTTCAAAAATGACCCAAACAAGAAGCGTGAAGTGTACAAGGATAAACTTAGAGACGAAGGGGCTGCGGAGTTTGAAAGGCAAATGATGGATTTCTGCGTCAAGCACATGCTTTTGCCTCGCCCCGAAACCAAAGAACCTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCCATTGGACGCTCCGGGAAAACTCTTGAGGCCGCTACAGCCATTACTATCCCTAGGAGAACATACAATGAAGAGTTCATACCTGATGCGTATGCCAAGGTGCAGCCGCAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTTCCCGACTGCAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACCGACGCCACGCAAAAACCTGTGGTGCCTAAACCGGGGTTGGGAAAACCTCCGAGACCTTCTAAGAGGAAGGTGACTGATAAGGCAGAGGAACCCGAGATGCAAAGGGAAAATCCAGTGCCGGAAGTGCCACCGGAGATTGCATTGCCAGAGGCAGCCATGGAGATTGCACCGCCGGAGGCAGCCATGGAGATTCCAGTGCCGGATGTGCCCATAGAGATTACAGTGGCAGAACCAGAGGTGCAATTTGTGGCATCAGTCGGGTCAGAAATAGAAGAAGTACCAGGATTGGAATGGGACGGTACAGAGCCAGAAATATTTGAAGACCCTTCTCCTGCGAAAGACCCCGAGGTTCAAGAGACCACGGTCCCTGAGAAGGCCACTACCAGTTCTGAGGTGCCACGAGTGCTTAGGAGCCACGACTCCAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACCGTCTTTAGAGGGGGTAAGGAACGTGCCAAGCTCAAAGATGACGACCCCCAGAAGGCTGCTGAACTAGCCGGGCCAACATATTTCGCAACCGATGATTGCCCGGAAAAGATGCAATACATGGATGCTAAGAAGAAAAAAGAACCCATCGGCTTCTTGGATCTAACTCAGATCTGCCAAACACAGCATACGGTGAGGCTAGCACCAGGGTCTGACCAGCTGAAGGGCAAGAATCCAAAAGAGATAGCAGAATACAAGAAGGGCTTGCACAAGGATAAATTGATTACTGTCGCACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTTAAGGTTAATGGACGGTACAGGACTAACGCAGAGGATTTGCCAAGATTACAATGTCGAACAAGCTTTAACGATACAGGTACCACAAATGTCCAGCGTGATCTGTGCCACTTCATCCACCATGAGTGTTGTCATGTGAAAGGAGATTTCTTCGACCCAGAGGGTGCCCTAGCGGCAAGTGATGAATTTAAGGATCTTCGGGAGTGGAACACTGCTATGCCATAA >LOC_Os06g20800 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGAACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAACTTGAGGGTCGGCACATTATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAATTATGTACGTCACAGCGATTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGACACGCGGAGATTATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGATGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATACCGCCAAGAAGAAGTACCATCACCACTTGAGGTCAGGAGGCTATAGCGTCGCGATGCCAAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATAGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGATATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAAGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCTAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAACTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGGAAGACATGACGATAGAAGAATTTATTATTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAATGCGGAATTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAACTGTACGTGGAGATGAGCGCCACCGGTAGAGAGATGATAGGAGCGAGGATCAGGGACCCGGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGGAATCTACGAAGTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGACTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCTATACTGGATTCATCGACCCTCGGAGAGTAAACGTTGCAATGCTCGACCAATATCCGCAGGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTTTCGGTTCCGTCATTTGGTCCGCGGCAACTGGAGAGAAAGACTTAGGCGGAGGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCAGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGACTACTACTACGTCGAAATCGTAA >LOC_Os06g16540 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGACACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAAATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCTGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGCGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAACTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAAGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGTCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACATGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTTACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCGCCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCAGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTAATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATGA >LOC_Os06g19310 ATGGATGAAGTCGGGGGTCGATGGACATTCTCCAGGGCAAATGAAGGCTACACGAGCTGCGGCCCGGTAGTCGAGATGTCATGGCACAGGGTTGGTGCCCTGCTGCTAGGGGCTCAGTCCTGCCTGCCTGTCCCGGAGGTTCCGGCCGTAGGTGGGATTGGGTCGGTACTCTTGTGTATGGCTAGGATGGGTTGGAAACTATGTCACGTCTTCCGTCTGTATACCGTGGTGATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGACACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGGCACGTTCCGACCAGACAGAGATAGGGACGAACTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGTCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTTACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCGCCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTAATCCTAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATGA >LOC_Os06g33840 ATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCAATCGGAGTTCTGGTACTATGCTCATGGTGGAACGCTCAACCCAGTTGATGGCTCCCAGGTCTTCAGCGATCAGATATGCGAGGCTGCGCGTCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCCGACAGAGAGAAGGACGAGCTGTCACTCGCGCTGCAGACTCCCGAGCATCCAGGACGAACACGAGGGAAATGGGTGATTCCTTGGAAGATTGGATTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTACAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGTACATTCCTCCTGCAATGGTGAGCCCTTCAGGCAATGGTAGCAGCTGCTCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCGAACGGACCCTTCAGGGACTTACCACTACAGGCCGATTCCAGCAGGATACTCCAAGGTCAAAGTTGAGTTGGTGGAAGGCGCGTACGAGGACGTCGAGTTGGACTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACACCATTATACTATGGCGCAAGCGGTACATCATCCTCCCTAGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGTTCCGCCATCTCCTCCTCAGGCTCTTGCACCGTCTCCTCCTCGTGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTACACCGACTCCTCCGCAAGCTCTTCGTCCGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCACCGAAGAAGGCGAAAGTTGACGCTGCAAAAAACAAGGACCCGGGGTATGATTGCACGCAAGAGGAGCTTGACGCTTATGTGGCATCAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCCAGAAAAGAAGATTCTTATAGACCCGAGTGTTAGTAACTTCTTCAGGGGTATGTCTGCACCTCCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTTAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGATTTTGGAATACAAGAATTTATTAATGACACCGGGCTAACTACGGATCAATTGCTACGAGGTGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTTAAGCCTGAGCAGCTGCAGTCCCTACCCACACAAATGTACAAATTCCATCAACTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGTGGATCAGGGACACGGACTTCTTAATGGAGATTCAAAGGGCCCGACGGTGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAGTTAGTTTTTACTATCTTCCTATGA >LOC_Os06g38062 ATGGCTGATCGCGATGAGGAACAGATACTGTACGACACAATCGCATCGGGAAGCAGCCAGTATTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGCGGAGAGGGATGCAGAGGGGAACGAGGAGGGGAACGTGGAGAGGGATGCGGTGGGGAACGAGGAGGAGGCTAGTGGAAGTCATCCCTCCGCTGGACAGAAGAGGGCACGCGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGCAGACGACCGACCTAGTGCCCCGGCACAAGCAGCCAAGAATTTTGTACGCCACAGCGGTTGGGTTGTGAGGGATAACGTGCCTGTCAGCAAGGTGTACTGGCGCAAAACAAGGGCACGCGGGGGTGATGACAGCTTCGTCCCGGAATCAGAGAAAGAGATGCTGTGGACCACAATGCTCAAGACGTTCACTCTCCCTGCGGAACAGTTCCAGACCTTCAAGGGAGATCTGTACCGGAAATACATCCTGAAGGGGCAGACACCGAACTTCGACGTATTCCCGAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTACAAGACAGGTCAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAAGTGGCCTGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCTAGTTGATGGCTCCTTGGTCTTCAGCGATCAGATACGCGAGGCTGCGAATCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTACAGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATGGGATTCAAGGAGGACATCCACACGTATAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATATTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCCCGGAAGGTGGATGAATGCATGACAGCACATCGGTCACACGATCCCCAGCCGTACATTCCTCCTCCAATGGTCAGCCCATCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGTATCACATAGCATGGATGCCATGCAAACCCAGGACGAAACCACCTACCTCGTTGATGAGATCACGCATCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTGGCGTCGGGAATGGCCATCCCAACAGACATTTCAGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGTGTACGAGGACCTCGAGTTGGACTATCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCGGTACATCATCCTCCTTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCGTCTCCTCCTGCACCATCTCCTCTGGCTCCTCCGCCACCTCCTCCTGCACCATCTCCTCTGGCTCCTCCGCCTCCTCCGCCTCCTCCTCCACCGTGTCTGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCTCCTGCCAGCACAAGGGCAACGAAGAAGGCCAAAGTTGAGACCACCAAAAACAAGGAGCCGCCGTACGGTTGCACTCAAGAGGAGCTTGACGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCAGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAATTTCTTCAAGGGAATGTCCACCGCAAACAAGGAGGCCTTAAAGCTATCGGACTATGACCGAACACTTAGGAAAGCCTATTACAAGAAGTCCAAACCAGTTCCTCAGCTTGGAGAACAACCACACCAAGTGATCGGCGAAGACTTTGGCATAACGGATTTCATTTCGGACACCGGTCTAACCATGGCTCAGTTGGTTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTTGGTAAACCGCTTGTCAGGCCTGAGCAGCTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGCTCGACAAGTACGAAAAAGACACAGAGGACAATCTCATCCATCTCCTAACGCAGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAAGTCACTATGTACGACTCAATGAATAAAGAGGAGAAGGTTTTTGACAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGAGGCTTGGAAAGAAAAACTTGGACGTAGGTTTCATTTTCCATGTGCAAAGCAAGACAAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTTTGCCCACTGCCTATCAAACCAAATATACACCACACGAGAGCTCGATCGTATTCACATGAGGGAAAAACTCCCACACAAGGATTTTATCATGGCTGTTCAAGAACAACTGATGGGGTTCATCAACGAAGAAGTCCTTAATCCCGATGGTGAATTCTACTACGACGGATCGACAATTCGTAACGTCGGTCCTTCCTCTTCTGACGTAACGCAGGCGTCGAAGTCATAG >LOC_Os06g09480 ATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTATAACGTGATTGCTCTCGATCAGGATGGGAAGCCCATCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCGTACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAGATATCCCCATAGATTGGGGTCGAGCGGATACACTAGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAAGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGAGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCAGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGATAGCATTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAGCACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTCAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCCTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGACCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAACTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAACAAGTGCACATACCAGATGGTACTACATCCGAACCAAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGACAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCGGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os06g23340 ATGGACAAACCCATCCAAGAGCAACCCACGGGTGACAAGAGCAAGGAAACTCAGCTAGTCATGGAGGAAGATATTTGCACGCAAGTAGTCGCGGAGGAATCTTTGTCGTCTAGCTCAAATGAACCAGGTAGTGGATCGTATCACTCGCCGAGTGACCCCCATCCTTCTCCTGCAAAGAAGAGAAAGGGCGGTAGCGACTATGAAGTTGACTCTGACTACGTTCCCCCCGAATCGGTGTTGAATGCTCCACGTCGCTCCAAAAGGAAAGCCCAAGCCGCAACTGAACCTGAAGCTGAAGCTACAGCTGTCGTGCGCACAACAGCTTTAAGCAAACCCAAGAAAAGGAGGGGCGAGCGAGGGAAGAACATGTTGTTGAAGGAAGTAAGCGTGCTGACGCGGATGAGTGAGATAGGGGAACCCCTATCACCGCAAGACTCATGTTCGAAGTATAGCAACCAATGTGGGGCGGTGGTCAGGGATATCGTGGAGATCACATGGAAGGATTGGAAGAAAGTTCCAGAGAGTCGAAAGAATAGCTGTTGGACGTCGCTGCAAAGCAAGTTTGAATATCCGGAGGGGACAGACAACGATAAAGCTAAGGATTATGCGTTGAAGACAATGGGGAAGTTGTGGCGAAACTGGAAAACAGACCTGAATAAGAAATATGTCCAGAAGGGACTCACTCCGTTTAAGGACTACGGAAGGATAACACAGGCCCAGTGGGATGAGTTCGTTGCCCTTAAGACATCGACAGAAGAAAAGGAGAAGAGCCAGAAGATGGCAAAACAAGATGAAGAGATGGAGAAGGCTGGGAAACCCGTTCCTATGAAAAATCACAACCCACAAAGTAGGAACTGGGTGCGTGCAAGAACACCGGCCTTCACCCCTGAGGGGGATGTAGTATTCAAGGATCAGAAGCTCCAGGAGGTAGCTGTCAAGATGAAGAACATCGTCACGCAGCAACAGGCCGGGACGTTCGTGCCAGATACAAACCGGGACGAGTTGACCTATGCCTTGGGCAAACCGGAGCACTCTGGCCGTGTACAGGGAGTTTCCTCAAAGACTAACTGGAAGGATGGATTCAAACAGGATGCTCATACCTACAAGAAGCGTGATCGCTACAAGGAAGAGATTGACTCTCAGGCTAGGGCAGTAGCTCGCGATGAATGCAATATATACTGGAGTCAGAAAATGATGCACGGTGCTGCTGTTTTAGAGCCTGAGCCGAGCTATCCTTTCGATGATGTAACGGAGGATACTCCGTGCAAGCTCTTGATTCCGGTCGGCAGGGCAGGAAAGAAAATACTCGTTGCAACTAGGAGGTTCATACCAGGCCGCAGGTTTCTTTGCCAAGACATTCCGGATGACTACGCCAAGGTAGAGGTCCGGACGGTCATTGAGGCTTACCAGATACACGAGCTCGACTTTCCAACTACTGAGCAGATTGTGTACCTTGGAGATGCCGTCGACCAATTCATACTATGGCACAAGAATGATATTGAACTAGGGTCAATGGATGGAACTAATCGTCCACCAAGGATACCGACCTTCGATGACTATCTCAACTATATCAATTCCCCAGATGTGCCACACGAGTTTGAGAATGGCAAACCATTCATTTACAACTGGCAACTAAGAGAAGGACCGTGGCAACTAAGAAGGTGGCACGATTGGTACATTAGGGCAAGCACCATGAAAGGCATCGATTCATTCACAGTTGCCGTGGGGGAGAACATCTTTTGGAGCGGTCCTTGTCTACTCCAAGTCTATTTCTCCGATATGCATTCCCTCTACCATAGGAAGCGGCTGGACGCCAATTTGATTGCCATCTGGTGTCTGATGAATTACGTGGAAGCCGAAGCGATGAAAAAGCCTGTTGCCTACCTAAACCCGTGCAGGATAAGTAAATCGAACCAAACATACACGCTAGACGAGAAGAAGCTACCGGAACACATCAAGGCAATGACTCCCGAAGAGAGGAAAGCTTACATAGCACAAAAGCATTTTGAAAAGGTGCTCGATGTTGCTACTGCATTTAAAAGGTATTACCAGCGAGATGGACAATGCAAAAACTCAAGAGAACGCATATTCGTCCGCAATAAGTGGCCGTGTCACAAGCAACCGGTGGGAACAGTACTATGCGGATATTACTGTTGTGAGTTCCTAAGGGTTAATGGGAAATATTGTACGAATTACGACGAGCTTCCAAAATTTCCCAAGTCTGAAAGAGAGCTCAATGATACATCCATTCAGGACATTCAGGCAGACATGTGCTACTTCATCCACCGTGAGTGCGCACATCAGCTTGGGCGGTTTTTTGACAACGAAGGAGTCTTAGCCCTGCCGGAGAACGAATCCCTGTCTAACTGGACCAGGCATATAATATAG >LOC_Os06g16870 ATGTCGAACGAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTCCGGTAGCAATAAGCATCCAGGCGCTTCTAGTGAAGAAACGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCATCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCGTACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAAATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGAGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCATTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTCAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGACCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAACTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTTCTCTGGTAGAAGAAGTGCACATACCAGATGGTACTACATCCGAACCAAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGACAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGACAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os06g15050 ATGGCAGACCGCGATGAGGAACAAATCCTATTAGACATGATCGTAGTAGGCAGTAGTCAGTACTGGGTGGATGAGGAGGGGAACGATGATCCCAACCAATACCTGAACGGGGAGGGAAATAAGGAGGGTAACCAGGAGGGGACCGAGGAGGGGACTGATAACCAACCGTCGGCCGGACAGAAGAGGCCACACGGGAAAAGAGGTCCCGCGAAGAAGCTGGAGGGAAGGCACATTGTTACTGAGATTGTCCCAGACGGCGAACCAGTAGCCCCAGTGGGTATAGGACAAAAGTTCGTGAATCATTGCGGTTGGGTCATGAGAGACAACGTCCCCATCAGCATAGTGTACTGGCGTCGAACAAGGTCATGTGGGGATGAAGATAGTTTTCTCCTTGACACAGAGAAAGATATGCTGTGGACAACCATGCTGGAGACATTCACGATCCTTGAGGCAGATCGTCCAAGATGTGAAGAATGGACCCTGAAGAAAATGGACATCCACACGTATTGGAGTGGGATGAGGAGCAAGAGGAATATAGAGGCTAAGATCGTTGATCTTGAGTACATGGTGTCCACCTACGAGGCAAGGATGCAAGAAGAGGTTACGAGACAGGTGGACCAACGCCTGGCCGAGCAGCGCGGAATGGAAACACAAGCGCCCGTCATGGTGAGCCCCTCAGGCAACCGTAGCAGCTACGCATCAACGGGCCATGTTGGATCAGAAGGCATTGAGGCCGTCGCAGCTCACGAAGCAACCCACTTCCCCGTTGAGGAGATCACACAGCGGACACCCTGCGATATGCATACTCCCTTCAGGAACTTCTCTATCAAGGTGGCGTCGGGCATGGCCATACCCACGGACCCTTCGGGTACATACCATTGCAGGCCCATTCCACCTGGATACGCGAAGGATCACTTTATTAAGATGGCCGAGCCGAGCAAACCGGTCGTAGTTTCTGACTATGATCGAACATTGAGGAAGGCTCTTAAAGCCAAGCCTGCAGCAGTGAAATGCGGAAAGGAAGTCCCTCAGCTGGGGCAGCAGCCACAACAAGAGGTTGAACCATTCGTAGATCCGGACCAACTTGAGATACACAAGTTCTTGAAAGAAACTAGACTAAAGATGGAGCAGTTGCTAGAGAACGCACCTATCGAAACTGCTCCGGTCAAGTACATGTTTGAACTCGGAGAACCGCTAGTAACGCCTGATAAGATCAGAGAGCTACCTACACAGACGTACCGGTTCCATCAATGGTACATGGACAAATCAGGGATGGATGATGTTCTTTGGACCCGTCACAAAGAAGTCTTCGACTTATACCACCGCGACGCCCTCGACGCCTCTATCCTCAGCGCGTGGACTTTATTCCACTGGGTCCTTATTCTTTTCGACCTTGAGAAATCCAAACTCCATGTCTACGATTCAATGGATAAACCGAAGAAAGCTTTCGCACAGATTTTCGAAGTGATAGATAGGGCATGGATTCGGTTCCATACATTGGTCTGCGGGATTTGGAATGAAAAACTCACCCGGAGGTTCAATTTTCTGTGTGCAAAGCAGGAACAGGGGACTAACTTGTGCGGCTACTATGTCTGCCATTACATGCACTGCTTATTATTCCAAATCAGGACTGGCCAGGACTTGGAAATGATTTACATGATAGATAACCTCACCAACGATGATTTCATAAGGGTTGTTCAAGAACAAATGATGGGATTCATCAATGAGCAGATTCTTGATCCCACAGGAGAATTCTATTACGATGGAAAGCCTATTCATTAA >LOC_Os06g35350 ATGAAGCTTGAGGGAAGGCACATCGTTACTGAGATTGCCCCAGACGGCGAACCAGTAGCCCCGACGGGTATAGGACGAAAGTTTGTGAATCATTGTGGTTGGGTCGTGAGAGACAACGTCCCCATCAGCATAGTATACTGGCGTCGAACTAGGTCACGCGGGGATGAAGATAGCTTTCTCCCTGACACAGAGAAGGACATGTTGTGGACCACCATGCTGGAGACATTCACGATCCCTGAGGCAGATCGTCCCAGATGCAAAGAATGGACCCTGAAGAAAATGGCAGAACTATTCCAGAGCTACAAATCAGATCTGTACAAGAGATACATCCTCAAGGGCTTGATACCTAATTTCAACGTGCATAACAAGTTTAGGGATCACTGGGATGCGTTTGTGGCATACAAGACTGGAGCGCAAGGGCAAGCACAGATAGAAAAGAACAAAGCCAATGCAGCTAAGAAGAAATACCATCACCGGCTTGGGTCAGGCGGATATGCAAAGGCAATCCCCAAGTGGGACAAGTTGGAAGCTGACTTGATAGCAAGGGGTATCGAGCCGGCCACGGCTAATTGGCCTGAGCGATCGAGGAACTGGTTCTATGCACACGGTGGATCGCTCAATCCAGAGAAGGACGAGCTCACCCTCGCACTACAGAATCCTGAGCATCTAGGACGAATGCGAGGAAAAGGCGTCATTCCTTGGAAATATGGATTCAAAGAGGACATCCACACGTATAGGAGTTGGATGAGGAGCAAGAGGGATACAGAAGCTAAGATCGTCGATCTTGAGTACAGGGTGTCCACCTACGAGGCAAGGATGCAAGAGGAGGTGACAAGACAGGTGGACCAACGCCTGGCCGAGCAGCGCGGAATGGAAACACAAGCGCCCGTCATGGTGAGCCCCTCGGGCAACCGCAGCAGCTGCGCATCAACGGGCCAAGTTGGATCAGAGGGCATTGAGGCAGTGGCAGCTCACGAAGCAACCCACTTCCCCGTTGGTGATATCACGCAGCGAACACCCTGCGATATGCATACTCCATTCAGGAACTTGTCTATCAAGGTCACGTCGGGCATGGCCATATCCACGGACCCTTCGAGTACATACCATTGCAGGCCCATTCCACATGGATATGCGAAGGTCGAGATAGAGCTAGTGGAACGAACCTACGAGGATCTCGAGCTTGACATCCCCGGAGGAGACGGGGAGAAGAAACTTGGAGACATAGCCCACGCCATCATACTCTGGCGTAAGAAGTACATCGTGTTTCCCGGGCAAGAACGGCCGCCCGCTCCTCCTTCCCCGCCGCAAGCACAGTCTCCTCCGCCATCACCGCCTCGTCAGTCTCCTCTGGCTCCTTCCCCTGCACCACCACCTCCTCCGCGTGCACCAGCTGCCAAGTCTGCACCGTCGGGCTCGCGGGCAACTACTCCTCCACGTGCACTTGCTGCCAAGTCTACACTGTCAAGGTCCCGCCCATATGAACCCGCACCATCAAGGTCGAAGAAGAAAGCCAGATCTGACGAGCCATGGCTCCCCGCTCTCAAGAAAAGGGCGTACGACTTGACTCCGGAGGAGCTCGATGAAGCCGTTAGAGCGGAAGTTAGGGAGCAGTTGAAGCCACGTAGTCCGGAAAAGAAGATCCCTATAGCCCCGGAGGTTCAGGATCACTTTATTAAGATGGCCGAACCGGGCAAACCGGTCGAAGTTTCTGACTATGATCGAACATTGAGGAAGGCTCTTAAAGCCAAGCCTTTAGCAGTGAAGTGCGGAAAGGAAGTCCCTCAGCTGGGGCAACAGCCACGACAAGAGGTTGAAGCGTTAGTCGTAGAACCGGCACAACTAGAGATATGCAACTTCTTGAAAGATACGGGACTGAGTATGGAGCAGTTGCTAGAGGATGCACCTATCGAAACGGCTCCAGTCATGTACACGTTTAAACTCGGTGAACCGCTAGTCATGCCTGATAAGATCAGAGAGCTACCTACACAGATGTACCGGTTCCATCAATGGTACATGGACAAATCAGTGATGGGTAGATAG >LOC_Os06g42290 ATGAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCTAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCTGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAATGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCTATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATTTATAAAAAAGAGTCTACGTTTGATAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTATGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os06g21150 ATGCCGCCGCCGCCGTCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGGACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAATGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAATGAGAACGATCGAACGAAGATAAGCGAGAATGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAACGAACGTGAACGAGCTAGGGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAAAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCAAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCATGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGACCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCACGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCTGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCTCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCAAAAGTTGACGCTGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAAAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGATGATAGAACAATTTATTATTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATTGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACATGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACCAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAACATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCATTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os06g08410 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCTAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGTTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGAATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCATGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCATGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCGCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCTAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTATGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGAAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os06g15010 ATGGGCCGCTGGGAGAAGGGTGAGGTATGGTCTTTGACGTATGCCAACATAACCCCGAAGCAGTGGGACGACTTTCTGACGTTCAATAACTCCCCGGAAGAAATTGAAAGGAGCAAAAAGTTTTCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCCACGGGATACGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGGCGGGGCAACCGGTACCAATGGAGGAATGGACACAGATATCAAGGAACTGGGTAAGAGCTAGAACTCCTAAGATCACGGATAAAGGCAAAGTATCATTTGAAGATCCGGAGCTGCAGGGGGTGGCCGATAAAATAGAGAATTTATCCAGTGCACAGAAGAAATGA >LOC_Os06g17320 ATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTAGGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGATTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os06g16580 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAAGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCAAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATACCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATTGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGTGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCTGATTCCACCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCTAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGGAAGACATGACGATAGAAGAATTTATTATTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAATTGAAATACATGTATGAACTCGGTAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACGTGGAGATGAGCGCCACCGGTAGAGAGATGATTGGAGCGAGGATCAGGGACCCGGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGGAATCTACGAAGTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGACTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTTGCAATGCTCGACCAATATCCGCAGGAAACAGAGGACAATCTCGCCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTACCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAATGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCATGGTTTCGGTTCCGTCATTTGGTCCGCGGCAACTGGAGAGAAAGACTTAGGCGGAGGTTTAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCAGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACATAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGACTACTACTACATCGAAATCGTAG >LOC_Os06g30580 ATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCTTGAAGGCGCAGCATTACAAGACGTTCAGACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCATCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCAGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTTTATTCGCATGAGGGATAACCTGACCACACACAAGAAATTTATCGCGGCGGTTCAAGAACAACCCATGGGATTCATCAATGAACAAATCCTTAATCCCAAGGGTGAATTCTACTACGACAGAAACACAATTCATAGGTTCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os06g28370 ATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTACGATACTGGGTTCATTGACCCTCGCAAAATCAACGTCAAAATGGTTGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTGACGCAGCAGCATTTCAAGACGTTCATACTACTGCTGTACAACACAGAAGTCAATGTGTATGACTCATTGAATAAAGAGAAGACGACTTTTGATAAGGTTTTCCAGCTGATAGACAGGGCTTGGGATTGGTTCCGTCAATTGGTCCGCGGGATTTGGAAAGAAAAACTTGGACGGAGGTTTAATTTTCCATGTGCAAAGCAAGACCAGAGAACTAACTTGTGCGGCTACTACGTATGCGAGTATGCCCACTGCCTATCAACCCAAATCTACACCACACGAGAGCTCGATCGTATTCACATGAGGGACAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAGAAAAACTGATGGGATTCATCGACGAACAGGTCCTTGATCCTGGGGGTAAATTCTACTACAACGGATCGACAATTCATAACATCGGTCCATCTTTTTCTGACGTAACACCCGCGTCGAAGTCGTAG >LOC_Os06g21750 ATGATGTACCGTCAATTTCTAACAATCTTCAAATATTCCTTCTATGTGTATGTCATGAAGTGTCACAAGCAACTTAAAAGCGGTGTCCTCTGCAGTTATTACACATGCGAATTCCTCAGGGTTAATGGGAGGTACATGACCAACGCAGAGGATTTGCCTAGAATTGAACATCGAACAAGCTTTGACGATGAAGGCATTAAAAATGTGCAGCGGGACCTCTGCCACTTCATCCACAACGAGTGCTGTCATATCCAAGGACGGTTCTTCGACCCAGAAGGCACCCTAGCGACAAGCGATGAATACAAGTCTCTTCGGGAGTGGAACAACGCGATGCCATAA >LOC_Os06g17330 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTACGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGTTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGAAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCAAGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCTATTATTCTATGGCGCAGGCGGCACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCGCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTACATCTGTCAAGGAGGCCATCAATCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGA >LOC_Os06g15850 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGAGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACAAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTATTCGGCGTTCAGATACGAGAGGCTGCGCAACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCCGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCGCAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCATGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGACAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAAACAGGAGATCGAGCCGTTGGTTACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAATTCCATCAGCTGTACATGGAGATGAGCGCCGCCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCATTGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTAATCCCAAGGCGCGCAGGGGCAGGGAGGTGGGCAGCGGCGCGGGGACGGGCGGTGAGCTGGAGGGCGGTGGAGGATGCCGCCGCGCCACGGCTGCACGCCGTGCGTCTCCCACCTCACCTTCGCCGCCAGTTGCATCGACCCCAGGAGGATGCCACCGCGCCACGGCTGCACTCATGCAGTGCCAGCGCGTGAGTGACCTGCTCATCGTGGCGACCTTCCTCTCCTTCCCGTTCGAGCTCTTCTACTTCGCCACCTGCGCCGACCTGTCGGAGGTCAAGTGCGCGGTGCTCCACTTCTGCGCCTTCATCGTCCTCTGCAGCGCCACCAACCTCCTCGCCGCGTTCACCCACGCCCTCCCGCACTCCACGCCGCTGCTCAGGGCGCTCACCACCGCCAAGGTGCTCGCCGTGGCCGCATCGTCGGCAGTCACGGTCTCGCTCCCCACCTTCATCCCCAAGCTGCTCTGCTTCAAGGTGTAG >LOC_Os06g14100 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAAGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGATAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCAGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCAAAGTGGGAGAAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCACGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTAAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTATGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGTCAACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCATGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCACACATATCTACGAACTATACCAGCTGGACGCCGTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGATGCAGCCATCAAGCTGGCTTTTGTTACTGCAGGGTAACACCTAGGTTTAGCACATTTATGTGCTACAATGACACCGTCATTAAAGGCAGTGATACTTTATCACTGCCGGTTCAATCTGTATCCCCAACCAAAACCGATGGTTCAAGCTATGAAACAACAGTGATCCGATCACCCGAAGGTGACGACGACAGTGCACTATTCAATAGCGGGAACGAGGGCATCAACTATGGCTGCTGCTTGACGACGGGGATAGCGGCGACAATGATGATGGCTGCTTGA >LOC_Os06g15190 ATGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCATTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGTGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTATTGGCGAAGAACAAGGGCACACGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGTTTCAATAGAGATCTATACCAGAAGTATATCCTGAAGGGGAAGACACCGAACTTCGACACATTTCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGTCAAGAAGAAGTACCATCACCACTTGGGGTTAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACCGCCAATTGGCTGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATACAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCGGACAGAGATAGGGACGAGCTGACACTCGCCTTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACATGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCCGGGTATCGAGCTACGAACTCAGAATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGTAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGATATCACTCAGCGGACACCATGTGAGCTTCATTTTCCTTACAAGAACTTATCAATAAAGGTGGCGTCGGGCACGGCCATCCCAACGGACCCTTCAGGTACTTACCACTTCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTTGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACACATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCTGGCTCTGCCATCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACATTTAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACACCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGGAAGACATGACGATAGAAGAATTTATTATTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTGAAATACATGTACAAACTCGGGAAACCGCTTGGGAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGATAG >LOC_Os06g14970 ATGACCCCCACAAGACGCGTGAAGCGTACAAGGATAAACTTAGAGATGAAGGGGCTGCGGATTTTGAAAGGCAAATTGATGGATTTCTGCGTCAAGCACATGCTTTTGCCTCCCCCCGAAATCAAAGAACCTGAGCCAGATTACCCCTTCGATGACCTCAAGAATGACATATCCTTTGGATTGGGCACCGACGCCACGCAAAAACCTGTGGTGCCAAAACCGGGGTTGGGAAAACCTTCGAGACCTCCTAAGAGGAAGGTGACTGATAAGGTGGAGGAACCCGAGATGCATAAGGAAAATCCTATGCCGAAAGTGCCACCGGAGATTGCAGTGCCGGAGGTGCCCGTGGAGATTGTAGTGCCGGATGTGCCCATGGAGATTACAGTGGCAGAACCAGAACTGCAACTTGTGGCATTAGTCGGGATAGAAATAGAAGAAGTACCAGGATTGGAATGGGACGGTACAGAGCCAGAAATATTGGAAGACGCTTCTCCGTCGAAAGACCCCGAGGTGCAAAAGACCACGATCCCTGAGAAGGCCACTACCAGTTCTGAGGTGCCTAGAGTGCTTAGGAGCCACGACTCCAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACCATCTTCAGTGGGGGACCATGGGAGATGAGAAGGTTACATACCTTCTACATGGAGGCCAGCAAGAAAGGCTTGGGCAATATAACAGCTCGATCGCCGGCAGATTGTTTCGGCATCGAAGGTTACGTATGGCTAGATTTCTCAGATCTCCACAGCATATATCGTCGGGATAAGATGGATGTCAACTTTGTCGGTGTTTGGTGCATGATGCAATACATAGATGCTAAGAAGAAAAAAGAACCTATCGGCTTCTTAGATCCAACTCGGATCTGTAAAACACAGCATACCGTGAGGCTAGCACCAGGGTCAGACGAGCTGAAGGGCAAGACTCCAAAAGAGATAGCTGAATACAAGAAGGGCTTGCACAAAGAGAAATTGATTACCGTCGCATATACATACCAATACTACAAGTTCAAGGGTGGAGAACAGACCCGAACAAGGGAGAAGCTGCTATTGCCAAGATTAGAACGTCAAACAAGCTTTGACGATACATGCATCACAAATGTCCAGCGTGATCTGTGCCACTTCATCTACCATGAGTGTTGTCATGTGAAAGGAGATTTCTTTGACCCAGAGGGTGCCCTAGCGACAAGTGACGAATTCAAGGATCTTCGGGAGTGGAACACTGCTATGCCATAA >LOC_Os06g21000 ATGGCTGATCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGCACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACATGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGTGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCATTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAAAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACACGGAGATCATGAGAGCTTTGTCCTAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATCCTGAAGGGGCAGACACCGAACTTCCACACATTCCTAAAGTTAAGGGATCACTGGGACAAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAAGTGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCAACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGCCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACATTCCGACCGGACAGAGATAGGGACGAGCTGACACTTGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACATGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGACGAAGATTGCAGATCTAGAGTTCCGGGTATCGAGCTACGAGCTCGGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAATGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGCCGATTCCAGCAAGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTATGAGGACCTCGAGCTGGATTACCCTGAAGGAGACGGATCCTGCACTGTCTCCTCCTCATGCTCCGCTAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGATGCCGCCAAGAACAAGGACCCGGGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGCAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGAACGGTGAAGACATGACGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGAACCAATAGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTATACATAGAGATGAGCACCACCGGTAGAGAGATGATTGGAGCGAGGATCAGGGACCCAGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACGAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTTGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTTCAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCATCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATTGGTTCCGTCATTTGGTCCACGGCAACTGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTACGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGATCCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os06g16080 ATGTCGAACGATAAGGTTCCATCGAACGCACCAATAACGCCTCAAGAAGGTAACGCTCATCAAAAATCCGGTAGCAACAAGCAGCCTGACGCTTCTAGTGAAGAAACATGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGTCCCTCGCGATGATGATCCGGACTACATACCTATGGAACAGGCCGATAGGAAGCCCGTCGAGCCACTGATAGTGCGGTCCAAGTTTAGCAACACCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTATGGGAAACGGTGGACGACAACATCAAGACACTTCTTTGGAATGAGTTGCAGAAGTATTTTGTGTACCCTCCTGGATCAGAGGTCAGGAGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTCACGGAATATGGACATATATCGGAGGCTGACTGGGATACGTTTGTTAAAGATCATACAACAGATGAAGCATTGGCTTTGAGTAAAAAAATGTCAGACCTCGCGAAGAAGAACAAATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGGCACGTAAATCAGTGGCGGGAGACCGAGCAAAGATTTGCAGCGGCCGGCAAACCTCTGTTGGTAGACCCCATGGCGGAACGTAGCAAGAACTCTGTTTTGGCGCGTAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCTAGACATAGAACAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGAGCAGGACAGTTCGTCCCACGGAGGGAGCGAGACCAGCTTACAGCGACGTTGGGGACCGCCGAACACTCTGAACGTGTAAGGGGTTTGTCCTCAAAGACGAGTTGGAAGATAGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCAGACAAAATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTAAAAACCCGACAGCCTTTCCAAGTCTCGTCGTACCTATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCAGACATCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACATTTCCTTGGAACTAGACATACCTGCACCTAAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGACCGCGGCCGTTCCAGCAGTAGGATCTTCAACTCCATCCTCATCGCAAGCAAGGACAGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGAGATCCGGCATCACCACCATCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCTACAGCCTGCTTTTCCGGCTCCGCAACCAGTTCAAGCCTCTCCCACGTCCCCAGCTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAGCCTCTCCACCTACACCCCAATCTGCTCTAGTAGAACAAGTGCACATACCAGAAGGTACTACATCTGAACCGAAGTCTAATCCTTTCGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTTAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCATGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGGTGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAATAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATCAAGGCATCTAGGAAGGGTCTCGGTTTCATAAGCGTCGCCGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCGAGACCTTTATGCCCTCTACAAGCTAGATAAAATGGACGTTAATCACGTTGCGGCGTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACATCGATCCAACAAGAATATGCAAAACACAACACATCGTAGAGCTGAGAGAGGACTGCGAGCAATTGGTTGGCAAGACCCCTCAAGAGAAGGGAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTAGCAATAGCAATGTTGGCGCACGCTGACGAAGATGTCTTAATGGTCCCATACGCGTTCACAGACCACTACATATTATTCCTTGTATATCCAAAAGATCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTGTCGATCCCTAGTCTTCTAACTACTGAAAAAACAATTGTTTTCTTCAAACAGAGCACACAAGTACTACCGCAAAAGAGGCAGACCAGTACATATTCCATCCTAGAAGCAGTTATCTGCCAGGACTGGCTGGCTGTGCTACAAACAACCACCGGGAACCAACTTGTGCGGTTATTACGTGTGCGAGATGCTCAGAGTAAACGGGAGATCCCTGAAATCCCATATATTGTACAATGA >LOC_Os06g19090 