>PAB00030860 ATGAAGACCGAAGTGAATGAAGATGCACATCAGCAAGGACACGTGGCACAATCAGATGATGACAAGTGTCAAGTTGATTCGGCATTTCAGGGTGGTCCGGGTGGGAGAGCGTGCAAGAACCTGAGCCACTTGGTGCCTAGGGTGGTCCGGGTGGACGCCGAACAGAAGGGTAGGCCGCATCTTCAACAGGCGGTTATGAATCTATTCCATTCCCACTGGTCCTCTTCAACAGATATGGAGACTGGTAGTAGTGAATTCCCTTGCGTGCCTTTCACGACCATTCATCTCTTGCAGGCCTTCCAGGCCATTGAGGTTGCGATTGGTTGTTTGATTCCAGTAGCTCTGATTGGGATGAAGAGCCTTTCTGCTTTAGACTATTACGACTTACTTTCTCTCGGAAATGCCAGTGAAAATATGCCAAGAAGTTTATATGTGAAAATATATGAGATTAAGGAAACAATATCTGAATTGGGTTATGGAGTATGGGGAAATACATATGTTGCACTAATGTTGCTCATACCGTACGAAGCTCGGGGTTAG >PAB00039682 ATGGGAGCATCCATAGACTATTGGATGGTTGAAAGGAGATGGAAAATGCTCACAGATATTGTACATTTGCTTCTAGTGATGGACCTAGATGATTTCCTTCGCCTTAAACACCAATTAACCATCAATATCACTAGTACTCCTATAGGTGCATATTTCCTTCAATATTATGCCCTTAAAGGTGTTATACATGCATGCAATGAACTAATTTATATGGAGGAAAAAATCATGGGTGTTGAGGCTAATCCAAAGGGTGGACGAAGGCTCCAGGAAGAAATTATGCATTTTTTTCATTCACAAGGACTTCAATCACATAACACTTCATATGATTATCATGTTGCAACAATGCATATTTTGATGGCTTTAGAGGTAATTGAAATTGTGGTCAAAATGTTTTTATTTTCATATTAG >PAB00065532 ATGGGCGAGGCGACTGGAATCGGTGATCGGAAATCAGTTGGAGCAGAGGAATGGGCGAGGCGACTGGAATCGGTGATCGGAAATCAGTTGGAGCTTATTTCCATCATCTGCCAAGATGATCAGTGCGCGCCCACGGTACAGTTGGCCGTTAGCAGCGGTATTCTCGGGATGGGCGCCGCGCAAGAGGTTTGGCAACGGCCCGGGGCGTTGGCCGTGGTGAGCAGGTCCAGCGAGGAGAGCCTGCTCCCGCGGTTGGCCACATGGAAGAGGGCCGAGAATCTGGTGCGCAGAATAGGGCTCGCCATCGAGTGCCATATGCAGAGAGCGCCTTTTACTCTGGGTTTAGGTGAGCCGAATCTGTGTGGGAAACCCATCTTGGACTACGATCGGGTCTGTCAGCCGAGCTACGTTTGTTCGCTCAAGCGAACACCCGCACAGGGCAACGGAGAGGACAACACGCTGCGCACCGCGCACCAGATACTAGAGTGCTGGCTGTTCTCGGCGGGGATGTTGGTGAACAGAATAGAGGAGAAAGTGAACTCCGGAGACCTGAAAGGAGCCGCTAAAGATAGCTGGGTCGTGGAGAGGACATGGAAGCTGTTGGCGGAGACCGCTAATTTGCTGTTATTGATGGATCCGGATGATTTCTTGAGGTTGAAGCAGCTGCTGGCTATGGATAGCTCGACAGGGGCCTATTGCCTTCGCTCCAGGGCTCTGAGGGACTTGACGAGAGCGTGCAAGAACCTGAGCCACTTGGTGCCGAGGGTGGTCCGGGTGGACGCCGATCCGAAGGGCGGGCCGCGTCTTCAACAGGCGGTTATGAATCTATTCCATTCCCACGGGTCCTCTTCAGCAAAGATGGAGACTGGTTGCAGCGAATTCCCTTGCGTGCCTTCCACGGCCATTCATCTCTTGCAGGCCTTCCAGGCCATTGAGGCTGCGGTGAGAAGATTCTTTTTCTCATATCAGCAATTGGTGATCACGGTGATGGGCAGCGTGGAGATGAAGAGATCCTCTTACAGACCCGACGGACTCACCCAGATATACCTGGAACCGCCTTATTTCCCCAGCCTGGACGGCGCCAAGGCTTTTCTGGGCGACTACTGCAGGCACAATTATACGCTCAATTCTAATGCCATTTCCCTCAATCTGAGTATGTGCAGCGTTCCCTCGGATGATTCCATGACCCTCGTCGATTCCTTCAATTCCGAACCAGATCAGCGTTATCAACCACACGACAAATTCAGAAGAGGATAA >Pp3c11_5520 ATGGACGCACGGGACTTGAGATTCAGGAGCTGCGAAGGCTGCGGAGGGGTCCACTGCTCTCTTTTCCCCGGAACGCCCGTGTCTGTGTCCTTGTCAAACTGCGACATTGAGGCCCTTGTGCAACCGTCTCCTGAGCAGGTTGAAGCCTATGAGCTGTACTTGCATCTCCCTGAGCTCACTCGGCTATGGCGGACAAAGCTCTATCCGCGTTGGGAAAATGAGATCATTGTGAGACCTGCTCTTCACAGCCTTGAACTCGTCTTCCGCGTGATTTCAGCTGTCTTGTGCGACACGAGACCATACATAGACCGCGATGAGTGGCTTCGGAGATTGGAATCGTTGGCAAACTTGCAACTGGAAATTATATCTTGCATCGTAGAAGGAGACGAGGAGGCTCCTACATCGAAGCTTTCTAATAGTTGCAGCTACGTTGGAACGGAGTCAGTGGTTTGGCACAAGTCTGGATCACGGCCTCTCGTGAGCAGGTTGAGCAAAGAGAGCTTATTGCCTCGTCTTGCGGCCTGGAGGACGGCGCACAATGTAAGCATATTGTTGCATTTCGCCATTGAAGGTCACATGGCACGTGCACCTTTCACGCTGGGCCTTGGCGAGCCCAATCTCTCTGGCAAGCCAGTTTTGGAGTACGACAAAGTTTGCACGCCTCTTGAGGTGTATGGCTGCAGACAATCCATGCCTGGGCATCCTGAGGATCACACTCTTTCGACTGTGCATCAAATCATGGAGGCATGGTTGGAGGTTGCTTCTGGTTTGTTGCAAAATGTGGAAAAGACGGTTAAAGAAGGAAATTTTGAATCAGCTGCCAAGAGCTGCAGAATTGTCGAGCGGGTGTGGAAGCTTCTCATCTCCACGATGGATTTGCTTCAAATTATGGACCCAGACGATTTTATGCGCTTGAAGGAGGAGCTTGCAATTTCTCAGGGCGGAACAGCCATCAGTACTGAACATATTGGTGGAGGTGCGTACTGTTTGCGATCTTCGAGGCTACGGCATGTTACGAAGGATTGCAAGGAGCTTCGGCATTTGGTTCCTAAGGTCGTCGGGGTTGAAGCTGATCCTAAAGGCGGTCCAAGGCTCCAAGAGGCTGTGATGGATTTGCTTCACTCCCATGGGTTGCGGACTCATGCAGCACCGCTGTACAAGCGCCCCTCGGGATACCATTCATCCACAATCCACCTGCTGCAAGCTTTCCAGGCGGTTGAGGCAGCAGTTCGTCAGTTCTATTTCTCATACCAGCAGTTAGTGATTGCTGTAATGGGAAGTGGTGAGTATAAGGCCACAGCGCAGACAGAAATATCCGCTGCAGACGCTCTAGCTCAAATTTATTTCGAACCACCTTATTTTCCAAGCCTGGACGGTGCAAAGACGTTTCTAGGTAGTTACTGGCATAACAATCCGGAACTTGAAGAAGGTGCTATTATGAGACAGCTCATGGTTGAGAAAACATCGCGTACAGGAAACTCTAGCAAAGCGTCTAGTGTTGCTAACAGTGACAGCAGTGACAGTACTAAGAATGATGAAGACGAAGAGCGAACACAAAAGAAAAGCCTAGGATCTTCAGAGAGAAAGCAATACGTGAACGCTGCTTTTTCTTACAACAAACATCACATGTATCAAGGAGCCATGGGGGCTTGA >Pp3c10_11250 