ATGGCTAGCCGTCATCGATCGAAACGAAATGCCATCAGGGCTGAACGTGAGTCGGACACAGCGACCTCGGGACCACAGCCAATGGACACGACGACGAGTAGGGGAGCATGTCCAAAGAAAAAACGTGGCGAGAGGAGCAAGAACTTGATGCCGAAGGAGACGTACTACATTGCTGCTCTCAACAATGACGGCAAACTCGTCGAGCCGCAAAATGTGAGGGCGAAGTTTAGCACCGCATGCGGCACGCTGGCAAGACTTCATGCTCCTCTCAACGTGGACGACTGGAAAAATGTTAGCATACACATCAAGAACTTAATGTGGGAAGTCGAGTGGGACAAGTTCGTGGCCAAGATGACAACGCCTAAAGCTCTAGAAAAGAGGAAGAAGATGTCGGACCTGGCGAAGAAGAACATATATCAACATAGGTTAGGGTCAAGTGGATACGCCTGTCACGAGAAGAAATGGCGAGCTACGGAGGAAAAGTTTGCGGCTGAAGGCAAACCTTTGATTGTGCAGCCCCTAAATAAGCGAACTAGAAATTGGCCGTCTCCTGCTCCACAGTCGTATCTTGCTCCACCCCTTGACGAACATGTGCCACCTCCTAAGCCAGATACATCCAAGGAGCAGCCAACTACCTGTGAAGCCTGCAAGCTCATACCTGTTATGGTTTCCACGTACAACAAGGAGAAAATGGTAGAGTATGAGATGCGGATGGTTTTGCAGTCTTTCAACGGTCGAGGGGGTCCGCTAAAGCCAGTTGGACCTGATCAGTATTCGGACGCACAGAAGAGCGTTGTAGCTCTTGCTAACAAAATGCAATCTTGGACCTCCGATGAAGTGCCAAAGGAGTATGAATATGGCAAGCCGTTCTTGCCGTACAACTTTATGTGTGAACTCCCATGGCCAATGAGGTTGATGCATGACTGGTACTTGAGAGCAAGTGAGTTAGATCTCGGGATGATTACTGTGCATGTCCCGGAAGGCACTTTCAAGGATGGACCTAACGCACACTTCGCCATCAGTTTCAATGACCTCCACGCATTCTTTAAGATGGATAAAATGGATATCAATCTCGTCGGCACGTGGTGCCTGTCACAATGGGTAGACGCTCAAAGAACGGAGGCCTCAATCGGTTACGTAAATCCAACGATGGTTTGCGAGACGGCCCACACTGTGCGGATATCGGAGGATAGTGCGGTACTAAAGAATAAGACACATCAGGAGAAAAAAGATTACATCGAGCGTCTGCATAAGAGAAAGATGGCCGAGGTGGGAAATTACTTGGCCACCTCATTTCGCGCGCACTCCGACAAACGAGTCATCATGATCCCCTACCACTTTGGCGACCACTACATACTATTCCTCGTCTATCCAACGGACCAAACCGTCGTAGTTCTTGATCCAGCAGACTATGACAAGGACGCGTACATGGAGTTCCTATGCTTCCTGAACTTAGCACACGGCCGTTATAAGAAACGTGGCGGGTACGTAAAGAATCCAAGTAGAGAGAAACTATACGTAAGGGGACGCTGGCCGTGTTATAAGCAACCTAGCTTGACGAACCTATGTGATTATTGCGTGTGCGAGATGCCCAGGGTCAGTGGGAGATACGAAACTGAGTTTACAGATCTCCCGAGCATCACTTATAACGCAAGCCGGTTCGATCAGAAAACGCTTATCAACTTGTGCACGGACTTGCGCCGGTTCATTCATCGCGACATCTGCAATCATCTAGGAGAGTTCCACGATCCTCATAGCGAACTTGCTACGGACCCCAAATTCAAGAACCTAAGAGAGTGGGAGAGGGAACATGCTGTGGACTAA >LOC_Os06g50010 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGTGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACAGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTTGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCTAAGGTCGAAGTTGAGTTGGTCGAAGACGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAAAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCATCATTTGGTCCGCGGCAAAGGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACTGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAACCGTAG >LOC_Os06g40400 ATGGCTGATCGCGATGAGGAACAGATACTATACGATACAATCGTAGAGGGAAGCAGCCAGTACTGGAACGAAGGAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGGGAACGATGAGGAGGAGGCTAGTGGAAGTCATCCCTCTGCTGGACAGAAGAGGGCACGCGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTACGGAGAACATAATGAAACAGTGGACTCTGAAGAAAATGGCAAAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGATTAACACCGAGCTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGTGATGATGGCCAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCTGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTTGTCTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGTAGCCTCTTCTCAGGGAACATTCCGACCCGACAGAGAGAGATTCCGACCCGACAGAGAGAAGGATGAGCTGTCACTCGCCCTATAG >LOC_Os06g27900 ATGTACGCTGACCGGCGGTCCAAAGAGTTTATTGACGGCGTGCACTATTTTTTGAGAGTGGCCGAAGCTAACAGGCAAAGGGGTTTTATTTGTTGTCCATGCAATAAGTGTAAGAATCAGAAGGCTAGTGGAAGTCAACCCTCCGTTGGACAGAAGAGGGCATGCGGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGACCTAGTGCCCTGGCAGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATTACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGTTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAAAGGACAAAGTGAAAAGGAGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGCCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTTCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATACCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTAGTCTTCGGCGATCAGATACGAGAGGCTGCGCGTCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCGGACAGAGAGAGGGACGAGCTGTCACTCGCCCTACAGACTCCAGAGCATCCAGGACGAACACGAGGGAAATGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGCGCAAGAGAGATACCGAGGCGAAAATTGTAGATCTAGAGTTCAGGGTATCGAGCTACGAGTGCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAATGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCTGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGTTGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAATCCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCAAGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTGAGGATCTTACACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCGGGCTTCTACACTGACTCCTTCGCAAGCTTCTCTTCCGGCACCTTCAAAGTCAAGGGCCTCCCAAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCACCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGAGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCAGAAGTGAAATACATGTACAAACTCGATAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGATATGACATTCTCTGGATCAATTTCAAGGGAATCTATGAAATATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTTGACCAATATCCGCAAGCCACAGAGGACAATCTTGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTATGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATAGGTTCCGTCATTTGGTCCGCGTCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGTGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATGAATTTATCGTGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTATGACGGAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTATTACGTCGAAATCGTAG >LOC_Os06g11890 ATGGCTGACCGCAATGAGGAACAGATATTGTACGATACAATCGTGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCTGGCCGAAGCCGCAAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTATCAGTATGGTGTACTGGCGAAGAACAAGGGCACGTGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATACTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGAGCTGTACAAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCACGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATTGAACCGGCAACCGCCAATTGGCTGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGCAAGCCTCCTCTCAAGGCACGTTCCGACCGGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTACAGAGCATCCAGGACGAACACGAGGGAAAGGGGAGTCGGAGAGGAGTAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCCGGGTATCGAGCTACGAACTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCACACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTACAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGCTCTAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGAGCCCCCCAGCTCCACCGCCTGCCCACATAAGGGCAATGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTATGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCTAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCAAACGTTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGATCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACAGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGAGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTAAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACTACGTCGAAATCGTAG >LOC_Os06g25680 ATGCAAACCCAGGATGAAACCACCTGCCCCGTTGATGACATGACTCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGGACTTACCACTACAGGCCGATTCCAGCAGGATACTCCAAGGTCAAAGTTGAGTTTGTGGAAGCCACGTACGAGGACCTCGACTTGGACTACGCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATACTATGGCGCAAGCTCCTACACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTTCTGCACCGACTCCTCCTCAGGCTCCTACACCGACTCCTCCGCAAGCTCCTCGTCCGGCATTTTCCAAGTCAAGGGCAACGAAGGGCAACGAAGAAGGCGAAAGTTGACACCGCCAAAAACAAGGACCCAGGAATGGAGATTCAAACAGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGTAAAGTAAACGTCGAAATGATCACCAAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACATTCATACTATTGTCGTACAACATAGAATTCCACTGGGTCCTTTTACTCTTCGACTTGGAGGCCTGCGTAGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACCAGTGCGCAAAGCAAGCCCAGGGAACTAACTTGTGCAGCTACTTCGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCAACACAACAGAGCTTGATGTTATTCGCATGTGGGATAACCTCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCGAGGGTGAATTCTACTGCGACGGAAATACAATTCATAGGTCGTTTCTGAGATAA >LOC_Os06g42670 ATGTTGGATCCGCCCCTGGATGCAGTGAAGGATGATGGATGCACATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTACATGACTCAATGGATAAAAAAGAGTCTACGTTTGATAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGTGGCGGTTCAAGAACAACTCATGGGATTTATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAGCTTCTGAGATAGCGACTACTACTACGTCAAAATTGTAG >LOC_Os06g24160 ATGCCGCCGCCGGCACACCACGCCGCCGCCTTCACCGCCGCGCGCGCAACGCCGCCGCCGCCATGCCACGCCGCCACCTTCGCCGCCGCGCAACGCCGCCACCGCATGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCACCGCGCCAAGCGCTGGCCCGATGCCGCCACACCGCTGTTAACGAACACGTGAACGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACAAACACGTCAACAAAAGACGTGTTGTCGGAGTCGTCCCTCAAGCCGGAGTGGAAGAGCTAGCCCTAGAAGACATGTCTAGCAAAGGAAAGAAGGGCAAAGGGCCTGACGAGCCTAAGCGTCAAGTAGTTCTCTCAGGCAAAAGAAAAATCGTCGGAGTTGAGGACAAGACTGACGAGGATTACGATCAGTTGGATAGGCAACCCCCTTTCATGGTGATGATTGACCCTAGCATCCTCCTATCAAATGAAGACACCCCTTACTCACGCAGCGATCACAAGGAGGGAACAATAGTGAGGAGAAAAAACATAAATATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACAAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACACGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAATGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACATCACAGCGGTTGGGTTGTGCAGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAACAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGTTGTGGACCACAATGCTCAAGACATTCACCCTTCCTGCTGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGAGAGATCTGTACCAGAAGTATATCCCGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTTATTGAGCGGGGTATCGAACCGGCAACCGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAAACCAGTTGATGGCTCACTGGTCTTTGGCGATCAGATACGAGAGGCTGTGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCGAACAGAGATAGGGACGAGCTGACACTCACCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCCGGGTATCGAGCTACGAACTCAGAATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTACAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGTCCAAACCAGTCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGGAAGACATGACGATAGAAGAATTTATTATTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACCCGGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGGAATCTACGAAGTATACCAGCTGGATGCCCGCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACATGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCATCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAACTGGAGAGAAAGACTTAGGCGGAGGTTCAAATTTCCTAGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGTGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAAGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACTACGTCGAAATCGTAG >LOC_Os06g19870 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACAGCCCCGCAACGCCACGCCGCCGCCGCCGTTGCCACGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAATGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAATGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACAAGGGAACGAACGTGAATGAGAACAAGCGAACGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATAAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAAGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCAGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTTAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATTCTATGGCGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCATCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACACTTACATTGCATCAGAAGTCAAGAGACAATTCAAGTCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCTAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCATTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACTGCTTGTCAAGCCTGAGCTGCTACAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTATACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATTTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGTGGCTACTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCAGTGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTATCAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os06g42580 ATGCGGGAGGTGGTCCGGGGCGACGCCGGCGGCGGACCGGAGCTCGGCGGTGACGGCGGAGAGAGAGAGCGACGGCGCGAGCTCGATTCCGACGGGGAGAGAGGGCGGCGAGTGGCGGAAACGGTGGAGGGAGGCACGGGGAAGGTTTATATAGGGTTGGGAGGGGAAGAGAGCGGCCGGACGAGGGGGAAACGGGCGCGGAAGATCCGGCCGCCATTGATGGCGCCGGCGAGATTCCACTGGGTCTTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATCGATAAAGAAGAGTCGATGTTTGACAAGGTTTTTGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAATTTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTACCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCATAGGTCCTTAGCTTCTGAGATAACGACTACTACTACGTCGAAATCGTAG >LOC_Os06g17240 ATGTCGAACGAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTCCGGTAGCAATAAGCATCCAGGCGCTTCTAGTGAAGAAACGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCATCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTTAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCGTACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAAATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGAGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCATTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTCAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGACCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAACTAAACAGCATGCTCCCCCGGCTCCGCCCCCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAAGAAGTGCACATACCAGATGGTACTACATCCGAACCAAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCATAGAGCTGAGACAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAGGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os06g34500 ATGGAAGTGGACGAAGACGGCCGACCTAGTGCCCCGGTGGAAGCAGCCAAGAACTACGTACAACACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGTAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGATCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAGTTTTTGAGCTTCAAGGGAGATTTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAATTTCGATACATTCCCAAAGCTAATGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTCAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGAGGTCAGGCGGCTATAGCATCGCGATGTCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGACCACCGCTAAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGATCAACCCAGTTGATGGCTCCTTGGTCTTCAGCGATCAGATACGCGAGGCTGCGCGTCAACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCACGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATAAACGCATGGCCGCACATCGGTCCCACGATCCCCAGCCGACCATTCCTCTTGCAATGGTGAGCCCTTCAGGAAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGCTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGGTGAGACACATCTACGAGACACAAGCCACGCCATTATACTATGGCACAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCAGGCTCCTGCACCGTCTCCTCCTCAGGCTCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCACAAGCTCCTCGTCCGACACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACTCAAGAGGAGCTTGACGCTTATGTGGCATCAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCTAGAAAAGAAAATTCCTATGGACCCGAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTCAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGATGAGCGCCACCGGTAGAGAGATGATTGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGTATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGCCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAGTTAGTTTAA >LOC_Os06g21800 ATGAGGCTTTCATGGCTGAGGAAGGTAAATCCATACAATGCGTATAACTACTACAAGAAGTGTCACATGCAACTTAAAGTCGGTGTCCTCTGCATTTATTACACATGCGAATTCCTAAGGGTGAATGGGACGTACACGACCAACGCAGAGGATTTGCCTAGAATTGAACATCGGACAAGTTTTGATGATGAAGGCATTCAAAATTTGTAG >LOC_Os06g30570 ATGAACGTGAACGAGAACGAGCGAACAAACGTGAACGAGCCAACGAACGTGAATGAGAACGAGCGAACGAACATGAACGAGAACAAGGTGAATGAACGTGAACGAGAACGTTGTCGGACGAACGTGAACGAGCCAACGAACGTGAACGTGAAATGCAATTATACGCAGATGGCTGATCGCGATGAGGAACAGATATTGTACGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAACAAAGAAGAGGGGAACGAGGATCCAAACCAGTATTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAAATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCACGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGAGCTGTACAAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGATAGGTGAACAAGGGCAGGCGATGATGAAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGTGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCAGCCACCGCTAATTGGCCAGAACGATCGAAGTTCTGGTACTATGCTCACGGTGAAACGCTCAACCCAGCTGATGGCTCACTAGTCTTCGGCGATCAGATACGAGAGGCTGCGCGTCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCGGACAGAGAGAGGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGAGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCGGAAGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTTCAGGGTATCGAGCTATGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCAGTCCAATTATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAACTGCGCCTCAACGGGGCAAGTAGGATCACTGAGCATGGACGCCATGCAAACCCAGGACGAATCCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCATCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTAGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCACAGGCAGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACTGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTGCTCCTCAGGCTCCTGCACCGACTCCTCCTCGGTCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCTGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCACAGAAGGGCAACGAAGAAGGCGAAAATTGACGCTGCCAAGAACAAGGACCTGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAATCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGATTCGAGTGTCATGAACTTCTTCAAGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGGGCGAGCCGTTGGTGATCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACTGGTCTAACTATGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTAAGCTGCTGCAGTCCCTACCCACACAAATATACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTATGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTAG >LOC_Os06g24220 ATGGAAAAACACAATGAAGCACAACCCGCGGGTGACAAGTCCAATGAAACTGAACTTATCGGCTTGCAAGTAATCGCGGAAGAATTGTCGTCATCAAGCTCCGGTGAAGCAGGGAGTGACTCTTATCACTCACCGAGTGACCCTCATCCTTCTCCTCCAAGAAAGAATAAGGGCGGTGGTGAGGACGACGAGGTTGACTCGGATTACATTCCCCCTGAGCCGGTGATACAATTACAGAAGAATGCTCCACGCCGCTCAAAAAGGAAAGCGCAAGCCGCACCTATAGAAAGGGAACCAACTGTGGAAGCCGCATCTGCCGTGCGCCCAACAGCTTCTCGTAAACCCAAAAAAAGAAGAGGCGAGCGAGGCAAAAACGTGCTGTCAAAAGAAGTCCACGCCCTTACGCGGATCGGTGAGAAAGGGGAACCCCTATCGCCTGAAGATGTATGTTCCAAGTATAGCAACCAATGTGGGGCAATAGTAAGGGATAACGTGGAGATCACATTTAAAGATTGGAAGAAAGTTAACCCAGCTAAAAAGAACACGTGTTGGACGGAGCTGAAAAGTAAGTTTTCTTTTCCAGAAGGGACAGACGAAGAAGCAGCGAAGGATTTCGCGCTAAAGACTATGGGCAAGTTATGGCGAAACTGGAAAACGGATCTGAACACGAAATATGTTCAAAAGGATCGCCAACCTTTTAATGACTATGGAAAGATAACAAAGGCCTAG >LOC_Os06g33030 ATGGCTGATCGCGATGAGGAACATATACTATACGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAATGATGCGGAGGAGGCTAGTGGAAGTCAGCCCTCTGCTGGACAGAAGAGGGCACGCGAACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGAAGACGGCCGACCTAGTGCACCGGCAGAAGCAGCCAAGAATTTTGTACGCCACAGCGGTTGGGTTGTGAGGGACAATGTGCCTGTCAGCACGGTGTACTGGCGCAGAACAAGGGCACGCGGGGATGATGACAGCTTTGTCCCGGACTCAGAGAAAGAGATGTTGTGGACCACAATGCTCGAGACGTTCACGCTACCCGCGGGTACGGATAACTTAGTGAAACAGTGGACTCTGAAGAAAATGGCGGAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGACTAACACCGAACTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCATTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGCCAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCGAAGCCGAAGTGGAAGGAGATGGAGGCTAGCTTGCTTGAGAGGGTGGTAGCCTCTTCTCAGGGCACATTCCGACCTGACAGAGAGAAGGATGAGCTGTCACTCGCCCTACAGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATTGGATTTAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCGTACATCGGTCCCAGGATCCCCAGCCGTACATTCATCCTGCAATGGTCAGCCCATTAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTCGGATCACAGAGCATGGACACCATGCAAACCCAGGACGAAACCTCCTGCCCCGTTGATGAGATCACGCAGCGGATACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTGGCGTCGGAAATGGCCGTCCCAACGGACCCTTCCGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCTTGTACGAGGACCTCGAGTTGGACTACCCAGGAGGGGACGATGAGACGCATCTACGAGACACAAGCCACGCCATCATACTATGGCGCAAGCGGTACATCATCCTTCCTGGGCGACAAGCGGCATTTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTGCACCATCTCCTCCGCCACCTCCTGCTGCACCATCTCCTTCGGCTCCTCCGCCACCTCCTGCTGCACCATCTCCTCCGTCTCCTCCGCCTCCTCCGGCTCCACCGTGTCCGTCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCGCCTGCCCGCACAAGGGCAAGGAAGAAGGCGAAAGTTGACACCACCAAAAACAAGGAGCCACCATACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAGGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAAATTCTTCAAGGGAATGTCCAAAACAAACAAGGAGGCGTTACAGATATCGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTTCCTCAGCTTGGAGAACAACCAAACAAAGAGGTCGAGCCGTTGGTGACCGGCGAAGATTTTGGCATAACGGATTTCATTGCAGACACCGGTCTATCTGTGGATCAGTTGGTTGGAGCCGCACTAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAAACCTGAACAGCTGGAGTCCCAACCGACACAGATGTACAAATTCCACGAACGGTACATGGAAATGAGCGCCAACGGTAGAGAGATGTTCGGGGCGAGGATCAGAAACCCTGACTTCTTGCAAGGAGACGATGTTCTCTGGATCCATTTCAAGGATCTCTTCGATCTGTACCAGTTGGATGCCCTCGACGTCTCTCTCCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTCTACAATACTGGGTTCATCGACCCTCAGAAAATCAACTCCGAAATGATCAACAAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCAAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCATGTGGAAAGCAGGAACAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCCCACTGCCTATCAAACCAAATATGCACAACACGAGAGCTTGATCGTATTCACATGAGGGATAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGATTCATCAACGAAGAAGTCCTTAATCCCGACGGTGAATTCTACTACGACGGATCAACAATTCATAACGTCGGTCCTTCCTCTTCTGACATAACGCCGGCGTCGAAGTCGAAGTCGTAG >LOC_Os06g15180 ATGGCGGTTGGCGTTGGCCGGCGAGAGGTAGGAGGAGGAGCTGACGGATTTCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCACGGCAATTGGAGAGAAAGACTTAGGCGGAGGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGAGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTTGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGTGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTATGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTGCTACGTCGAAATCGTAG >LOC_Os06g33160 ATGCCGCCGCCGGCACGCCACGCCGCCGCCTTCGCCGCCGCGCAACGCCGCCGCCGCATGCCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACATTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGACATACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGAAGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGTTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGTTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCTATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCCCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCTGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCATCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCATTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCATCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAATTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACTTGACCACACACAAGGAATTTATCGCAACGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGACTACTACTACGTTGAAATCGTAG >LOC_Os06g15340 ATGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGAGAACGTGGAGAGGGATGTAGAGGGGAACGAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGCTGGACAGAAGAGGGCATGCGGACAACGAGGTGCCGCGAAGAAGCTAGAGGGTCGGCACATCATAACGGAAGTGGACGAAGATGGCCGACCTAGTGCCCCGGCAGAAGCAGCCAAGAACTACGTACAACACAACGGTTGGTTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTATTGGCGTAGAACAAGGGCACACGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGTTGTGGACCACAATGCTTGAGACATTCACCCTTCCCGCGGGTCAACAAGGGCAGGCGATGATGGAAAGAAACAATGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAATGCTCAACCCAGTTGATGGCTCCCTGGTCTTCAGCGATCAGATACACGAGGCTGCGCGTCGACTAACGGACGCAGTGGAAGCCTCTTCTCAAGGCACGTTCCAACCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGAGTCGGATAAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGTACATTCCTCCTGCAATGGTGGCGTCAGGCATGGCCATCCCAACGGACCCTTCAGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAATTGAGTTGGTGGAAGGCGCGTACGAGGACCTCGAGTTGGACTACCCTGGAGGAGACGCACCGTCTCCACCTCAGGCTTTTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTACACCGACTCCTCCGCAAGCTCCTCGTCCAGCACCTTCCAAGTCAAGGGCCTCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCTGCAAAAAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTATGTGGCATCAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCGAGAAAAGAAGATTCCTATAGACCCGAGTGCTAGGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCAGACTATGAGCGAACACTTAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCAGTGAAGATTTTGGAATACAAGAATTTATTAATGACACCGGGCTAACTACAGATCAATTGCTACGAGGCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGTTGCAGTCCCTATCCACACAAATGTACAAATTCCATCAACTGTACATGGAGATGAGTGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCGAGGAGAAGATATTCTCTGGATCAATTTTAAGGGTATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGGTTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTAAAGGCGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACCGAGTTAGTTTTTACTGTCTTCCTATACCAAATTTCATTCTCGTATGAACATGCTAAGTGTTTCATATGTAATGCATCCGATGCACATTGCAAATTCCACTGGGTCCTTTTACTCTTCGACTTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTTGAACTTATAGATAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAATTGGAGAGAAAGACTTAGGCGGAAGTTTAATTTTCCTTTTATTCGTATAAGGGATAATCTCACACACAAGGAATTTATCGCGGTGGTTCAAGAACAACTTATGGGATTCATCAACGAACAAATCCTTGATCCCAACGGTGAATTCTACTACGACGGAAATACAATTCATATGTTCTTAGCTTCTGAGATAATGACTACTACTACGTCGAAATCGTAG >LOC_Os06g16900 ATGGTTGGCCTGGGTTGGCTTAGGACGAGCTGGGACCCAGGGTCGGGTTGCCAGTTCGGTCTGAATCATCATAGGCCTTGGGTTAAGGCAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGTTCAGATACGAGAGGCTGCGCAACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCCGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCGCAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGATCCTGCACCGACTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCGTCCTCAGGATCCTGCACCGTCTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAGGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCAAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCTATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGCCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCACACATATCTACGAACTATACCAGCTGGACGCCGTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCACAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCCCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTTCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os06g10380 ATGGAGTTGGGTCGGCCGGGGTGTCCGGTTGATCGGCTTCCGGATTCACTGCGGCACGAAAGGGGGGCTGCCCGTTGCCTGCTGGGGACGGGGGCGAACCCTAAGGTGTGGTGCGATCGGTTAGAGGGGATTATGCGAAGGGTCCTGTCACGGCCTCTTTCCGCTTTATGCAAAAGAACCTTTAGCCTCCCTTGGATATACCCTGCATCATACCTCCTCTTCCGCTTAGAAATCCTGGTTCATGAATTTCTGAGCGTGACATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCGGGCTCCTGCACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGATGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCAAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAACCGTTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTTAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGACATGAGCGCCACCGGTAGAGAGATAATCGGAGCGAGGATCAGGGACACGGACTTCTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAATGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGATGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATAAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGATGAATTCTACTACGACGAAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTTGAAATCGTAG >LOC_Os07g17510 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGTGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGGAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGTTGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACAATCAAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATTATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCCCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTTCGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCTAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCAGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACTGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAAGGACACTGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTACTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGTGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os07g03440 ATGGCTGATCGCGATGAGGAACAGATACTATACGAAACAATCGCAGAGGGAAGCAGCCAGTATTGGAACGAGGAGGGTAACGTGGAGAGGGATGCAGAGGGGAACGATGCGGAGGAGGCTAATGGAAGTCAACCCTCTGCTGGACAGAAGAGGGCACGCGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGAAGACGGCCGACCTAGTGCCCCGGCAGAAGCAGCCAGGAATTTTGTACGCCACAGCGGTTGGGTTGTGAGGGACAACGTGCCTGTCAGCACGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGACTAACACCGAACTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGAGATGATGGCCAGAAACAAGGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCGAAGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGGGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTTGTCTTCAGCGATCAGATATGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGTGGCCTCTTCTCAGGGCACATTCCGACCCGACAGAGAGAAGGATGAGCTGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATTGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCGCACATCGGTCCCAGGATCCCCAGCCGTACATTCATCCTGTAATGGTCAGCACATCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGAATGGCCATCCCAACGGACCCTTCCGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGGGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATCATACTATGGCGCAAGCGGGAGGTGAAGAGGCAACTCAAGCCTCGGAGTACTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCAAAACAAACAAGGAGGCGTTACAGATATCGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCGAAGATTTTGGCATAACGGATTTCATTGCAGACACTAGTCTATCTGTGGATCAGTTGGTTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAAACCTGAACAGCTGGAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCTCCAACAGTAGAGAGATGTTCGGGGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGACGGGGTTACTAATCGGGACTCCAAACGGTTTCTCCACCAATCCCGAGCTCACAACTGCATTACAAAAGGAAAACGGAAGCCAGGACTTGGACCAATCAACACAGGCACGACTTGGGAACTAGGCCGAAACCCTAAAACTCATCGTAGCCGACTTGCTCCTGGAAGAACTCCTCGTCAGCAGGATCCACTTCATCTTCTTCAGCAACTGGGGGGAGATTATTTATATAGAGCAAGGCCCGTGGGGATCAGCCACGTCGGGAGACCTCCAAGCTTTCATGACAAGGCATTTCGAAAGCCGACACAGGTTTACCATATGCCGACGAGAGGGGTCCCAGACCAACAACAGGTTAGGTCCCAGACCATACTGTGCCAGGAAGCCCAGGGGTCCTCTCCGACACCACCCCGGCGAATCCACATGTCTCTCGACATCAAGGCTCCCCCGATTAGCAATTTACTCAGCCAGGGGCGTCCCATTCCACCCATGTGGTCGTACTTGTCTTATGTTCGGATGAAATTTCCAAGGAAACGGTCCTTAAGTGCAAGAGCGGGAAACCGTACACCCGGCTCAAGATGTTCAAAGGTGGCTTGCCTTGCTCGAGATCTGGAGCTTGATCCTCGAAATCCTCGCACTGCGGGTCTTCGGGCTCCGGAACTACACGCGAAACGGAACAACTCAACAAACGGCGAAAATTAA >LOC_Os07g13080 ATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCCCTAGTCTTCGGCGATCAGATACGCGAGGCTGCGCGTCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCGGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTGCATTATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCGGATAAGAAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAATCCACCTGCCCCGTTGATGACATCACTCAGCAGACACCATGTGAGCTGTATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACAGACCTTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAACTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCAAGCTGGATTACCCTAGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATTCTATGGCGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCGCAAGTTCCTCTTCCGGCACCTTCCAAGTCAAGGGCCTCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCTAGTAAAGAAGATTCCTTTAGACCCGAGTGTCAGGAACTTCTTCAGGGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCTGTTGGTGACCGGTGAAGATTTTGGAATACAAGAATTTATTAATGACACCGGGCTAACTACGGATCAATTGCTAGGAGACGCACCAATCGAAAAGGCGGAAGTGAAATACATCTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGATTGTAGATTCCACTGGGTGCTTTTACACTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGATAAGGTTTTCGAACTTATAGACAGAGCTTGGTATCGGTTCCGTCATTTAGTCCGCGGCAACTGGAGAGAAAGACTTAGGCGGAAGTTTAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGTGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTAATCCCAAGGGTGAATTCTACTAG >LOC_Os07g11430 ATGAACGAGAACGTGAACGAACGAACGAACGTGAACGAACATGAAGATTTTGGAATACAAGAATTTATTAATGACACCGGGCTAACTACGGATCAATTGCTACGAGGTGCACCAATCAAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAACTGTACATGGAGATGAGCGCCACCGGTACAGAAATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGTATCTACGAACTATACCAGCTGGATGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGGCGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCTTGAAGGCGCAGCATTACAAGACGTTCATACTATTACCGTACAACACAGAATTCCACTGGGTCTTTTTACTCTTCAACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTATGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGATTCCGTCATTTGGTCCGCAGTAAATGGAGAGAAAGACTTAGGCGGAAGTTCAATTTTCCTTGCACAAAGCAAAAGCAGGGAACTAACTTGTGCAGCTGCTACGTGTGCGAGTATTGCCACTGCCTTGTAGACCAAATCATCACCGCAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGTGGTTCAAGAACAACTCATGGGATTTATCAATGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACAGAAATACAATTCATAGGTCCTTAGCTTCTGAGATAACGACTACTACTACGTCGAAATCGTAG >LOC_Os07g29990 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTGTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCACCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACAGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAACTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCTATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACAATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCATACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGAGATAATCGATGCCGAATCCTTCCGCGTTCACTCGGACGACACCTTGTTTCCATTGAAGGCAAGGTGTTTGAGGACGGCGTGGCTGAGGAGGTCGGCAATGGACTCCATCACGGTGGCCGCAACGAGAACGAGGCCCGCGATTTAGACGAGTATATCATGGCAACAAAGCACATGACATGTCTCTGTGAAAGACGTGGCCACGTTGGTGTTTGTCACGTTCGACTCGCCCACATGCAATGTGACCGCGGCCTGGGCAAGCGCATTCTCGGCCGCTTCGTCCTTGTCCTTGAAGGAGGTAGCCATGGAGATAGCCCCGTGTTGGCTCATGGAACAAGGTTGAAGAAGAAGAAAAAGAAGAAGAAGAAGAAGAAGAAGTGGTTGCTGAGCGAGCGATGGGAACTTACGGTTGTGAAACCTTGTGGTTCTATTGTTGATGGATGTAAATGA >LOC_Os07g28030 ATGGTCGCCGGCGGTGGCCATAGGCACGGCGGAGCGGCGGCCGAGAGAGGGGAGGGAAAGGGGGAAACGAAGCGGCTGTCCACGGCTCACCCCGGGTCGACGGCGACGACGGAAACGGCGACCGGAGCGGAGGAAGGCGGCGGCGCGGCTCGGGTGGACGGGGTCGACGGTGCTCCGGCGGTCGGCGACCGAAACGGAGAGGTGGACGAGGTCGGCGAGGATGCGGCTAAGCCGAAGGAGGCGGCGCCGAGGTGGGAGGTGGTCGGGGCGACGACGGCGGCGGACCGGAGCTCGGCGGCGACGGCGGAGAGAGAGAGCGACGGCGCGAGCTCGATTCCGGCGGGGAGAGAGGGCGCTCATTTGATATCCATTGTTGGCAGGATGAATTACGTGGAAGCCGAAGCGATGAAAAAGCCTGTCGCCTACCTAAACCCGTGCAGGATAAGTAAGCCGAACCACACATACACGGTAGACGGGAAGAAGCTACCGGAACACATCAAGGCGATGACTCCCGAAGAGAGGAAAGCTTACGTAGCACAAAGGCATCATGAAAAGGTGCTCGATGTCGCTACGTACGTAGCTATTGCGCTTGAATCTACGCAGGACAAGGAGTGTGTTTATGCCCCATGTGCCTTTGACGACCATTGGATAGTCTTTCTTCTCTATCCAAAGTACAATGAAGTCATCATCTTGGATTCCCTCGACAATGATAGCAACACCTATCAGGAATTTCTAAGAATTCTTGATCTTGCTTTTAAAAGGTATTACCAGCGAGGCGGACAACGCAAAAACTCAAGAGAACGCATATTCGTCCGCAATAAGTGGCCGTGTCACAAGCAACCGGTGGGAACAGTATTATGCGGATATTACTGCTGTGAGTTCCTAAGGGTTAATGGGAAATATTGTGCGAATTACAACGAGCTTCCAAAATTCCCCAAGTCTGAAAGACAGCTCGATGATACTTCCATTCAGAACATTCAGGCAGACATGTGCTACTTCATCCACCTTGAGTGCGCACATCAGCTTAGGCGATTTTTCGACAATGAAGGAGTCTTAGCCCTGCCGGAGAATGAATCCCTGTCTAACTGGACCAGGCGTATAATATAG >LOC_Os07g11850 ATGGAGTGCCAGACTGAGAAGCGGCGAGAAGTCCGTGGGGGTCGCTGGGGAGTCCATGCCTCTGGTTGTAGAGGGGGTGATTATGATCCAGGTATGGTGCACTGTGGTGAGTTGTGTTGTGCAAGGGGTATTGTCACAGTTCCTTTCCGAGGTATCGTGGTGGTACTAAGGCGCATGAATGGAGATTCAAAGGGCCGACGGTGGAGGGTCTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACATAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTACATACTACTGCCGTACAACACAGAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCAAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGATAGAAAAACTTGGACGGAGGTTTCATTTTCTATATGCAAAGCAGGACCAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCCCACTACCTATCAAACCAAATATGCACAACACGAGAGCTCAATTGTATTCACATGAGGGATAATCTCCTACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGATTCATCAACGAAGAAGTCTTTATTCCCGATGGTGAATTCTACTACGACGGATCGACAATTCATAACGTCGATCCTTCCTCTTCTGACATAATGTCGACGTCGATGTCGTAG >LOC_Os07g31900 ATGCCGCGCGCGGTGCCACGCCGCCGCCGCGCCGCCCCGCCGCCGCTCTGCTGCCGCCACACCGAGAACGTGAACGAGCGAACGAACTTGAACGAGAACAAGATGGCTGATCGTGATGAGGAAAAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTATTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGAGAACCAGGAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCCAAGAAGAAGCTTGAGGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAAAGCTTTGTCCCAGATTCGAAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAAAATATATCCTGAAGGGGAAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCTGGAACGATCGAAGTTCTTGTACTATGCTCATGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGTGATCAGATACGAGAGGCTGCGCGTCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCGGACAGAGAGAGGGACGAGCTGTCACTCGCCCTGCAGACTCTAGAGCATCCAGGACGAACACAAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGCGCAAGAGAGATACCAAGGCGAAAATTGCAGATCTAGAGTTCAGGGTATCGAGCTACGAGCGCAGCATGCAAAAGGAGGTGACAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGGCGTCGGGCATGGCCATCCCAATGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCAGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACTGTCTCCTCCTCATGCTCTAGCACCGTCTCTACCTCAGGCTCCTGCACCGACTCCTCCTCAGACTCCTGCACTGACTCCTCCTCGGGCTCCTACACCGACTCCTCCACAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCACACAAGGGCAATGAAGAAGGCGAAAGTTGACACCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGTTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCAAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTAGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACAATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGTCACCGGTAGAGAAATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTAGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATAGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATTGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCTGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGTGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGTTTATTCGCATGAGAGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os07g28600 ATGGCCGATAGTACTAAAGGGATCGAAGAGAAGGGTTTAGGGGAGCAAGAGCAGTCCCTTGCTGTTGTGGTTGCTCCGGAACCAATGGTCCCACCGGAAGATAGTTCCGACAGCGACGTAGCTGACGAAGACGATGAGTACTCGTCGCCAAATGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAATGGGCGACTGTGCAGAAGGCGATAAGGACTACATTCCCCCTAAAGAAGGGGAAACGGCACCACGGCAATCAAAACGGCAGCCGAAGAAAAAAGTTCCGTCGAAAGACGACGAGGCACCAACTAACACAACCGGCTCAAACAAAAGCGAACGGTCAGCAAAGGCGAAGAAAAGGAAGGGCGAGAGAAGCGTGAATAAAAAGGATGAAGGGTTCCATGTTGTTACCCATGTTTCGCCAAAAGGAGAGCCGCTCGCCCCTAAGACGGCACGTGCGAAATTCAGTTCACAGTGTGGCATAATAGTAAGGGAAAAGATCCCCATCACGGTCAAGGACTGGGATCATGTATCGAACGGGGATAAGGAAGTCCTATGGAAAGAGTTGAAGAAAATCTTCCAGTTCCCGGATGGATCAGAGGCAGCAGTGAGGAATTGTGCACTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAACCACTTTGAACAAGAAATTTGTAAAGACGGGACGTACACCGTTTTTGACGTATGCCAACATAACCCCGAATCAGTGGGACGACTTTCTGACGTTGAAAAACTCCCCGGAAGAAATTCAAAGGAGCCAAAAGTATTCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCCGCGGGATACGCACCAAAGGTGGAGCAGTGGACAAAAGATGAGGAGGAAATGAGGAAGATGGGGCAACCGGTACCAATGGAAGAATGGACACATAGATCAAGGAACTGGAAAGGATTTTTCAAGCCTAAGAGGGAGAAAGATGTGCTAAGTACGGCGCTGGGTACTCCTGAGCATGGGGGTAGGGTTCGAGGTGTGTCGAGCAAGATGAGTTGGAAGGAAGGGTTCAAACATGACCCCCACAAGAAGCGTGAAGCGTACAAGGATAAACTTAGAGACGAAGGGGTTGTGGATTTTGAAAGGCAAATAATGGATTTCTGCGTTAAGCAAATGATTTTGCCTCGCCCCGAAACCAAAGAACCTGAGCCAGATTACCCCTTTGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCCATTGGACGCTTCGGGAAAACTCTTGAGGCCGCTACAGCCATTGCTATCCTTGGGAGAACATATAATGAAGAGTTCATACCCGATGCGTACGCCAAAGTGCAGCCGCAAGTGGTCCACGAAGGGTTTGAGTCCTATGACATTGACTTCCCTACTGCAGATGGTGTATCCGTACTTGGGGATGTGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACCGACGCCACGCGAAAACCTGTAGTGCCAAAACCGGGGTTGGGAAAACCTCCGAGACCTCCTAAGAAGAAGGTGACTGATAAAGCGGAGGAACCCGAGATGCATAAGGAAAATCCAGTGCCGGAAGTGCCACCGGAGATTGAAGTGCCGGAGAACCAGAGGTGTGGCATCAGTCGAGACAGAAATAGAAGAAGTACCAGGATTGGAATGGAACGACCCCGAGGTGCAAGAGATCACGGTTCTGAGGTGCCTAGAGTGCTTAGGAGCCACGACTCCAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACCGTCTTCAAAGGGGATAAGGAACGTGCCAAGCTCAGAGATGATGACCCCCAGAAGGCCGCTGAACTAGCCGGGCCAACATACTTCACAACTCATGATTGCCCGGAAAAGTACGAACATGGGAAAGCACTCTTGCTTGAATGGGCACTGAACGAAGGACCATGGGAGATGAAAAGGATGCAATACATGGATGCTAAGAAGAAAAAAGAACCTATCGGCTTCTTGGATCTAACTCGGATTTGCCAAACACAGCATACTATGAGGCTAGCACCAGGGTCTGACCAGCTGAAGGGCAAGAATCCAAAAGAGATAGCTAAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCGCACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTTAATGATCATTATATCTGTTTACTCATCCACCCTGAAGACGGAACCGTGGTAGTCTTGGACCCTCTCGATTATAGTCACAAGCAATACAAAGAATTTCTAACAATCTTACAGTATGTGTACCAATACTACAAGTTCAAGGGTGGAGAACAGACCCGAACAAGGGAGAAGCTGCTATGTCACAAGCAACCGCGAGGAACGGTCCTTTGCGGGTTTTACGCGTGCGAATTCCTAAGGGTTAATGGGAGGTACAGGACTAACCCGGAGGATTTGCCAAGATTAGAACATCGAACAAGCTTTGACGATACAGGCATCAAAAATGTCCAGCGTGATCTGTGCCACTTCATCCACCATGAGTGCTGTCATGTGAAAGTAGATTTCTTCGACCCAGAGGGTGCCTTAGCCACAAGTAACGAATTCAAGGATCTTCGGGAGTGGAACAGTGCTATGCCATAA >LOC_Os07g25160 ATGGCGAGCGGCGATGACGCGGACGGGAGGCGGGAAACAACGGCGGTGACCGGCGCAAAGGCGGCGGTGGCATCAGGAATGGCCATCCCAACTGACCCTTCAGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGACGCTTACGAGGACCTCGAGTTGGACTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACTCAAGCCACGCCATTATACTATGGCGCAAGCGGTACATCATCCACCCTGGGCGACAAGCAGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCGCTACCTCCTCCTGCACCATCTCCTCTGGCTCCTCCGTCACCTCCTCCTGTACCATCTCCTCCGGCTCCTCCGGCTCCTCCGCCTCCTCCACCTCCACCATGTCCGCCTGCACCTCCCAAGACAAGGTCTCGTCAAGCTCCACCGCCTGCCCGCACAAGGGCAACGAAGAAGGCAAAAGTTGACGCCACCAAAAACAAGGAGCCGCTGTACAATTGCAGTCAAGAGGAGCTTGACGCTTATGTGGCAGCAAAAGTGAAGAGGCAATTCAAGCCTCGGAGTCTTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGAAAATGTCCACAACAAACAAGGAGGCCTTAAAGCTATCGGACTATGACCGAACACTTAAGAAAGCCTATTACAAGAAGTCCAAACCAGTTCCTCAGCTTGGAGAACAACCTAACCAAGAGTTGATTAGAGGCGCACCAATCCCGAAGACGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCACGCCTGAGCAGCTGCAGTCCCTACCGACACAGATGTACAAATTCCATGAATGGTACATGGAAATGAACGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATAAGAAACTCCGACTTCTTGCAAGGAGAAAATGTTCTCTGGATCCATTTCAAGGATGTCTTCGAACTATACCATCTGAACGCCCTGAACGTCTCTCTTCTGAGCGCATGGATTTTAATGAAGATTCAAAAGACCCGACGGCGGGGGGTTTGCGATACTGGGTTCATCGACCCTCAGAAAATCAACGTCGAAATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTGACGCAGCAGCATTTCAAGACGTTCATAGTACTGCCGTACAACACAGAGTGA >LOC_Os07g26070 ATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAACGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTATCAGAAATATATCATGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAATGGATCACTGGGACGAGTTCGTTGCATATAAGACAGCTGATGGCTCCCTAGTCTTCGGCGATCAGATACGCGAGGCTGCGCGTCGACTAACAGACGCATTGAAAGCCTCTTCTCAGGGCACGTTCCGACCGGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCTAGGACAAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACAACCACACGTACAGGAGTCGGATGAGGATTAAGAGAGATACCGAGGCAAAGATTGCAGATCTTGAGTTCAGGGTATCGAGCTACGAGCTCAGCTTGCAAGAGGAGGTGGCAAGGAAGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAAACCACCTACCCTGTTGATGACATCACTCAGCGGACACCATGTGAGCTGTATATTCCCTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTTAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTATGAGGACCTCGAGCTGGATTACCCTAGAGGAGACGGTGAGACGCATCTACATGACACAAGCCACGCCATTATTCTATGGCGCAAGTGGGCCCCCAAGGCTCCTCCGCCTACCCCTACAAGGGCAACGAAGAAGGCGAAAGTTGATGCCGCCAAGAATAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAGGAGACAATTCAAGCCTCGTAGTCTAGAAAAGAAGATTCCTATAGACCCGAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTCAAGAAAGCATCTTCTGGAAAGTCCAAACTAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGTTTTTGGAATACAAGACTTTATTAATGACATCGGGCTAACTACAGATCAATTGCTACGAGATGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTCTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTTGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCAACGGCGGGGGGTTTTTGATTCTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCTTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCAGAAGTTCAAATTTCCTTGTGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACATGTGCGAGTATTGCCACTGCCTTGCAGATCAAATCATCACCACAAGAGAGCTCGATGAATTTATCGCGGCGGTTCAAGAACAACTCATGAGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCATATGTCCTTAGCTTCTGAGATAGCGACTACTACTACGTCAAAATCGTAG >LOC_Os07g17140 ATGGCCCCGCAACGCCACGCCGCTGCCGCCGTCGCCACGCCGCCGCCGCGCCAACCACCGCCCCGATGCCACCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACAAAAGACGTGTTGTCGGAGTCGTCCGTCAAGCCTGAGTGGAAGAGCTAGCCCTAGAAGGAATTGGAGCAGGCAAATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGAGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGTGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTACCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCTGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGAAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCCTCATTTGGTCCGCGGCAAATGGACAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTAATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os07g11030 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGCCACGCCACGCCACCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCACAACGCCACGCCGCCGCCGCGCCAACCGCTGTCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAATGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGACAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAACGAGCTAGGGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCATCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCTCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAATAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGAAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTATGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGTGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGTGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAACGAGTACTACTACGTCGAAATCGTAG >LOC_Os07g18090 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACAAAAGACGTGTTATCGGAGTCGTCCGTCAAGCCTGAGTGGAAGAGCTAGCCCTAGAAGGAATTGGAGCAGGCAAATGGCTGACCGCGATGAGGAACAGATATTGTATGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGATGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAGTTTCAGAGCTTGAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGACGATGATGGAAAGAAACAAAGAAAATGCTGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGTGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTTAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCTAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATATACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCAACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGTATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os07g17950 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGAGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGTGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACTATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTTAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCTACAAGCAGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGAGCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTATTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTGCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGTCACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATATACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGTGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAATGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os07g29180 ATGGCACCGCGCCGCGCGCCGCACGCCGCCGCCGCGCCACGCCGATGCCGCGCCGCCCCGCCGCCGCTCCGATGCCGCCACACCGAGAACGTGAACGAGCGAACGAACAACGAGCGAACGAACGTGAACGAGCCAACGAACGTGAATGAGAACGAGCGAATGAACGTGAACGAGAACAAGGTGAATGAACGTGAACGAGAACGTTGTCGGACGAACGTGAACGAGCCAACGAACGTGAACGTGAAATGCAATTATAGGCAGATGGCTGATCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTATATGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAAATGGACGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGCTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGTTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAAAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAATACAGGTGAACAAGGGCAAGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCAAACCGGCCACCGCTAATTGGCCGGAACGATTGAAGTTCTGGTACTATGGTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGTGATCAGATACGAGAGGCTGCGCGTCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCGGACAGAGAGAGGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGCGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGCTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGTCTCAACGGGGCAGGTAGGATCACAGAGCATGGACACCATGCAAACCCAGGACGAATCCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGAGCATGGCCATCCCAACAGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGTGCGTACGAGGACCTTGAGCTGGATTACCCTAGAGGAGACAGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGCTACATCATCCTCCCTAGGCGACAAGCGGCGTCTCGTGCACCATCTCCTTCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTTATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACTCGGGGTATGATTGCACGCAAGAGGAGCTTGACGCTTACGTAGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAATGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGATGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGAACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTTAAGGGAATCTACGAACTATACCAGCTGGATGCCCTCGATGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGTGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTTGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGACCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTACGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTTATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os07g29080 ATGGCTGAGCTAGCAAGAAGGAATGAATATCCACATCATTTGGGATCGACCGGTTACCGGCAAGCGGTGAAGAAATGGGCAAAACAAGATGAAGAGATGGAGAAGGCTGGGAAACCGGTTCCTATGAAAAATTACAACCCACGAAGCAGGAACTGGAAGCTCCAGGAGGTAGCTGTCAATATGAAGAACATTGTCACGCAGCAACAGGCCGGGACGTTCGTGCCAGATAGAGACCGGGACGAGCTGACCTATGCCTTGGGAAAATCAGAGCAATCTGGCCGTGTATGGGGAGTTTCCTCAAAGACTAACTGGAAGGATGGATTCAAACAGGATGCTCATACCTACAAGAAGCGTGATCGCTACAAGGAAGAGATTGACTCTCAGGCTAGGGCAGCAGCTCATGATGAATGCAATATATACTGGAGTCAGAAAATGATGCACGGTGCTGCTGTTTTAGAGCCTGAGCCGAGCTATCCTTTTGATGATGTAACGGAGGATACTCCGTGCAAGCTCTTGATTCCGGTCGGCAGGGCGGGAAAGAAAATACTCGTTGCAACTGGGAGGTTCATACCAGGCCACAGGTTTCATTGCCAAGACATTCCGGATGACTACGCCAAGATTGTGTACCTTGGAAATGTCGTCGACCAATTCATACTATGGCACAAGAATGATATTGAACTAGGGTCAACGGATGGAACTGATCGTCCACCAAGGATACCGGTGTCACCGTCGCGTCCACCAGTCGTAGCCAGTCCGAGGGATAGTCCTATTGCTTCACCCCCTAGACCAGAGCCACCAGTTGCATCATCTCCAGGACCAGAGCCACCTGTTGCATCACCTCCAGGACCAGAGCCTCCTGTTGCATCACCTCGGACAGAAAAGGATGCAGAAGAACAATCGGTGCTTGCAAAGCAACAATCACAGCTAGCAATACGGGAAATGTCTTCCGCACAACCATCAGAGCCTGTACAAGCAAAGCCTACAAAGCTAGCGGCGGGTGAAATTGAAGCGGTGCTTGATCAGCCAATGCCCGATCAACCAGAGCAATCGCAACCAGAGCAATCGCAGCTAGAGGAATCTAAGGGTGCCGATGTGCCAGTGATGGTAAGGACGCACAAGCACAAAGCAAAAAGTGCGTCCAAGAAAATTAAAGGGTTCAAACAGACCTTCGATGACTATCTCAACTATATCAATTCCCCAGACGTGCCACACGAGTTTGAGAATGGCAAACCATTCATTTACGACTGGCAACTAAGAAGGTGGCACGATTGGTACATTAGGCTCATTTGGTCATCCATTGTTGGCAGGAGGAATTACCTGGAAGCTGAAGCGATGAAAAAGCCTGTCGCCTACCTAAACCCGTGCAGGATAAGTAAGCCGAACCACACATACACGCTAGACGAGAAGAAGCTACCGGAACACATCAAGTCTATGACTCCCGAAGAAAGGAAAGCTTACATAGCACAAAGGCATCATGAAAAGGTGCTCGATGTCACTACGTACGTAGCTATTGCGCTTGAATCTACGCAGGACAAGGAGTGTGTTTATGCCCCATATTCCTTTGACGACCATTGGATAGTCTTTCTTCTCTATCCAAAGTACAATGAAGTTATCGCCTTGGATTCTCTCGACAAAGATAGCAACACCTATCAGGAATTTCTAAGAATTATCGATCTGTATTACCAGCGAGGCGGACTATGCAAAACTCAAGAGAACGCATATCCATCCGCAATAAGTGGCCGTGTCACAAGCAACTGGTGGGAACAGTACTATGCGGATATTACTGTTCTTCCAAAATTCCTCAAGTCTGAAAGAGAGCTCAATGATACATCCATTCAGAACATTCAGGCGGACATGTGCTACTTCATCCACCGTGAGTGCGCACATCAGCTTGGGCAGTTTTTCAACAAGGAAGGAGTCTTAGCCCTGCCGGAGAACGAATCCCTGTCTAACTGGACCAGGCGTATAATATAG >LOC_Os07g34200 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGAGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACAAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTATTCGGCGTTCAGATACGAGAGGCTGCGCAACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCCGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCGCAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCATGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGACAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGTCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAAACAGGAGATCGAGCCGTTGGTTACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAATTCCATCAGCTGTACATGGAGATGAGCGCCGCCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCATTGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTAATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATGA >LOC_Os07g11340 ATGATTTTGCTTCGCCCCGAAACCAAAGAAACTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGGACGTTCCCATTGGACGCTCCGGTAAAACTCTTGAGGCCGCTACAGCCATTGCTATCCCTGGTAGAACATACAATGAACAGTTCTTACCCGATGCGTATGCCAAGGTGCAGCCACAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTACCCGACTGCAGATGGTATATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCATAAGAATGACATATTCTTTGGATTGGGCACCGACGCCGGGGAAAAACCTGTGTTGCCTAAACCGGGTTTGGGAAAACCTCCGAGGCCTCCTAAGAGGAAGGTGACTGATAAGGCGGATGATCCTGAACTTGGTAAGGAAAATCCAGTGCCGGAAGTGCCACCGGAGATTGCATTGCCGGAGACAGCCATGGAGACTGCACCGCCGGAGACAGCCATGGAGATTGCACCGCCGGAGACAGCCATGGAGATTCAAGTGCCGGATGTGCCCATAGAGATTACAGTGGCAGAACCAGAGGTGGAATTTGTGGCATCAGTCGGGTCAGTCAAAGATGAAGTACCAGGATTGGAATGGGATGGTACAGAGCCAGAGATATTTGAAGACCCTTCTCCTGCGAAAGAACCCGAGGTGCCACGAGTGATTAGGAGCCACGAATCCAAGTCCAAAGATGCGAACAAGGAGAAGTTCATGCTAACCGTCTTCAGAGGGGGTAAGGAACGTGCCAAGCTCAGAGATGACGACCCCCAGAAGGCTTCTGTGCTAGCCGGGCCAACATACTTCGCAACCGATGATTGCCCGGAAAAGTACGAACATGGGAAAGCACTCTTGCCGGAATGGGCACTGAAAGAAGCACCATGGGAGATGAGAAGGTTACATAACTTCTACATGGAGGCCAGCAAGAAAGGCTTGGGCAATATAATAGCTCGATCACCGGCAGATTGTTTCGGCGAAGAAGGTTACGTATGGCTAGATTTCTCAGATCTCCACGCCATATATCGTCGGGATAAGATGGACGTCAACTATGTCGGTGTTTGGTGCATGATGCAATACATGGATGCTAAGAAGAAAAAAGAACCCATCGGCTTCTTGGATCCAACTCAGATCTGCCAAACACAGCATACCGTTACGCTAGATCCAGGGTCAGACCAGCTGAAGGGCAAGAATCCGAAAGAGATAGCAGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCGCACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTTAACGATCATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGATCCTCTCGATTACAAACACAAGCAATACAAAGAATTTCTAACAATCTTACAGTATGCATACCAATACTACAAGTTCAAGGGTGGAGAACAGACACGAACACGGGAGAAGCTGCTATGTCACAAGCAACCGCGAGGAACGGTCCTTTGCGGGTATTATGCGTGCGAATTCCTTAGGGTTAATGGACGGTACAGGACTAACGCGGAGGATTTGCCAAGATTAGAATGTCGAACAAGCTTTGACGATACAGGTATCACAAATGTGCAGCGTGATCTGTGCCACTTCATCCACCATGAGTGCTGTCATGTCAAAGGAGATTTCTTCGACCCAGAGGGTGCCCTAGCGGCAAGTGACGAATTCAAGGATCTTCGGGAGTGGAACACTGCTATGCCATAA >LOC_Os07g30750 ATGGGGAGCTCGGGAGAGATCGGCGAAATGGGGAAAAAGCGAGAGAGGGGGACGGCGATGCTTAAAAAGGGGGAGAGGGAGCCGGACGTGGCCGGGAGCGGCGGGATTCGACGGCCGACGTGGGGGAGTGGGGAGGAGAGAGAGGCGGGATTCGGTTTTCGAATCCCGGCCATCTCGGGCGCGGGCGCGAACGGGAGGGAGAGGGGAAAGGGCGCGGGAGACGCGGCGCACGCGCGGGCGTGGCCGACGTGGCCCGGGAGAGACGGAGGCGTGGACGCGGCGGCGGTTTCGGCGCGGCGGCGCGCCGGGATCGGCGGGAGGTGGGGGAAGGACCCGACAGGGTTTTATCCTGATTTCCTCTGCATTTTCTTGGGGTCATTTGTAATTTACAATGTGGCTTGGGAGGAAAACTTCGGGATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGTGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGTGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGAGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCAGATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGAAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACAAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGACCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGACAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCACTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACTAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACATATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCTAAGGGTGAATTCTAA >LOC_Os07g09540 ATGGATGTACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGTCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTTCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTGTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os07g17540 ATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATTGAAGTTCTGGTACTACGCTCACGGTGAAACGCTTAACCCAGTTGATGGCTCCCTGGTCTTCAGCGATCAGATACGCGAGGCTGCGCGTCGACTAACGGATGCAGTGGAAGCCTCTTCTCAAGGCACGTTCCGACCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCTAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGATTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGACGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCACACATCGGTCCCATGATCCCCAGCCAACCATTCCTCCTGCAATGGTGAGCCCTTCAGGAAGTCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAATGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGTGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCGGTATATCATCCTCCCTGGGCGACAAGCGGCATCTCATGCACCATCTCCTCCAGCTCCGCCATCTCCTCCTCAGGCTCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCAAGCTCCTCGTCTGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCATCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTATGTGGCATCGGAAGTTAGGAGACAATTGAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACGTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTCAAGAAAGCATCTTCTGGAAAGTCCAAACTAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACTGGTGAAGATTTTGGAATAGAAAAATTTATTACTGACACCGGGCTAACTACGGATCAATTGCTACGAGGCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCTTGAGCAGCTGCAGTCCTTACCCACACAAATGTACAAGTTCCATCAACTGTACATGGAGATGAGTGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGTATCTACGAACTATACCAGCTGGACGCCCTCGATGCCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGTCCGACGGCGGGGGGTTTTCGATATTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAGTATCTGCAAGCCACAGAGGACAATCTCGTCCATCTCCTAAAGGCGCAGCATTACAAGACGTTCATACTATTGCCATATAACACAGAATTCCACTGGGTCCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAATTTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGTGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACAACGGAAATACAATTCATAGGTCCTTAGCGCTTCTGAGATAA >LOC_Os07g17340 ATGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTACCGCGAGAACGTGAACGAGAACGAGAATGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAACGAACGTGAACGAGCTAGGGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAAGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCTGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGATACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGAAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTTCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCTAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTTTGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGCTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAACTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTTGAAATCGTAG >LOC_Os07g34090 ATGCCGCCGCCGCCACGCCACGCCACGCCGCCGCCGCCACGGCCCCACAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGTGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACATCAACGTACGTTGCCGCGACAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAACGAACGTGAACGAGCTAGGGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAATGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAATTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCTGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCAACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTTGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTAGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGTATCGACTCCTCCTCAGGATCCTGCACCGACGACTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACAGAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGACACAATTCAAGCCTCGATGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATATTTTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAAAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACCATCTCTGGATCAATTTTAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACATGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTATGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os07g34150 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCTGCCGCCGCCGCCACGCCGCCGTGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAACAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCAAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCGGAACTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGATGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACAATCGAAGTTCTGGTACTCTGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCAACCATTCCTTCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGTGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCATCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTTTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATTAGAAGTCAAGACACAATTCAAGCCTCGATGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTTAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATAAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGAAGACCATCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGATGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCGCAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTTTCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os07g29090 ATGGAGGAAGATATTTGCACGCAAGTAGTCGTGGAGGAATCTTCGTTGTCTAGCTCAAGTGAACCAGGCAGTGGATCGTATCACTCGCCGAGTGACCCCCATCCTTCTCTTGGAAAGAAGAGAAAGGGCGGTAGCAACAATGAAGTTGACTCCGACTACGTTCCCCCCGAACAGGTGTTGAATGCTCCACGTCGCTCCAAAAGGAAAGCCCAAGCCGCAACTGAACCTGAAGCTGAAGCTACAACTGTCGTGCGCACAACAGCTTTAAGCAAACCCAAGAAAAGGAGGGGCGAGCGAGGGAAGAACATGTTGTTGAAGGAAGTAAGCGTGCTGACGCGGTTGAGTGAGACAGGGGAACCCCTGTCACCGGAAGACTCATGTTCAAAGTATAGCAACCAATGTGGGGCGGTGGTCAGGGATATCGTGGAGATCACATGGAAGGATTGGAAGAAAGTTCCAGAGAGTCGAAAGAGCAGCTGTTGGACGTCGCTGCAAAGCAAGTTTGAATATCCAGAGGGGACAGACGACGATAAAGCCAAGGATTATGCATTGAAAACAATGGGGAAGCTGTGGCGAAACTGGAAAACGGACCTGAATAAGAAATATGTCTAG >LOC_Os07g15800 ATGAACGTGAACGAGAACGAGCGAACGAACGTGAACGAGCCAACGAACGTGAATGAGAACGAGAGAACGAACGTGAACGAGAACAAGGTGAATGAACGTGAACGAGAACGTTGTCAGACGAACGTGAACGAGCCAATGAACGTGAACGTGAAATGCAATTATAGGCAGGTTAATGAACGTGAACGAACAAACGTAGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGTTCGAGACATTCACCCTTCCTGCGGGTATAGAGGACAAAGTGAAAAGGTGGACTTTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGAAGAGCTGTACATGAAATATATCCTGAATGGGCAAACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCAATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACACTCAAACCAGCTGATGGCTCACTGACTCTAGAGCATCCAGGACAAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACATACAGGAGTGGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCAATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCTTGGACGCCATGCAAACCCAGGACGAATCCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAATGGATCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGACGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCAAGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCAACAAGTGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCGGGCTCCTACACTGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAAGAAGGACCCGGGGTACGATTGCATGCAAGAGGAGCTTAACACTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTTCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCTTCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACTGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACGAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGAAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGACCAAACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTTGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGAAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGTAGACCAAATCATCATCACAAGAGAGCTCAATTTTATTCGCATGAGGGATAACCTGACCACGCACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAACTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os07g28770 ATGGCCGATCGCGATGAGGAACAGATACTATACGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGGGAACGATGCAAAGGAGGCTAGTGGAAGTCAGCCCTCTGCTGGACAGAAGAGGGCACGCGGACAACGAGAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGACTAACACCGAACTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGCCAGAAACAAAGAAAATGCTGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCGAAGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTTGTCTTAAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACAGACGCAGTGGTAGCCTCTTCTCAGGGCACATTCCGACCCGATAGAGAGAAGGATGAGCTGTCACTCGCCCTACAGACTCCCGAGCATCCAGGACGAACACGAGGAAAATGCGTGATTCCCTGGAAGATTGGATTTAAGGAGGACATCCACACATACAGGAGTCGGATGAGGAACAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTATAGGGTATCGAGCTACGAGCTTAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCGCACATCGGTCCCAAGATCCCCAGCCGTACATTCATCCTGTAATGGTCAGCCCATCAGGCAATCGTAGCAGCTGCGCCTCAACCGGGCAGGTGGCATCGGGAATGGCCATCCCAACGGACCCTTCCGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTAGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGGGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATCATACTATGGCGCAAGCGGTACATCATCCTTCCTGGGCGACAAGTGGCATTTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCGGCTCCTCCGCCACCTCCTGCTGCACCATCTCCTCCGGCTCCTCCGCCTCCTCCGCCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCGCCTGCCCGCACAAGGGCAACGAAGAAGGCAAAAGTTGACGCCACCAAAAACAAGGAGCCACCATACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAGGTGAAGAGGCAACTCAAGCCTCAGAGTCCTGAAAAGAGGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCAAAACAAACAAGGAGGCGTTACAGATATCGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGTTGGTTGGAGCCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAAACCTGAACAGCTGGAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCAACGGTAGAGAGATGTTTGGGGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGACGATGTTCTCTGGATCCATTTCAAAGATCTCTTCGATCTGTACCAGTTGGACGCCCTCGACGTCTCTCTCCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTCTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTACATACTACTGCCGTACAACACAGAGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCATGTGCAAAGCAGGAACAGGGAACTAACTTATGCGTCTACTACGTATGCGAGTATGCCCACTGCCTATCAAACCAAATATGCACAACACGAGAGCTCGATCGTATTCACATGAGGGATAATCTCCCACACAAGGATTTTATCATGGCTGTTCAAGAACAACTGATGAGATTCATCAACGAAGAAGTCCTTAATCCCGACGGTGAATTCTACTACGACGGATCATCAACAATTCATAACGTCGGTCCTTCCTCTTCTGACATAACGCCGGCGTCGAAGTCGAAGTCGTAG >LOC_Os07g39610 ATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTCAACAAGGGCAAGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTGGGGGTCAGGCGGCTATAGTGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGTTAAATGGCCGGATCGATCGAAGTTCCGGTACTATGCTCACGGTGGAACGCTCAACCCAGTTGATGGCTCCCTGGTCTTCAGCGATCAGATACGCGAGGCTGCGCGTCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGTCCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCTAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGATTCAAGGAGGACATCCACACGTATAGGAGTCGAATGAGTAGCAAGAGAGATACCGATGCGAAGATTACAGATCTTGAGTATAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCTTCCTGCAATGGTGAGCCCTTCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATACCAACAGACCCTTTAGGTACTTACCACTGTAGGCCAATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTGGAAGGCGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGCTCCTCGTCCGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCAAAAAATAAGGACCCGGGGTACGATTGCACGCAAAAGGAGCTTGACGCTTATGTGGCATCAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCTAGAAAATAAGATTCCTATATACTCGAGTGCCAGGAACTTATTCAGGTGTATGTTTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTTAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAAGAGATCGAGTCGTTGGTGACCGGTGTAGATTTTGGAATACAAGAATTTATTAATGACACCGGGCTAACTATGGATCAATTGCTACGAGGCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCACTTGTCAAGCCTGAGCAGCTACAGTCCCTACCCACACAAATGTACAAGTTCCATCAACTGTACATGGAGATGAGCGCCACCGGTAGAGAAATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGTATCTACGAACTGTACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATTGACCCTTGGAAAGTAAACGTCGCAATGCTCGTCCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTATTACCGTACAACACAGAATTCCACTGGATCCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAATCTACGTTTGACAAGTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCATAGGTCCTTAGCTTCTGAGATAACGACTACTACTACGTCGAATCGTAGCTAG >LOC_Os07g32750 ATGTGGGCGTCCTCAGAAAACCATGACGATTCAATGGCGGGAAGCTATCCTTGGGATCACAATGGATGGTGGACAGAACCGTCGTTGTTTAAAGTGAACACTGGGATTGGTACGGATAAACACAGAAGATTTCCGATTTCCAAAATCGGGGGTCTACACAATGTCCGGGCAACAATAACAAAGATATGTGCATTCATGAACGCAATTTCGCAGAAGGTCATCGATCCGGATAGATTAGAAGCCCTTCAGAATGAAGTGGTGCAATGTCTCGTCAGTTTTGAGTTGATATTTCCACCTTCATTTTTCAATATAATGACGCATCTGCTTTGTCACCTTGTGAAAGAGATCCGTATTCTCGGGCCTATGTACCTACACAACATGTTTCCTTTCGAGAGGTACATGGGCGTTCTGAAGAAGTATGTTCGTAACCGTGCTCGTCCAGAGGCAAGCATCGCCAAGGGTTATGGAACAGAGGAGGTCATCGAATTTTGCGTAGAATTTATCGAAGACCTTCGCCCAATCGGGGTACCTGAATCACGCCATGAAGGGAGACTATGGGGAAAGGGAACTCTCGGAAGGAAAGCAATAACGACGGTAGACAACAATTTATTCCGTAAAGGCCATTTCACTGTTCTGCAACACTCTTCATTGGTAGCTCCTTACATCGAGGAGCACTTGGCTCTAGTTCGCGCCAGGAACATCGGTAAGTCCGATGCATGGATTACACGGCATCACATTGATACTTTCCCCGCGTGGCTACGACAACATCTCATGGGTAACGAGTCGATCAACCAACAACTTGCCTTCCTGGCGAGGGGACCGTCTGGGTCGATCGCGACATTCCAGGGATATGAGATCAATGGGTACACATTCTACACGAGAGCCCAAGACATGAAGAGCACGAACCAAAACAGCGTTGTTCGTGTCGATGCCATGGGACACGATGGAACAACTGCCACGTATTACGGTGCCATCGAGGACATATGGGAACTTGACTATGGTCCTCTCAAGGTTCCTCTGTTCCGGTGCCAATGGGTTAGGTTGACTAGTGGAGGCGTAATGATTGATGACAGTGGGATGACAACTGTTGACCTTAACAAGGTTGGATACTCGGACGAACCTTTTGTCCTTGCCAATGATGTAACGCAAGTCTTTTTCGTGAAGGACATGTCTAGCAAAGGAAAGAAGGGCAGAGGGCCTGATGAGCCTAAGCGTCAAGTGGTTCTCCCAGGCAAAAGAAAAATCGTCGGAGTTGAGGACAAGACTGACGAGGATTACGATAAGTTGGATGGGCAACCCCCTTTCACGGTGACGATTGACCCTAGCATCCTCCTATCAAATGAAGACACCCCTTACTCACGCAGCGATCACAAGGAGGAAACAATAGAGAGGAGAAAATGTTTCTTGTATCAACAGATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGATGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGATCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCATACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTAGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCAAGGATCAGGGACACGGGCTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTATGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCACAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAAAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTACGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os07g37470 