ATGGAAAGCAACCAGGAAGCAGATCCTCGGAAATCAAGGGAAGGCTACCGGGATGTAGATCCTTACAAACTGAGCGCACGGAATTGTGGAGGTGTCCATTGCGCGCTCTTTCCTGGAACACCCGTTGAAATTTCTCTCGCCAACTGCGACATCGAGGCACTGGTGCAACCCTCCCCAGATGAAGTGGAATCGTATGAGCTTTACCTTCATCTTCCTGAGCTTCGCTGGCTATGGCACACACCTCTCTGTCCGAACTGGTCCATGGAGGGCATCGTCAAGCCGGCCCTCCATTCGTTGGAGATGGTGTTCCGGTTGACATCTAGTATGCTGCAAGACGCTCGTCCTTACATTGCTCGAGATGAGTGGCTCCGCAAGCTAGAGTCTCTGGCTATCATGGAGATTGAGCTTGTCTCTCACCTTGTTGAGGGTGACAAGAAAGCCCCCACCACAGCAGCAGGCTCTATGCCATCAGCATGGCAAACAGCGGGTGCGAGATCCTCTGTTAGTCGCACCAGTCAGGACAGCCTTCTTTCCAAATGGCCCAACTGGAAGGGTGCACAGAACTTAAGAATGAGGTTGCTGTACGCTATTGAATGTCACATGCTGCGTGCGCCATTTACTCTTGGTCTTGGCGAGCCTAACCTTGCTGGCAAACCACTACTCGAATACGACCGGATCTGCACTCCCTTACAGGTCTTTGCTTGTCGTCAAGCTGCGCCAGGGCATCCCGAGGACCATACATTGTCCACAGTGCATCAGATTTTGGAGTCATGGCTCATGGTGGCGCAGGGTTTGCTGAAAGCAATAGAGGAGCGAGTGAAAGCTGGTGACTCTGAAGGCGCTGCTAGAAAGTGCTGGATTGTGGAGAAGGTTTGGAAGCTTTTACTGGCCACCATGGATCTTCTTCAAGTCATGGATCCTGATGACTTCATGCGGCTCAAACATGAGCTTGCTATTAACACAAAGCCTCAAGTAGGAATCAACCACGGATTCGAACACATTGGGGGAGGTGCGTATTGTCTTCGGTCTACAATGTTGCGGGAAGTCACCCGAGCCTGCAAAGAGCTGCGGCACCTGGTGCCAAAGGCAGTGGGTGTGGAGGCTGATCCTAAAGGAGGCCCGCGGCTGCAAGAGGCTATCATGGGGCTATTTCAAACACACGGAATGGAAACATCTGGGACGCCATCACGTTCAGGAGTGATTCATTTACTTCAGTCTTTTCAAGCTGTTGAAGTCTCAGTGCGACAATTTTACTTCTCATATCAACAGCTAGTTGTAGCAGTAATGGGTAGTGGAGAGTACAAGGTTGACGTGCAGACAGAGATTTCTGCTGCAGAAGCTCTCTCCCAATTCTATTTTGAGCCTCCTTATTTTCCTAGCCTTGATGGGGCGAAGACATTCTTAGGAAGCTATTGGCACAATAGTCCTGATTTGGAAGAGGGAGTGATCATGCGGGAGCTCGCGGCAGCTAAAACAAGCAGCACACAGAACGGGTATCACAAGGACCATCACACTCAAGGAAGCCTTCACCTCTGA >Pp3c2_27180 ATGGAGGTTCCCCCACGCATGGACACAGATGAATTGGGATCTAAAGGGCGCTGCCCGGTGCCCTGCCCTGTGTTCCCCGGAACGCCCGTACCGGCATTACTCTTGAAATATGATATCGAAACTCTTGTGCAACCGACTCCTCAGCAGGTTGAAGCGTATGAGCTTTACCTGCACCTCCCTGAGCTGAGGCGGCTATGGCGGGCAAGAGATTTTCCGTCTTGGGAAAACGAAAGCGTAGTAAGACCTGCTTTACACAGTTTAGAGCTGGTCTTCCGCGTGATATCAGGCGTTCTGTGCGACACTCGGCCCTACATAGATCGCGACGAGTGGCTTCGTAGACTGGAATCGCTTGCAAACTTGCAGCTGGAAGTTCTAGCTTGCATCGTAGAGGGAGATGAGGGGGCGCCCACGTCCAATCTCTCTAATTGTTGTAGTTCCGTGGGAACGGAGTCGGTAGTGTGGCACAAGTCTGGTTCGAAGCCCATCGTGAGCAGGCTCAGCAAAGAAAGCTTGTTGCCCCGCCTTGCTGCTTGGAGGACTGCGCAAAGCGTAAGCTTTCGGTTACATTTTGCCATTGAGGGTCAAATGGCGCGGGCACCATTCACTCTTGGCCTTGGGGAGCCTAATCTCGCTGCCAAGCCGGTTTTAGAGTATGACAAAATTTGCACCCCTCTTGAGGTTTATGCGTGCAGACAAGTCATGTCTGGGCATCCTGAAGATCACACGCTTTCGACTGTACATCAAATCATGGAGGCATGGTTGGAAGTAGCTTCCGGCCTGCTGCAGAATGTTGAGAGGATGGTCAAAGCAGGAGATATTGGATTAGCTGCCAAGAATTGCTGGATCATCGAGCGAGTGTGGAAGCTTCTCATTTCCACAATGGATTTACTCCAAATCATGGACCCGGACGATTTCATGCGCTTGAAGGAGGAGCTTGCAATTTCCCAGGATGAGACAGCTGTCAGCACAGAACATATTGGCGGAGGTGCATACTGTTTGCGATCCACAAAGCTACGACAAATCAGTAAGGGCTGCAAAGACCTTCGGCATCTGGTCCCCAAGGTGGTGGGAGTAGAGGCTGATCCCAAAGGCGGTCCAAGGCTCCTGGAGGCAGTGATGGATTTGCTCCATTCGCACGGGATGCAAACTCACATAACTCCGCCATTCCGGCGACCCTTGGCCTACCACTCGTCTACAATACATTTACTCCAAGCCTTTCAAGCGGTTGAGGCAGCAGTTCGGCAGTTTTACTTCTCATATCAGCAGCTAGTGATCGCTGTCATGGGCAGCGGAGAGTACAAGGCAACTGCACAAGCAGAAATCTCTGCCGCAGATGCATTATCTCAAATATACTTCGAGCCACCATACTTTCCCAGCCTTGATGGCGCAAAGACTTTCCTAGGTAGCTACTGGCATAATAACCCAGAGCTCGAAGAGGGCGCTATCATGAGGCAGCTCATGTTGGAGAAGACTACGCGAGATGCCCTAACTGGAGACTCTAGCAAGGCTTCTAGTGATAGCAATAAGACTGACGCAGTCGAAGAGCAAATACAAAAGACTTCTGGATCTATGCGGAAGACCCCAGGATCTTTGCAGAAGAAGCAGTCTTACGCGACCCTTGCTTTCATGTATCAAGGAGCCATGGGGGCTTGA >Pp3c1_9290 ATGGAGTATAACCCATGCATGGACACACGCGGCTTGAGATCTAGGGGTCCGGTGCACTGCGCGGTGTTTCCCGGAACGCCTGTTTCTGTGTCACTTGCGAATTGCGACATCGAAGCTCTTGTGCAACCGTCACCTCAGCAGGTAGAAGCTTATGAGCTTTATCTGCACCTTCCCGATTTGACCCGGCTATGGCGGTTGAAGGAGTTTCCCAATTGGAAAAACGAAAGATTAGTGAGACCTGCTCTTCACAGCTTAGAGCTTGTGTTCCGCATGATCTCATGTGTTCTATGCGATACGCGGCCTTACATATATCGCGACGAATGGCTTCGGAGATTGGAGTCACTCATAAACTCGCAGCTGGAGATTTTATCCTGCATCGTTGAAGGGGACGATGAGGCGCCCACATCGACGCTATCTAACAGTTGCAGCCACGTAGGAACCGAGTCGGTGGTTTGGCACAAGTCTGGGTCGCGGCCAATTGTTAGTAGAATCAGCAAAGAAAGTTTGTTACCTCGTCTTGCTTCCTGGAGAACTGCCCAAAATGTAAGCACTAGGTTGCATTTTGCTATTGAAGGTCACATGGCACGCGCACCATTCACTCTGGGCCTTGGGGAGCCCAATCTGTCTGGCAAGCCGGTTTTGGAGTATGACAAAGTTTGCACACCTCTTGAGGTTTATGCGTGCAGACAATCCATGCCTGGTCATCCTGAGGATCACACCCTCTCGACTGTACATCAAATCATGGAAGCGTGGTTGGAAGTGGCTTCTGGTTTGCTACAGAATGTGGAAACAATGGTTAAAGAAGGTAACTGTGAATTGGCCGCCAAGAACTGCTGGATTGTTGAGCGTGTGTGGAAGCTTCTTATGTCCACAATGGACCTGCTCCAAATCATGGATCCAGACGATTTCATGCGCTTGAAGGAAGAGCTTGCAATATCCCAGGACGAGGCAGCTATCAGCACTAAACACATTGGTGGAGGTGCTTACTGTTTGCGATCCACGAGGCTAAGAAAAATCACCAAGGGCTGCAAGGACCTTCGGCTTTTGGTCCCCAAGGTGGTTGGAGTAGAAGCCGATCCCAAAGGCGGTCCAAGGCTTCAAGAGGCAGTAATGGACCTGCTCCATTCGCATGGGATGAGCACTCATGTGGCCCCGCCGTTTCGGCGACCCTTGGCATACCACTCGTCCACAATCCATCTCCTCCAAGCGTTTCAGGCGGTTGAGGCAGCAGTTCGGCAATTCTACTTCTCATACCAGCAGCTAGTGATCGCTGTTATGGGAAGCGGGGAGTACAAGGCAACGGCACAAGCGGAAGTTTCTGCTGCAGATGCGCTGTCTCAAATCTACTTTGAGCCGCCGTATTTCCCCAGCCTCGACGGTGCGAAGACATTCCTCGGTAGCTATTGGCATAACAATCCGGAACTTGAGGAGGGTGCTATCATGAGGCAGCTCATGGTGGAGAAGACAAGCCGACAATTGAACACAGGAAACTCTAGTAAGGCTTCCAGTGTTGATGCAAATAGTGGCAGTGGGGACAGCAATAAGGCGGACACAAGTGAAGAGCGAGCACAAAAGCCTTCAAGACCTATACAAAAGAAGCAGTCTTACGCGACCCTTGCTTACATGTATCAAGGAGCAATGGGGGCTTGA >Pp3c1_34950 ATGGGAAGCTACAGGGGTAGAATAGATGATCAGGAACTTAGGGGAAATTATCGGGACGTAGATCCTCATAAACTAAGTTCCCGAATGTGTGGGGGTGTTCACTGTGCGCTCATTCACGGAACCCCTGTAGAAGTATCACTTGCCAACTGCGACATTGAGGCATTGGTGCAACCCTCTCCAGATGAAGTTGAGGCCTATGAACTTTACCTTCACCTTCCTGACCTCATGCGGCTATGGCGATCCCCCGTTTGTCCGACTTGGGCTAACGAGAGCGTCGTTAAACCGGCCCTTCATACTTTGGAAATGGTTTTCCGTATGATAACAAGCATCCTGCAGGATCCTCGGCCCTACATTGCTCGAGATGAATGGCTCCGGAAGCTAGAGTCTTTGGCTAATATGGAGATTGAGCTCGTCTCCCACTTGGTTGAAGGCGATAAAAAGGCTCCTACTACATCAGCAGGCTCCATGCCACCAGCGTGGCAGAGGGTCGGCTCAAGACCATTTATGAGCCGTACTAGTCAAACAAGTCTCCTTTCTGTGTTACCAAACTGGAAGGGTGTTCAGAGTCTGAGGTCGAGGTTGTTGTATGCCATTGAAGGCCACATGATGCGTGCACCATTTACTCTTGGTCTTGGAGAACCTAACCTTGCAGGAAAACCAGTTTTAGAGTACGATAGGATCTGCACCCCTTTGGAGGTATTCGCTTGTCGTCAAGCGGCACCAGGGCATCCCGAAGATCACACGCTCAGCACTGCACATCAAATTCTAGAGGCATGGCTCATGGTTGCGCATGGATTACTGCAAGTCATTGAGGAACGTGTGAAGGCCGGTGACCCTGTAGGAGCTGCAAAGAAGTGCTGGCTTGTAGAGAGGGTTTGGAAGCTTCTAGTGGCTACTATGGACCTTCTCCAAGTCATGGACCCTGATGACTTCATGAGGCTGAAACACGAGCTTGCTATCAACACAAAAGCTCAAGTAGGAGTCAACTACGGATTTGAACACATCGGAGGAGGTGCGTATTGTTTACGTTCGAACATGCTGCGAGAGGTTACCCGAGCCTGCAAAGATCTAAGACACCTGGTGCCAAAAGCTGTGGGCGTAGAAGCTGACCCCAAAGGAGGCCCGCGGCTCCAGGAAGCTATTATGGAGTTATTTCACACTCACGGAATGAAAACATCCGTCTTGATGGAGCAAAGACATTTTTGGGAAATTATTGGCATCACAACCCTGACTTGGAAGAGGGGGCAATCATGCGGGAGCTCGTGGAAACTAAGGCAAGAAACATGCTAA >Pp3c7_23390 ATGGACTATCACACAGCTATGGACGCACGGGACTTGAGATCTAGGAGCTGCGAAGGGTGTGGAGGGGTGCACTGCTCTCTTTTTCCCGCAATGCCAATGTCTGCATCACTCGCAAACTGTGATATGGAGGCTCTTGTGCAGCCGTCCCCTGAGCAGGTCGAAGCTTATGAGCTCTACTTGCATCTACCTGAGCTCACTCGGCTATGGCGGACGAAGCTTTATCCGATGTGGAAAAATGAGATCATTGTAAGACCTGCTCTTCACAGTTTAGAACTCGTCTTTCGTATGATTTCAGTTGTTCTATGCGACACGAGGCCATACATAGACCGCGACGAGTGGCTTCGGAGATTGGAATCACTAGCAAACTTGCAGTTGGAAATTCTATCTTGCATCGTAGAAGGTGATGATAAAGCTCCTACATCGAAGCTCTCTAGTAGCAGTAGCTACGTTGGAGCCGAGTCAGTGGTGTGGCACAAGTCTGGATCACGGCCTGTTGTGAGCAGAGTGAGCAAAGAGAGCTTGCTGCCTCGTCTTGCATCCTGGAGGACGGCGCAAAACGTTAGCACTCGGATGCATTTCGCCATTGAAGGTCACCTTATACGCGCACCATTCACTCTGGGACTTGGCGAACTCAATCTTTCTGGCAAGCCGGTGTTGGAGTATGATAAAATTTGCACACCTCTAGAGGTTTATGCCTGTAGACAATCCATGCCTGGACATCCTGAGGATCACACTCTTTCGACTGTACACCAAATAATGGAGGCATGGTTGGAGGTAGCTTCTGGTTTGCTGCGGAACGTGGAAATGATGGTCAAGAAAGGGAACTTCGAATCAGCTGCCAAGAGCTGCAGAATCGTCGAGCGTGTGTGGAAGCTTCTCATCTCCACTATGGATTTGCTCCAAATAATGGATCCAGACGATTTTATGCGCTTAAAGGAGGAACTTGCGATTTCCCAAGACGGAAAAGCTATCAGCACTGAACACATTGGTGGAGGTGCGTACTGTTTGCGGTCCTCGAGATTACGACAAGTTACCAAGGATTGCAAGGAGCTTAGGCACCTAGTTCCCAAGGTCGTCGGAGTTGAAGCTGATCCCAAAGGTGGTCCAAGGCTTCAAGAGGCTGTAATGGACTTACTTCACTCCCATGGAATGTGCGCTCATATAGTGCCGCCGTTCAAGCGCCCCATGGCTTATCACTCGTCCACAATCCATCTGCTTCAAGCTTTTCAGGCGGTTGAGGCGGCAATTCGACAATTCTACTTTTCATATCAGCAACTAGTGATTGCTGTGATGGGAAGTGGAGAGTACAAAGCCACAGCGCAGACAGAAATATCTGCTGCGGATGCGTTAGCTCAGATTTATTTCGAGCCACCTTACTTCCCAAGTCTGGACGGTGCAAAGACGTTTCTCGGTAGTTACTGGCATAATAATCCAGAACTTGAAGAAGGTGCTATCATGAGACAACTCATGGTTGAGAAAGCCATGCGTACAGGAAGCTTCAGCAAAGCCTCAAGTGTTGCAAATAGTGACAGCGGCGACAATATTAAGAACGGCGCAGATGAAGAGCGAACACAAAGGAATATGTCAGAATCTATAGAGAAGCAGTATGTGAACGCTGCTCTTGCTTACAAAAATCATCACGTGTATCAAGGAGCCATGGGGGCTTGA >Pbr009495.1.g