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCGCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACATTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCCAGAACGAGAACGATCGATCGAAGACATACGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAACGAACGTGAACGAGAACGATCGATCGAAGACATACGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAACGAGCTAGGGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGTGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCTGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCTAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCATGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCATCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATTACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os07g09170 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGAAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCAATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACAGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCATACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGATGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTTCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCATCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGAAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTAGTACTACGTCGAAATCGTAG >LOC_Os07g15140 ATGCTTGAGACATTCACCCTTCCTGCAGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGACAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCTCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGTAGGCCGATTCCAGCAGGATACTCCAAGGTCAAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAAGCCATCAAGCTATCGGACTATGAGCGAACGCAGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTTGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os07g18210 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGTCGCCACGCCGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGATAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAACGAACGTGAACGACCTAGGCAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGTGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGGAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGTTGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACAATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCAAAGGTCGAAGTTGAGTTGGTCGAAGGCGTGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCCCCTACACCTACTCCCCCGCAAGCTCCTCTTCTGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCTAGAAAAGAAGATTCCTATAGACCCAGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGATCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTAAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTTCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os07g28620 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTAGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCATATTCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCCAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACAAACTCAACATGCAAGAGGAGGTGGCAAGGAAGATTGATGAACGCATGGCCACACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCACCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCTACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAGGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTATCAAGCCTGAGCTGCTGCAGTCCCTACCTACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAATACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTTAATGGATAAAAAAGAGTCTACGTTTGACATGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCTGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCAAGTATTGCCACTGCCTTGTAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os07g29740 ATGCCGCGCCACCACGCCGCCGCTCCACCGCTCCACTGCCGCCACGTGAACGAACGAACGATCATGAACGAGAACGAACGAACGAACGTGAACATGAACGTGAACGAACGAACGAACGTGAACGTGAACGTGAACGTGAACGAACGAACGAACATGAACGAGAATGTGAACGAACGAAACATGGCTGATCGTGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGGAGCCAGTACTGGAGCGAAGAAGAGGGGAATGAGGATCCAAACCAGTACTTGAACAAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGGGAACGTGGTGAAGGATGTGGAGGGGAACCAGGAAGAGGAGGCTAGTGGAAATCAACCCTCCGCTGGACAGAAGAGGGCACGCGGGCAACAAGGTGCCGCGAAGAAGCTAGAGGCCAAGAACTACGTACGACACAGCGGTTGGGTTGTGTGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGCAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAGTTTCTGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTTGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACATGTCAACAAGGGCAGGTGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCAGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCTGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGTTGATGGCTCCCTGGTCTTCAGCGATCAGATACGCGAGGCTACGCATCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCCGACAGAGAGAAGGACGAGCTGTCACTTGCCCTGCAGACTCCAGAGCATCTAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGACTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCAGGGCGAAGATTGCAGATCTTGAGTACAGGGTACCGAACTACGAGCTCAGCATCTGCACCTCAACGGGGCAGATAGGATCACAGAGCATGGACGCCATGCAAACCCAGGACAAAACCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCCTTCAGGAACTTATCAATAAAGGTGGCGTCAGGCATGGCCATCCCAACGAACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGCACCTTTCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCAAAAATTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTATGTGGCATCAAAAGTCAGGAGACAATTGAAGCCTCGAAGTCCAAAAAAGAAGATTCCTATAGACCCGAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTCAAGAAAGCATCTTCTGAAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGATTTTGGAATAGAAGAATTTATTACTGACACCGGGCTAACTACAGATCAATTACTACGAGGCGCACCAATCGAAAAGACGAAAGTGAAATACATGTACGAACTCAGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAACTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGTATCTACGAACTATACCAGCTAGACGCTCTCGACATCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGTTTTCGATACTGGATTCATCGACCCTCAGAAAATTCCACTTGGTCCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAATCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTTGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTACGCGGAAGTTCAATTTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGAGATAACCTGATCACACACAAGGAATTTATTGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCATATGTCCTTAGCTTCTGAGATAACGACTACTACTACGTCGAAATCGTAG >LOC_Os07g23630 ATGTCCACAACAAACAAGGAGGCCTTAAAGCTATCGGACTATGACCGAACACTTCAGAAAGCCTATCACAAGAAGTCCAAACCAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCTATTGGTGACCGGCGAAGATTTTGGCATAACGGATTTCATTTCAGACACCGGTCTAACTGTGGATCAGCTGATTGGAGGCGCACCAATCCCGAAGGCGGTAGTGGCATACAAGTTTGAACTTGGTAAACCGCTTGTCACGCCTGAGCAGCTGCAGTCCCTACCGACACAGATGTACAAATTCCATGAACAGTACATGGAAATGAGCGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTCTTGATCCATTTCAAGGATGTCTTCAATCTGTACCATCTGGACGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGTGGGGTTTACGATACTGGGTTCATCAAATCTCGAAAAATCAACACCGACATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAACAGCATTTCAAGACGTTCATACTACCGCCGTACAACACAGAATTCCACTGGGTCCTGTTATTTTTCGACTTGGACGCATGCAAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCCAATTGATAGACAGGGCATGCGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCACGTATTCATATGAGGGATAATCTCCCACACAAGAATTTTATCACGGTTGTTCAAGAACAACTGATGGGATTCATCAACGAAAAAGTCCTTAATCCCGATGGTGAATTCTACTACGACGGATCGACAATTCATAACATCGGTCCTTCCTCTTCTGACATAACGCCGGCGTCGAAGTCGTAG >LOC_Os07g46120 ATGGCTGACCGTGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAATGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGACACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCAGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCACCAAGAAGATGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCACGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCAGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTTGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAAGAAACCGTAGCAGCTGCGCCTCAACAGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGCTACTCGAAGGTCGAAGTTGAGTTGGTCCAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCTTCAGGATCCTACACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCATCTCCACCGCCTGCCCACACAAAGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCACACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCACAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGTGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os07g06030 ATGGCTGATCGCGATGAGGAACAGATACTGTACGATACAATCGCATCGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGAGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGCGGAGAGGGATGCAGAGGGGAATGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGAGGCTAGTGGAAGTCATCCCTCCGCTGGACAGAAGAGGGCACGCGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGCAGACGGCCGACCTAGTGCCCCGGCACAAACAGCCAAGAATTTTGTACGCCACAGCGGTTGGGTTGTGAGGGATAACGTGCCTGTCAGCAAGGTGTACTGGCGCAGAACAAGTGCACGCGGGGATGATGACAGCTTTGTCCCGGAATCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTCACGCTCCCTTCGGGTATAGAGAACATAGTGAAACAGTGGACTCTTAAGAAAATGGCAGAACAGTTCCAGACCTTCAAGGGAGATCTGTACCGGAAATACATCCTGAAGGGGCAGACACCGAACTTCGACGTATTCCCGAAGCTAAGGGATCACTGGGACGAGTTTGTTGCTTACAAGACAGGTCAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGAAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAAGTGGCCTGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAGCCCAGTTGATGGCTCCTTGGTCTTCAGCGATCAGATACGCGAGGCTGCGAATCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTACAGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTAATTCCCTGGAAGATGGGATTCAAGGAGGACATCCACACGTATAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCCCGAAAGGTGGATGAACGCATGGCAGCACATCGGTCACACGATCCCCAGCCGTACATACCTCCTCCAATGGTCAGCCCATCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGTATCACATAGCATGGACGCCATGCAAACCCAGGACGAAACCACCTGCCCCGTTGATGAGATCACGCATCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATTAATCAAGGTGGCGTCGGGAATGGCCATCCCAACGGACATTTCAGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGTGTACGAGGACCTCGAGTTGGACTATCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCGGTCTCGCCAAGCTCCACCTCCTGCCAGCACAAGGGCAACGAAGAAGGCCAAAGTTGAGACCACCAAAAACAAGGAGCCGCCGTACGGTTGCAGTCAAGAGGAGCTTGACACTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAATTTCTTCAAGGGAATGTCCATCGCAAACAAGGAGGCCTTAAAGCTATCGGACTATGACCGAACACTTAGGAAAGCCTATTACAAGAAGTCCAAACTAGTTCCTCAGCTTGGAGAACAACCACACCAAGTGACCGGCGAAGACTTTGGCATAACGGATTTCATTTCGGACACCGGTCTAACCATGGCTCAGTTGGTTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAGGCCTGAGCAGCTGCAGTCCCTACCGACACAAATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCAATGGTAGAGAGATATTTGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTATGGATCCATTTCAACGATGTCTTCGATCTGTACCATCGGGACGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTACAATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGCTCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCATGTGCAAAGCAGGACAAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTTTGCCCACTGCCTATCAAACCAAATATACACCACACGAGAGCTCGATCATATTCACATGAGGGAAAAACTCCCACACAAGGATTTTATCATGGCTGTTCAAGAACAACTGATGGGGTTCATCAACGAAGAAGTCCTTAATCCCGATGGTGAATTCTACTACGACGGATCGACAATTCGTAACGTCGGTCCTTCCTCTTCTGACGTAACGCAGGCGTCGAAGTCGTAG >LOC_Os07g26160 ATGAAGGCAAGCACCATCAATGGCATTTCATCATTCATAGTTGCCGTGGGGGAGAACATTTTCTGGAGCGGGCCATGTCTACTTCAAGTCCATTTCTCCGATATACATTCCCTCTTCCGTAGGAAGAGACTGGACGCCAATTTGATCGCTATCTGGTGTCTGATGAATTACGTGGAAATCGAAGCGGTGAGAAAGCCTGTCGGCTATCTAAACCCGTGCAGGATAAGTCAGTCGAACCACACATACAGGCTAGACGAGAAGAAGCTACCGGAACACATCAAGGCGATGACTCCCGAAGAGAAGACAGCTTACATAGGACAAAGGCATCAGGAAAAGCTGCTCGATGTCGCTACTTACGTAGCAATAGCGCTTGAATCTGCGCAGGACAAGGAGTGCGTTCATGCCCTGTATGCCTTTGACGACCATTGGATAGTCTTTCTTCTCTATCCAAAGTACAATGAAGTCATCGTCTTAGATTCTCTCGACAAAGACGGCAAGACATATCAGGAATTTCTAAGAATTATCGATCTCTTCCAAAATTCCTAA >LOC_Os07g23270 ATGGCAACCCGTCGTCGGTCAAAACTAAGTGCCGTCAGGGTTGAACCTGATTCAGACACAACGACCTCGGGACCACCGCGAACGGACACGACGATGAGTGGGGGAGCTTGTCCAAAGAAAAAGCGTGGCGAGAAGGGCAGGAACCTCATGCCGAAGGAGACGTACTACATTGCTGCTCTCGATGTTGACGGCAAACCCGTCGAGCCGCAACATGTAAGGGTGAAGTTTAGCACCGCATGCGGCGCGCTGGCAAGGCTTCATGGGCCTCTCAACGTGGACGAATGGAAGCATGTTAGCATTCACATCAAGAACTTAATGTGGGAAGGTCTGCAGGAGCACCGTATTTATCCGCCTGAGTCGGAGGCACTTGGCCGGAAATTTGCACTGCAAACAATTGCCCATCGGTGGCGACAATGGAAGTCGGACATGAACACCAATTATGTTCAGAAGAATAAGACTCCATTTGAAGAATGGGGCACCATTTCAGCAGAAGCCCAAAGTTACAAGAAGCGCGATGCCTACAAGGCCAAGATGCGCCAGGAAATCACAAATCAAGTCACACAACAAGTCACCCAACAGTTCTACAGTCTTGCCGCACAACATCCTCAAGCCTTCCCTGACCTGGTTCCTCATGGTTTGCAGTCGACACAGATCCTAAGCTCAGTCGGGTCGGTAGAAAATACAACCTACCCAGTAGATAGTATAACTGGTCCGACACCGTGCAGCTTTGTCGTTCCGATAGGGAGAGCGGGAAAAACGAAGGAGGTTGCGTCTGGATTGGCGATACCGGGGAGACAGTTCCATAACAGCCTAATTCCGGCGGACTACGTAAGTGTTCAGGTCGCACTTGTTCATGGCGACCAGATGTCGTTGGAGCTTGACATCCCAACACCAGAGGGGATTGAACTTCTCAGGGATGCGGTTAACCAGTTCATACTCTGGCATCGTCGTGACATCATCCTCACTGGACAGTTCATGTCGATGACACCAGCTCCATCGCCAGATACATCAAAGGAGCAGCCAAAAACCTGTGAAGCCCGCAAGCTCATACCCGTTATGGTATCCACATACAACAAGGAGAAAATGGCAGAGTGTGAGACGCGGATGGTTTTGCAATCTTTCAAGGGTCGAGGGGGTCCGCTAAAGCCAGTTGGACCTGATCAGTATTCGGACGCACAGAAGAGCGTTGTAGGTCTTGCTGACAAAATGCAATCTTGGACCTCCAATGAAGTGCCTAAGGAGTATGAATATGGCAAGCCGTTTTTGCCGTTCAACTTGATGTGTGAACTCCCATGGCCAATGAGGTTGATGCATGAGTGGTACTTGAGGGCAAGTGAGTTAGGTCTCGGGATGATTACTGTGCATGTCCCGGAAGGCGCTTTCAAGGATGGACCTAACGCAAACTTCGCCTTTAGTTTCAAGGACCTCCACGCACTCTTTAAGATGGATAAAATGGATATCAATCTCGTCGACGCTCAAAGAACGGGGACCTTAATCGGTTACGTAAATCCAACGATGGTTTGCGAGACGGCCCACACTGTGCGGATATCGGAGGATAGTGCGGTACTAAAGAATAAGACACCTCAGGAGAAAAAAGATTACATCGAGCGTATGCGTAAGAGAAAGATGGCTGAGGTGGGAAATTACTTGGCCACCTCATTTCTCGCACACTCCGACAAACGAGTCATCATGGTCCCCTACCACTTTGGCGAACACTACATACTATTCCTCGTCTATCCAACGGACCAAACCGTTGTAGTTCTTGATCCGGCGGACTATGACAAGGACGCGTACATGGAGTTCCTATGCTTGCTGAACTTAGCACACGGCCGTTATAAGAAACGTGGCGGTGTTATAAGCAACCTAGCTTTACGAACCTATGCGATTATTACGTGTGCGAGATGCTCAGGGTCAATGGGAGATACAATTGAGTTTACAGATCGTGCCGGGCAACCGCCTCGTCTCCCTGCCACCGCCGAGCGAGCTGCGACGTGCACTCTTCAACAACGTGGACGCGTGGCTCGCCGTTGCCGCCGAGTCGAAGACCTTGGCATTGTGGTGCTCGTCGAGGAGGATGTTCTCCGGCTTGATGTTGCAGTGGACGATGCAGTCGCGACACTTCTCGTGGAGGTAGGTGATGCCACGGGCGGTGCCGACAGTGACGGCAAACCGCGTCGGCTACGACATCTTGCAGCCCGGCGCGTCGGTGAAGAGGAAGGCATCGAGGGAGCCGTTCTTCATGAACTCGTAGGTGAGCAGGCGGTGGCGTCCCTCGGAGCAGAAGCTGATGAGGCGGACGAGGTTGAGGTGGTGCGTGCTGCTGATGGTGGCCACCTCCATCCTGAACTGCTTCTCCCCCTCTCGATCCCCTCCAGCTGCTTCACCGCCACCACCGTCCGGTTCGCCATCACGCCGTGGTACACGGCGCCGTACTTCGGGCTGTGCCGGCACAACACACACCACAACGCTCACTCGCACAGCACCAGCCCGGACACCACGCCGAGCATCACCCACCTGCGGACGCCAGACACCCTGCTCTACAGCGAGCCGCCGCCGCCGAGGGGCAGGTTGGGTATCCCCGGGAAGCAGACCTTGATGAACGACGTGCTGGGCAGCGCCACGGACCGGTACCCGCTGACGAAGTTGGACACCTTGAGGAAGCAGAGGCTCGAGCCGCCGTAG >LOC_Os07g03350 ATGGCTGATCGCGATGAGGAACAGATACTATACGAAACAATCGCAGAGGGAAGCAGCCAGTATTGGAACGAGGAGGGTAACGTGGAGAGGGATGCAGAGGGGAACGATGCGGAGGAGGCTAATGGAAGTCAACCCTCTGCTGGACAGAAGAGGGCACGCGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGAAGACGGCCGACCTAGTGCCCCGGCAGAAGCAGCCAGGAATTTTGTACGCCACAGCGGTTGGGTTGTGAGGGACAACGTGCCTGTCAGCACGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGACTAACACCGAACTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGAGATGATGGCCAGAAACAAGGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCGAAGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGGGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTTGTCTTCAGCGATCAGATATGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGTGGCCTCTTCTCAGGGCACATTCCGACCCGACAGAGAGAAGGATGAGCTGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATTGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCGCACATCGGTCCCAGGATCCCCAGCCGTACATTCATCCTGTAATGGTCAGCACATCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGAATGGCCATCCCAACGGACCCTTCCGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGGGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATCATACTATGGCGCAAGCGGGAGGTGAAGAGGCAACTCAAGCCTCGGAGTACTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCAAAACAAACAAGGAGGCGTTACAGATATCGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCGAAGATTTTGGCATAACGGATTTCATTGCAGACACTAGTCTATCTGTGGATCAGTTGGTTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAAACCTGAACAGCTGGAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCTCCAACAGTAGAGAGATGTTCGGGGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGACGGGGTTACTAATCGGGACTCCAAACGGTTTCTCCACCAATCCCGAGCTCACAACTGCATTACAAAAGGAAAACGGAAGCCAGGACTTGGACCAATCAACACAGGCACGACTTGGGAACTAGGCCGAAACCCTAAAACTCATCGTAGCCGACTTGCTCCTGGAAGAACTCCTCGTCAGCAGGATCCACTTCATCTTCTTCAGCAACTGGGGGGAGATTATTTATATAGAGCAAGGCCCGTGGGGATCAGCCACGTCGGGAGACCTCCAAGCTTTCATGACAAGGCATTTCGAAAGCCGACACAGGTTTACCATATGCCGACGAGAGGGGTCCCAGACCAACAACAGGTTAGGTCCCAGACCATACTGTGCCAGGAAGCCCAGGGGTCCTCTCCGACACCACCCCGGCGAATCCACATGTCTCTCGGCATCAAGGCTCCCCCGATTAGCAATTTACTCAGCCAGGGGCGTCCCATTCCACCCATGTGGTCGTACTTGTCTTATGTTCGGATGAAATTTCCAAGGAAACGGTCCTTAAGTGCAAGAGCGGGAAACCGTACACCCGGCTCAAGATGTTCAAAGGTGGCTTGCCTTGCTCGAGATCTGGAGCTTGATCCTCGAAATCCTCGCACTGCGGGTCTTCGGGCTCCGGAACTACACGCGAAACGGAACAACTCAACAAACGGCGAAAATTAA >LOC_Os08g21200 ATGGGCCAGGGTCCCAAACAAAGTTACAAGCCCATTGGCCCAATACAGCCAAACGAGATAGAATTCCGAGATGAGGCTGGATCCGTTGGAAGGAGGACTTCGAGAGCTTTCCATCAAAAGGGACTCACGCCGTTTAAGGACTACGGAAGGATAACACAGGCCCAGTGGGATGAGTTCGTTGCCCTTAAGACATCGGCAGAAGAAAAGGAGAAGAGCCAGAAGATGGCTGAGCTAGCAAGAAGGAATGAATATCCACATCATTTAGGATCGACCAATTACCAGCAAGCGGTGAAGAAATGGGCAAAACAAGATGAAGAGATGGAGAAGGCTGGGAAACCCGTTCCTATGAAAAATCACAACCCACGAAGCAGGAACTGGGTGCGTGCAAGAACACCGGCCTTCACCCCTGAGGGGGATGTAGTATTCAAGGATCAGAAGCTCCACGAGGCTAGGGCAGCAGCTCGTGACGAATGCAATATATACTGGAGTCAGAAAATGAAGCACGGTGCTGCTGTTTTAGAGCCTGAGCCGAGCTATCCTTTCGATGATGTAACGGAGGATACTCCGTGCAAGCTCTTGATTCCGGTCAGCAGGGTGGGAAAGAAAATACTCGTTGCAACTGGGAGGTTCATACCAGGCCACAGGTTTCATTGCCAAGACATTCCGGATGACTACGCCAAGGTAGAGGTCCGGACGGTCATTGAGGCTTACCGGATGCACGAGCTCGACTTTCCAACTACTGAGCAGATTGTGTACCTTGGAGATGCCGTCGACCAATTCATACTATGGCACAAGAATGATATTGAACTAGGGTCAACGGATGGAACTGATCGTCCACCAAGGATACCGGTGTCACCGTCACGTCCACCAGTCGTAGCCAGTCCGAGGGATAGTCCTATTGCTTCACCCTCTAGACCAGAGCCACCAGTTGCATCACCTCCAGGACCAGAGCCACCAGTTGCATCACCTCCAGTACCAGAGCCACAAGTTGCATCACCTCCAGTACTGGAGCCTCCCGTTGCATCACCTCAGACAGAAAAGGATCCAATGCCCGATCAACCAGAGCAATCGCAACCAGAGGAACCTAAGCGTGCCGATGTGCCAGTGATGGTAAGGACGCACAAGCACAAAGCAAAAAGTGCGTCCAAGAAACATTATATGGTAACGGCATTCCGAGGAAGGGACAAAGATATCATAAATGCCGAATTTGATAATAGAAAATTAAAAGGGTTCAAACAGACCTTCGATGACTATCTCAACTATATCAATTCCCCAGACGTGCCACATGAGTTTGAGAATGGCAAACCATTCATTTATGACTGGCAACTAAGAGAAGGACCGTGGCAACTAAGAAGATGGCACAATTGGTACATTAGGGCAAGCACCATGAAAGGCATCGATTCATTCACAGTTGCCGTGGGGATCATTACACCTATATGCGTAGCTCATTTGATCATCCATTGTGGCAGGATGAATTACGTGGAAGCCGAAGCGATGAAAAAGCCTGTCGCCTACCTAAACCCGTGCAGGATAAGTAAACCGAACCACACATACACGCTAGACGAGAAGAAGTTACCGGAACACATCAAGGCGATGACTCCCGAAGAGAGGAAAGCTTACATAGCACCAAAGCATCTTGAAAAGTACAATGAAGTCATCGTCTTGGATTCTCTCGACAAAGATAGCAACACCTATCAGGAATTTCTAAGAATTATCGATCTTGCATTTAAAAGGTATTACCAGCGAGGCGGACAATGCAAAAACTCAAGAGAACGCATATCCGTCCGCAATAAGTGGCCGCTTCCAAAATTCCCCAAGTCTGAAAGAGAGCTCAATGATACATCCATTCAGAACATTCAGGCGGACATGTGCTACTTCATCCACCGTGAGTGCGCACATCAGCTTGGGCAGTTTTTTGACAACGAAGGAGTCTTAGCCCTGCCGGAGAACAAATCCCTGTTTAACTGGACCAGGCGTATAATATAG >LOC_Os08g15740 ATGTCGATGAAATGTAACTGTCAATTAGTGCAACGTTCCAAGCTCAAAGATGACGACCCCCAGAAGGCTGCTGAACTAGCCGGGCCAACATACTTCGCAACCGATGATTGCCCGGAAAAGTACGAACATGGGAAAGCACTCTTGCTGGAATGGGCACTGAAAGAAGGACCATGGGAGATGAGAAGGTTACATACCTTCTACATGGAGGCCTGCAAGAAAGGCTTGGGCAATATAACAGCTCAATCACCGGCAGATTATTTCGGCGAAGAAGGTTATGTATGGCTAGATTTCTCAGATCTCCACGCCATATATCGTCGGGATAAGATGGACGTCAACTACGTCGGTGTTTGGTGCATGATGCAATACATGGATGCTAAGAAGAAAAAAGAACCCATCGGCTTCTTGGATCCAACTCGGATCTGCCAAACACAGCATACCGTGAGGCTAGCACCAGGGTCTAACCAGCTGAAGGGCAAGAATGCAAAAGAGATAACAGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCGCACATGCATACCAATACTACAAGTTCAAGGGTGGAGAACAGACCCGAACACGGGAGAAGCTGCTATGTCACAAGCAACCGCGAGGAACGGTCCTTTGCGGGTATTATGCGTGCGAATTCCTTAGGGTTAATGGACGGTACAGGACTAACGCGGAGGATTTGCCAAGATTAGAATGTCGAACAAGCTTTGACGATATAGGTATCACAAATGTCCAGCGTGATCTGTGCCACTTCATCTACCATGAGTGCTGTCATGTGAAAGAAGATTTCTTCGACCCAGAGGGTGCCCTAGCGGCAAGTGACGAATTCAAGGATCTCCGGGAGTGGAACACTACTATGCCATAA >LOC_Os08g30750 ATGAGTCAGCGGCTCAAGAGAGAGAGAGGGAGGGGCGCCGGCACATGGGCCCCACTGGCAGTGGCACAAGGCGGGAGGGGCGCGGCTGGTGGCTCGGCTCGGCTTCAAAGCCGGCAGGCCAAGCATGGCAAGCGACGGCGGCACGCGCGGTCGCCGGCGACGGCAACCGGCGGCGCGGACGGCGATGGCAGACGGCGCGAAAAGCGGCGGCGGCGGCCGAAGACGACGAGCAAGGGAGGGGAACTTCAGGGCGTGACAACTGGTGGAGGCGTAATGATTGATGACAGTGGTATGACAACTGTTGACCTTAACAAGGTTGGATACTCGGACGAACCTTTTGTCCTTGCCAATGATGTAACGCAAGTCTTTTTCGTGAAGGACATGTCTAGCAAAGGAAAGAAGGGCAGAGGGCCTGACGAGCCTAAGCGTCAAGTGGTTCTCCCAGGCAAAAGAAAAATCGTCGGAGTTGAGGACAAGACTGACGAGGATTACGATCAGTTCGATGGGCAATCCCCTTTCACGGTGACGATTGACCCTAGCATCCTCCTATCAAATGAAGACACCCCTTACTCACGCAGCGATCACAAGGAGGGAACAATAGTTAGGAGAAAAAACATAAATATGGCTGACCGCGATGAGGAACAAATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGTGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACAGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAAGTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGACCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGTACGAGTTCGTTGCATATAAAACAGCTGATGGCTCACTGGTCTTCGGTGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCAACCGGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAAGACGAACACGAGGGAAATGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCCGGGTATCGAGCTACGAACTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCTATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTATCCCATTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTACAAGAACTTATCAATAAAGGTGGTGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACATACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCAAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACGTCATCCTCCCTGGGCGACAAGCGGCGTCTTGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGGAAGACATGACGATAGAAGAATTTATTATTAATACCGGTCTAACTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCAGAATTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACCCGGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGGAATCTACGAAGTATACCAGCTGGATGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGACGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGAAAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAACTGGAGAGAAAGACTTAGGCGGAGGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGAGTGAATTCTACTACGATGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGTGAGTACTACTACTACGTCGAAATCGTAG >LOC_Os08g08180 ATGAGGATGAAAAGTTCATGGAGCGGGTACTGCCAATGCGAGGTTATCGAAAAGCTTTGCCGTGACGCGTCTCATGTGTTGGGACGAGGCTCATGTGTTGGGCAGTCGCGGAGTGCGGGTAAAGTGTACATCCACTGCAGTGAGAGTGTTGAAGAGAAGCCCTTGTCGCCGCCTCTCCCAGCCCCACAACCAGTTCAAGCCTCTCCCACCTCCCCAGCTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAACAAGTGCACATACCAAATGGTACTACATCCGAACCGAAGTCTAATCCTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCAGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCCTGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCGAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACATTAATCTCGTTGCGGCGTTCTGTCTTATGCAATTCCACGAACCTGATAGAACTGGAGCAAAGGTTGGATATGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGAGAGGACTGCGAGCAATTGGTTGGCAAGACCCCTGAAGAAAAGGAAGAATATGTGAAGACATTACACAAGAGGAAGAAACTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAAGAACCAACTTGTGCGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGAAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACGACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTTGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os08g17340 ATGCAATTCCACGAAGCTGATAGAACTGGATCACCGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTAAGAGAGGACTGCGAGCAATTGGTTGGCAAGACCCCTCAAGAAAAGGAAGAATATGTGAAGCAATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATATTGGCGTACGCCGACAAAGATGTCTTAATGGTCCCCTACGCGTTGACGTCGATCCTCAATCTTCTAACTACTGATAAAACAATTGTTTTCTTCAAACATAGCACACAAGTACTACCGCAAAAGAGGCGGACCAGTACATATTCCATCCCAGAAGCAGTTATCCATCAAGACTGGCCGACCGTGTTACAAACAACCACTGGGAACCAACTTGTGCGGTTATTACGTGTGCGAGATGCTCAGAGTAAACGGGAGATCCCCAAAATCCCATATATTGCACAACGAATCGACGACAGTACTATCTGGAACGTGGGCGCTGAACTCTGCCGATTCCTCTGTCGTGATGTCTGCAACGCAATGTAA >LOC_Os08g21140 ATGCTCGAGATGTTCACGCTCCCTGCGGGTACGGAGAACATAGTGAAACAGTGGACTCTTAAGAAAATGGCAGAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGGCTGACACTGAACTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCATTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGACAGAAACAAAGAAAATACCGCCAAGAAGAAGTACCATCACCACCTGGGGTCAGGCGGCTATAGCGTCGCAATGCCGAAGTGGGAGGAGATGGAAGCAAGCATTATTGAGAGGGGTATCGAACAGGCCACCGCTAAATGGCCGTATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCCGTTGATGGCTCCCTGATGTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGATGCAGTGGAAGCCTCTTCTCAGGGCATGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGGCAAGAGGAGGTGGCAAGGAAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACTCAGGATGAAACCACCTGCCCCGTTGATGAGATCACGCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTGGCGTTGGAAATGGCCATCCCAACGGACCCTTCAGGGACTTACCACTGTAGGCCGGTTCCAGCAGGATACTCAAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCGGTACATCATCCTCCCTAGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCGCCACCTCCTCCTGCACCATCTCCTTCGGCTCCTCCGGCTCCTCCACCTCCACTGTGTCCACCTGCACCTCTCAAGACAAGGTCTCGCCAAGCTCCACCGCCTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCACCAAAAACAAGGAGTCGCCGTACGATTGCAGTCAAGAGGAGCTTAATGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTGTTGACCCGAGCGTGAAGAACTTATTCAAGAAAATGTCCACAACAAACAAGGAGATGTACAAATTCCATGAACGGTACATGGAAATGAGTGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACTCCGACTTCTTGCAAGGAGAAGATGTTCTATGGATCCATTTCAAGGATGTCTTCGAACTATACCCTCTGGACACCCTCGACGTCTCTCTTCTAAGCGCATTGATTTTAATGGAGATTAAAAGGGCTCGACGGTGGGGGGTTTACGATACTGGGTTCATCGACCCTCGGAAAATCAACGCCGAAATGATCGACAAGTACGAGAAAGACATAGAGGACAATCTCGTCCATCTCCTGACGCAGCAGCATTTCAAGACGTTCATACTACTGCCGTACAACACAGAGTGA >LOC_Os08g17120 ATGCCTGTCAGTACGGTGTACTGGCGCAGAACAAGGACACGCAGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTATGGACCACAATGCTCGAGACATTCACCCTTCCCATGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGACAGAACAGTTTCAGAGCTTCAAGGGAGATCTATACCAGAAATACATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGATAGGTCAACAAGGGCAGGCGATCATGGAAAGAAACAAAGAAAATACCACCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGAAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCTACCGCTAATTGGCCAGATCGATCGAAGTTTTGGTACTATGCTCACGGTGGAACACTCAACCCAGTTGATGGCTCCTTGGTCTTCAGCGATCAGATACGCGAGGCTGCGCATCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCATGTTCCGACCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCAGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGTAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGATGAGCCCTTCAGGAAATCGTAGCAGCTGCGCCTCAACAGGGCAGGTGGCGTCGGGCATGGCCATCCCAACAGACCCTTCAGGTACTTACCACTGCAGGCCGATTCTAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGTGCGTACGAGGACCTCGAGTTGGATTACCCTAGAGGAGACGGCGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCGGTACATCATCCTCCCTAGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCTGCCATCTCCTCCTCAGGCTCTTGCACCGTCTCCTCCTCATGCTCCTGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACACCGCCAAGAACAAGGACCCGGGGTACGATTGTACGCAAGAGGAGCTTGACGCTTATGTGGCATTAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGATATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTCAAGAAAGCATCTTCTAGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAATCAGGAGATCGAGCCGTTGGTGACCGGTGAAGATTTTGGAATACAAGAATTTATTAATGACACTAGGCTAACTACGGATCAATTTCTACGAGGCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAATTGCTTATCAAGCCTGAGCAGCTGCAGTCTCTACCCACACAAATGTACAAGTTCCATCAACTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCAAGGATCAGGGACACGGACTTCACATATATTTTTGAATAA >LOC_Os08g27180 ATGAAGTGGAAGACGACAATATTCCGGACTTTGCTCAGTACGCTGGATTTGAAGGAAATAAAACGGGTGAGGAGGAAAGGGATGCTGATGATGTTGCAGGACGCCAAGGAGGATTGTGAAAGTGAAAAGGGGGCCCATAAATTGGACAAGATGTTAGAGGACCACAGAACGTCGTTGTACCCAGGTTGCGAGCAGGGGCACAAAAAGTTGGATACCACTCTGGAGTTCTTGCAATGGAAGGCAAAAAATGGTGTTAGTGACAAGGCATTTGGCGATTTATTGAAACTCGTCAAGAACATTCTTCCGGAGGTAAACAAATTGCCCGAGACAACGTACGAGGCTAAGAAGATAGTCTGCCCTCTAGGACTGGAAGTTCAGAAGATTCACGCATGTCCGAATGATTGTATCCTGTATCGCGGTGAGGAGTACGAGAACCTAGAAGCATGCCCCATTTGCAAAGCACTACGATACAAGATTAGACGAGATGATCCAGGAGAAGTTGACGGGCAGCTAACGAAGAAAAGAATTCCTGTTAAGAGGAAGTACATAATGATGCCGATTATAATTCAAGGCCCCAAGCAACCTGGTAACGACATCGATGTGTACCTAAGACCACTGGTCGAAGATCTTAAACTGTTGTGGAAGAAGGAAGGTGTCCCCGTGTGGGATGAGGACAAACAGAAGGAGTTTAACCTACGAGCGCTGCTGTTCGTAACCATCAACGATTGGTCTCACCAACTGGGACTAAAGATCCGGGGGTATATATTCCCGATGGCTGATCGCGATGAGGAACAGATACTATACGATACAATCGCAGAGAGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAGCGAGGAGGGGAACGATGAGGAGGAGGCTAGTGGAAGTCATCCCTCCGCTGGACAGAAGAGGGCACTCGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGAAGACGGCCGACCTAGTGCCTCGGCAGAAGCAGCCAAGAATTTTGTACGCCACAGCGGTTGGGTTGTGAGGGACAACGTGCCTGTCAGCACGGTGTACTGGCACAGAACAAGGGCACGCAGGGATAATGACAGCTTTGTCCCGGACTCAGAGAAAGAGATGCTGTGGACCACAATGCTTGAGACGTTCACGCTACCCGCGGGTACGGAGAACATAGTGAAACAGTGGACTCTGAAGAAAATGGCGGAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGACTAACACCGAACTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGATGAGTTTGTTGCTTACAAGACAGGGCGACAAGGGCAAGCGATGATGGCCAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCAATGCCGAAGTGGGAGGAGATGGAGGCAAGTTTGATTGAGAGGGGTATCGAACCGGCCACCACTAAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAATCTAGTTGATGGCTCCCTTGTCTTTAGCGATCAGATACACGAGGCCGCCAGTCGACTAACGGACGCAGTGGTAGCCTCTTGTCAGGGCACATTCCGACCAGACAGAGAGAAGGATGAGCTGTTACTCGCCCTACAGACTCCCGAGCATCCAGGACGAACACGAGGGAAATGTGTGATTCCCTGGAAGATTGGATTTAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCGCACATCGGTCCCAGGATCCCCAGCCGTACATTCATCCTGCAATGGTCAGCCCATCAGGCAATCGTAGCAGCTGCGTCTCAACGGGGCAGGTCGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAAACCACCTGCCCCGTTGATGAGATCACGCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTGGCGTCAGGAATGGCCATCCCAACGGACCCTTCCGGGACTTACCACTACAGGCCGATTCTAGCAGGATACTCGAGTGTCGAAGTTGAGTTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATCATACTATGGCGCAAGCAGTACATCATCCTTCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCTCCGCCACCTCCTGCTGCACCATCTCCTCCGGCTCCTCTAGCTCCTCCGCCTCCACCGTGTTCGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACTGCTTGCCCGCACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCACCAAAGACAAGGAGCCACCGTACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAGGTGAAGAGGCAACTCAAGCCTTGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCACAACAAACAAGGAGGCGTTACAGATATCGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCGAAGATTTTGGCATAACGGAATTCATTTCAGACACCGGTCTAACTGTGGATCAGTTGGTTGGAGGAGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAAACCTAAACAGCTGCAGTCCCTACCGACACAGATGTACAAATTCCATGAATGGTACATGGAAATGAGTGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTCTGGATCCATTTCAAGGATCTCTTCGATCTGTACCAGTTGGACGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTCTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAACATTTCAAGACGTACATACTACTGCCGTACAACACAGAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGATAAGGTCTTCAAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTGATTTTCCATGTGCAAAGCAGGACCAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCCCACTGCCTATCAAACCAAATATGCACAACACGAGAGCTCGATCGTATTCACATGAGGGATAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGATTCATCAACGAAGAAGTCCTTAATCTCGACGGTGAATTCTACTACGACGGATCGACAATTCATAACGTCGGTCCTTCCTCTTCTGACATAACACCGGCGTCAAAGTCGTAG >LOC_Os08g33510 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGAGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAACTTCAAGGGAGATCTGTACAAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTATTCGGCGTTCAGATACGAGAGGCTGCGCAACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCCGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCGCAGAGCATGGACGCCATGCAAACACTGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCATGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGGTCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCTCCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCACACATATCTACGAACTATACCAGCTGGACGCCGTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACTCGCTAG >LOC_Os08g11300 ATGTCATGGCACAGGGCCGGTGTCCTGCTGCTAGGGGCTCAGTCCTGCCTGCCTGTCCCGGGGGTTTCGGCCGTAGGTGGGATTGGGTCGGTACTCTTGTCTATGGCTAGGATGGGTTGGAAACTATGTCACGTCTTCCGTCTGTATACCGTGGTGATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTATAAGATAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCAAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTTGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGAACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTACATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGATGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTATTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTGTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os08g16340 ATGGTCCCACTAGAAGATAGTTCCAGCAGCGACGTAGCTCAGGAAGACAATGAATACTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGGCGACAGTGAAGAAGGCGACAAAGACTACATTCCCCCTAAAGAAGGGGAAACGGTGCCACGGCGATCAAAACGGCAGCCGAAGAAAAAAGTTCCGTCGCAAATTGACGAGGTACCAGCTAACACAACCGGCTCAAAGAAAAGCGAACGGTCAGCTAAGGCGAAGAAAAGGAAGGGCGAGAGAAGCATGAATAGAAAGGATGAAAGGTTCCATGTTGTTACCCATGTTTCGCCAAAAGGAGAGCCGCTCGCCCCTAAGATGGCACGTGCGAAATTCAGTTCACAGTGTGGCACAATATTCCCGGATGGATCGGAGGCAGCTGTGAGGAATTGCGCACTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAACCACCTTGCACACGAAATTTGTGAAGAAGGGACGCACACCGTTTTCGACATATGCCAACATAACCCCAAATCAGTGGGACGACTTTCTGACGTTGAAGAACTCCCCGGAGGACATTCAAAGGAGCCAAAAGTATGCAGAGTTGGCCCAGAAGAACAAATTTCCTCATCGCTTAGGCTCCGCGGGATACACACCAAAGGTGGAGCAATGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGGGTCAACCAGTACCAATGGAGGAATGGACATACAGATCAAGGAACTGGATGAGTTGGAAGGAAGGGTTCAAACATGACCCCCACAAGAAGCTTGAAGCGTACAAGGATAAACTTAGAGACGAAGGGGTTGCGGAGTTTGAGAGGCAAATGATGGATTTCTGCGTCAAGCACATGATTTTGCCTCCCCTCGAAACCAAAGAACCTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCCATTGGACGCTCCGGGAAAACTCTTGAGGCCGCTACAGCCATTGCTATCCCTGGGAGAACATACAACGAAGAGTTCATACCCAATGCGTATGCCCAGGTGCAGCCGCAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTTCCCGACTGTAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACTGACGCCAAGCAAAAACCTGTGGTGCCAAAACCGGGGTTGGGAAAACCTCCGAGACCTCCTAAGAGGAAGGTGACTGATAAGGCGGAGGAACCCGAGATGCAAAAGGAAAATCCAGTGCCGGAAGTGCCACCGGAGATTGCAGTGCCGGAGGCAGCCCTGGAGACTCCAGTGCCAGAAGTGCCCATAGAGATTACAGTGGCAGAACTAGAGGTGCAATTTGCGGCATCAGTCGGGTCAGAAATAGAAGAAGTACCAGGATTGGAATGGGACGGTACAGAGCCAAAAATATTTGAAGACCCTTCTCCTGCAAAAGACCCCGATGTGCAAGAGACCACGGTCCCTGAGAAGGCCACTACCAATTCTGAGGTGCCTAGAGTGCTTAGGAGCCACGACTCCAAGTCCAAAGATGAGAACAAAGAGAAGTTCATGGTAACCGTCTTCAGAGGGGGTAAGGAACGTGCCAAGCTCAGAGATGATGACCCCCAAAAGGCCGTTGAACTAGCCGGGCCAACATACTTCTCAACCGATGATTGCCCGGAAAAGATGCAATACATGGATGCTAAGAAGACAAAAGAATCTATCTGCTTCTTGGATCCAACTCGGATCTGCCAAACACAACATATCGTGAGGCTAGCACCAGGGTCAGACCAGCTGAAGGGCAAGACTCCAAAAGAGATAGCTGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTATTGTCGCATACAATCATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGACCCTCTCGATTACCGTCACCAGTCATACAAAGAATTTCTAACAATCTTACATGCGTACCAGTACTACAAGTTCAAGGGTGGAGAACAGACCCGAACAAGGGAGAAGCTGCTATGTCACAAGCAACCGCGAGGAATGGTTCTTTGCGGGTATTACGCTTGCGAATTCCTTAGAGTTAATGGGAGGTACAGGACTAACGCGGAGAATTTGCCAAGATTAGAATGTCGAACAAGCTTTGACGATACAGACATCAAAAATGTCCAGCGTGATCTGTGTCACTTTATCTACAATGAGTGCTGTCATGTGAAAGGAGATTTCTTTGACCCAGAGGGTGCCCTAGCCACAAGTGACGAATTCAAGGATCTTCGGGAGTGGAACATTGCTATGCCATAA >LOC_Os08g34530 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAAAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAATTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAAAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAAGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACTGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGATCAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGATAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACTTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os08g35400 ATGGAGTTCCTATGCTTCCTGAACTTAGTACACGGCCGTTATAGGAAACTTGGCGGGTTCATAAAGAATCCAAAGAGAGATAAACTCTACGTAAAGGGACGCTGGCCGTGTTACAAGCAACCGAACTTGTCGAACCTATGCGGATATTACGTGTGCGAGATGCTCAGGGTCTGTGGGAGATACAGAACTGAGTTTACATATCTCCCGAGCATCCCTTATAACGCAAGCTGGTTCGATCAGAAAACGCTTATCAACTTATGCGTGGACTTATGCCGGTTCATTCATCGTGACATCTGTAACCATCTAGAAGAGTTCCACGATCCTCATAGCGAACTTGCTACAGACCCCAAATTCAAGAACCTAAGGGAGTGGGAGAGGGAACATGCTGTGGACTAA >LOC_Os08g17740 ATGAGTTGGAAGGAAGGGTTTAAACATGACCCCCACAAGAAGTGTGAAGCGTACAAGGATAAACTTAGAGACGAAGGGGCTGCGGAGTTTGAAAGGCAAATGATGGATTTCTGCGTCAGGCACATGCTTTTGCCTCGCCCCGAAACCAAAGAACCTGAGCCAGAATACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCCATTGGACGCTCCGGGAAAACTCTTGAGGCCGCTACAACCATTGCTATCCCTGGGAGAACATATAATGAAGAGTTCATACCCGATGCGTATGCCAAGGTGCAGCCGCAAGTGGTCCATGAAGGGTTTGAGTCCTACGACATTGACTTCCCGACTGCAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACCGACGCCACGCAAAAACCTGTGGTACCAAAACCGGGGTTGGGAAAACCTCCGAGACCTCCTAAGAGGAAGCTGACTGATAAGGCGGAGGAACTAGAGGTGCATAAGGAAAATCCAGTGCCAGAAGTGCCACCGGAGATTGCACTACCGGAGCTGCCCATGGAGATTCCAGTGGCAGATGTCCAAATGGAGATTACAGTGGCAGAACCAGAGGTGCAATTGTTCGCATCAGTCGGGACTGAAATAGAAAAAGTACCAGGATTGGAATGGGACGGTACAGAGCCAGAAATATTTGAAGACCCTTCTCCTACGAAAGACCCCGAGGTGCAAGAGACCACGGTCTCTGAGAAGACCACTACCAGTTCTGAGGTGCCTAGAGTGCTTAGGAGCCACGACTCCAAATCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACCGTCTTCAGAGGACGTAAGGAACGTGCCAAGCTCAGAGATGATGACCCCCAGAAGGCCACTGACCTAGCCGGGCCAACATACTTTGCAACTTATGATTGCTCGGAAAAGTACGAACATGAGAAAGTACTCTTGCCGGATTGGGCACTATATGAAGGACCATGGGAGATGAAAAGGTTACATACCTTCTACATGGAAGCCAGCAAGAAAAGCTTGGGCAATATAACAGCTCGATCACCGGCAGATTGTTTCAGCGAAGAAGGTTACGTATGGCTAGATTTCTCAGATCTCCACGCCATATATCGTCGGGATAGGATGGACGTCAACTATGTCGGTGTTTGGTGCATGATGCAATACATGGATGCTAAGAAGACAAAAGAACCTATCAACTTCTTGGATCCAACTCGGATCTACCAAACACAGCATACTGTGAAGCTAGCACCAGGGTCAGACCAGCTGAAGGGTAAGACTCCAAAAGAGATAGCTGAATACAGGAACGGCTTGCACAAGGAGAAATTGATTACTATCGCACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCTGCTTATAATTTTAACGCGTACGAGTACTACAAGTTCAAGGGTGGAGAACAGACCCGAACAAGGGAGAAGCTGCTAATACGTACCTATTGGCCGTTACCAAGATTAGAACATCGAACAAGCTTTGACGATACAGGCATCAAAAATATCCAACGTGATCTGTGCCATTTCATCTACCATGAGTGTTGTCATGTGAAAGGAGATTTCTTCGACCCAGAGGGTGCCCTAGCGACAAGTGACGAATTTAAGGATCTTCGGGAGTGGAACACTGCTATGCCATAA >LOC_Os08g28310 ATGGATGAAGTCGGGTGTCGATGGACATTCTCCAGGACAAATGAAGGCTACACGAGCTGCGGCCCGGCAATTTTCCCGGTCGCGACACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGCGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCATTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTCAACCCCATCCTCAGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGGCCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAGCTAAAAAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAACAAGTGCACATACCAGATGGTACTACATCCGAACCGAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTGGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTCACACAAGTACTACCACAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGATCCCCGAAATCCCATATATTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGTAA >LOC_Os08g28760 ATGGACAAGTCTTGGCGTGGTTGGAAAACCACCTTGAACAAGAAATTTGTGATGATGGGATGTACACCGTTTTCGACGTATGCCAACGTAACCCCGAAGCAGTGGGACGACTTTCTGACGTTCAAGAACTCCCCAGAAGAAGTTGAAAGGAGCAAAAAGTTTTCAGAGTTAGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCCGCGGGATACGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGGTGGGGCAACTGGTACCAATGGAGGAATGGACACAGAGATCAAGGAACTGGGTAAGAGCTAGAACTCCTAAGATCATGGATGAAGGCAAAGTATCGTTTGAAGATCCGGAGCTGCAGGAGGTGGCCGATAAAATAGAGAATTTATCCAGTGCACAGAAGAAAGGAGCTTTTAGGCCTAAGAGGGAGAAAGATGTGCTAAGTACGGCGCTGGGTACTCCTGAGCATGGAGGTAGGCATATGCTTTTCCCTCCCCCCAAAACCAAAGAGCCTGAGCAAGATTACCCCTTTGTTGACCTCAAGGAGAATACTCCCTGCAGATTGCACGTTCCCATTGGACGCTCCGGGAAAACTTTTGAGGCCGCTACAGCCATTGCTATTCCTGGAAGAACATATAATGAAGAGTTCATAGACGATGTGTATGCCAAAGTGCAGCCGCAAGTGGTCCACGAGGGGTATGAGTCCTACGACGTAGACTTCCTTACTCAAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACCGACGCCACGCGAAAACCTGTGGTGCCAAAACCGGGGTTGGCAAAACCTCCGAGACCTCCTAAGAGGAAGGTGACTGATAAGGCGGAGGAACCCGAGATGCATATGGAAAATCCAGTGCTGGAAGTGCCACCGGAGATTGCAGTGCCAGAGGTGCCCATGGAGATTACAGTGGCAGAACCAGAGGTGCAATTTGTGGCATCAGTCGGGACAGAAATAGAAGAAGTACCAGGATTGGAATGGGACGGTACAGAGCTAGAAATATTTGAAGACCCTTCTCCTACGAAAGACCCCGAGGTGCAAGAGACCACGGTCCCTAAGAAGGTCACTACCAGTTCTGAGGTGCCTAGAGTGCTTAGGAGCCACAACTCCAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACCGTCTTCAGAGGGGGTAAGCAACATGCCAAACTCAGAGATGATGACCCCCAGAAGGCCGCTGAACTAGCAGGGCCAACATACTTGGCAACTGATGATTGCCTGGAAAAGTACGAACATGGGAAAGCACTCTTGCCGGATTGCGCACTAAACGAAGGACCATGGGAGATGAGAAGGTTACATACCTTCTACATGGAAGCCAGCAAGAAAGGCTTGGGCAATATAATAGTTCGATCACCGGTAGATTGTTTCGGCGCCGAAGGATGCAATACATGGATACTAAGAAGAAAAAAAGAACCTATCGGCTTCTTGGATCCAACTCGGATATGTCAAACACAGCATACCGTAAGGCTAGCACCAGGGTCAGACCAGCTGAAGGGGAAGACTCCAAAAGAGATAGCTAAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTATCACACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTTGTCATGGCCGCTTATAATTTTAACGATCATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGACCCTCTCGAGTACAGACACCAGTCATATAAAGAATTTCTAACAATCTTACAGTATGCGTTCCAATACTACAAGTTCAAGGGTGGAGAACAAACCCGAACAAGGGAGAAGCTGCTATGTCACAAGCAACTGCGAGGAACGGTCCTTTGCAGGTATTACGCGTGCGAATTCCTTAGGGTTAATGGGAGGTACAGGGTTAACGCAGAGGATTTGCCAAGATTAGAACGTCGAACAAGCTTTGACGATACATGCATCACAAATGTCCAGCGTGATCTATGCCACTTCATCCACCATGAGTGCTGTCATGTGAAAGGAGATATCTTCAACCCAGAGGGTGCCTTAGCGACAAGTAACAAATTTAAGGATCTTCGGGAGTGGAACACTGCTATGCCATAA >LOC_Os08g12280 ATGGAGGTGGATGAAGTCGGGGGTCGATGGACATTCTCCAGGGCAAATGAAGGCTACACGAGCTGCGGCCCGGTAGTCGAGATGTCATGGCACAGGGCCGGTGTCCTGCTGCTAGGGGCTCAGTCCTACCTGCCTGTCCCGGGGGTTCCGGCCGTAGGCGGGATTGGGTCGGTACTCTTGTCTATGGCTAGGATGGGTTGGAAACTATGTCACGTCTTCCGTCTGTATACCGTGGTGGTTGTGTCGGGAATGGCCATCCCAACGGACCCTTCAGGGACTTACCACTGTAGGCCGATTCCTGCAGGATACTCGAGAGTCGAAGTTGAGCTGGTGGAAGCCACGTACGAGGACCTCGAATTGGACTACCCTGGAGGAGACGGTGAGACGCATCTACGTGACACAAGCCACGCCATTATACTATGGCGCAAGCGCTACCTCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCCCCTCCGGCTCCACCGTCTCCTCCTCAGGCTCCTGCACCGTCTCCTCCTGATCAGGCTCCTGCGCCGTGTCCTCCGGCACCTTCTAAGTCAAGAACTCACCAAGCTCCACTGCCTGCCGGCACAAGGGCAATGAAGAAGGCGAAAGTTGACGCCGCCGAGAACAAGGAGCCGCCGTACGATTGCACGCAAGAGGAGCTTGACGCTTATGTGGCTGTAGAAATTCCTATAGACCCGAGTGCCAACAAGTTCTTCCAGAAGATGTCGGGACCACTCAAGCAGGCCTTAAAGCTAACGGACTATGAGCGAACACTTAGGAAAGCATATTATAGAAAGTCCAAAAAAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGGTCGAGCCATTGGTGACTGGGCAAGAAATTGGAATAAAAGAATTCATTTCTGATATCGGGCTAACTAGGGCTCAGTTACTTAGAGGTGCACCTCCAAAGGCGGAAGTGAGACACCTTGACGAACTTGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCCACACAGATGTACCAATTCCATGAATGGTACATGGAGATGAGCGCCAGCGGTAGGGAGATTATTGGAGCGAGAATCAAGAACTCCGACTTCTTACAAGGAGAAGATGTTCTCTGGATCAATTTCAAGGATATCTACGAACTATACCAACTAGATGCCCTCGACGTCTCTATTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCTCGACAGCGGGGGTTTTTCAATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGAAATGGTCACCAAGTATCCGCAACCCACAGAGGAATGTAGAGTCAATGTCTATGACTCAATGAATAAAGATGAGTCTACTTTTGACCAGATTTTTGAACTTATAAACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGTGGCACTTGGAAAGAAAAACTTCGCCGGAGGTTCAAATTTGTATGTGCAAAACAGGAAGAGGGAACTAACTTGTGCGGCTACTACATATGCGAGTATTGCCACTGCGTTACAACCCAAATCATCACCACAAGAGAACTCGATGTTATTCACATGAGGGACAACCTCACACACGAGGACTTTATCACGGCTGTTCAAGAACAACTCATGGGATTCATCAATGAACAAGTCCTTGATCCCGAGGGTGAATTCTACTACGACGGATCTACAATTCATAAGTCGTTAACTTCTGAGATAACGACTACGTCGAAGTCGTAG >LOC_Os08g34590 ATGGCTGATCGCGATGAGGAACAGATACTATACGATACAATTGCAGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGACGATCCACACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGGGAACGATGAGGAGGAGGCTAGTGGAAGTCATCCCTCCGCTGGACAGAAGAGGGCACGCAGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGATGGACGAAGACGGCCGACCTAGTGCCCCGGCAGAAGCAGCCAAGAATTTTGTACGCCATAGCGGTTGGGTTGTGAGGGACAACGTGCCTGTCAGCACGGTGTACTGGCGCAGAACAAGGGCACGCGGGGATAATGACAGCTTTGTCCCGGACTTAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTCACGCTACCCGCGGGTACGGAGAACATAGTGAAACAGTGGACTCTGAAGAAAATGGCAGAACAGTTCGAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGACTAACACCGAACTTCGACACAGGGCAACAAGGGCAAGCGATGATGGCCAGAAACAAAGACAACGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCAATGCCGAAGTGGGAGGAGATGGAGGCAAGTTTGATTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTTTGGTACTATGCTCACGGTGGAACGTTTAACCCAGTTGATGGCTCCCTTGTCTTTAGCGATCAGATACGCGAGGCTGTGGCGTCGGGAATGGCCATCCCAACGGACCCTTCCGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATCATACTATGGCGCAAGCAGTACATCATCCTTCCTGGGCGACAAGCGGCGTCTCGTGCACCAACTCCTCCGGCTCCTCCGCCACCTCCTGCTGCACCATCTCCTCCGGCTCCTCCGGCTCCTCCGCCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCGCCTGCCCGCACAAGGGCAACGAAGAAGGTGAAAGTTGACGCCACCAAAAACAAGGAGCCACCGTACGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAGGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCACAACAAACAAGGAGGCGTTACAGATATTGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCGAAGATTTTGGCATAACGGAATTCATTTCAAACACCGGTCTAACTGTGGATCAGTTGGTTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTTGGTAAACCGCTTGTCAAACCTGAACAGCTGCAGTCCCTACCAACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCAAGGGTAGAGAGATGTTCAGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTCTGGATCCATTTCAAGGATCTCTTCGATCTTTACCAGTTGGACGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTCTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACACAAAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTACATACTACTGCCGTACAACACAGAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCAAACTGATAGACAGGTAA >LOC_Os08g04870 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGATCGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGAAACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGTCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTACCTTGATTGAGAGGGGTATCGAACCGGCAACATCCAATTGGCCGGAACGATTGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGCGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCACCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGTGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACTTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCAGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAAGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCAACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTAAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACATTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTCGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTACCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os08g13300 ATGCCGCCGCCGCCATGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCGCCGCCGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACAAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACAATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACAAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTGAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCATCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACAAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCTGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTACATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTTAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACATACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCATCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTTAAGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCATTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCAAAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGTATGAGGGATAACCTGACAACACACAAGGAATTTATCGCAGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os08g36730 ATGGCTGACCGCGATAAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGAATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTTCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCTAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAGGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTTGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTAATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGGCATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTGTATTATGAGTTGCTGGATTTTATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os08g26280 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACTCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCGCCGCCGCCACGCTGCCGCGCCAACCACCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGCTCGAACGAACGAGAGCGAGAACGAGAACGATCGATCGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAACGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACATAGAGAGGGATGCGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAACCGACCATTCCTCCTGTAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATACTGCACCGTCTCCTCCTCATGCTTCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACACCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAGGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGATATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATAACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACAGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACAAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTATTGCCATACAACACAGAATTCCATTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os08g15310 ATGGCCAAGTCTTGGCATGGTTGGAAAACCACCTTGAACAAGAAATTTGTGAAGACGGGACGTACACCGTTTTCGACGTATGCCAACATAACCCCGAATCAGTGGGAGGACTTTCTGACGTTGAAGAACTCCCCGGAAGAAATTCAAAGGAGCCAAAAGTATTCAGAGTTGGCCAAAAATAACAAATTTCCTCATCGCTTAGGCTTCACGGGATACGCACCAAAGGTGGAGCAGTGGACAAAAGAGGGTGAGGAAATGAGGAAGGCGGGGCTTCCGGTACCAATGGAGAAATGGACACAGAGATCAAGGAATTGGGTAAGAGCTAGAACTCCGAAGATCATGGATGAAGGCAAAGTATCGTTTCAAGATCCGAAGCTGCAGGGTGTTGCCGATAAAATAGAGAATTTATCTAGTTCACAGAAGAAAGGATTTTTTAAGCCTAAGAGGGAGAAAGATGTGCTAAGTACGGCGCTGGGTACTCCTGAGCATGGGGGTAGGGCCGTTACAGCCATTGCTATCCCTGAGAGAACATATAATGAAGAGTTCATACCCGATGCGTATGCCAAAGTGCAGCAACAAGTGGTCCACGAAGGGTTTGAGTCCTATGACATTGACTTCCCTACTGCAGATGGTGTATCCGTACTTGGGGATGCGGTCGATATTGTAATTATCTGGCACAAGAATGACATATCCTTTGGATTGGGCACCGACGCCACGCGAAAACCTCTGGTGCCAAAACCGGGGTTGGGAAAACCTCCAAGACCTCCTAAGAAGAAGGTGACTGATAAGGCGGAGGAACCCGAGATGCATAAGGAAAATCTAGTGCCAGAAGTGCCACCGGAGATTGAAGTGCCGGAGGTGCCCATGGAGATTGCAGTGCCAGATGTCCAAATGGAGATTAAAGTGACCGAACCAGAGGTGCAAGTTGTGGCATCAGTCGGGACAGAAATAGAAGAAGTACTAGGATTGGAATGGGATGTTACAGAGCCAGAAATATTTGAAGACCCTTCTCCTGCGAAAGACCCCGAGGTGCAAGAGACCACGGTCCCTGAGAAGGCCACTACCAGTTCTGAGGTGCCTAGAGTGGTTAGGAGCCACGACTCCAAGTCCAAAGATGAGAACAAGGAGAAGTTCATGGTAACCGTCTGTAGAGGTGGTAAGGAACGTGCCAAGCTCAGAGATGATGAACCCCAGAAGGCCGCTGAACTAACCGGGCCAACATACTTCACAACTGATGATTGCCCGGAAAAGTACGAACATGGGAAATCACTCTTGCCGAAATGGGCACTGAAGGAAGGACCATGGGAGATGAGAAGGATGCAATACATGGATGCTAAGAAGAAAAAAGAACCTATCGACTTCTTGGATCCAACTCGGATCTGCCAAACACAGCATACCGTGAGGTTAGCACCAGGGTCTGACCAGCTGAAGGGCAAGAATCCAAAAGAGATAGCTGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTAGTGTCACACAGTACATTGGACGAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTTAATGCGTACCAATACTACAAGTTCAAGGGTGGAGAACAGACCCGAACAAGGGAGAAGCTGCTATGTCACAAGCAACTGCGAGGAACGGTCCGTTGCAAGTATTATGCGTGCGAATTCCTTAGGGTTAATGTGAGGTACAAGACTAACGCGGAGGATTTGCCAAGATTAGAATGTCGAACAAGCTTTGACGATACAGGCATCACAAATATCCAGCGTGATCTGTGCCACTTCATCCACCATAAGTACTGTCATGTGAAAGGAGATTTCTTCGACCCAGAGGTTGCCCTAGCGGCAAGTGACGAATTCAAGGATCTTTGGGAGTGGAACACTGCTATGCCATAA >LOC_Os08g23340 ATGTCGAACGAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTCCGGTAGCAATAAGCATCCAGGCGCTTCTAGTGAAGAAACGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCATCGAGCCACCGATAGTGCGGTCCAAGTTCATCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCGTACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAAATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTTCCACGGAGGGAGAGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCATTTCCAAGGTTATTCCCTAATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCTAGCAGTGTAGGCTCAGTGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTCAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGACCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAACTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAAGAAGTGCACATACCAGATGGTACTACATCCGAACCAAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGCTATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGACAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os08g30310 ATGATCGACAAGTATGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTGACGCAGCAGCATTTCAAGACATTCATACTACTGCCGTACAACACAGAATTCCACTGGGTCCTGTTACTTTTCGACTTGGACGCATGCAAAGTCAATGTGTATGACTCAATGAATAAAGAGGACAAGACTTTTGACAAGTTTTTTCAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTAATTTTCCACGTATTCACATAAGAGACAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGATTCATCAACGAAGAAGTCCATAATCCCAAGGGTGAATTCTACTACGACGGATCGACAATTCATAACATCGGTCCTTCTTCTTCTGACATAACGCCGGCGTCGAAGTCATAG >LOC_Os08g12260 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGTGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCAGAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGAAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGATTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCCAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAAGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCAAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCGTCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACTTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGAAAGACATGACGATAGAAGAATTTATTATTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACGTGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACCCGGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGGAATCTACGAAGTATACCAGCTGGACGCCCTCGATGTCTCTATTATGAGTTGCTGGACTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTTGGAATGCTCGACCAATATCCGCAGGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTACCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAATGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAACTGGAGAGAAAGACTTAGGCGGAGGTTCAAATTTCCTTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCAGCGGTTCAATAA >LOC_Os08g10230 ATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTACACCGTCTCCTCCTCATACTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCATCGACTCCTCCTCGTGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAGGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCTCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGAAAGACATGACGATAGAAGAATTTATTATTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACGTGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACCCGGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGAAATCTACAAAGTATACCAGCTGGACGCCTTCGACGTCTCTATTATGAGTTGCTGGACTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTTATCGACCCTCGGAGAGTAAACGTTGCAATGCTCGACCAATATCCGCAGGAAACAGAGGACAATCTCATCCATCTCCTGACGGCGCAGCATTACAAGACGTTCATACTGTTACCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAATGTATATGACTCAATGGATAAAAAAGAGTCTATGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAACTGGAGAGAAAGATTTAGGCGGAGGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACATAAGGAATTTATCGCAGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCATGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os08g08310 ATGCCGCCGCCGCCACGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGCCACGCCGCCGCGCCAACCACCGCCCCGATGCCGCCACACCACCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAATGATCGATCGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAACGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGTATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCAGAGGGGAACCAGGAGGAGGAGGCTAGTGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAATGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCAGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACAGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGGGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAACGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGAAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACATGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGGGGGTTACGAACCGGGACTACAGAGGGTTTCTCCACCAGTGTTCTCTAGACTGGGGCCTCCTCGATTCGGACTACCTACGAAAGATGGCTGGTGGGCACACACACCGGACGGAGGCGGAGCTCAAAGCCTTCCTGGACAGTTGCATGGAGGAAATCGAGGGCCGCACCATCACCGGCAGCTGCTCGAAAGCTCAGGACTACGTCAATCTGCAGGCAGCGATTTACGAGAAGGCCAGCAAGGTTGTGAACAAGAACTAG >LOC_Os08g03740 ATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAATTTACGTTTGATAAGGTTTTTGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGTGACAACCGGAGAGAAAGACTTAGGTGGAGGTTCAAATTTCCTTGCGCAAAGCAAAAGATGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCTAAGGGTGAATTCTACTACGACGGAAACACAATTCATCGGTCTTTAGTTTCTGAGCTAGCAGCGAGTACTACTACTACGTCGAAATCGTAG >LOC_Os08g16080 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACATGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGTTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCAGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATATACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCATCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCTGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAAAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGAACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAATTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAATGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCAATTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGATATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCTCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os08g31350 ATGTCGGGCAAGACAGCTCCGGTGGGCACAGAACCGACGGTCAATAAACCTAACGGGCAGGACAGCTCCGTCGGACATAGAACCGATGTCACTAACAAGCCCCAACACGAAGAAGATGCCGGGAAGGTACCGGCGTCGAGCGGGGAATCGTGGCGCACACCGAGCGACCCGTTTGAGCTAGAACTAGCGCAATTGCAGTATGAAAGACCTGAGGATGACCCCGATTATATTCCTATTGAGCAGGCGATGGCAACCCGTCGTCGGTCAAAACGAAGTGCCGTCAGGGTTGAACCTGATTCGGACACAGCGACCTCGGGACCACCGCGAACGGACACGACAACGAGTGGGGGAGCTTGTCCAAAGAAAAAACGTGGCGAGAAGGGCAGGAACCTCATGCCGAAGGAGACGTACTACATTGCTGCTCTCGACAATGACGGCAAACCCGTCGAGCCGGAACATGTAAGGGCGAAGTTTAGCACCACATGCGGCGCGCTGGCAAGGCTTCATGGGCCTCTCAACGTGGACAAATGGAAGCACATTAGCATTCACATCAAGAACTTAATGTGGGAAGGTCTGCAGGAGCACCTTATTTATCCGCCTGGGTCGGATGCACTTGGCCGGAAATTTGCACTACAAACAATTGCCCATCGGTGGCGACAGTGGAAGTCGGACATGAACACCAATTATGTTAAGAAGAATAAGATTCCATTTGAAGAATGGGGCACCGTTTCAGCAGCTGAGTGGGACAAGTTCGTGCCCAAGATGACAACGCCTCAAGCTCTAGAAAGGAGGAAGAAGATGTCGGACCTGGCGAAGAAGAACATATATCCACACAGAACTTCGGGGGAAGTGACAGAAGAGGGTGAGATGTTGGTGGACTGTCCGGACATCCAGAACGTGACAACGTCTCTCCAGCAGATCGTCCAGAAGGAGAAGACCGGTGAGTTCGTCCCTCGACGGCAACATGATGAGCTGACCGAAGCTTTGGGAACTGCTGAACACTTCGGTAGGGAAGCCCAAAGTTACAAGAAGCGCGACGCCTACAAGGCCAAGATGCGCCAGGAAATCACAGATGAAGTCACACAACAAGTCACCCAACAGTTCTACAGTCTTGCCGCACAACATCCTCAAGCCTTCCCTGACCTACTTCCTCATGGTTCGCAGTCGACACAGATCCCAAGCTCTGTCGGGTCGGTAGAAAATACAACCTACCCGGGTCGAAGGGGTCCGCTAAAGCCAGTTGGACCTGATCAGTATTCGGACGCACAGAAGAGCGTTGTAGGTCTTGCTAACAAAATGCAATCTTGGACCTCCGATGAAGTGCCTAAGGAGTATGAATATGGCAAGTCGTTTTTGCCGTTCAACTTAATGTGTGAACTCCCATGGCAAATGAGGTTGATGCATGAGTGGTACTTGAGGGCAAGTGAGTTAGGTCTCGGGATAATTACTGTGCATGTCCTGGAAGGCGCTTTCAAGGATGGACCTAATGCAAACTTCGCCTTCAGTTTCAAGGACCTCCACGTATTCTTTAAGATGGATAAAATGGATATCAATCTCGTCGCCGCGTGGTACCTCGAACACTACATACAATTCCTCGTCTATCCAACGGACCAAACCGTCGTAGTTCTTGATCCGGCGGACTATGACAAGGACGCGTACATGGAGTTCCTATGCTTGCTGAACTTAGCACACGACCGTTATAAGAAACATGGCGGGTATGTTAAGAATCCAAGTAGAGAGAAACTGTACATAAGAGGACACTGGCCGTGTTATAAGCAACCTAGCTTGACGAACCTATGCGGTTATTACTTGTGCGAGATGCTCAGGGTCAATGGGAGATACAGAACTGAGTTTACAGATCTCCTGAGTATCCCTTATAGCGCAAGCCGGTTCGATCAGAAAACGCTTATCAACTTGTGCACGGACTTGTGCCGGTACATTCGTCGTGACATCTGTAATCATCTAGGAGAGTTCCATGATCCTCATAGCGAACTTGCTACGGACCCCAAATTTAAGAATCTAAGAGAGTGGGAGAGGCAACATGCTGTGGACTAA >LOC_Os08g24590 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACAAGGAAGGGAACGTGGAGAGGGATGTGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGCGCAACGAGGTGCAGCGAAGAAGCTAGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGATGTCCTAGTGCCCCAGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAAAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGAGCTGTACAAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACTTTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAGACAAAGAAAATGCCGCCAAGAAGAAGTACCATCATCACTTAGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGGGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACCGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGGTCACGATGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGCCTATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCGGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGAAGTCGGATAAGGAGTAAGAGAGATATCGAGGCGAAGATTGCAGATCTAGAGTTCCGGGTATCGAGCTACGAACTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGACGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATAGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGATAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTATATATTCCTTACAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACTGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTTAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCACAAGTTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGGGTATGTCTGCATCTGTCAAGGAAGCCATCAAGCTATCAGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTACTGCAGTCCCTACCCACACAAATGTATAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAAAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGAGATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCAGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGATCACACATAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTAATACGTCGAAATCGTAG >LOC_Os08g06970 ATGTCGAACGAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTCCGGTAGCAATAAGCAGCCAGGCGCTTCTAGTGAAGAAACATGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTAACCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCATCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGTCTGACTGGGACACGTTTGTTGCGGATCATACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAGATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAATTCGTCCCACGGAGGGAGCGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCATTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTCAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGACCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAACTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAACAAGTGCACATACCAGATGGTACTACATCCGAACCAAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATTAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCTGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGACAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os08g27360 ATGGCTGATCGCGATGAGGAACAGATACTATACGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGACGAGGGGAACGTGCAGAGGGATGCGGAGGGGAACGAGGAGGAGGCTAGTGGAAGTCAGCCCTCTACTGGACAGAAGAGGGCACGCGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATTACTGAGGTGGACGAAGACGGCCGACCTAGTGCACCGGCAGAAGCAGCCAAGAATTTTGTACGCCACAGCGGTTGGGTTGTGAGGGACAATGTGCCTGTCAGCACGGTGTACTGGCGCAGAACAAGGGCACGCGGGGATGATGACAGCTTTGTCCCGGACTCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTCACGCTACCCGCGGGTACGGAAAACTTAGTGAAACAGTGGACTCTGAAGAAAATGGCAGAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGACTAACACCGAACTTCGACGTATTCCCAAAGCTAAGGAATCATTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGCTAGAAACACAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCGAAGCTGAAGTGGGAGAAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGATCGATCGAAGTTCTGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGTGAAGATTGCAGATCTGGAGTACAGGGTATCGAGCTACGAGCTTAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCGCACATCGGTCCCAGGATCCCCAGCCGTACATTCATCCTGCAATGGTCGGATCACAGAGCATGGACGCCATGCAAACCCAGGACGAAACCTCCTGCCCCGTTGATGAGAGCACGCAGCGGACACCATGTGAGCTGCATATTCTCTTCAAGAACTTATCAATCAAGGACCTCGAGTTGGACTACCCAGGAGGGGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATCATACTATGGCGCAAGCGGTACATCATCCTTTCTGGGCGACAAGCGGCATTTCGTGCACCATCTACTCCGGCTCCTCCGCCACCTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCACCTCCTGCTGCACCATCTCCTTCGGCTCCTCCGCCACCTCCTGCTGCACCATCTCCTCCGGCTCCTCCGTCTCCTCTGCCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAAGTCTCGCCAAGCTCCACCGCCTGCCCGCACAAGGGCAACAAAGAAGGCGAAAGTTGACGACATCAAAAACAAAGAGCTACCGTACGATTGCAGTCAAGAGGAGCTCGATGCTTATGTGGCAGGAGAGGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGCAATGTCCAAAACAAACAAGGAGGCGTTACAGATATCGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCCCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCGAAGATTTTGACATAACGGATTTCATTGCAGACACCGGTCTATCTGTGGATCAGTTGGTTGGAGCCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAAACCTGAACAGCTGGAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCAACGGTAGAGAGATGTTCGGGGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGACGATATTCTCTGGATCCATTTCAAGGATCTCTTCGATCTGTACCAGTTGGACGCCCTCGACGTCTCTCTCCTGAGCGCATGGATTTTAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAACGTCTTCAAACTGATAGACAGGGCTTGGGATCGGTTCCATCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCATGTGCAAAGCAGGAACAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCCCACTGCCTATCAAACCAAATATGCACAACACGAGAGCTCGATCGTATTCACATGAGGGATAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGATTCATCAACAAAGAAATCCTTAATCCCGACGGTGAATTCTACTACGACGGATCAATAATACATAACGTCGGTCCTTCCTCTTCTGACATAACGCCGGCGTCGAAGTCGAAGTCGTAG >LOC_Os08g30120 ATGGAAAAACACAATGAAGCACAACCCGCGGGTGACAAGGCCAATGAAACTGAACCTATCGGCTTGCAAGTAATCGCGGAAGAATCATCGTCATCAAGCTCCGGTGAAGCAGGGAGTGACTCGTATCACTCGCCGAGTGACCCTCATCCTTCTCCTCCAAGGAAGAATAAGGGCGGTGGTGAGGACGACGAGGTTGACTCGGATTACATTCCCCCTGAGCCGGTGAAGAATGCTCCACGCCGCTCAAAAAGGAAAGCGCAAGCTGCACCTACAGAAAGGGAACCAACTGTGGAAGCCGCATCTGCCGTGTGCCCAACAGCTTCTAGTAAACCCAAAAAAAGAAGAGGCGAGCGAGGCAAAAACGTGCTGTCAAAAGAAGTCCACGCCCTTACGCGGATCGGTGAGAAAGGGGAACCTCTATCGCCTGAAGATGTATGTTCCAAGTATAGCAACCAATGTGGGGCGATAGTAAGGGATAACGTGGAGATCACATTTAAAGATTGGAAGAAAGTTAACCCAGCTAAAAAGAACATGTGTTGGACGGAGCTGAAAAGTAAGTTTTCTTTTCCAGAAGGGACAGACGAAGAAGTAGCGAAGGATTTCGCGCTGAAGACTATGGGCAAGTTATGGCGAAACTGGAAAACGGATCTGAACACGAAATATGTTCAAAAGGATCGCCAACCTTTTAATGACTATGGAAAGATAACAAAGGCCCAGTGGGAAGAATTCGTGGCCTTGAAGACATCAGCGGAAGAAAAAGAGAAGAGCCAGAAAATGTCAGAACTGACAATAAAAAACATCTATCCTCATCATTTGGGATCGGCCGGTTACCGTCCTAAAGCCAAGAAATGGAGAAAAGAAGAAGAAGAATTAAAAAAGGCAGGCAAACCAATTCCTATGGAACATCATAACGAACGAGCCAGGAACTGGGTGCATGCTAGAACCCCATCTTTTAACTCGGAGGGCGATGTAGTCTTCAAAGATCCAAAGCTCCAGCAGGTAGCCAACAAGATGAAGGAGATCGTCACACAACAAAAGGATGGGATATTCGTGCCAGACAGAGAAGTGGACCAACTGTCAGTTGCTTTGGGAACCTCGGAGCATGGAGGCAGCGTTCGAGGAGTCTCCTCAAAGGCTAGTTGGAAGGATGGCTTCAAAGAAGATGCTGCTAGCTACAAGAAACGTGATCGATATAAGGAGGAGACAGGAAAGACAATTCAGGTTGCAACTGGAAGGGCAATGCCAGGGCGCAGATTTCATTGCCAAGATATACCAGATGACTATGCCAAGGAAGAGGTGCGGACGGTAAATGAGGATCATAGGATGTACGAGATAGACTTTCCAACACCCGAGGATATCGTGTACCTTGGAGATGCAGTTGACCAGATAATACTATGGCACAAAAAGGATATTCAATTAGGATCAACGGATTCTCCGCCAAGGATACTGCGGTCACTATGTCATGCCTTGCGTAACATGGACGAAGAACCGAGGGATCCTCCAGAAGATGCATCACCTCGGCATCAACCTGAAAAGCAAGTCGATCAGCCTGAAAAACAAGCAGATGAACCAGAGCTTGCAAAGCAATCCAATCAGCCTGAAAAGCACGCAGATGAACCAGAGCTTGCACATCCAATGCCTGAGCAACCAGAGCCTGAGCAGCCAATGCTTGATAAAGCAGAGCTTGAAAGGGAAGAAGAGGTTGTACAAGAAAGGGAAAAAGAGGTTGTACAAGAGAGGGAAGAAGAGGCTGTAGAAGAGCACAAAGAAAAAAGTGCGCCCAAGAAAAAGTTTGTGGTAAAGGCATTCCCAGGAAGGAAGAGAGATATCAAGGGGAAAGCAAAGGATGTTTATGATAAAAGGAAAGCAAAAGGCCTGAAAATAAGCTTGGATAAAACTTTGAGTTTTATTCCTACCGTTGATGTGCCAGAACTATTTGAGAATGGCAAAGCATTCCTCCCCACATGGGAATTAGAAGAAGGACCTTGGCAATTAAAAAGGTGGCATGAATGGTACATGAAAGCAAGTAGAATAAAAGGCCTTTCATCATTTACAGTTGCCGTTTCAGAGGAGGTTTTCATGAGCGGGCCATGTCTACTACATGTTAGTTTTAAGGATATGCATGCTCTCTACCGTAGGCAAAGACTCGATGCCAATTTGGTCGCCATTTGGTGTCTGATGAATTACGTCATAGCAGAACAGATGCGTGAGACTGTCGGCTTCCTAAACCCTTGCCGTATAAGTAAGCCGAACCACACCTTCACGCTAGATGAGAAGAGGGTACCAGCACATGTTGCGGCCATGACTCCCGAAGAGAGAGATGCATACCTGACAGAAAGGCATCAAGCTAAAATTCGCGATGTGGCTACTTACGTAGCTATAGCACTTGAATCAATGCAGGGCAAAGAATGCATCTACGCCCCATACGCCTTTGACGACCACTGGATTACTTTTCTTCTATATCCAAAGTATAACGAAGTTATAGTCTTGGATTCTCTTGATAAAGACATACAATCATATCAGGAAATCCTCAGAATCTTCGATCTTGCATATAAAAGGTATTACCAGGTAGGCGGACAACGGCGAAACGACAGAGATCAAATATACATCCGCAATAAGTGGCCGTGTCACAAGCAACCGAAGGGAAGCGTATTATGTGGATATTATACTTGCGAGTTCCTTAGGATCAATGGTCAATATTGCAAAAATTATGGAGATCTTCCAAAATTTCCCAAGAGTGATAGGGAGCTGGATGATAAATCCATTCAGAATATACAACGAGACTTGTGCTATTTCATTCACAATGAATGTTGTCACCAGCTTGGGAGGTTTTTTGAGAAAGAAGGGCTTTTGAGCTTGCCAGAAAACGATATTCTTTCTAACTGGAGCAAGCATGCAATTTAA >LOC_Os08g36070 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGCGGAAGAAGATGAACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAGGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACAAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACAACATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAATGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os08g08950 ATGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCACCACCGCCGCCGCCACGCCGCCACGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGATCGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGACAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAATGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAACGAACGTGAACGAGCTAGGGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGAGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAAATGGACATCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGGTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACAAATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCATTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCATGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCAACCAGACAGAGATAGGGACAAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACATACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGTTCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGCAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCAGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGTAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTTGAAATCGTAG >LOC_Os08g14690 ATGGCGTGCCGCTGCCTTAACTCCGCTGCCTTACCTACTTCTGTTTTTGGAATGTATTCTGGATCGCTCGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCTAGAAAAGAAGATTCCTATAGACCCGAGTGTCAGGAACTTCTTCAGGGGAGTTGAACCAATAGAAAAGGCGGAACTGAAATACATGTACGAACTCGGTAAACCGCTTGTTAAGCCCGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACCCGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGAAACAGAGGACAAACTCGTCCATCTCTTGAAGACGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACATAGAGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAACTGGAGAGAAAGACTTAGGCGGAGGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGCACAACTCATGGGATCCATCAACAAAGAAATCCTTGATCCCAAGGGTGAATTCTACTATGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTACCTAGCTAGGACATATAATGGATTGTAA >LOC_Os08g35330 ATGACTCCCGATGAGAGGAAATCTTACATAGCACAAAGGCATCAGGAAAAGGTGCTAGATGTCGCTATGTACATAGCTATGGCGCTTGAATCTACGCAGGACAAGGAGTGTGTTTATGCCCCATATGCCTTTGATGACCATTTGATAGTCTTTCTTCTCTATCCAAAGTACAATGAAGTCAACGTCTTGGATTCTCTCGATAAAGATAGCAAGACCTATCAGGAATTTCTAAGAATTATCGATCTTGCATTTAAAAGAGGTATTATCAGCGAGGCGGACAACGCAAAAACTCAAGAGAACGCATATTCGTCCTCAATAAGTGGCCGGTGGTGTCACAAGCAACCGGTGGGAACAATACTATGCGGATATTACTGTTGTGAGTTCCTAAGGGTTAATGGGAAATATTGTGCGAATTACGACGAGCTTCCAAAATTCCCCAAGTCTGAAAGAGAGCTCGATGATAGATCCATTGAAGACATTCAGCGGGACATGTGCTACTTCATCCACCGTGAGTGCGCACACCAGCTTGGGCAGTTTTTCGACAACGAAGGAGTTTTGGCCTTGCCGGAGAACGAATCCCTGTCTAACTGGAGCAGGCGTTTAATATAG >LOC_Os08g05430 ATGCCGCCGCCGCCACGCCACGCCGCCACCGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCGCCGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACATGAATGAGAACGAGCGAACGAACGTGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGATGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAAACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTAGAGGAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCATCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCAGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACACAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGTGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTATGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCTGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os08g04850 ATGCCGCCGCCGCCATGCCACGCCGCCGCCGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACAAAAGACGTGTTGTCGGAGTCGTCCGTCAAGCCTGAGTGGAAGAGCTAGCCCTAGAAGGAATTGGAGCAGGCAAATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATAAAGAAGAGGGGAATGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAAGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGTTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGAATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCTGGCACCTTCAAAGTCAAGGGCCCCCCCCAGCTCCATCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCATGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTTCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCTATTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAACCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATTTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAAGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCAGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTATCAGCGACTACTACTACATCGAAATCGTAG >LOC_Os08g12870 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAGGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGATGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTGCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAACATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACATAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTATGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os08g28340 ATGTCGAACGAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTCCGGTAGCAATAAGCAGCCAGACGCTTCTAGTGAAGAAACGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAAAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGAAAGCCCGTCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCGTACAACAACTGAAGCAATGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAGATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTTGTCACGTCCTGA >LOC_Os08g08670 ATGGCTGATCGTGATGAGGAACAGATACTGTACGATACAATTGCAGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGCAGAGGGATGTGGAGGGGAACGAGGAGGGGAACGTGGAGAGGGATGCGGTGGGGAACGATGAGGAGGAGGCTAGTGGAATTGATGGCTCCCTGGTCTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCAACCCGACAGAGAGAAGGACGAGCTGTCACTTGCCTTGCAGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGATTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCAAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTATGAGCTCAGCATGCAAGAGGAGGTGGTAGGATCACAGAGCATGGACGCCATGCAAACTCAGGATGAAACCACCTGCCCCTTTGATGAGATCACTCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAAGCTCCTGCACCGACTCTGCCTCAGGCTCCTCCTACTCAAGCTTCTGCAGTGACTCCTCCTCGGGCCCCTGCGCCGACTCCTCCTCAAGCTCCTCGTCCGGCGCCTTCCAAGTCAAGGTCCCACCAAGCTCCACCGCCTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGTTGACACCGCCGAAAACAAGGAGCTGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTATGTGGCAGCAGAAGTCAAGAGGCAATTGAAGCCTCGAAGTCCGGAAAAGAAGATTCCTATAGACCCGAGTGCCAGGAACTTCTTCAGGGGCGCACCAATCCTAAAGACGGAAGTGAAATACAAGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCGACACAGATGTACAAATTCCATCAACTGTACATGGAGATGAGTGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAAAAGATATTCTCTGGATCAATTTCAAGGGTATCTATGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGTTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCTCAATGATCGACAAGTATCCGCAAGCCATAGAGGACAATCTCGTCCATCTCCTGAAGGCGCATCATTACAAAACGTTCATACTATTGCCGTACAACACACAATTAGTTTTTACTATCTTCCTACCAAATTTCATTCCCGCCTACGCAGTCAATGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACCAAGTGTTTGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAAAGAAAGACTTAGGTGGAAGTTTAAATTTCCTTTAAACACCACCTCCATGATCTCCTTCCATTCCCTGCTCCACCTCATCAAGCTCTCATATCTGACACCAGGAACACCTTGGCTCCACTATGTTATACCTGTACTTGCATAA >LOC_Os08g24290 ATGGCCGATAGTACTAAAGGGACTGAAGAGAAGGGTTTAGGGGAGGAAGAGCAGTCGATTGCTGTTGTGGTAGCTGACGAAGACGGTGAGTACTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAAGGCGACGGTGAAGAAGGCAACAAGGACTACATTCCCCCTATAAAAGGGGAAACGGCGCCACGGCGATCAAAACGGCAGCCAAAGAAAAAAGATCCGTCGAAAGACGACGAGGTACCAGCTAACACAACCGGCTCAAAGAAAAGCGAACGGTCAGCAAAGGCGAAGAAAAGGAAGGGCGAGAGAAGCGTGAATAGAAAGGATGAAGGGTTCCATGTTGTTACCCATGTTTCGCCGAAAGGAGAGCCGCTCACCCCTAAGACGGCACTAAGGGAAAAGATCCCCATCACGGTCAAGGACTGGGATCATGTATCGAATGGGGATAAGAAAGTCCTATGGAAAGAGTTAAAGAAAATCTTCCAGTTCCCGGATGGATCAGAGCCAGCAGTGAGGAATTGTGCTCTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAGACCACCTTGAACAAGAAATTTGTGAAGACGGGATGTATACCGTTTTCGACGTATGCCAACATAACCCCGAATCAGTGGGAGGACTTTCTGACGTTGAAGAACTCCCCGAAAGAAATTCAAAGGAGCCAAAAGTATTCAGAGTTGGCCAAGAAAAACAAATTTCCTCATCGCTTAGGCTCTGCGGGATACGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGGCGGGGCTTCCGGTGCCAATGAAGGAATGGACACAGAGATCAAGGAATTGGGTAAGAGCTAGAACTCCGAAGATCACAGATGAAGGCAAAGTATCATTTCAAGATCCGGAGCTGCAGGGTGTTGCCGATAAAATAGAGAATTTATCCAGTTCACAGAAGAAAGGATTTTTCAAGCCTAAGAGGGAGAAAGATGTGCTAAGTACGGTGCTGGGTACTCCTGAGCATGGGGGTAGGGTTCGAGAACCTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCCATTGGACGCTCCGGGAAAACTCTTGAGGCCGCTACAGCCATTGCTATCCCTAGGAGAACATATAATGAAGAGTTCATACCTGATGCGTATGCCAAAGTGCAGCCGCAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTTCCCTACTGCAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACCGACGCCACGCGAAAACCTGAGGTGCCAAAACCGGGGTTAGGAAAGCCTCCGAAACCTCCTAAGAAGAAGGTGATTGAAAAGGCGGAGGAACCCGAGATGCATAAGGAAAATATAGTCCCGGAAGTGGCACCGAAGATTGAAGTGCCAGAGGTGCCCATGGAGATTGCACTGCCGGATGTCCAAATGGAGATTAAAGTGGCTGAACCAGAGGTGCAATTTGTGGCATCAGTCGGGACAGAAATAGAAGAAGTACCAGGATTGGAATGGGACGGTACAGACCTAGAAATATTTGAAGACCCTTCTCCTGCGAAGGACCCCGAGGTGCAAGAGACCACGGTCCCTGAGAAGGCCACTACCAGTTCTGAGGTGCCTAGAGTGCTTAGGAGCCACGACTCCAAGTCCAAAGATAAGAACAAGGAGAAGTTCATGGTAACTGTCTTTAGAGGGGGTAAGGAACGTGCCAAGCTCAGAGATGATGACCCCCAGAAGGCCGCTGAACTAGCCGGGCCAACATACTTCGCAACTGATGATTGCCCGGAAAAGTACGAACATGGGAAAGCACTCTTGCCGGAATGGGCACTGAAGAAAGGACCATGGGAGATGAGAAGGTTACATACCTTCTACATGGAGGCCAGCAAGAAAGGCTTGGGCAACAGCTCGATCATCGGCAGATTGTTTCGGCGAACAAGGATGCAATACATGGATGCTAAGAAGAAAAAAGAACCTATCGGCTTCTTAGATCCAACTCGGATTTGCCAAACACAGCATACCGAGAGGCTAGCACCAGGGTCTGACCAGCTGAAGGGCAAGAATCCAAAACAGATAGCTGAATACAAGAAGGGCTTGCACAAGGAGAATTGA >LOC_Os08g16210 ATGCAATCTTGGAGCTCCGATGAAGTGCCTAAGGAGTATGAATATGGCAAGCCGTTCTTACCGTTCAACTTGATGTGTGAACTTCCATGGCCAATGAGGTTGATGCATCAGTCGTACTTGAGGGCAAGTGAGTTAGGTCTCGGGATGATTACTGTGCATGTCCCGGAAGATGCTTTCAAGGACGGACCTAACGCAAACTTCGCCTTCACTTTCAAGGACCTCCACGCATTCTTTAAGATGGATAAAATGGATATCAATCTTGTCGGCGCGTGGTGCCTCGAGCACTACATATTATTCCTCGTCTATCCAACGGACCAAACCATCGTAGTTCTTGATCCGGCAGACTATGGCAAGGACGCGTACATGGAGTTCCTATGCTTGCTAAACTTAGCACACGGCCGTTATAAGAAACGTGGCGGGTACGTAAAGAATCCAAGTAGAGAGAAACTGTACATAAGGGGACGCTGGCCATGTTATAAGCAACCTAGCTTGACGAACCTATGCGGTTATTACATGTGCGAGATGCTCAGGGTCAATGGGAGATACAAAACTGAGTTTACAGATCTCCCGAGCATCCCTTATAGCGGAAGCCAGTTCGATCAGAAAACACTTATCAACTTGTGCGCGGACTTGTGCCGGTTCATTCGTCGCGACATCTGCAATCATCCAGGAGAGTTCTATGATCCTCATAGCAAACTTGCTACGGACCCCAAATTCAAGAACCTAAGAGAGTGGGAGAGGGAACATGCTGTGGACTAA >LOC_Os08g35830 ATGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCAGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGTCGCCAAGAACTATGTACGTCACAGTGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCAATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTTCTCCTACAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCATCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCTAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATTGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGATATGAGCGCCACCGGTCGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTATTCCACTGGGTGCTTTTACTCTTCGACCTAGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAGCTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os08g03730 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGAAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACACGGGCAACGAGGTGCAGCAAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCTCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTATCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTACGGGTACAGAGGACAAAAGCTTCAAGGGAGATCTGTACCAGAAGTATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCTCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACCGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCGGACAGAGATAGGGACGAGCTGACACTCGCCCTGCATACTCCAGAGCATCGAGGACGAACACGAGAGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCCGGGTATCGAGCTATGAACTCAGAATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGATGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTACAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTTAAAGTTGAGTTGGTCGAAGGCGCGTACGAGGATCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTACACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTACACCGACTCCTCCTCGGGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCTGCCAAGAACAAGGACCCAAGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTTTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGGATGACATGACGATAGAAGAATTTGTTATTGACACCGGTCTATCTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTGAAATACATGTATGAACTCGGTAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCGTCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACCTGGACTTCTTGCAAGGAGATGATATTCTCTAG >LOC_Os08g17730 ATGGCCGATAGTGCTAAAGGGACTGAAAAGAAGGGTTTAGGGGAGCAAGAGCAGTCCCTTGCTGTTGTGGTTGCTCCGGAACCAACGGTCCCACCGGAAGATAGTTCCGACAGCGACGTAGCTGACGAAGATGATGAGTACTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGGCGACGGTGAAGAAGGCGACAAGGACTACATTCCCCCTAAAGAAGGGGAAACGGCGCCACGGCGATCAAAATGGCAGCCGAAGAAAAAAGTTCCGTCGAAAGACGACGAGGTACCAGCTAACACAACCGGCTCAAAGAAAAGCGAACGGTCAGCAAAGGCGAAGAAAAGGAAGGGTGAGAGAAGCGTGAATAGAAAGGATGAAGGGTTCCATGTTGTTACTCTTGTTTCGCCAAAAGGAGAGCCGCTCGCCCCTAAGACAGCACGTGCGAAATTCAGTTTACAGTGTGGCATAATAGTAAGGGAAAAGATCCCCATCACGATCAAGGAATGGGATCATGTATCGAATGGGGATAAGGAAGTCCTATGGAAAGAGTTGAAGAAAATCTTCCAGTTCCCGGATGGATCAGAGGCAGCAGTCAGGAATTGTGCACTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAACCACCTTGAACAAGAAATTTGCGAAGATGGGACGTACACCGTTTTCGACGTATGCCAACATAACCCCGAATCAGTGGGACAACTTTCTGACGTTGAAGAACTCCCCGGAAGAAATTCAAAGGAGCCAAAAGTATACAAGAGTTGGCCAAGAAGAACAATTTTCCTCATCGCTTAGGCTCCGCGGGATACGCACCAAGGGTGGAGCAGTGGACAAAAGAGGAGGAAATGAGGAAGAAGGGGCAACCGGTACCAATGGAGGAATGGACACAGAGATCAAGGAATTGGGTTAG >LOC_Os11g26250 ATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCAATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGTTGATGGCTCCCTGGTCTTCAGCGATCAGATACGCGAGGCTGCAAGTCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCCCAAGCATCCAGGACAAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGATTCAAGGAGGACATCCACACGTACAGGAGTCGAATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTTAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGCATGGCCACACATCGGTCCCTAGATCCCCAGCCGTACATTCCTCCTGCAATGGTCAGCCCTTCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGGACTTACCACTGCAGGCTTATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCTTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCACTATACTATGGCGCAAGCGGTACATCATCCTCCTTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCACAGGCTCCTGCACCGTCTCCTCCTCATGCTCCAGCACTGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTACACCAACTCCTCCGCAAGCTCCTCGTCCGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACTGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCTCCAAAAACAAGGACCCGGGGTACGATTGCACACAAGAGGAGCTTGACGCTTATGTGGCTTCAGAAGTCAGGAGACAATTGAAGCCTCAAAGTCCAGAAAAGAAGATTCTTATAGACCCGAGTGTCAGGAACTTCTTCAGGGGTATGTCTTCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTTAAGAAAGCATCTTCTGGAAAGTCCAAACTAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGAATTTGGAATACAAGATTTTATTAATAACACCGGGCTAACTACGGATCAGTTGCTACGAGATCCACCAATCGAAAAGGCGGAAGTGAAATACTTGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGTAG >LOC_Os11g05910 ATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os11g14350 ATGGCTGACCGCAATGAGGAACAGATATTGTATGATACAATCGCAGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCTGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGCCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAACGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGAAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCATTCCTGTGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGGTATCGAACCGGCAACCGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTTTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAATAGATGTAGTGGAAGCATCCTCTCAGGGCACGTTCCGACCGGACAGAAATAGGGACAAGCTGACACTCGCCCTGCAGAATCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGTAGATCTAGAGTTCCGGGTATCGAGCTACGAACTTAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCATAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCAACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAAGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATATACGAGACACAAGCCATGCCATTATTCTATGGCGCAAGGGTACATCATCCTCCCTGGGTGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTTCTCCGGATCCTGCACCGTCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCACCGACTCCTCCTCAGGATCCTGCAACGACTCCTCCTCGGGCTCCTACACCTACTCCTCCACAAGCTCCTCTTCCGACACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCACCTGCCCACACAAGGGAGGCCATCAAGCTGTCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCAGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAACTGGAGAGAAAGACTTAGGCGGAGGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACATGTGCAAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAAAGCTCGATTTTATTCGCATGAGGAATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os11g27280 ATGAATAAAGATGAGTCTACTTTTGACCAAGTTTTTGAACTTATAGACAGTGTGCAAAGCAGGAAGAGGGAACTAACTTGTGCGGATACTATGAATGCTAGTATTGCCACTGCCTTACAACCCAAATCATTGCCACAAGAGAGCTCGATGTACGTTATTCGCATGAGGGATAACCTCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACGAGTCCTTGATCCCGAGGGTAAATTCTACTACGATGAAAATACAATTCATAAGTCGTTAGCTTCTGAGATAACGACTACTACGTCGAAGTCGAAGCTAGCTAGGACATAA >LOC_Os11g21880 ATGACTCCCGAAGAGAGGAAAGCTTACATAGCACAAAGGCATCATGAAAAGGTGCTCGATGTCGCTACGTATGTAGCTATTGCGCTTGAATCTACGCAGGACAAGGAGTGTGTTTATGCCCCATATGCCTTTGACGACCATTGGATAGTCTTTCTTCTCTATCCAAAGTTCAATGAAGACATCGTCTTGGATTCTCTCGACAAAGATAGCAACACCTATCAGGAATTTCTAAGAATTCTCGATTTTGCATTTAAAAGGTATTACCAGCGAGGCAGACAACGCAAAAACTCAAGAGAACGCATATTTGTCCGCAATAAGTGGCCGCTTCCAAAATTCCCCATGTCTGAAAGACAGCTCGATGATACTTCCATTCAGAACATTCAGGCGGACATGTGTTACTTCATCCACCGTGAGTGCGCACATCAGCTTCGGCAGTTTTTCGACAATGAAGGAGTCTTAGCCCTGTGGGAGAACGAGTCCCTGTCTAACTGGACCAGGCGTATAATATAG >LOC_Os11g30090 ATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACACAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTTATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCAAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAAAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTAA >LOC_Os11g03950 ATGAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCATACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCAAAATCGTAG >LOC_Os11g25550 ATGCCGTGTACCAAAAGAGCAGGCAATGACCTCGACTGCACATCCGGTCACCGAACCATATCCATCCACGCCCATCTAACTTGGGGAAGAAACGATGTGCATGTATCAGCTTATCCAAGTGAGAGCAAGAGACTGTATCGGCTTACACTACTAGAAAAATCATACATGCGTACAACTACTACAAGTTCAAGGGTGGAGAAACAGACACGAACAAGGGAGAAGCTGCTAGTACATACATATTGGCCGTGTCACAAGCAACCTAGAGGCACTGTCCTCTGCGGGTATTACGCGTGCGAATTCCTCACGGTTAATGGGAGGTACAGGGTTAACGCAGAGGATTTGCCAAGAATAGAATTTCGAACAAGCTTTGACGATACAGGCATCACAAATGTCCAGAGCGATTTGTGTCACTTCATCCACCGCGGCCGCTTTCTATTTTCGCAGGCGGACCTGTCTAGCTAA >LOC_Os11g35940 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCCGCCACCGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACAAGAACGATCGAACGAACGAGAACTTAGTATGACATTATTGACTACGGAATTGATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCGGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCCCCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCTGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCTAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTTTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCACCACCAGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTAGTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGATGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGATGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGATAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCGCAAGTGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os11g28540 ATGGATGGAGGAATCGAGGTGTACCACCGCTACAGACGAGGCGACAACTACGCGCTTTGGCGCTCGCGGGAAACGATCTTCGCCCGCCATGCACGTGCCTCAACCTCTCGTCTGCTCAGAGAAGATGACCCCAAGAAGGCCGCTGAACTAGCCAGAAAAAAATACTTTCCAATTGATGGCTGCCAGGAAAAATACCAACATGGGAAAGCAATATGGCTGGATTTTGCACTTGATGACGGTCCATGGGAGATGACAAGGTTATATAAATGGTACATGGATGCCAGCAAGAAAGGCCTAAGTCATATAACAATTCGATCACCGCATGATGCTTTCGCCGGCGACGGTTACTTCTGGCTAGATTTTGAAGATCTCCACGCCATATATCGTCAGGAAAAGATTGACGAATGCATGGATGCTAAGAAGGAAAAAGAACCTATCGGATTCCTGCATCCAACTAGGATCTGTCAAACACAGCATACCTGTCATAAGCAACCTAGAGGCACTGTCCTATACGGGTATTACGCGTGCGAATTCCTCAGGGTTAATGGAAGGTACAGGGTTAACGCAAAGAATTTGCCAAGAATAGAACGTCGAACAAGCTTTGACAATACAAGCATCACAAATATCCAGCACGATCTCTTCCACTTCATCCACCGTGAGTATTGTCATGTGGAAGGAAAGTTCTTCAACCCAGAGGGTGCCCTAGCTACAAGTGATGAATACAAGAATCTTCGGGAGTGTAGCAATGCTATGCCATAA >LOC_Os11g23232 ATGGTCACCAAGTATCTGCAAGCCACAAAGGACAATCTCGTCCATCTCCTCAAGGAGCAGCATTTCAAGACGTTCATACTACTGCCGTACAACACAGCGTTAGTTTTTACTGTCTACCGAACAAATTTTGTTCCCGTTTTTGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTAGTCCGCGGCACTTGGAAAGAAAAACTTCGCCGGAGGTTCAAATTTGCATGTGCAAAGCAGGAAGAGGGAACTAACTTGTGCGGCTACTACGTATGCGAGTATTGCCACTGTCTTACAACCCAAATCATCACCATAAGAGAGCTCAATTCACAGGTTATTCACATGAGGGACAACCTCACACACAAGGACTTTATCAAGGCTGTTCAAGAACAACTCATGGGATTCATCAACGAACAAGTCCTTGATCCCGAGGGTGAATTCTACTATGACGGAAATACAATTCATAAGTCGTTAACTTCTGAGATAACGACTACGTCGAAGTCTCAGCTAGGACATAATTAA >LOC_Os11g27290 ATGGTTCCTTGGAAGATTGGATTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACTGAGGTGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGAAAGAGGAGGTGGAAAGGAAGATGGATGAACACATGGCCGCACATCGGTGCCAGGATCCCCAGTCGTACATTCCTCCTATAATGGTAGGATCACAGAGCATGGATGCCATGCAAACTCAGGATGAAACCACCTGCCCCGTTGATGAAATCATGCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTTGCATCAGGAATGGCCATCCCAACGGACCCTTCAGGGACTTACCACTGCAGGCCGATTCCTGCAGGATACTTGAGGGTCGAAATTGAGCTGGTGGAAGCCACGTACGAGGACCTCGAGTTGGAGTACCCTAGAGGAGACGCACCTTCCAAGTCAAGAACTCACCAAGCTCCACCACCTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGTTGATGCCGCCGAGAACAAGGAGCCACCTTACGACTGCACGCAAGAGGAGCTTGACGCTTACGTGGCAGCAGAAGTGAAGAGGCAATTGAAGCCTCGGAGTCTAGAAAAGAAGATTCCTATACACCCGAGTGCCAAGAAGTTCTTCAGGGGTATGTCGGCACCAGTCAAGGAGGCCATAAAGCTAACGGACTACAAGCGAACACTAAAGAAAGCATATTATGGGAAGTCCAAAAAAGTCCCTCAGCTTGGAGAGCAACCAAGCCAGGAGGTCGAGCCGTTGGTGACCTGGCAAGAAATTGGAATAAAAGAATTCATTTCTGACACTGGGCTAACTAGGGCTCAGTTGCTTAAAGGCGAACCAATCCCAAAGGCGGAAGTGAGACACCAGTACGAACTCGGTAAACCGCTTGTAAAGCCTGAGCAGCTGCAGTCCCTACCAACACAGATGTACAAATTCCATCAACGGTACATGGAGATGAGCGCCAGCGGTAGGGAGATTATCGGAGCGAGGATCAAGAACACTGACTTCTTACAAGGGGAAGATGTTCTCTGGATCAATTTCAAGGATATCTACAAACTATACCAGCTGGACGCCCTCGACGTCTCTATTCTGAGCGCATGGATTTTCTAG >LOC_Os11g35762 ATGCCGACCCCTCCTCCACCTCCCGCCGATGCCGACCCCGACTTCCACGCGGCCGCCACCGCCAACGCCGCCACGTTGGCTGATCGCGATGAGGAACAGATATTGTACGATACAATCGTAGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACATGGAGAGGGATGCGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGAGGCTAGTGGAAGTCATCCCTCCGCTGGACAGAAGAGGGCACGCGGACAACGAGAAGCAGCCAAGAATTTTGTACGCCACAGCGGTTGGGTTGTGAGGGATAACGTGCCTGTCAGCAAGGTGTACTGGCACAGAACAAGGGCACGCGGGGATAATGACAGCTTTGTCCCGGAATCAAAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACGCTCCCTGCGGGTACGGAGAACGTAGTGAAACCCTGGACTCGTAAGAAAATGGCCAAACAGTTCCAGAGCTTCAAGGGAGATCTGTACAAGAAATACATCCTGAAGGGACTAACACCGAACTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGTCAAAAACAAGGAAAACGCCGCCAAGAAGAAGTACCATCACCACTTAGGGTCAAGTGTTGATGGCTCCCTGGTCTTCAGCGATCAGATACGCGAAGCTGCCAGTCGACTAATGGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTACAGACTCCCGAGCATCCAGGACGAACACGAGGGAAATGCATGATTCCCTGGAAGATTGGATTCAAGGAGGACATCCACACGTACAGGAGTTGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAAATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAATGCATGGCAGCACATCGGTCCCAGGATCCCCAGCCGTACATACCTCCTCCAATGGTCAGCCCATCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGAATGGCCATCCCAACGGACATTTTAGGGACTTACCACTGCAGGCCAATTCTAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACCCGAGCATGAAGAAGTTCTTCAAGGGAATGTTCACCACAAACAAGGAGGCCTTAAAGCTATCGGACTATGACCGAACACTTAGGAAAGCCTATTACAAGAAGTCCAAACCAGTTCCTCAACTTGGAGAACAACCAAACCAAGAGGTCAAGCCATTGGTGACCGGCGAAGACTTTGGCATAACGGATTTCATTTCGGACACCGGTCTAACTGTGGTTCAGTTGGTTGGAGGCGCACCAATCCCGAAGGCGGAAGTGGCATACAAGTTTGAACTCGGTAAACCGCTTGTCAGGCCTGAGCAGCTGCAGTCCCTACCGACACAAATGTACAAATTCCGTGAACGGCACATGGAAATGAGCGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTATGGATCCATTTCAAGGATGTCTTCGATCTGTACCATCTGGATGCCCTCGATGTCTCTCTTCTGAGCACATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACACAAAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTTCATACTACTGCCGTGCAACACAGAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGGTTTTTGACAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCGGTTCCATCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGACGGAGGTTTTATTTTCCAGTGA >LOC_Os11g35140 ATGTCGAACGAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTCCAGTAGCAATAAGCAGCCAGGCGCTTCTAGTGAAGAAACGTGGCGCACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCGGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCATCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCGTACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCGAAGAAGAACAGATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCGCGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGCGCAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGCGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCTTTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTACCAATCGGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTTAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGACCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAACTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAACAAGTGCACATACCAGATGGTACTACATCCGAACCAAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCGTCGCCGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGACCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCGTAGAGCTGAGACAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAACAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTAAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGGCAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os11g19550 ATGGCTGATCGCGATGAGGAACAAATACTGTACGATACAATCGCAGAGGGAAGCAACCAGTACTGGAACGAAGAAGAGGTGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGAGGGATGCGGAGGGGAACGAGGAGGGGAACGGGCAGACACTGAACTTTAACACATTCCCGAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTACAAGATAGGGCAACAAGGGCAGGCGATGATGGACAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCCTCGCGATGCTGAAGTGGGAGGAGATGGAGGCAAGCTTGATTGAGAGGGGTATCGAACCAGCCACCGCTAAATGGCCGAATCGATCGAAGTTCTGGTACTATACTCATGGTGGAACGCTTAACCCAGTTGATGGCTCCCTGGTCTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCACGAGTCGGATGAGGAGAAAGAGAGATACCGAGGCGAAGATTGCCGATCTTGAGTACAGGGTATCTAGCTACAAGCTCAGCATGCAAGACGAGGTGGCAAGGAGGGTGGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGTACATTCCTCCTGCAATGGTCAGCCCATCAGGCAATCGTAGCAGCTGCGTCTCAACGGGGCAGGACGAAACCACCTGCCCCGTTGATGAGATCACTCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTGGCGTCGGGAATGGCCATCCCAACGGACCCTTCAGGGACTTACCACTGCAGGCCGATTCCAGTAGGATACTCGAGGATCGAAGTTGAGCTAGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCTGGAGGAGACGCACCTTCCATGTCAAGGTCTCATCAAGATCCACCGCCTACCCGCACAAGGGCAACAAAGAAAGCGAAAGTTGACGCCGCTGAAAACAAGGAGCCGCCATACAATTGCACGCAAGAGGAGCTTGACGCTTATGTGGTAGCAGAAGTGAAGAGAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCAGAAATGCACAAAGCAAGACCAGGGAACTAACTTGTGCGGCTACTACGTATGCGAGTATTGCCACTGCCTTACAACCCAAATCATCACCACAAGAGAGCTCGATGTTATTCGCATGAGGGATAACCTCAGACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTTATGGGATTCATCAACGAACAAGTCCTTGATCCCGAGGGTGAATTCTACTACAACGGAAATACAATTCATAAGTCGTTAGCTTCTGAGATAACGACTACTACGTCGAAGTTGTAG >LOC_Os11g18560 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGATGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAATTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGTGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGATGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGATGGCAAGGAAGGTCGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCATCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGATCAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGAGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os11g31180 ATGGCTGATCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTATTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGGTCACGTGGAAAGTGATGTGGAGGGGAATCAGGAGGAGGAGCTAGTGGAAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGAGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAAGCGATGATGGAAAGAAACAAAGAAAATGACGCCAAGAAGAAGTACCATCACTACTTAGGTTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATAGAGGCTAGCTTGGTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCTGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTTGGCGATCAGATACGAGAGGCTGCGCGTCAACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCGGATAGAGAGAGGGACGAGCTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTTTAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCAATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACTCAGGACGAATCCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGTGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTATAGGCCGAATCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACAAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATACCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCATCTCGTGCACCATCTCCTCCAGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAAGCTCCTGCACCGACTCCTCCTCATGCTCCAGCACTGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCGGGCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAAGGTCCCCCAAGCTCCACCGCCTGCCCACACAAGGGCAATGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGATCCGGGGTACGATTGCACGCAAAAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCTAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATTGGACTATCAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGATTCGCACCAATCGAAAAGGCGGAAGTGAAATACATATACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATATACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACAAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAATGCGCAAAGCAAAAGAAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCAATTTTATTCGCATGAGGGATAACCTGACCACGCACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCTCAAGGGTGAATTCTACTACGACGGAAACACAATTCGTAGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACGTCGAAATTGTAG >LOC_Os11g16730 ATGTCGAGTGGGATACCGATGATAGCTACCTGTCGTTGGTCGAAACGAAATGCCGTCAGGGCTGAACCTGAGTCGGACACCGCCACCTCGGGACCACAGCCAACGGACACGACGACGAGTGCTAGAGCACGTCCAAAGAAAAAACATGGCGATAGGAGCAGGAACCTGATGCCGAATGAGACGTACTACATTGCTGCTCTCAACGATGATGGCAAACCCGTCGAGCCACAACATGTCATGGCGAAGTTTAGCACTGCATGCAGCACGCTGGCAAGACTTCATGGGCCTCTCAACATGGACGAGTGGAAGAACGTTAGCATACACATCAAGAACTTAATGTGGGAAGGTCTGCAGGAGCACCTCATTTATCAGCCAGGGTCAGAGGCACTTAGCAGGAATTTTGCACTTCAAACAATTTCCCATCACTGGCGACAGTGGAAGTTGGACATGAACACCCAATGTGTTCAGAAGAATAAGACTCCATTTGAACAATGGGGCACCATTTCGAGAGACGAGTGGGACAAGTTCGTGGCCAAGATGACAACGCCTGAAGCTCTAGAAAGGAGGAAGAAGATGTCGGACCTGGAGAAAAACATATATCCGCACAGATTGGGGTCAAGTGGATACGCTGGTCACGAGAAGAAATGCCTTGTCGTTCTTATAGGGAGAGCGGGAAAAACAAAGGAGGTTGGGTCCGGATTGGCGAGACCAGGGAGACAGTTCCATAACAGCCCAATTCCGGCGGACTACGCAAGGGTCCATGTGGCATGGCTTAATGCCGATCAGATGTCGTTGGAGCTTGACATCCCAACACTAGAGGGGATTGAACTTATCGGAGATGCGGTGAACCAGTTCATACTCTGGCATCGTCGAGACATCATCCTCACGGGACAGTCACAATGGGTAGACTCCCAAAGAACGGGGGCCTCAATTGCATATGTAAACCCAATGTTGGTTTGCGAGACGGCCCACACGGTGCGGATATCGGAGAATAGTGCGATATGTTTAGGGCAAAAGTCTGCCGCAAAGACTTATGGTATCTTAGAGTTTGTTAGAGATAATAGTCGTGTCTGCATGCACTATATACTATTCCTTGTCTATCCAACGGACCAAATCGTCATAGTTCTTGATCCGGCAGACTATGACAAGCAGGCGTACATGGAGTTCCTATGCTTGCTAAACTTAGCACATGGCCGTTATAGGAAACTTGGCGGGTTCGTAAAGAATCCAAGTAGAGACAAACTCTACATAAGGGGAAGTTGGCCGTGTTACAAGCAACCGAGCTTGTCGAACCTATGCGGATATTACATGTGCGAGATGCTCAGGGTCAGTGGGAGATACAGAACTGAGTTTACAGATCTCCCGAGCATCCCTTATAACGCAAGCCGGTTCGATCAGAAAACGCTTATCAACTTATGCACGGACTTTTGCCGGTTCATTCGTCGCGACATCTGTAACCATCTAGGAGAGTTCCACGATCTTCATAGCGAACTTGCTATGGACCCCAAATTCAAGAACCTAAGGGAGTGGGAGAGGAAACATGCTATGGACTAG >LOC_Os11g05900 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACATGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCCACCCAGCTGATGGCTCACTGCTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACATTCCGACTAGACAGAGATAGGGACGAGCTGACGCTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGTGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCGAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCTCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGACGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCACTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTTTAA >LOC_Os11g30740 ATGGCCGATAGTTTAGGAGAGCAAGAGCAGTCCCTTGCTGTTGTGGTTGCTCCGGAACCAACGGTCCCACCAGAAGATAGTTCCGGCAGCGACGTAGCTCACGAAGACGATGAGTACTCGTCGCCAAGCGATCCTTGTCCAAGCCCAAGCCTGAAGAGAAGGAAAAAGGGCGACGGTGAAGAAGGCGACAAAGACTACATTCCCTTTAAAGAAGGGGAAACGGCGCCACGGCGATCAAAATGGCAGCCGAAGAAAAAAGTTCCGTCGCAAATTGACGAGGTACCAGCTAACACAACCGGCTCAAAGAAAACCGAACGGTCAACTATGGCGAAGAAAAGGAAGGGCGAGAGAAGCGTGAATAGAAAGGATGAAGGGTTCCATGTTGTTACCTATGTTTCGCCAAAAGGAGAGCCGCTCGCCCCTAAGTTGGCACGTGTGAAATTCAGTTCACAATGTGGCATAATAGTAAGGGAAAAGATCCCCATCACGGTGAAGGACTGCGATCATGTATCGAATGGGGATAAGGAAGTCCTATGGAAAGAGCTGAAGAAAATCTTCCAGTTCCCGGATGGATCAGAGGCAGCAGTGAGGAATTGTGCACTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAACCACCTTGAACTCGAAATTTGTCAAGACAGGACGCACACCGTTTTCGACGTATGCCAACATAACCCCGAATCAGTGGGTCGACTTTCTGACGTTGAAGAACTCCCTGGAAGAAATTCAAAGGAGCCAAAAGTATGCAGAGTATGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCGGCAGGATACGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAACCGGTACCAATTGAGGAATGGACACAGAGATCAAGGAACTGGGTAAGAGCTAGAACTCCTAAGATCACGGATGAAGGAAAAGTATCGTTTGAAGATCTGGAGCTACAGAGCGTTGCTGATAAATTAGAGAATTTATCCAGTTCACAGAAGAAAGGATTTTTCAAGCCTAAGAGGGAGAAAGATGTGCTAAGTACGGCGCTGGGTACTCCTGAGCATGGGGGAAGGGTTCGAGATTACCCCTTCGATGACCTCAAGGAGAATACGCCCTGCAGATTGCACGTTCCCATTGGACACTCTAGGAAAACTCTTGAGGCCGCTACAGCCATTGCTATCCCTGGGAGAACATACAACGAAGAGTTCATACCCGATGCGTATACCAAGGTGCAGCCGCAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTTCCTGACTGAAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTGGGCACCAACGACACACGAAAAACTGTGGTGCCAGAACCGGGGTTGGGAAAACCTCCGAGACCTCCTAAGAGGAAGGTGACTAATAAGGCAGAGCAACCCGAGATGCAAAAGGAAAATCCAGTGCCGGAAGTGCCACCGGAGATTGCAGTGTCGGAGGCAGCCATGGAGATTCCAGTGCCGGATGTGCCCATGGAGATTACAGTGGCAGAACTAGAGGTGCAATTTGTGGCATCAGTCGGGTCAGAAATAGAAGAAGTACCAGGATTGGAATGGGACGGTACAGAGCCAGAAATATTTGAAGACTCTTCTCCTGCGAAAGACCCCGAGGTGCAAGAGACCACTGTCCCTGAGAAGGCCACTACCAGTTCTGAGGTGCCTAAAGTGCTTAGTAGCCACGACTCCAAGTCCAAAGATCAGAACAAGGAGAAGTTCATGTGTCACAAGCAACCGCGAGGAACGGTCCTTTGCGGGTATTACGCTTGCGAATTCCTTAGAGTTAATGGGAGGTACAGGACTAACGCGGAGGATTTGCCAAGATTACAATGTCGAACAAGCTTTGACGATACAGGCATAAAAAATGTCCAGCGTGACCTGTGTCACTTCATCCACCATGAGTGCTGTCATGTGAAAGGGGATTTCTTCGACCCAGAGGGTGCCCTAGCCACAAGTGACAAATTCAAAGATCTTCGGGAGTGA >LOC_Os11g44100 ATGAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACCGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGTGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGATCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCAAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAGTTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTTGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAGCAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTAACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATTACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACAACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os11g42980 ATGGCTGATCGCGATGAGGAACAGATACTGTATGATACAATCGCAGAGGGAAGCAACGAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCAGAGGGGAACGAGGATGCGGAGGGGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGAGGCCAGTGGAAGTCATCCCTCCGCTGGACAGAAGAGGGCACGTGGACAACGAGGTGCAGCGAAGAAGATAGTGGGTCGGCACATCATAACTGAGGTGGACGAAGACGGCCGACCTAGTGCCCCGGCAGAAGCAGCCAAGAATTTTGTACGCCATAGCGGTTGGGTTGTGAGGGATAACGTGCCTGTCAGCCAGGTGTACTGGCGCAGAACAAGGACACGCGGGGATGATGACAGCTTTGTCCCGGAATCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTCACGCTCCCTGCGGGTACGGAGAACATAGTGAAACAGTGGACTCTTAAGAAAATGGCAGAACAGTTCCAAACCTTCAAGGGAGATCTGTACAAGAAATACATCCTGAAGGGACTAACACCGAACTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGTCAAAAACAAGGAAAACGCTGCCAAGAAGAAGTACCATCATCACTTGGGGTCAGGTGGCTATAGCGTCGCAATACCGAAGTGGGAGGAGATGGAGGCAAGAATGATTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCAAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTGGTCTTCAGCGATCAGATACGCGAGGCTGCCAGTCGACTAACGGACGCAGTGGCAGCCTCTTCTCAGGGCATGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAATGCATGGCAGCACATCGGTCCCAGGATCCACAGCCGTACATACCTCCTCCAATGGTCAGCCCATCTGGCAATCGTAGCTGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGAATGGCCATCCCCACGGACATTTCAGGGACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCCCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCGTCTCCTCCTGCACCATCTCCTCCGGTTCCTCTGCCACGTCCTCCTGCACCATCTCCTCCGTCTCCTCCGCCACCTCCTCTTGCACCATCTCCTCCGGCTCCTCCGCCTCCTCCACCTCCACCTCCACCGTGTCCGCCTGCACCTCTCAAGACAAGGTCTCGCCAAGCTCCACCTCCTGCCAGCACAAGGGCAACGAAGAAGGCCAAAGTTGACACCACCAAAAACAAGGAGCCGCTGTACAATTGCAGTCAAGAGGAGCTTGACGCTTATGTGGCAGCAGAGGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATGCCTATTGACCCGAGCGTGAAGAATTTCTTCAAGGGAATGTCCACCACAAACAAGAAGGCCTTAAAGCTATCGGACTATGACCGAACACTTAGGAAAGCCTATTACAAGAAGTCCAAACCAGTTCCTCAGCTTGGAGAACAACCAAACCAAGTGGTCGAGCCGTTGGTGACCGGAGAAGACTTTGGCATAACGGATTTCATTTCGGACACCGGTCTAACTGTGGCCCAGTTGGTTGGAGGCGCACCAATCTCGAAGGCGGAAGTGGCATACAAGTTTGAACACGGTAAACCGCTTGTCAGGCCTGAGCAGCTGCAGTCCCTACCAACACAAATGTACAAATTCCATGAACGGTACATGGAAATGAGCACCAATGGTAAAGAGATGTTCGGAGCAAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAGATGTTCTATGGATCCATTTCAAGGATGTCTTCGATCTGTACCATCGGGACGCCCTCGACGTCTCTCTTCTAAGCGCATGGATGTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTACGATACTGGGTTCATCGACCCTTGGAAAATCAACACCGAAATGCTCGACGAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACGTTCATACTATTGCCGTACAACATAGAAGTCCCTGTGTACGACTCAATGAATAAAGAGGAGAAGGTTTTTTACAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCATGTGCAAAGCAGGACAAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCCCACTGCCTATCAAACCAAATATATACCACACGAGAGCTCGATCGTATTCACATGAGGGAAAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGGTTCATCAACGAAGAAGTCCTTAATCCCGATGGTGAATTCTACTACGACGGATGGACAATTCATAATGTCGGTCCTTCCTCTTCTGACGTAACGCCGGCGTCGAAGTCGTAG >LOC_Os11g17410 ATGGAGGCAAGCTTGGTTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTGGTCTTCAGCGATCAGATACACGAGGCTGCCAGTCGACTAACGAACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCCGACAGAGAGAAGGACGAGCTGTCACTCAACCTGCAGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGATTCAAGGAGAACATCCACACCCCATCAGGCAATCATAGCAGCTGCGCATCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACTCAGGACGAAACCACCTGCCCCGTTGATGAGATCACTCAGCGGACACCATGTGAGTTGCATATTCCCTTCAAGAACTTATCAATCAAGGTGGCATCGGGAATGGCCATCCCAACAGACCCTTCAGGGACTTACCACTACAGGCCAATTCCAGTACGATACTCGAAGGTCGAAGTTGAGTTGGTGGAAGCCGCGTACGAGGACTTCGAGTTGGACTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCAGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCTCAGGCTCCAGCACCGTCTCTACCTCAGGCTCCTGCACCGACTCCTCATCAGGCTCCTGCACCGACTCTGCCTCAGGCTCCTCCTACTCAAGCTTCTACAGTGACTCCTCAAGCTCCTGCGCCGACTCCTCCTCAAGCTCCTCGTCCGGCACCTTCCAAGTCAAGGTCCCACCAAGCTCCACCGCCTGCCCGCACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCGGAAACAAGCAGCCGGCGTACGATTGCACGCAAGAGGAGCTTGAATCTTATGTGGCAGCAGAAGTCAAGAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGATCGAACACTTAAGAAAGCATATTCTGCAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGGTCGAGCCATTGGTGACCGGTGAAGAAATTGGAATAAAAGATTTTATTTCTGACACCGGGCTAACTACGGATCAATTTCTACGAGGCGCACCAATCCCAAAGGCGGAAGTGAAATACAAGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGCTGCAGTCCCTACCGACACAGATATACAAATTCCATCAACCGTACGTGGAAATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACATGGACTTCTTGCAAGGAGAAGATATTCTTTGGATCAATTTCAAGGGTATCTACGAACTATACGAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGTTGGATTTTGTAA >LOC_Os11g25630 ATGGGTCCGACAGTGATGAAGCTGACGAGGGAGATTCATATTTGTCCAAGCCCGAAATGGCGGACGAAAGATGATGGTGAAGAAGACGACGAAGACTACGTCCTTCGCAAGAAAGTGGAAATGGGGCCACAAAGATCTAGATGGCATCCGAAAAAAGCCGCCCAACTCGATGAAGTCCCAACTACGACCTCCAACTCCAAGAAGAAAGCAAAGTCCAAAGAGCTTACCAAAAAGAGAAAGGGCAAGAGGAGCGTGAATAGAATAGACGATGGGTTGTACGTTGTCACCCACATAAGTCCAAATGGTGAGCCGCTCGCGCCCTCCACTGCACGCGCAAAGTTCAGCTTTCAGTGTAGCGCAATAAAGGGGAAGGCACCATTTAAGAAATATGGGAAAATAACGCTGAACCAATGGGACAAATTTGTAAAGTTCAAGACCTCGCCGGAAGAAATGGCCAAGAGTAAAAGGTTGTCTGACTTGGCCAAGCGAAAAAAATGGCACCATCGACTGGGCTCCGGTGGGTACGCACGTAAGATTGCACTGTGGAATAAAGAGGATGAGGAAATGAAGAAGGCGGGGGTTCCGGTGCCAATGGAAGAATGGAACATACAATCCAAGCATTGGGTAAAAGAAAGGACCCCGAAGATCACATCGGAAGGGAAAGTGTTATTTGAAGACCCCGAGCTGCAGGGAGTTGCCGACAAGATAGAAGATTTATCTAGCAAGGAAAAGAAAGGAGAATTTATCCCACAGAGGGAGAAAGATGTGCTTAGCCAGGCGTTGGGAAATCGGGAGCACGGGGGTCGGGTTCGAGGAGTGTCCTCTAAGCTGAGTTGGAAAGAAGGGTTCAAACAGGACGCCTCCTCGTATAAGAGACGTGACGCCTATAAGGAAAGCTTGAGGGACGAAGGGGGTAAGAAATTTGAAAAACAAATGATGGGGTTTTGCATAAGACATTTTCTACTGCCTAAGACAGAAGAAGAGACCCAACAACCGGAACCAAATTATCCCTTTGATGACTTGGAGGAGACTACACCCTGTAGGTTGCATGTACCGAGTGGACGAGCTGGTAGGAGACTTGAGGCTACGACCGAAATTGCTATCCCTGGTAGAACGTACCATGACAGATTTATTGATTCTGGATATGCGAAAGTGCAATCGCAAGGGGTGAATAAAGGGTTTAAGTCGTACGACCTAGATATCCCAACTCCTGATGGTATAACCGTACTTGGGGATGCGGTCGGCCTTATCATATTCTATGGCACAAAAAGGATATAA >LOC_Os11g13730 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGCCACGCCACGCCACCGCCGCCACGCCACGCCACCGCCGCCGTGCCACGCCGCCGCCGCCACGGCCCCACAACGCCACGCCGCCGCCGCCGTCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGTGAGAACGAACACGTCAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAATTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGACGAAAGTTGACGCCGCCAAGATCAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACGCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAAACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAA >LOC_Os11g15430 ATGGCCTGCTTGGCAGCCACTCCACTCCCCCTAGACCCACATGGAAGTCTCACTACCGCTTTTGACACCCCTAGCTGTCCATTTGAACACGTGGAAGCCAAGGAACACGCCAGAAGAGCTAACACAACCGGCACAAAGAAAAGCGAACGGTCAGCAAAGGCGAAGAAAAGGAAGGGCGAGAGAAGCGTGAATAGAAAGGATGAAGGGTTCCATGTTGTTACCCATGTTTCGCCTAAAGGAGAGCCGCTCGCCCCTAAGACGGCACGTGCGAAATTCAGTTCACAGTGTGGCATAATAGTAAGGGAAAAGATCTCCATCACGGTCAAGGACTGGGATCATGTATCGGATGGGGATAAGGAAGTCCTATGGAAAGAGTTGAAGAAAATCTTCCAGTTCCCGGATGGATCAGAGGCAGCATGGGACGACTTTCTGACCTTGAAGAACTCCGCGGAAGAAATTAAAAGGAGCCAAAAGTATGCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCCGCGGGATACGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAATGAGAAAGAATGGGCAACCGTTCACAAAAAAAGGATATTTCAAGCCTAAAAGGGAGAAAGATGTGCTAAGTACTGCGCTGGGTACTCCTGAGCATGGGGGAAGGGTTCGAGGTGTGTCGAGCAAGATGAGTTGGAAGGAAGGGTTCAAAAATGACCCCCACAAGAAGCGTGAAGCGTACAAGGATACACTTAGAGACAAAGGGGCTGCGGAGTTTGAAAGGCAAATGATGGATTTCTGCATCAAGCACATGATTTTGCCTCACCCCGAAACCAAAGAAACTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTGCAGCCACAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTACCCGACTGCAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGAATTGGGCACCGACGCCACGCAAAAACCTATGGTGCCTAAACCGGGGCTGGGAAAACCTCCGAGGCCTCCTAAGAGGAAGGTGACTGATAAGGCGGATGATCCAGAGATGCAAAAGGAAAATCCAGTGCCAGAAGTGCCACCGGAGATTGCATTGCCGAAGGCAGCCATGGAGATTGCACCGCCGGAGATAGCCTTGGAGATTCCAGTGCCAGATGTGCCCATGGAGATTACAGTGGCAGAACCAGAGGTGCAATTTGTGGCATCAGTCGGGTTAGACAAAGAAGAAGTACCAGGATTGGAATGGGACGCTCAGAGATTACGACCCCAGAAGACTGCTGAACTAGCCGGGCCAACATACTTCGCAACCGATGATTGCCCGGAAAAGTACAAACATGGGAAAGCACTCTTGCCGGAATGGGCACTGAAAAAAGCACCATGGGAGATGAGAAGGTTACATAAATTCTACATGGAGTCCAGCAAGAAAGGCTTGGGCAATATAACAGCTCGATCACCGGCAGATTGTTTCGGCGAAGAAGGTTACGTATGGCTAGATTTCTCAGATCTCCATGCCATATATCGTCGTGATAAGATGGATGTCAACTACGTCGGTGTTTGGTGTATGATGCAATACATGGATGCTAAGAAGAAAAAAGAACCCATCGGCTTCTTGGATCCAACTCGGATCTGCCAAACACAGCATACCGTGACGCTAGCACTAGGCGATCATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGATCCTCTCGATTACAGTCACAAGCAATACAAAGAATTTCTAACAATCTTACTACAGTATGCATACCAATACTACAAGTTCAAGGGTGGAGAACAGACCCGAACACGGGAGAAGCTGCTATGTCACGAGCAACCGCGAGGAACGGTCCTTTGCGGGTATTATACGTGCAAATTCCTTAGGGTTAATGGACGGTACAGGACTAACGCGGAGGATTTGCCAAAATTAGAATGTCGAACAAGCTTTGACGATACAGGTATGACAAATGTCCAGCGTGATCTGTTCCACTTCATCCACCATGAGTGCTGTCATGTGAAAGGAGATTTCTTCGACCCAGAGGGTGCCCTAGCGGCAAGTGACGAATTCAAGGATCTTCGGGAGTGGAACACTGCTATGCCATAA >LOC_Os11g26080 ATGGGGAGGCGACCGGCGGCGGAAAGGATGGCGGCGACCGGCACGGGAGGCGACGGGAACGGCGTTCCGACGACGCCCGACCATGGCGGAGCCGCGGCCGAGGGCCGGCAAGACCTGGGGAAATTATTGGAGCGGTTAGGGAGGGAAATAGGCGACCGGAGCGGCGAGAATACCACGCCGGAGAGGAGAGGAATGGTGGGGCTCACCGGAGACCGAGAGATACCACGTTCCGGTGGGTTTCCGGCGATGAACAACGGTGACCGAGGTGCTGCACGGCGCTGCGAGGCGAGAGTTCCTACTACCAGAAGTTGCATCAGAAACATTGCTCTGGGCATTGATCTTCAGGGAGGGAATGGCAATCCTCTTGACAGCTATGGCAGGTGGGATCTTCTTGCTAATGGATTATCGAGCGGCGATTTACAGATGGGCCTCCGGATTGGAGCAATACGAGGTGCATTGCTAAGGCGACGGTGGCACACGGCTGGAGGCGTCGTATGGTGGAGGTGGCTCGGGATGCACGGTGGAAGGGTGGTTGCGGTCGTGGAATGGGGAAACGGAGCGGAGGCCGGGGTAGAGCTTGGCACGGCGTTGCCGACGGCGCAAGCGGCGAGAGAAGTGAAGAGACAACTCAAGCCTCGAAGTCCTGAAAAGAAGATACCTATTGACCCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCACAACAAACAAGGATGCCTTAAAGATATCGGACTATGACCGAACACTTCAGAAAGCCCATCACAAGAAGTCCAAACCAGTCTCTCAGCTTGGAGAACAACCAAACCAAGAGGTCGAGCCGTTGGTGACCGGCGAAGATTTTGGCATAACGGATTTCATTTCAGACACCGGTGTAACTATGGATCAGCTGATTGGAGGCACACCAATCCCAAAGGCAGAAGTGGCATACAAGTTTGAACTCGGTAAATCGCTTATGTACAAATTCTATGAACGGTACATGGAAATGAGCGCCAAGGGTAGAGAGTTGTTCGGAGCGAGGATCAGAAACCCTGACTTCTTGCAAGGAGAAGATGTTCTCTGGATCCATTTCAAGGATCTCTTCGATCTGTACCATCTGGACGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACAGAGGTTTCATTTTCCACGTATTCACATGAGGGATAATCTCCCACACAAGGATTTTATCATGGCTGTTCAAGAACAATTGATGGGATTCATCAACGAAGAAGTCCTTAATCCCGATGGTGAATTCTACTACGACGGATCGACAATTCATAACGTCGGTCCTTCCTCTTCTGACATAACCCCGGCGTCGAAGTCATAG >LOC_Os11g19020 ATGGAGCCAGAGATTGAAGAACTAGGCATCTCATTTTTTCTGACCCCGCATCCTGAGCCAGATTACCCCTTCGATGACCTAAAGGAGAATACACCCTGCAAGTTGCACGTTCCAATTGGACGCTCCGGAAGAACTCTTGAGGCCACTACAGCCATTGCTATCCCTGGGAGAACATTTAATGACGAGTTCATACCCGATGAGTATGCCAAAGTGCAGCTGCAAGTGTTCCATGAAGGGTTTGAGTCGTACGACATCGACATCCCTACTCTAGATGGTGTATCCGTACTTGGGGATGCGGGGGGGGGTGCAAAAACCTCCGAGACCACCGAGACCTCCTCCTCCGAAGTAGTGACTGATAAGGCGGAGGAACCCGAGATGCCTAAGGAAATTACAGTGCTGGAAGTGCCACATGAGATTTCAGTGCCGGAGGTGCCCATGGAGATTTCAGTACCGGATGTCCCCATGGAGATTACATTGGCAGAACCAGATGTGCAAGTTGTGGCATCAGTCGGGACATATATAGAAGTACTAGGATTGGAATGGGACGGTACAGAGCTAGAAGTATTTGAAGACCCTTCTCCTGCAAAAGACCCCGAGGTGCAAGAACCCCCGGTCAGTGACAAGGCCACTGACAAGTCTGAAGTGCCTAGAGTGGTTAGCAGCCACAACTCCAAGTCCAAAGATGATCAAAAGGAGAAGTTCATGGTAACCGTCTTCAGAGGGGGTAAGGAACATGCCAAACTCAGAGAAGATGACCCCAAGAAGGCCGCTTCACTAGCTAGGAAAAAAAATACTTGCCAACTGATGATTGTCCAGAAAAATACGAACATGGGAAAGCAATCTTGCCGGATTGGGCACTTGAGGAAGGTCCATGGGAGATGA >LOC_Os11g29640 ATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCGACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATTGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGAAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATCTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCTAGTACTACTACGTCGAAATCGTAG >LOC_Os11g45670 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAAGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGATAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCAGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCTTATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCAAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAAACGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCACGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTACAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGTCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCATGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCATTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCACACATATCTACGAACTATACCAGCTGGACGCCGTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCAATTGGTCCGTGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os11g45490 ATGGAGAGGGATGAAGAGGGGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGACGAGGACGCTAGTGGAAGTCATCCCTCCGCTGGACAGAAGAGGGCACGCGGACAACAAGGTGCCGCGAAGAAGATAGAGGGTCAGCACATCATAACTGAGGTGGACGCAGACGGCCGACCTAGTGCCCCGGCAAAAGCAGCGAAGAATTTTGTACGCCACATCGGTTGGGTTGTGAGGGATAACGTGCCTGTCAGCAAGGTGTACTGGCGCAGAACAAGGGCACGCGGGGATAATGACAGCTTTGTCCCGGAATCAGAGAAAGAGATGCTATGGACCACAATGCTCGAGACGTTCACGCTCCCTGCGGGTACGGAGAACATAGTGAAACAGTGGACTCTTAAGAAAATGGCAGAAGAGTTCCAGACCTTCAAGGGAGATCTGTACCAGAAATACATCCTGAAGGGGCAGACACCGAACTTCGACGTATTCCCGAAGCTAAGGGATCACTGGGATGAGTACATTGCTTACAAGACAGGTCAACAAGGGCAGGCGATGATGAAAAGAAACAAAGAAAATACCGCCAAGAAGAAGTACCATCACCACTTGAGGTCAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCAAGCTTGCTTGAGAGGGGTATCAAACCGGCCACCGCTAAATGGCCTGATCGATCGAAGTTCTGGTACTATGCTCATGGTGGAACGCTCAACCCAATTGATGGCTCCTTGGTCTTTAGCGATCAGATACGCGAGGCTGCGAATCGACTAACGGACGCAGTGGAAGCCTCTTCTCAGGGCACATTCCGACCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTACAGACTCCCGAGCATCCAAGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATGGGATTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTGGTGTCAGGAATGGCCATCCCAACAGACATTTCAGGGACTTACCACTGTAGGCCGATTCCAGCAGGATACTCGATGGTCGAAGTTGAGCTGGTGGAAGCCGTGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCGGTACATCATCCTCCCTAGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCTGCCGTCTCCTCCTGCACCATCTCCTCCGGTTCCTCCGCCACGTCCTCCTGCACCATCTCCTCCGGCTCCTCCGCCACCTCCTCCTGCACCATCTCCTCCGGCTCCTCTGCCTCCTCCACCTCCACCGTGTCCGCCTGCACCTCCCAAGACAAGGTCTCGCCAAGCTCCACCTCCTGCCAGCACAAGGGCAACGAAGAAGGCCAAAGTTGACACCACCAAAAACAAGGAGCCGCCATACGGTTGCAGTCAAGAGGAGCTTGACGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATAGCTATTGACCCGAGTGTGAAGAATTTCTTCAAGGGAATGTCCACCACAAACAAGGAGGCCTTAAAGCTATCGGATTATGACCGAACACTTAGGAAAGCCTATTACAAGAAGTCCAAACCAGTTCCTCAGCTTGGAGAACAACCACACCAAGTGTTCGAGCCGTTGGTGACCGGCGAACACTTTGGCATAACGGATTTCATTTCGGACACCGGTCTAACCATGGCTCAGTTGGTTGGAGGCGCACCAATCCCGAAGGTGGAAGTGGCATACAAGTTTGAACTCGAGTGCTTCATAGAGATGCACTTGATAGTGCAGTGGCAAGAGATGTGTGGTTTTAACCGTAAGGTTCTGTGTTCAATCCCTAACACACTCACAATTTCTTCTTAA >LOC_Os11g47445 ATGGGGAAGCTGTGGCGAAACTGGAAAACGAACCTGAATAAGAAATATGTCCAGAAGGGACTCACGCCATTTAAGGACTACGGAAGGATAACACAGGCACAGTGGGATGAGTTCGTTGCCCTTAAGACATCGGTGGAAGAAAAGGAGAAGAGCCAGAAGATGGCTGAGCTAGCAAGAAGGAATGAATATCCACATCATTTGGGATCGACCGGTTACCGGCAAGCGGTGAAGAAATGGGCAAAACAAGATGAAGAGATGGAGAAGGCTGGAAAGCCGGTTCCTATGAAAAATCACAACCCACGAAGCAGGAGCTGGGTGCGTGCAAGAACACCGGCCTTCACCCCTGAGGGGGATGTAGCATTCAAGGATCAGAAGCTCCAGGAGGTAGCTGTCAAGATGAAGAACATCGTCACGCAGCAACAGGCCGGGACGTTCGTGCCAGATAGAGACCAGGACGAGCTGACCTATGCCTTGGGCAAACCGGAGCACTCTGGCCGTGATGCTCATACCTACAAGAAGCATGATCGCTACAAGGAAGAGATTGACTCTCAGGCTAGGGTAGCAGCTCGTGACGAATGCAATATATACTGGAGTCAGAAAATGATGCACGGTGCTGCTGTTTTAGAGCCTGAGCCCAGCTATCCTTTCGATGATGTAACAGAGGATACTCCGTGCAAGCTCTTGATTCCGGTCGGCAGGGCGGAAAAGAAAATACTCGTTGCAACTAGGAGGTTCATATCAGGCCACAGGTTTCATTGCCAAGATATTCCGAATGACTACGCCAAGGTAGAGGTTCGGACGGTCATTGAGGCTTACCGGATGCATGAGCTCGACTTTCCAACTACTGAGCAGATTGTGTACCTTGGAGATGCCGTCGATCAATTCATACTATGGCACAAGAATGATATTGAACTAGGGTCAACAGATGGAACTGATCGTCCACCAAGGATACCGGTGTCACTGTCGCGTCCACCAGTCGTAGCCAGTCCGAGGGATAATCCTATTGCTTCACCCCCTAGACCAGAGCCACCAGTTGCATCACCTCCTAGACCAGAGCCACCGGTTGCATCACCTCCAGGATCAGAGCCTCCTGTTGCATCACCTCCGACTGAAAAGGATGCAGAAGAACAATCGCTAGTGCCCGATCAACCAGAGCCATCGCAACTAGAGCCATCGCAACCAGAGGAACTTAAGGGTGCCGATGTGCCAGTGATGGTAAGGACGCACACGCACAAAGCAAAAAGTGCGTCCAAGAAAAAGTATATGGTAACGGCATTCCGAGGAAGGGACAAAGATATCATAAATGCCGAATTTGATAACAGCAAATTAAAAGGGTTGAAACAGAGCATGGATGACTATCTCAACTATATCAATTCCCCAGACGTGCCACACGAGTTTGAGAATGGCAAAACATTCATTTACGGCTGGCAACTAAGAGAAGGACCGTGGCAACTAAGAAGGTGGCACGATTGGTACATTAGGGCAAGCACCATGAAAGGCATTTCATCATTCACAGTTGCCGTAGGGGAGAACATCTTATGGAGCGGTCCTTGTCTACTCCAAGTCCATTTCTCCGATATGCATTCCCTCTACCATAGGAAGAGGCTGGACGCCAATTTGATTGCCATCTTGTGTTTGATGAATTACGTGAAAGCCGAAGCGATGAAAAAGCCTGTCGCCTACCTAAACCCGTGCAGGATAAGTAAGCCGAACCACACATACACGCTAGACGAGAAGAAGCTACCGGAACACATCAAGGCGATGACTCCCGAAGAGAGGAAAGCTTACATAGCACAAAGGCATCATGAAAAGGTGCTCGATGTCACTACATACGTAGCTATTGCGCTTGAATCTACGCAGGACAAGGAGTGTGTTTATGCCCCATATGCCTTTGACGACCATTGGATAGTCTTTCTTCTGTATCCAAAGTACAATGAAGTCATCGTCTTGGATTCTCTCGACAAAGATAGCAACACCTATCAGGAATTTCTAAGAATTATCGATCTTGCATTTAAAAGGTATTACCAGCGTGGCGGACAATGCAAAAACTCAAGAGAACGCATATCCGTCCGCAATAAGTGGCCGTGTCACAAGCAACCGGTGGGAACTGTATTATGCGGATATTACTATTGTGAGTTCCTAAGGGTTAATAGGAAATATTGTGCGAATTATGACGACCTTCCCAAATTCCCCAAGTCTGAAAGAGTGCTCGATGATACTTCCATTCAGAACATTCAGGCGGACATGTGCTACTTCATCCACCGTGAGTGCGCACATCAGCTTGGGCAGTTTTTCGACAACGAAGGAGTCTTAGCCCTGCCGGAGAACGAATCCCTGTCTAACTGGACCATGCGTATAATATAG >LOC_Os11g18954 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCACCCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTAAAGAAAATGGCAGAACAATTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTCGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTTTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGTGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTTCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGATCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os11g43160 ATGGACACTGCTACGTCTGCACCTGAACGTACAGATACATCTATAAGTGCAGGCGGAAGTGGGAAAAAAAGACGTGGTGAGAGAATCAGGACGCGTTGTCCCATTAATGTCAAGTTATGGGAAACGGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTACCCTCCTAGATCAGAGGTCAGGGGAAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAATCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTCACGGAATATGGACATATATCGCAGGCTGACTGGGATACGTTTGTTGCGGATCATACAACAGTTGAAGCATTGGCTTTGAGGAAAAAAATGTCCGAGCTCGCCAAGAAGAACAGATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGGCACGTCGATCAATGGCGGGAGACCGAGCAAAGATTTACAGCGGCCAGCAAACCTCTGCTGGTAGACCCCATGGCGGAACGTGGCAAGAACTGGGTTTGGGCGCGCAACACAGATCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGACATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGATAG >LOC_Os11g30080 ATGCCGCCACGCCGCCGCGCCAACTGCCGGCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAAAATGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAATGAACGTGAATGAGAACAAGCGAACGAACTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGTGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGATACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACAATCGAAGTTCTGGTACTATGCTCATGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACATAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAAGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAAATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCAGCCGACCATTCCTCCTGCAATGGTGA >LOC_Os11g23810 ATGAACGAGAACGTGAACGAGCGAACGAACGTGAACGAGAACGTGAACGAGCGAAAGAACGTGAATGAGAACGAGCGAACAAACGTGAACGAGAACGTGAACGAGCGAACGAACATGGCTGATCGCGATGAGGAACATATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTATTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGTGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAATGGAAGTCAACCCTCCGTTGGACAGAAGAGGGCACACGGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGACGAAGACAGCCGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGAGATCACCGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGTCGCCAAGAAGAAGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCCCAACGGGGCAGGTGGCGTCAGGCATGGCCATCCCAACAGACCCTTCAGGTACTTACCATTGCAGGCCGATTCCAGCAGGATACTACAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTAGAGGAGATGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATTCTATGGCGCAAGCGGTACATCATCCTCCTTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGCTCCTCCACCGTCTCCTCCTCATGCTCCAGCACCGTTTCCTCGTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACTGACTCCTCCTCAGGCTCCTCTTCCGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCGAAATTTGACGCCTCCAAGAACAAGGACCCAAGGTACGATTGCACGCAAGAGGAGCTTGTAGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTCAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGATTTTGGAATACAAGAATTTATTAATGACACCGGGCTAACTACGGATCAATTGCTAGGAGATGCACCAATCAAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTACTGCAGTCCCTACCCACACATATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGAATCAGGGACACGGATTCTTGCAAGGAGATGACATACTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACACCCTTGACAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAATACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGATAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCGCAAGAGAGCTCGATTTGAAGAAATGTTTGAGAGTTCCTGAGGAACAGGCAAGTCCGGATCACATTGAAATTCAGGAAGATCTGACGTATGTGGAGAAGCCGACCCGTATCCTCGAAACCAGCAAGAGAAGGACCAGAAACAAAGTAATCAGATTCTGCAAGGTTCAATGGAGTCATCACTCAGAAGAAGAGGCCACTTGGGAAAGAGAAGATGAATTGAAGGCCGCCCATCCGCACCTCTTCACCAGCTCTTCCGAATCTCAGGGTCGAGATTCCGTTTAA >LOC_Os11g43430 ATGCCGCCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCGCAACGCCACGCTGCCGCCGCCGTCGCCACGCCGCCGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCAGACCGCCGTTAACGAACGAGAACGAGAACGATCGAATGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACGTGAATGAGAACGAGCGAACGAACGTGAACGAGCTAGGGAACATGGCTGACCACAATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTAGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGTTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATTTGTACCAGAAGTATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGTCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTAGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGATGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGAACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGAGCCTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTATACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACACCGCTAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGGCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACACTGAAGAAAGCATCTTTTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGGGAAGACATGACGATAGAAGAATTTATTATTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACGTGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACCCGGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGGAATCTACGAAGTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGACTTTAATGGAGATTCAAAGGGCCCGATGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTTGCAATGCTCGACCAATATCCGCAGGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTTTCGGTTCCGTCATTTGGTCCGCGGCAACTGGAGAGAAAGACTTAGGCGGAGGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCAGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os11g10440 ATGACCTATAGACTTACCAACTATGTCTTGTATGAACAGATGGCTGATCGTGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCAGAGGGGAACCAGGAGGGGAACGTGGAGAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTTTGCTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCCGCAAAGAAGCTAGAGGGTCAGCACATCATAACGGAAGTGGACGAAGACGGCCGACCTAGTGCCCCGGCGGAAGCAGCCAAGAACTACCGCAGAACAAGGGCACGCAGAGATCATGAGAGCTTTGTCCTAGATTCAGAGAAAGAGATGTTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTATAGAGGACACAGTGAAAAGGTGGACTCTAAAGAAAATGGTAGAACAGTTTCAGAGCTTCAAGGGAGATCTATACCAGAAATATATCCTAAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTCAACAAGGGCAGGCGATGATGGAAAGAAACAAAAAAAATGCCACCAAGAAGAAGTATCATCACCACTTGGGGTCAGGCGGCTATAGCGTCGCGATGCCAAAGTGGGAGGAGATGGAAACAAGCTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGTTGATGGCTCCCTGGTCTTCAGCGATCAGATACGCGAGGCTGCGCGTCGACTAATGGACACAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCCGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCTAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGATTCAAGGAGGACATCCACACGTATAGGAGTCGAATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGAAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCACCTGCAATGGTGAGCCCTTCAGGCAATCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCTATGCAAACCCAGGACGAAACCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATACCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCTAGCAGGATACTCCAAGGTCGAAATTGAGTTGGTGGAAGGCACATACGAGGACCTCGAGTTGGATTACCTTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATACTATGGCGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCATGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGCTCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTTCACCGACTCCTCCTCAGGCTCCTTCACCGACTCCTCCTCAGGCTCCTACACAGACTCCTCCGCAAGCTCCTCGTCCGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCCCACAAGGGCAACGAAGAAGGCAAAAGTTGACGCCGCAAAAAACAAGGACCTGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTATGTGGCATCAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGCCAGGAAATTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACACTTAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAAGAGATCGAGCCGTTAGTGACCGGTGAAGATTTTGGAATACAAGAATTTATTAATGACACCGGGCTAACTACGGGTCAATTGCTACGAGGCGCACCAATCGAAAAGGCGGAAGTGAAATACATAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTTGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTGCTGAAGGCACAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAGTTTTTAGTGTCTTCCTATAACAAATTTCATTCCCGTACGAACATGCTAAGTGTTTCATATGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGATAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGACAAATGGAGAGAAAGACTTAGGCAGAAGTTCAATTTTCCTTGCACAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGTATGAGGGATAACCTGATCACACACAAGGAATTTATCGTGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCATAGGTCCTTAGCTTCTGAGATAACGACTACTACTACGTCGAAATCGTAG >LOC_Os11g32680 ATGGCTGATCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTATTTGAACGAGGAAGGGAACGTGCAGAGGGATGCGGAGGGGAACCAGGAGAGGCACGTTGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGATAGTGCAAGTCAACCCACCGCTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGACGAAGACGGCCGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATGTACGTCATAGCAGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTATACTGGCGCAGAACAAGGGCACGCGCAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAAGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGAGTTGTACAAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGATAGGTGAACAAGGGCAGTCAATGATGGAAAAAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCATGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGGTTGCTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGTCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGAGTCGTATGAGGAGCAAGAGAGATACTGAGGCGAAGATTGAAGATCTTGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAAGAAGGTTGATGAACGCATGGCCGCACATCGGTCCAATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCATAGCAGCTATGCCTCAACGGGGCAGGTTGGACCGCAGAGCATGGACGCCATGCAAACCCAGGACGAATCCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTTAAGAACTTATCAATAAAGGTAGCGTCGGGCATGGCCATCCTAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTTGAAGTTGAGTTGGTCGAAGGCGCGTACGTGGACCTCGAGCTAGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCAATTATTCTATGGCGTAGGTGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTTCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTTATGCTCCAGCATCGTCTCCATCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCACAGAAGGGCAACGAAGAAGGCGAAAATTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGTCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACACTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACCGATCTAACTACGGACCAATTGCTAGGAGTCGCACCAATCGAAAAGGAGCAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGCGACACAGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACATCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGAGGACAATTTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAAGCGGAAGTTCAAATTTCCTTTTATTCGCATGAGGGATAACCTGACCACGCACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAGCTTCTGAGCTAGCGACTACTACTACATCGAAATCGTAG >LOC_Os11g42180 ATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACATATGCCATGCTATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCGCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGACAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCACTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCGTTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os11g46830 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGAAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGAGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACAAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTATTCGGCGTTCAGATACGAGAGGCTGCGCAACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCCGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCGCAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCATGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAAACAGGAGATCGAGCCGTTGGTTACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCGCCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTAATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATGA >LOC_Os11g47443 ATGAAGAGCACGAACCAGAACAGTGCTATTCGTATCGATGCCATGGGACACGATGGTACAACTGGCACATATTACGGTGCCATCAAGGACATATGGGAACTTGACTATGGACCTCTCAAGGTCCCTCTGTTCCGGTGCCAATGGGTTAGGTTGACTGGTGGAGGCGTAACGATTGATGACAGTGGGATGACAACGGTTGACCTTAACAAGGTTGGATACTCGGACGAACCTTTTGTCCTTGCCAATGATGTAACGCAAGTTTTTTACGTGAAGGACATGTCTAGCAAAGGAAAGAAGGGTAAAGGGCCTGACGAGCCGAAGCGCCACGTGGTTCTTCTAGGCAAAAGAAAAATCGTCAGAGTAGAGGACAAGACTGACGAGGATTACGATCAGTTTGATGGGCAACCCCCTTTCACGGTGACGATTGACCCTAGCATCCTCCTATCAAATGAAGACACCCCTTACTCACGTAGCGATCACAAGGAAGGAACACTAATGGCTGATCGCGATGACGAACAGATACTATACGATACAACTGCAGAGGGAAGCAACCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAAACAGTACTTGAATGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGGGAACAAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGCTGGACAGAAGAGGGCACGCGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGTGGTGGACGAAGACGACCGACCTAGTGCCCCGGCAGAAGTAGCCAAGAATTTTGTACGACACGGCGGTTGGGTTGTGAGGGATAACGTGCCTGTCAGCAAGGTGTACTGGCGCAGAACAAGGGCACGCGGGGATTATGACAGCTTTGTCCCGGAATCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACGTTTACGCTCCCTGCGGGTACGGAGAACATAGTGAAACAGTGGACTCTTAAGAAAATGGCAGAACAGTTCGAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGTGGCTGACACCGAACTTCGGCGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGATAGGGCAACAAGGGCGAGCGATGATGGACAAAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACCTAGGGTCAGGCGGCTATAGCGTCGCAATGCCGAAATGGGAGGAGATGGAAGCAAGCTTGATTGAGAGGGGTATTGAACCGGTCACCGCTAAATGGCCAGATCGATCAAAGTTCTGGTACTATGCTCACGGTGGAACGCTTAACCCAGTTGATGGCTCCCTGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTTATTCCTTGGAAGATTGGATTCAAGGAGGACATCCACATGTACAGGAGTCGCCTGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGAGGCAAGGAAGGTTGCGTCGGGAATGGCCATCCCAATGGACCCTTCAGGGACTCACCACTGCAGGCCGATTCCAGCAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCTGCGTACGAGGACCTCAAGTTGGACTACCCTGGAGGAGACGGTGAGACGCATCTACGAGATACAAGCCACGCCATTATTTTATGGTGCAAGCGCTACATCATCGTACCTGGGCGACAAGCGGCGTCTCGTGCACCATCCCTTCCGGCTCCACCGTCTCCTCCTCAGGCTCCTGCACCATCTCCTCCTCAGGCTCCTACACGTGGTCCTCCTGATCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCGTCGTGTCCTCCTCAGGCTCCTCATTCGGCACCTTCCAAGTCAAGGTCTCACCAAGCTCCACCGCCTGCTTGCACAAGGGCAAAGAAGAAGGCGAAAGTTGACGTCATAGAAAACAAGCAGCCGCTGTACAATTGCAGTCAAGAGGAGCTTGACGCTTGTGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTGCTGACCCGAGCGTGAAGAACTTCTTCAAGAAACTGTCCACAACAAACAAGGAGGTCTTAAAGCTATCGGACTATGACCGAACACTTAAGAAAGACTATTACAAGAAGTCCAAACTATTGATTGGAGGCGCACCAATCCCGAAGGTAGAAGTGGCATACCAGTTTGAACTCGGTAAACCGCTTGTCACGCCTGAGCAGCTGCAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACTCTGACTTCTTGCAAGGAGAAGATGTTCTCTGGATCGAATTCAAGGATGTCTTCGAACTATACCATCTGGACACCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGTGGGGGGTTTACGATACTGGGTTCATCGACCCTCGGAAAATCAACACCGAAATGATCGACAAGTACGAGAAAGACATATAG >LOC_Os11g26070 ATGACAACGGTTGACCTTAACAAGGTTGGATACTTGGACGAACCTTTTGTCCTCGCCAATGATGTAACGCAAGTTTTTTACGTCAAGGACATGCCTAGCAAAGGAAAAAAGGGCAAATTGCCTGACGAGCCGAAGCGCCACGTGGTTTTCCCAGGAAAAAGAAAAATCATCGGAGTAGAGGATAAGACTGACGAGGATTACGATCAGTTTGATGAGAAACCCCCTTTCACGGTGACGATTGACCCTAGCATCCTCCTATCAAATGAAGACACCCCTTACTCACGTAGCGATCACAAGGAAGGAACAATAGTGAGGAGAAAAGAAGACGTCGTCGTCGTCCCTCAAGCCGAAGTGGTAGCTAGCCATCGAAGGAATTCGCACAGGCAAATGGCTGATCGCGATGAGGAACAGATACTGTACGATACAATCGCAGAGGGAACTAGCCAGTACTGGAACGAAGAAGAGGGGAACGATGATCCAAACCAGTACTTGAATGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACGAGGAGGAGGAGGCTAGTGGAAGTCATCCCTCTGCTGGACAGAAGAGGGCATGCGGACAACGAGGTGCCGCGAAGAAGATAGAGGGTCGGCACATCATAACTGAGGTGGACGAAGACGGCCGACCTAGTGCCCCGGCAGAAGCAGCCAAGAATTTTAGCTTCAAGGGAGATCTCTACAAGAAATACATCTTGAAGCGACTAACACCGAACTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCATTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGCCAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGATATAGCGTCGCAATGCCAAAGTGGGAGGAGATGGAGGCAGGATTGATTGAGAGGGGTATCGAACCGGCCACCGCTAAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACAGTGGAACGCTTAACCCAGTTGATGGCTCCCTTGTCTTCAGCGATCAGATACGTGAGGCTGCCAGTCGACTAACGGATGCAGTGGAAGCCTCTTCTCAGGGAACATGCCGACCCGATAGAGAGAAGGACGAGCTGTCACTCGCCCTACAGACTCCCGAGCATCCAGAACGAACACGAGGGAAATGCGTGATTCCTTGGAAGATTGGATTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCGCACATCGGTCCCAGGATCCCCAGCCGTACATTCCTCCTGCAATGGTCAGCCCATCAGGCAATTGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATTCAAACCCATGACGAAACCACCTGCCCCATTGATGAGATCACGCAGCGGACACCATGTGAGCTGCATATTCCCTTCAAGAACTTATCAATCAAGGTGGCGTCGGGAATGGCCATCCCAACGGACCCTTCCGGGACTTACCACTGCAGGCCGATTCCAGTAGGATACTCGAGGGTCGAAGTTGAGCTGGTGGAAGCTGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGATGAAGAGGCACTTAGTCCTCACACCGAAACAAAAGCAGCAGCAGCGGAAAAAGGCGATCCTAGCGGGGCTTCAGCTCCACTCCACAGGCAAAACTCAACTGGGGTCTGA >LOC_Os11g29650 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAGCCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGGTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCAAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGCGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACTACTTGGGGTCAGGAGGCTATAGCATCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTTCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTATCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTTGTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCTGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGTCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAATCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTAGACGCCCTCGACGTCTCTATTATGAGTTGCTAG >LOC_Os11g35460 ATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCAGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGTGAGTACTACTACGTCAAAATCGTAG >LOC_Os11g15360 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTCGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCAGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGTGGGTACAGAGGACAAACTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGCAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGAAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGGGTATGTCTGCATCTGTCAAGGAGTCCATCAAGCTATCGCACTATGAGCGGACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAACATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAACCGTAG >LOC_Os11g18530 ATGTCTTCCGCACAACCATCAGAGCCTGTACAAGCGGAGCCTACAAAGCTAGCGGCGGGTGAAATTGAAGCGGTGCCTGAACAGACAATGCCTGATCAACCAGAGCCATCGCAACCAGAGGAACCTAAGGATGCCGATGTGCTAGTGATGGTAAGGACGCACAAGCACAAAGCAAAAAGTGCGTCCAAGAAACAGTATATGGTAACGGCATTCCGAGGAAAGGAGAAAGATATCGTAAATGCCGAGTTTGATAAAAGAAAATTAAAAGGGTTCAAACATACCTTTTATCACTATCTCAACTATATCAATTCTCTAGATGAGCCACACGAGTTTGAGAATGACAAACCATTCATTTACGACTGGAAACTAAGAGAAGGACCGTGGCAACTAAGAAGGCGGCACGATTGGTACATTAGGGCAAGCACCATGAAAGGCATTTCATCATTCACAGTTGCTGTGGGGGAGAACATCTTCTAG >LOC_Os11g28050 ATGGTCGATAATACTAAAGGGACTGAAGAGAAGGGTTTAAGGGAGGAAGAACCGTCCATTCCTATTGTCGATGCTCCGGAACCAATGGTCCCACCGGAAGATAGTTTCGACAGCGACGTAGCTGACGAGGGCGATGAGTACTCGTCGCCAAGCGATCCTTGTCCAACCCTAAGCCCGAAGAGAAGGAAAAAGGGCAATGGTGAAGAAGGCGACAAGGACTGCATTCCCCCTAAAGAAGGGGAAACGGCGCCACGACGATCAAAATGGCAGCCGAAGAAAAAAGATCGGTCGAAAGACGATGAGGTCCCAGCTAACACAACAGGCTCAAAGAAAAGCGAACGGTCAGCAAAGGCGAAGAAAAGAAGGGGCGAGAGAAGCGTGAATAGAAAGGACGAAGGGTTTCATGATGTTACCCATGTTTCGCCAAAAGGAGAGCCGCTCGCCCCTAAGACGGCACGTGCGAAATTCAGTTCACAGTGTGGCATAATAAACTCCTCGGAAGAACTTGAAAGGAGCAAAAAGTTTTTAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTTCGCGGGATATGCACCAAAGGTGGAGCAGTGGACAAAAGAGGTGGAGGAAATGAGGAAGGCGGGGCTTCCGGTGGTGGCCGATACAATAGAGAATTTATCCAGTGCACAGGAGAAAGGAGCTTGTAAGCCTAAGAGGGAGAAAGATGTGCTAAGTACGGCGCTTGGTACTCCTGAGCATGGGGGTAGGGTTCGAGGTGTGTCGTCCAAGATGAGTTGGAAGGAAGGATTCAAACATGACCCCCATAAGACACGTGAAGCGTACAAGGATAAACATAAGGACGAAGGGGCTGTGGATTTTGAAAGGCAAATGATGGATTTATGCGTTAAGCACATGCTTTTGCCTCCCCCCGAAACGAAAGAACCTGAGCCTGATTACCCCTTCGATGACCTCAAGGAAAATACACCCCACAGATTGCACATTCCCATTGGACGCTCCGGGAAATCTCTTGAGGCCGCTACAGCCATTGCTATCCCTGGGAGAACATATAATGAAGAGTTTATAGACGATGTGTATGCCAAAGTGCAGCCGCAAGTGGTCCACGAAGGGTTTGAGTCCTACGAAATAGACTTCCCTACTCAAGATGGTGTATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATCCTTTGGATTTGGCACCGACGCCACACCACCTAAGAGGAAGGTGACTAATAAGGCGGAGGAACCCGAGATGCATAAGGAAAATCCAGTGCCGGAAGTGCCACCAGAGATTGCAGTGCCGGAGGTGCCCATGGAGATTGCGGTGCCGGATGTCCAAATGGAGATTACAGTGGCAGAACCAGAGGTGCAATTTATGGCATCAGTCGGGACAGATATAGAAGAAGTACCAGGATTAGAACGGGACGGTACAGAGCCAGAAATATTTGAAGACCCTTCTCCTGCGAAAAACCCCGAGGTGCAAGAGACCCCGGTCCCTGAGAAGGCCACTACCAGTTCTGAGGTGCCTAGAGTGCTTAGAAGCCATGACTCCAAGTTCAAAGATGAGAACAAGGAGAAGTTCATGGATGCAATACATGGATGCCAAGAAGAAAAAAGAACCTATCAGCTTCTTGGATCCATCTCGGATCTGTCAAACACAGCATACCGTGAGGCTAGCACCAGGTGTCACAAGCAACCTAGAGGAACTGTCCTTTGCGGGTATTACGCGTACGAATTCCTTAGGGTTAATAGGAGGTATAGGGTTTACGCAGAGGATTTGCCAAGATTAGAACGTCGAACAAGCTTTGACGATACAGGCATCACAAATGTCCAGCGTGATCTATGCCACTTCATCCACCATGAGTACTGTCATGTGAAAGGAGATTTCTTCGACCCAGAGAGTGCCCTAGCGACAAGTGACGAATTCAAGGATCTTCGGGAGTGGAACACCGCTATGCCATAA >LOC_Os11g16630 ATGGCCGATAGTACTAAAGGGAATGAAGAGAAGGGTTTATGGGAGGAAGAGCCATTCCTTCCTATTCTGGTTGCTCCAGAACCAACAGTCCCGCCGGAAGATATTTCCGACAACGACGTAGCTGACGATGATGATGAGAACTCGTCGTTAAGTGTGTCATTCAATCTGAGTTGGAAGGAAGGGTTCAAACATGACCCCCACAAGAAACGTGAAACCTACAAGGATAAACTAAGGGACGAAGGGGCTCAGGATTTTGAAAGGAAAATGATGGATTTCTGCAGCAAGCACATGCTTTTGCCTGATCCCGCAACCAAAGAACCTGAGCCAGATTACCCCTTCGATGACCTAAAGGAGAATACATCCTGTCGATTGCATGTTCCCATTGGACGCTCCGGAAGAACTCTTGAGGCCACTACAACCATTGCTATCCCTAGGAGAACATATAATAAAGAGTCCATACCCGATGAGTATGCAAAAGTGCAGCTGCAAGTGGTCCACGAAGGGTTTGAGTCAAATTCTCCAAAGAAGCAGGTGAATGATAAGGCGGACAAACCCGAGATGCCTAAGGAAATTTCGGTGCCGGATGTCCCAATGGAGAGTGCAGCGCCGGAGGTGCCCATGGAGATTTCAGTGCCGGATGTCCCAATGGAGACTACAGTGGCAGAACAAGATGTGCAAATTGTGGCTTCAGTCGGGACAGATATAGAAGATGTAGCAGGATTAGAATGGGACGGTACAGAGATAGAAGTATTTGAAAACCCTTCTCCTGCGAAAGACCCCGGGGCGCAGGAACCCCTAGTCTCTGACAAGGCCACTGACAAGTCTGAGGTGCCTAAAGTGCTTAGGAGCCACAACTCCAAGTCCAAAGATGATAAAAAAGAGAAGTTCATGGTAACCGTCTTCAGAGGGGGTAAGGAACATGCCAAACTCAGAGGTGATGACCCCCAGAAGGCCGCTGCACTAACCGGGAAAAAATACTTCCCAACTAATGATTGCCCAGAAAAATACGAATATGGGAAAGCACTTTTACCGGAATGGGCACTTGACGAAGGACGGAACCGTGGTAGTCTTGGACCCTCTCGATTTCAGTCACCAGTCATACAAAGAATTTCTAACAATCTTATAGTATGTCACAAGCAACCTAGAGGCACTGTCCTTTGCGGGTATTACGCGTGCGAATTCCTCAGTGTTAATGGGAGGTACAGAGTTAACACAAAGGATTTGCCAAGAATAGAACTTCGAACAAGCTTTGACGATACAGGCATCACAAATGTTCAGCGCGATCTATGCCACTTCATCCACCGTGAGTGCTGTCATATGCGAGGAGAATTCTTCGACCCAGAGGGTGCCCTAACTACAAGTGACGAATTCAAGCAACTTCGGGAGTGGAACAATGCTATGCCATAA >LOC_Os11g25000 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCAAACTTGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTACGCGACGACTAACTGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGACGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCATCTCCTCATCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCTTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCTGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGATCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATATCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os11g26700 ATGGACAAACCCACCCAAGAGCAACCCACGGGTGACAAGGGCAAGGAAACTCAGCTAGTCATGGAGGAAGATATTTGCACGCAAGTAGTCGTGGAGGAATCTTCGTCGTCTAGCTCAAGTGAACCAGGCAGTGGATCGTATCACTTGCCGAGTGACCCCCATCCTTCTCCGGCAAAGAAGAGAAAGGGCGGTAGCGACAATGAAGTTGACTCTGGCTACGTTCCCCCCGAACTGGTGTGCAAAACAGTGCATTTAAAAGGTATTACCAGCGAGGCGAATAACACAAAAACTCAAGAGAACGCATATCCGTCCGCAATAAGTGGCCGTGTCACAAGCAACTGGTGGGAACAGTACTATGCGGATATTACCGTTCTTCCAAAATTCCCCAAGTCTGCAAGAGAGCTCAATGATACATCCATTCAGAATATTCAGGCGGACATGTGCTACTTCATCCACCGCCCCAAACCCACCCTTCCGTGGAATGCAGCCCACGCCTGGATCAATTCCCACATCCGGCCCAAATGTGCATTTGGCTGTTCGTGTATTGCTGTGTATTGCGGCTCGATACATGCCGACCCACGGGACCTTCAAGATCTGGAAAGTACAGCCATCCTGCTAGGGTTTGACGATCTGCAAGAGAAATATTGGAGACGAGGTATGTCAATGCTTGGAGATATGCAAAGTACAGCCATCCTGAAGGGAACAAAACACAGTAGGGAATCACTAGCTTTGATCTTGTATTAG >LOC_Os11g40960 ATGCCACGCCGCCGCGCCAACCGCCGCCCTGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAATGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGATAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAAGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCATTGGACAGAAGAGGGCACGTGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGATGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGTTCAGGAGGCTATAGTGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGAAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGGTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAACAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAGGGGCCCCCCAGCTCCACCGCCTGCCCACATAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGGGTATGTCTGCACCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAATTCCAAATCAGTCCCTCAGCTTAGAGAGCAACTAAACCAGGAGATCGAGCCGTTGGTGATCGGGGAAGACATGACGATAGAAGAATTTATTATTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTTGAACCAATAGAAAAGGCGGAATTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCCGAGCTGGTGCAGTCCCTACCCACAAAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACCCAGACTTCTTGCAAGGAGATGATATTCTCTGGATCAATTTCAAGGGAATCTACGAAGTATACCAGCTGGATGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGTGATTCAAAGGGCCCGACAGCGGAGGGTTTTCGATACTGGATTCATCGACTCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCGCAGGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCTGTACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTTACAAGGTTTTCGAACTTATAGATAGGGCTTGGTATCGGTTCCGTCATTTCGTCCACGGCAACTGGAGTGAAAGACTTAGGCGGAGGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTACTACGTGTGTGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGATCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACAGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os11g46160 ATGAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTGTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCAAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGAGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os11g17850 ATGGCTGATCGCGATGAGGAACAGATACTATACGATACAATCACAGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGATGATCCAAACCAGTACTTGAACGAGGAGGGGAACGTGGAGAGGGATGCGGAGGGGAACAAGGAGGGGAACGATGCGGAGGAGGCTAGTGGAAGTCAGCCCTCTGCTGGACAGAAAAGGGCACGCGGACAACGAGGTGACGCGAAGAAGATAGAGGGTTGGCACATCATAACTGAGGTGGACGAAGACGGCCGACCTAGTGCCCCAGCAGAAGCAGCCAAGAATTTTGTACACCACAGCGGTTGGGTTGTGAGGGACAACATGCCTGTCAGCATGGTTTACTGGCGCAGAACAAGGGCACGCGGGTATGATGACAGCTTTGTCCCGAACTCAGAGAAAGATATGTTGTGGACCACAATGCTCGAGACGTTCACGCTACCCGCGGAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCCTGAAGGGACTAACACCGAACTTCGACGTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGACGGGGCAACAAGGGCAAGCGATGATGGCCAAAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACCCTTGGGGTCAGGCGGATATAGCGTCGCGAGGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGCTTGAGAGGGATACGCGAGGCTTCCAGTCGACTAACGGACGTAGTGGTAGCCACTTCTCAGGGCACATTCCGACCCGACAGAGAGAAGGATGAGCTGTCACTCGCCCTACAGACTCCCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATTGGATTTAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGTAAGAGAGATACCGAGGCGAAGATTGCTGATCTTGAGTACAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGTCGGATCACAGAGCATGGACGCCATGCAAACCCAGGATGAAACCACCTGCCCCGTTGATGAGGTCACGCAGCGGACACCATGTGAGTTGCATATTCCCTTCAAGAACTTATCAATCAAGGTGGCGTCGGGAATGGCCATCCCAACAGACCCTTCCGGGACTTACCACTACAGGCCGATTCCAGCAGGATACTCGAGGGTTGAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGGGACGACACCGGTCTAACTTTGGATCAGTTGGTTCGAGGCGCACCAATCCCGGAGGCGGAAGTGGCAAACAAGTTTGAACTCGGTAAACCGCTTGTCAAACCTGAACAGGTGGAGTCCCTACCGACACAGATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCAACGGTAGAGAGATGTTCAGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGACGATGTTCTCTGGATCCATTTCAAGGATTTCTTCGATCTGTACCAGTTGGACGCCCTCGACGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTCTACGACACTGGGTTCATCGACCCTCAGAGAATCAACACCGAAATGGTCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCATTTCAAGACATACATACTACTGCCGTACAACACAGAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCAAACTGATAGACAGGGCTTGGGATCGGTTCCATCAATTGGTCCGCAGGACTTGGAAAGAAAAACTTGAACGGAGGTTTCATTTTCCACGTATTCACATGAGGGATAATCTCCCACAAAAGGATTTTATCATAGCTGTTCAAGAACAACTGATGGGATTCATCAACGAAGAAGTCCTTAATCTCGACGGTGAATTCTACTACGACTGTTCGACAATTCATAACGTCGGTCCTTCCTCTTCTGACATAACGCCGGCGTCGAAGTCGAAGTCGTAG >LOC_Os11g38550 ATGCCGCCGCCGCCACGCCACGCCGCCGCTGCCACGGCCCCGCAACGCCACGCCGCCGCCGCCGCCGCCGCCACACCGCCGCGTCAACCGCCGCCTCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACAAAAGACGTGTTGTCGGAGTCGTCCGTCAAGCCTGAGTGGAAGAGCTAGCCCTAGAAGGAATTGGAGCAGGCAAGTGACATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAAGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGACTACTACTACGTCGAAATCGTAG >LOC_Os11g37600 ATGGCTGATCGCGATGAGGAACATATATTGTATGATACAATTGCGGAGGGAAGCAGCCAGTACTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTATTTCAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGGGCACGTGGAAAGGGATGTGGAGTGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGTTGGACAGAAGAGGGCATGCGGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGACGAAGACGAACGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTATGGTGTACTGGCGCAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGATATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAATATATCCTAAAGGGGCAGACACTGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTTAGGCGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTACTTGAGAGGGGTATCGAACCGGCCACCGCTAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATATGCTCTGCGCGTCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCAGACAGAGAGAGGGACGATTTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGATCTAGAGTTCAGGGTATCGAGCTACGAGCTCAGCATGCAAGAGGAGGTGGCAAGGAAGGAAACTGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATCCATCCCAACGGACCCTTCAGATACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCAAAGTTGAGTTGGTCGAAGGCGCGTATGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAAGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTCTTCCGGCACCTTCAAAGTCAACGGCCCCCCAAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGACGAAAGTTGATGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACATGGCATCAGAAGTCAAGAGACAATTCAAGCATCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTGAAGATATTGGAATGGAAGAATTTATTAATGACACCGGCCTAACTACAGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGAGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCCGCAGTCCCTACCCACACAAATGTACAAGTTCCATCATCTGTACATGGAGATGAGCGCCATTGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGATGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCAGGGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCGCAAGCCACAGTGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCGTACAACACATAG >LOC_Os11g17190 ATGTACAAATTTCATGAACAGTACATGGAAATGAGCGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCTGACTTCTTGCAAGGCGAAGATGTTCTATGGATCCATTTCAAGGATCTCTTCGATCTGTATCAACTGGACACCCTCGATGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACAGCGGAGGGTCTACGATACTGGGTTCATCGACCCTCAGAAAATCAACACCGAAATAATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAACGCAGCAGCGTTTCAAGACGCACATACTACTGCCGTACAACACAGAAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCAAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCACGTATTCACATGAGGGATAATCTCCCACACAAGGATTTTATCACGGCTGTTTAA >LOC_Os11g38690 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAAAGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAGGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGATGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGTGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAATGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACATTTGACAAGGTTTTCGAACTTATAGATAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os11g12780 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGAAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGCAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGAAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTACGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAATACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACAGACCCTTCAGGTACTTACCATTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCTTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACAATTGCACGCAAGAGGAGCTGGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os11g28140 ATGTCGAACGAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTCCGGTAGCAATAAGCAGCCAGGCGCTTCTAGTGAAGAAACGTGGCACACACCAAGTGACCCGTTTCCAATGGAAATAACACAAGTCGCCCCCCGCGATGATGATCCGGACTACATACCTATCGAACAGGCCATGGTAGTCCGACGCCGCTCGAAACGTAAAGCCGGGAGGAACAGGACAGAGCAAGAAGTTGAGATGGACACCGCTACGTCTGCACCTGAACGTACGGAGACATCTACAAGTGCAGGCAGGAGTGGGAAAAAAAGACGTGGTGAGAGAAGCAAGAATAAATTACCCAAGGAAACTTACAACGTGATTGCTCTCGATCAGGATGGGAAGCCCATCGAGCCACCGATAGTGCGGTCCAAGTTCAGCAACGCCTGTGGCACTCTAGTCAGGACGCGTTGTCCCATTAATGTCAAGTTGTGGGAAACAGTGGACGACAACATCAAGACACTTCTCTGGAATGAGTTGCAGAAGTATTTTGTGTTCCCTCCTGGATCAGAGGTCAGGGGGAGAGATTACGCACTTAAAAAGATGGGAGATCGATGGCGACAGTGGAAGTCCGATCTAAATCGGGATTATGTTCAGAAGAATCTCCCACCGTTTACGGATTATGGACATATATCGCAGGCTGACTGGGACACGTTTGTTGCGGATCGTACAACAGCTGAAGCATTGGCTTTGAGGAAAAAAATGTCCAAGCTCGCGAAGAAGAACAGATATCCCCATAGATTGGGGTCGAGCGGATACGCTGGTCACGTCGATCAATGGCGGGAGATCGAGCAAAGATTTGCCACGGCCGGTAAGCCCCTGCTGGTAGACCCCATGGTTGAACGTAGCAAGAACTGGGTTTGGGCGTGCAGCACAGGTCAAGTCTCGGATGAGGGAGACATACTATTCGAGACTCCAGATATAGAAGAAGTGACTACTAATTTGCAGCAGATAGTCGAGAAAGAAAGATCAGGACAGTTCGTCCCACGGAGGGAGCGAGATCAGCTTACTGCGGCGTTGGGGACGGCTGAACACTCTGGACGTGTAAGGGGTTTGTCCTCAAAGACAAGTTGGAAGGTCGGGTTTCCACAAGACGCACCAAGTTATAAGAAGAGAGACAAATACAAAGAACAACTATCGGACAAGATCTATGCGCAAGTGAAGGAACACTTCTACTCGTTGGCAGCTGAAAACCCGACAGCATTTCCAAGGTTATTCCCTGATAGCCAGCAACCCACACAATCCGCACAGCAAACAACTAATGTACCCAGCAGTGTAGGCTCAGTGCAGACAAGTACCTTCCCTGTGGATAGTATAACTGGACCAACTCCGTGCAGTCTCGTCGTAGCAATCAGCCGCGCTGGAAAGACTAAGGAGGTTGCAACGGGTTTAGCGATACCCGGACGTCAATTCCACAACACGGCAATCCCTGAGGATTACGCAAGGGTACAGGTCGCCAAGGTCCATAGCGACCACGTTTCCTTGGAACTAGACATACCTGCACCTGAGGGGATTGAACTTCTCGGTGATGCAGTGAATCAGTTTATCTTGTGGCACCGCAGAGACATAATCCTGAGCGCGGCCGTTCTTGCAGCAGGATCTTCAACCCCATCCTCATCGCAGGCAATGACTGCTGCCGCTCCTGCACCACCGTCGCCTCCTGAACCACCGTCACCTCGACATCCGCCGTCACCACCACCGCTTAGGTCACCGCCTCGCCAACCTACACCACCACCCTCCCCTTCTCAACAACCGCCTCTCCCGACCCCGCAACCAGTTCAAGCCTCTCCCACCTCCCCAACTAAACAGCATGCTCCCCCGGCTCCGCCCTCAGTTCAAACCTCTCCACCTACACCCCAATCTGCTCTGGTAGAACAAGTGCACATACCAGATGGTACTACATCCGAACCAAAGTCTAATACTTTGGAACCTCGTCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCAGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCACGTCTTGTCAGACTCCCAGAAGTCAGTACTAGCGGCCCAAGATGAAGTGCAATCCTGGTTATCTGCCGATGTGCCTGAAACTTATGAGTATGGCAAGCCATTCTTGCCAACTTATCTTATGAACAAGCTACCATGGGAAATGAGGGTAATGCACGAATGGTATATGAAGGCATCTAGGAAAGGTCTCGGTTTCATAAGCATCGCCGTCCCGGAAGGCGCTTTCATGAGTGGTCCTAATGGGATATTTTTTATCTCTTTCCAAGATCTTTACGCCCTCTACAAGCTAGATAAAATGGACGTTAATCTCGTTGCGGCTTTCTGTCTTATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAACCACAACACACCGTAGAGCTGAGACAGGACTGCGAGCAATTGGTTGGCAAGACCCCGGAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACCAGTTCACAGACCACTACATATTATTCCTTGTATATCCGAAAGACCAATTGATCATATCATTGGACCCCGCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGTGGACCAGTACATATTCCATCCCAGAAGAAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCAGGAACCAACTTGTGTGGTTATTACGTGTGCGAGATGCTCAGAGTGAATGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAACGATTCAACCACACTACTATCTTGAACGTGGCCGCTGACCTCTGCCGATTCATCCGTCGCGATGTCTGCAACGCAAGAGGTCTCTTCTACGACAACCAGAGTGAACTCGCAATGGACGACAAATTTAAACCTCTCAGAGAGTGGGAGAAAGAACATATGCAATAA >LOC_Os11g35470 ATGGCTGACCGCGATGAGGAACACATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCAGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCTAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATAAACGCATAGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTTCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGATCAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATTGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTAG >LOC_Os11g24880 ATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGACGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAACTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os11g14680 ATGAAAAAGCCTGTCGCCTACCTAAACCCGTGCAGGATAAGTAAGCCGAACCATACATACACGCTAGACGAGAAGAAGCTACCGGAACACATCAAGGCAATGTCTTCCGAAGAGAGGAAAGCTTACGTAGCACAAAGGCATCATGAAAAGGTCCTCGATGTCGCTACGTATGTAGCTATTGCACTTGAATCTACGCAGGACAAGGAGTGTGTTTATGCCCCATATGCCTTTGACGACCATTGGATAGTCTTTCTTCTCTATCCAAAGTACAATGAAGTCATCGTCTTGGATTCCCTCGACAAAGATAGCAACACCTATCAGGAATTTCTAAGAATTCTCGATCTTGCATTTAAAAGGTATTACCAGCGAGGCGGACAACGCAAAAACTCAAGAGAACGCATATTCGTCCGCAATAAGTGGCCGTGTCACAAGCAACCGGTGGGAACAGTATTATGCGGATATTACTATTGTGAGTTCCTAAGGGTTAATGGGAAATATTGTGCGAATTATGACGAGCTTCCAAAATTCCCCATCTGA >LOC_Os11g30552 ATGCCGCCGCCGCCACGCCACTCCGCCGCGCCGCCGCCGCCACGCCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAACACGTCAACGTACGTTGCCGCGAGAACGTGAACGAGAACGAGAACGATCGAACGAACGAGAGCGAGAACGAGAACGATCGAACGAAGACAAGCGAGAACGAGGGAACGAACGTGAATGAGAACAAGCGAACGAACATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGTGGAGATCATGAGAGATTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTAGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCGATCAGATACGAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGTCATGCAAACACAGGACGAATCGACCTGTCCTGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTTGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCAGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTATCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACTGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAATAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATTACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGTGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAATGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATCGTAG >LOC_Os11g43170 ATGCCTCCCCTGGCTCTGCCCTCAGTTCAAGCCTCTCCACCTACACCCCAATCTGCTCTGGTAGAACAAGTGCACATACCAGAAGGTACTACATCCGAACCGAAGTCTAATCCTTTGGAACCTCATCGTATAATTCCAAAGTTGATATCGACATACGACCCAAAGGAGATTGACAAGGATAAGGAGAAGTTCATGTTTTCGGCTTTCAGGAATTCTGAGAAGAGAAAAGAACTTGCTCATGTCATGTCAGACTCCCAGAATATGCAATTCCACGAAGCTGATAGAACTGGAGCAAAGGTTGGATACGTCGATCCAACAAGAATATGCAAAACACAACACACCATAGAGCTGAGAGAGGACTGCGAGCAATTGGTTGGCAAGACCCCTCAAGAAAAGGAAGAATATGTGAAGACATTGCACAAGAGGAAGAAGCTAGAAGTAGCAACATACTTGGCAATAGCAATGTTGGCGCACGCCGACAAAGATGTCTTAATGGTCCCCTACGCATTCACAGACCACTACATATTATTCCTTATATATCCAAAAGACCAATTGATCATATCATTGGACCCCTCACACTATGACAAGGAGACATTTATGGAATTCCTCACTATTTTGAATTTAGCACACAAGTACTACCGCAAAAGAGGCGGACCAGTACATATTCTAGACCAGAAGCAGTTATCCGTCAGGACTGGCTGGCCGTGCTACAAACAACCACCGGGAACTAACTTGTGCGGTTATTACGTGTGCGAGATGCTCAGAGTAAACGGGAGGTACAAAACAACCAGTAACCGAATCCCCGAAATCCCATATATTGCACAATGA >LOC_Os11g38456 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGAGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACAAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGGAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTATTCGGCGTTCAGATACGAGAGGCTGCGCAACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCCGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCGCAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCATGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTGCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAAACAGGAGATCGAGCCGTTGGTTACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCGCCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAGAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAAATAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAAACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCACGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTAATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAATGA >LOC_Os11g27500 ATGGAGATTCAAAGGGCCCGACGGCGGGGGGTTTTCGATACTGGATTCATCGACCCTCAGAAAGTAAACGTCGCAATGCTCGACCAGTATCCGCAAGCCACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTATTGCCGTACAACACAGAATTCCACTGGGTCCTTTTACTCTTCGACTTGGAGGCCTGCACCGTCAATGTATATGGCTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCAGAAGTTTAATTTTCCATGCGCAAAGCAAAAGCAGGGAACTAACTTATGCGGCTACTATGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGATCACACACAAGAAATTTATCGTGGCGGTTCAAGAACAACTCATGGGATTCATCAATGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGAAAATACAATTCATAGGTTCTTAGCTTCTAAGATAACGACTACTACTACGTCGAAATCGTAG >LOC_Os11g32150 ATGCCGCCGCCTCCACGCCACGCCGCCGCCGCCACGCCACGCCACGCCACCGCCGCCACGCCACGCCGCCGCCGCCACGGCCCCACAACGCCACACCGCCGCGCCAACCGCCGCCCCGATGCCGCCACACCGCCGTTAACGAACGAGAACGAGAATGATCGAACGAACGAGAGCGAGAACGAACACGTCAACATGGCTGACTGCGATGAGGAACAGATATTGTACAATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAATACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGATGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGATTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGTTGATGGCTCACTGGTCTTCGGCTATCAAATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGCGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCGATGCAAACACAGGACGGATCGACCTGTCCTGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTGAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCATCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGAAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACAGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTTGCAATGCTCGACCAATATCCACAAGAAATAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCAGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTACGTCGAAACCGTAG >LOC_Os11g24870 ATGGCTGACCGCGATGAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGTGGAAGAAGATGGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTTGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCAGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAAGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTTGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCTTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCACAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCATCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTATGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGTGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTAG >LOC_Os11g09750 ATGGCCGAAAGTACTAAAGGGACTGAAGAGAAGGGTTTAGGGGAGCAGGAGCAATCCCTTGCTGTTGTGGTTGCTCCGGAACCAACGGTCCCACTGGATGGTAGTTCCGACAGCGACGTAGGTGACGAAGACGAGGAGTACTCGTCGCTAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGGCGACGGTGAAGAAGGCGACAAGGACTACATTCCCCCTAAAGAAGGGAAAAGCGAACGGTCAGCAAAGGCGAAGAGAAGGAAGGGCGAGAGAAGCGTGAATAGAAAGGATGAAGGGTTCCATGTTGTTACCCATGTTTCGCCTAAAGGAGAGCCGCTCGCCCCTAAGACGGCACGTGCGAAATTCAGTTCACAGTGTGGCATAATAGTAAGGGAGAAGATCTCCATCACGGTCAAGGACTGGGATCATGTAACGGATGGGGATAAGGAAGTCCTGTGGAAAGAGTTGAAGAAAATCTTCCAGTTCCCGGAAGGATCAGAGGCAGCGGTGAGAAATTGTGCACTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAATCACCTTGAACAAGAAATTTGTGAAGACGGGACGCACACCGTTTTCGACGTATGCCAACATAACCCCCAATCAGTGGGACGACTTTCTGACCTTGAAGAAATCCCCGGAAGAAATTAAAAGGAGCCAAAAGTATTCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCGCTTAGGCTCCGCGGGCTACGCACCAAAGGTGGAACAGTGGACAAAAGAGGAGGAGGAAATGAGGAAGAAGGGGCAACCGGTACCAATGGAGGAGTGGACACAGAGATCAAGGAACTGGGTAAGAGCTAGAACTCCGAAGATCACGGATGAGGGAAAAGTATCGTTTGAAAATCCGGAGCTGCAGAGTGTTGCCGATAAAATAGAAAATTTATCCAGTTCACAAAAGAAAGGATATTTCAAGCCTAAAAGGGAGAAAGATGTGCTAAGTACGGCGCTGGGAACTCCTAAGCATGGGGGAAGGGTTCGAGGTGTGTTGAGCAAGATAAGTTGGAAGGAAGGGTTCAAAAATGACCCCCACAAGAAACGTGAAGCGTACAAGGATAAACTTAGAGACGAAGGGGCTGCGGAGTTTGAAAAGCAAATGATGGATTTCTGCATCAAGCACATGATTTTGCCTCGCCCCGAAACCAAAGAAACTGAGCCAGATTACCCCTTCGATGACCTCAAGGAGAATACACCCTGCAGATTGCACGTTCCCATTGGACGCTCCGGTAAAACTCTTGAGGCCGCTACAGCCATTGCTATCCCTGGTAGAACATACAATGAACAGTTCATACCCGATGCGTATGCCAAGGTGCAGCCACAAGTGGTCCACGAAGGGTTTGAGTCCTACGACATTGACTACCCGACTGCAGATGGTATATCCGTACTTGGGGATGCGGTCGATCTTGTAATTCTCTGGCACAAGAATGACATATTCTTTGGATTGGGCACCGACGCCGGGGAAAAACCTGTGTTGCCTAAACCGGGTTTGGGAAAACCTCCGAGGCCTCCTAAGAGGAAGGTGACTGATAAGGCGGATGATCCAGAGATGGATAAGGAAAATCCAGTGCCGGAAGTGCCACCGGAGATTGCATTGCCGGAGACAGCCAAGGAGATTGCACCGCCGGAGACAGCCATGGAGATTCAAGTGCCGGATGTGCCCATAGAGATTAGAGTGGCAGAACCAGAGGTGGAATTTGTGGCATCAGTCGGGTCAGACAAAGATAAAGTACCAGGATTGGAATGGGATGGTACAAAGCCAGAGATATTTGAAGACCCTTCTCCTGCGAAAGAACCCGAGGTGCCACGAGTGCTTAGGAGCCACGACTCCAAAGGGGGTAAGGAACGTGCCAAGCTCAGAGATGACAACCCCCAGAAGGCTTCTGAGCTAGCCGGGCCAACATACTTCGCAACCGATGATTGCCCGGAAAAGTACGAACATGGGAAAGCACTCTTGCCGGAATGGGCACTGAAAGAAGCACCATGGGAGATGAGAAGGTTACATAACTTCTACATGGAGGCCAGCAAGAAAGGCTTGGGCAATATAACAGCTCGATCACCGGCAGATTGTTTCGGCGAAGAAGGTTACGTATGGCTAGATTTCTCAGATCTCCACGCCATATATCGTCGGGATAAGATGGACGTCAACTATGTCGGTGTTTGGTGCATGATGCAATACATGGATGCTAAGAAGAAAAAAGAACCCATCGGCTTCTTGGATCCAACTCGGATCTGCCAAACACAGCATACCGTTACGCTAGCACCAGGGTCAGACCAGCTGAAGGGCAAGAATCCGAAAGAGATAGCAGAATACAAGAAGGGCATGCACAAGGAGAAATTGATTACTATCGCACAGTACATTGGACAAGCCTTCTTGCACTTTCAAAATAAGAGAGTCGTCATGGCCGCTTATAATTTTAACGATAATTATATCTGTTTACTCATCCACCCTAAAGACGGAACCGTGGTAGTCTTGGATCCTCTCGATTACAATCACAAGCAATACAAAGAATTTCTAACAATCTTACAGTATGCATACCAACACTACAAGTTCAAGGGTGGAGAACAGACCCGAACACAGGAGAAGCTGCTATGTCACAAGCAACCGCGAGGAACGGTCCTTTGCGGGTATTATGCGTGCGAATTCCTTAGGGTTAATGGACGGTACAGGACTAACGCGGAGGATTTGCCAAGATTAGAATGTTGA >LOC_Os11g41050 ATGTACAAATTCCATGAACGGTACATGGAAATGAGCGCCAAGGGTAGAGAGATGTTCGGAGCGAGGATCAGAAACCCCGACTTCTTGCAAGGAGAAAATGTTCTCTGGATCCATTTCAAGGATCTCTTCGATCTGTACCATCTGGACGCCCTCGATGTCTCTCTTCTGAGCGCATGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGATCTACGATACTGGGTTCATCGACCCTCGGAAAATCAATACCGAAATGATCGACAAGTACGAGAAAGACACAGAGGACAATCTCGTCCATCTCCTAATGCAGCAGCATTTCAAGACGTACATACTACTGACGTACAACACAGAAGTCACTGTATACGACTCAATGAATAAAGAGGAGAAGATTTTTGACAAGGTCTTCCAACTGATAGACAGGGCTTGGGATCGGTTCCGTCAATTGGTCCACGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCATGTGCAAAGCAGGACCAGGGAACTAACTTATGCGGCTACTACGTATGCGAGTATGCCCACTGCTTATCAAACCAAATATGCACAACACGAGAGCTCGATCGTATTCACATGAGGGATAATCTCCCACACAAGGATTTTATCACGGCTGTTCAAGAACAACTGATGGGATTCATCAACGAAGAAGTCCTTAATTCCGATGTGCAAATGATTCATGCCCTCGCAAGCCAAAAACGAGGTAACATCATGCATGGATTTTGA >LOC_Os09g26220 ATGAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCGAAGGTCAAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCTTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCTTCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCCTGCCCACACAAGGGCAACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCACAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAACAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTCTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTCGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCTTCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCACATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTATGTCGAAATCGTAG >LOC_Os09g11420 ATGGCCATCCCAACGGACCCTTCAGGTACTTACCATTGTAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCGGTCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGCCCACAGAAGGACAACGAAGAAGGCGAAAATTGACGCCGCCAAGAACAAGGACCCGGGGTACAATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTATCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGACGATAGAAGAATTTATTACTGACACCAGTCTAACTACAGATCAATTGTTAGGAGTCGCACCAATCGAAAAGGCGAAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCTTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTCAAGGGAATCTACGAACTATACCAGCTGGACGCCCTCAACGTCTCTATTATGAGTTGCTGGATTTTATTCCACTGGGTGCTTTTACTCTTCGACCTGTCGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCAGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATCAGGGATAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCATAGGTCCTTAG >LOC_Os09g25240 ATGCCGCGCGCGGCGCCACGCCACCGCCGCGCTGCCCCGCCGCCGCTCCGCTGCCGCCACACCGAGAACGTGAACGAGCGAACAAACGTGAATGAGAACGAGCGAACGAACGTGAACGAGAACAAGATGGCTGATCGCGATGAGGAACAGATATTATACGATACAATCGCAGAGGGAAGCAGCCAGTATTGGAACGAAGAAGAGGGGAACGAGGATCCAAACCAGTATTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGGAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGAAGTCAACCCTCCGTTGGACAGAAGAGGGCACGTGGGCAACGAGGTGCCGCGAAGAAGCTTGAGGGTTGGCACACCATAACGGAAGTGGAAGAAGATGGACGACCTAGTGCCCCGGCAGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAATAAGGGCACGCGGAGATCATGAGAGCTTTGTCCTAGATTCGGAGAAAGAGATGTTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGAGCTGTACAAGAAATATATCCTGAAGGAGCAGACACCGAACTTCGACACATTTCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGCAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGTGAAGATTGCAGATCTTGAGTTCAGGGTATCGAGCTACGAGCGCAGCATGCAAGAGGAGGTGGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCAATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTTAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACCCAGTACGAATCCACCTGCCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGTATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCACGTACGAGGACCTCGAGCTGGATTACCCTGGGGGAGACGCACCGTCTCCACCTCAGGCTCCTGCACCGACTCCTCCTCGGGCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCAAGCTCCACCGCCTGTCCACACAAGGGCTACGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTGGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCGAGTGTCATGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATTAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTAGAAAGTCCAAACTAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGTAAAGAAATGATGATAGAAGAATTTATTACTGACACCGGTCTAACTACGGATCAATTGCTAGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGATGATCGGAGCGAGGATCAAGGACACGGACTTCTTGCAAGGAGATGA >LOC_Os09g37220 ATGGCTGACCGCGATAAGGAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGGAACGAGGATCCAAACCAGTACTTGAACGAGGAAGGGAACGTGGAGAGGGATGCGGAGGGGAACCAGCAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACCCTCCGTTGGACAGAAGAGGGCACGCGGGCAACGAGGTGCAGCGAAGAAGCTTGAGGGTCGGCACATCATAACGGAAGTGGAAGAAGATAGACGTCCTAGTGCCCCGGCCGAAGCCGCCAAGAACTATGTACGTCACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTCAGTACGGTGTACTGGCGAAGAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGATTCGGAGAAAGAGATGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCTACGGGTACAGAGGACAAAGTGAAAAGGTGGACTCTGAAGAAAATGGCAGAACAGTTTCAGAGCTTCAAGGGAGATCTGTACCAGAAGTATATACTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCATATAAGACAGGTGAACAAGGGAAGGCGATGATGGAAAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGAGGCTATAGCGTCGCGATGCCGAAGTGGGAGCAGATGGAGGCTAGCTTGATTGAGAGGGGTATCGAACCGGCAACAGCCAATTGGCCGGAACGATCGAAGTTCTGGTACTATGCTCACGGTGGAACGCTCAACCCAGCTGATGGCTCACTGGTCTTCGGCTATCAGATACAAGAGGCTGCGCGACGACTAACAGATGCAGTGGAGGCCTCCTCTCAGGGCACGTTCCGACCAGACAGAGATAGGGACGAGCTGACACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACTCGAGGGAAAGGGGTGATTCCTTGGAAGATTGGTTTCAAGGAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAAGAGAGATACCGAGGCGAAGATTGCAGACCTAGAGTTCCGGGTATCGAGCTACGAACTCAACATGCAAGAGGAGGTTGCAAGGAAGGTTGATGAACGCATGGCCGCACATCGGTCCCATGATCCCCAGCCGACCATTCCTCCTGCAATGGTGAGCCCGTCAGGAAACCGTAGCAGCTGCGCCTCAACGGGGCAGGTAGGATCACAGAGCATGGACGCCATGCAAACACAGGACGAATCGACCTGTCCCGTTGATGACATCACTCAGCGGACACCATGTGAGCTGCATATTCCTTTCAAGAACTTATCAATAAAGGTGGCGTCGGGCATGGCCATCCCAACGGACCCTTCAGGTACTTACCACTGCAGGCCGATTCCAGCAGGATACTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGCTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACATGCCATGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCTGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCGCCAGCACCGTCTCCACCTCAGGCTCCAGCATCGACTCCTCAGGATCCTGCACCGACTCCTCCTCGTGCTCCTACACCTACTCCCCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAGGGCCCCCCCAGCTCCACCGCTTGCCCACACAAGGGCAACAAAGAAGGCGAAAGTTGACGCCGCCAAGAACAATGACCCGGGGTACGATTGCACGCAAGAGGAGCTTGACGCTTACGTTGCATCAGAAGTCAAGAGACAATTCAAGCCTCGAAGTCCAGAAAAGAAGATTCCTATAGACCCCAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCATCTGTCAAGGAGGCCATCAAGCTATCGGACTATGAGCGAACGCTGAAGAAAGCATCTTCTGGAAAGTCCAAACCAGTCCCTCAGCTTGGAGAGCAACCAAACCAGGAGATCGAGCCGTTGGTGACCGGAGTCGCACCAATCGAAAAGGCGGAAGTGAAATACATGTACGAACTCGGTAAACCGCTTGTCAAGCCTGAGCTGCTGCAGTCCCTACCCACACAAATGTACAAGTTCCATCAGCTGTACATGGAGATGAGCGCCACCGGTAGAGAGATGATCGGAGCGAGGATCAGGGACACGGACTTTTTGCAAGGAGATGACATTCTCTGGATCAATTTCAGGGGAATCTACGAACTATACCAGCTGGACGCCCTCGACGTCTGTATTATGAGTTGCTGGATTTTAATGGAGATTCAAAGGGCCCGACGGCGGAGGGTTTTCGATACTGGATTCATCGACCCTTGGAAAGTAAACGTCGCAATGCTCGACCAATATCCACAAGAAACAGAGGACAATCTCGTCCATCTCCTGAAGGCGCAGCATTACAAGACGTTCATACTGTTGCCATACAACACAGAATTCCACTGGGTGCTTTTACTCATCGACCTGGAGGCCTGCACCGTCAACGTATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGGCTTGGTATCGGTTCCGTCATTTGGTCCGCGGCAAATGGAGAGAAAGACTTAGGCGGAAGTTCAAATTTCCTTGCGCAAAGCAAAAGCAGGGAACTAACTTGTGCGGCTATTACGTGTGCGAGTATTGCCACTGCCTTGCAGACCAAATCATCACCACAAGAGAGCTCGATTTTATTCGCATGAGGGATAACCTGACCACACACAAGGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAAGAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAACACAATTCACCGGTCCTTAGCTTCTGAGCTAGCAGCGAGTACTACTA