ATGGTCGATTTAGATTGGAAAGCAAAGATGGTCTCCTCCAACATACCCAACAAATCCTCCAAACTCTCCACCAAGCTCCACGTTTCGGTTCCCGGTTCGTTTCGCTCCGCCGCCCAAGTTCAGACCGATATTTGCGCCGCCTCCGAAATGTCCTGCTCCACCTACGAGCACTACCTCCGCCTCCCGGAGCTCCGAGAGTTCTGGAGCTCTCACGACTTCCCATCGTGGAAAAACGAGTCCATTCTCAAGCCGGCTCTCCAAGCTCTCGAAATCTCGTTCCGGTTCGTCTCGACCGTTTTGTCCGACCCTAGACCGTACTCAAACCGGCGCGAGTGGAAGCGCCGGCTTGAGTCGCTCATTACCAGCCAGATACAGCTCATCGCGATGTTGATCGAGGACGACGAGGAGGACAGCGAGACGCGCGGATTGGCGCCGATCGTCGATCTCAGCACGTCGAACGGGGAGCTGGCCCGCGACGGGAGCATGGCGGAGGTGTGGAGTTCTGGGGAGCACACGGTGGTCAGCCGCACCAGCGAGGTCAGCTTGCTACCTAGGCTCGCCACGTGGCAGAAATCGGAAGGGATGGCACAGAAGATCTTGTACTCGATCGAGTGCGAGATGAGTAACTGTCCGTACTCGTTGGGTCTGGGGGAGCCGAACCTCGCCGGGAAGCCGAACCTGGATTACGACGCCGTTTGCAAGCCGAGCGAGCTGCATTCGCTGAGGAAGAGCCCGTACGATGCCCACGTCGACAACTACGAAAACCAGACGGTGTACGCCACGCACCAGGTCCTCGAGTCGTGGGTCCACGTTTGCCGGGAGCTTCTCATGCGCGTGGTAAGCCGCATCGACTCTCGAGACCTGGAAAAGGCCGCGAGCGACTGTTACGTGATCGAACGGATATGGAAGCTCCTCGCAGAGATAGAGGATCTTCACCTTCTGATGGACCCAGCCGATTTTCTGAGGCTGAAGAACCAGCTGCGGATCAAGACGGTGGACGATACGGAGTCATTTTGCTTCAGATCGAAGGCGCTCGTGGAGGTGACGAAGCTCTGCAAGGAGCTGAGGCATAAGGTGCCGTCCATACTGGGTGTTGAGGTGGACCCCAAGGGTGGGCCCAGGATTCAGGAGGCGGCGATGAGGCTGTACTCGGAGAAGAAAGCCGAGTCAGACTCGGAATCCGTCTCGGATAAGATCCACTTGCTGCAGGCGCTTCAGGCGATTGAGTCGGCGTTGAAGCGATTCTACTACGCGTACAAGCAGGTGCTGGTGGTGTTGATGGGGAGCTTGGAGGCGAAGGGGAACCAAGTCGTGGTGAGTCCGGAGGCGTGTGACTCGCTGAGTCGGATATTTCTGGAGCCGACCTATTTTCCGAGCTTGGACGCGGCGAAGACGTTTTTGGGGGATAGTTTGAATCACGGGTTACACGGCGGACACAGGCGGAAACAGTGA >Pbr011333.1.g ATGGTTGATTTAGATTGGAAAGCAAAGATCGTCTCCTCCAACATGCCTAGCAAATCCCCCAAGCTCTCCAACAAGCTCCACGTTTCGGTTCCCGGTTCGTTTCGCGCCGCCTGCCAAGTCCAGACCGACATTTTGGCCGCCTCCGATATGTCCTGCTCCACCTACGAGCACTACCTCCGCCTCCCGGAGCTCCGACAGCTCTGGAGCTCCCACGACTTCCCCTCTTGGAAGAACGAGTCGGTTCTCAAACCGGCTCTTCAAGCTCTCGAAATCACCTTCCGGTTCGTCTCGACTGTTTTGTCCGATCCCAGGCCATACTCGAACCGGCGCGAATGGAAGCGCCGGCTCGAGTCGCTCACTACCAGCCAGATACAGCTCATCGCGATGTTGATCGAGGACGACGAGGAAGACAGCGAGACGCGCGGAATGGCGCCGATCGTCGATCTCAGCACGTCGAATGGGGAGCTGGCCCGCGACGGGCGCGACGGGGAGGTGTGGAGTTCGGGGGAGCACACGGTGGTGAGCCGCATCAGCGAGGCCAGTTTGCTGCCGCGGCTCGCCACGTGGCACAAATCGGAAGGGATGGCTCAGAAGATCTTGTACTCGATCGAGTGCGAGATGAGGAACTGTCCGTACTCGCTGGGTCTCGGTGAGCCGAACCTCGCCGGGAAACCGAACCTGGATTACGACGCCGTTTGCAAGCCGAGCGAGCTGCATACGCTGAGGAATAGCCCGTACGACGCTCACGTCGACAGCTACGAGAACCAGACGGTGTACGCCACGCACCAGGTCCTCGAGTCGTGGGTCCACGTTTGCCGGGAGCTTCTCATGCGCGTGCTTCTCAAGCGCGTAACGAGCCGCATCGAATCTCGAGACTTCGAAAAGGCCGCGAGCGACTGTTACGTGATCGAACGGATATGGAAGCTCCTGGCGGAGATAGAGGATCTCCACCTTCTGATGGACCCGGCCGATTTTCTGAGGCTGAAGAATCAGCTGCGGATCAAGACGGTGGACGATAGGGAGTCGTTTTGCTTCAGATCGAAGGCGCTCGTGGAAGTGACGAAGCTCTGCAAGGAACTAAGGCATAAGGTGCCGTTCATATTGGGGGTTGAGGTGGACCCCAAGGGTGGGCCCCGGATTCAGGAGGCGGCGATGAGGCTGTACTCGGAGAGGAAGGCCGGTTCGGACTCCGACTTCGGCTCGGAGAATATCCACGTGCTGCAGGCGCTTCAGGCGATTGAGTCGGCGCTGAAGCGTTTCTACTACGCGTACAAGCAGGTGCTGGTGGTGTTGATGGGGAGCTTGGAGGCGAAGGGGAACCGAGTTGTGGTGAGTCCGGAGACGTGTGACTCCCTGAGTCGGATATTTCTGGAGCCGACTTATTTCCCGAGCCTGGACGCGGCGAAGACGTTTTTGGGGGATAGTATAAATCACGATATACCCGGCGGAGACAGGCGGAGTCGGCGGACGCACTGA >Carubv10025158m.g ATGGTTGATATGGATTGGAAGAGGAAGATGGTATCATCTGATATACCAAACTCACCTAAGCTTTCTTCAAAGCTCCACGTCACTATCCCTTCACCTTTCAAAGTCCTCCCTGTTTCTTCTCCCATCTCTTCTTCCGCTCCTCCCCTCTGCTCTGCTTACGAGCTTTACCTTCGTCTCCCTGAGCTCCGAACCCTCTGGTCCTCTCGTGATTTCCCTCTCTGGACCTCTGAGCCTATTCTCAAACCGGCTCTCCAAGCTCTGGAGATCAGTTTCAGATTACTCTTCGCCGTTTCTTCTGATACTCGACCCTACGTCAACCACCGTGAATGGAACCGTAGGCTCGATTCTCTCCTCACGAATCAGATCCAGCTTTTGGCAGCGATCTGCGAGGAAGAGGACGATGAAGAAGCGGCTCCGGTAGGCGATGGACGGAGTTCTTTGAGTTTGTTACCGCAGCTAGCTACGTGGAGGAGATCCGAGGCTCTAGGGAAGAAGATCTTATGCACGATCGATAACGAGATGCGTCGGTGTAAGTACACGCTCGGACTCGGCGAACAGAACATCGCCGGCAAACCGAATCTCCGGTACGATGCGATTTGCCGGCCTAACGAGCTTTACAGCCTCAAGGACAACCCATACGCCGATCACATCGATAACCAAGAGAATCAAACGCTCTACATCATTCACCAGATCCTCGAATCGTGGATCTACGCATCTGGAAACCTCCTGAATCGGATCGTCTCCGGCATCGAAGACGGGAAATTCAAAAAAGCTTCCAACGATGTGTACTTGCTCGAGAGGATCTGGAAGCTTCTAGCGGAGATTGAAGATCTTCACATGTTGATGGATCCTGAAGATTTTTTGAAACTGAAGAAACAGTTACAGATCAAATCGACGGGAAAAAACGACGCCTTCTGTTTCAGATCTAAAGGGTTAGTGGAGGTGATGAAGATGTCGAAAGATCTCAGGCAGAAGGTTCCGGCGGTGTTGGCGGTTGAGGTAGATCCCACCGGAGGACCGAGATTGCAAGAGGCGGCGATGAAGCTGTACTCGAGGAAGGGAGAGTGCGATAAGATCCATCTGCTTCAGGGGATGCAAGCCGTGGAAGCTGCGGCGAAGAGTTTCTTCTTCTCGTATAGGCAGCTAGTGGCTGCGATGATGGGAAGCGCCGAGACGAACGCCACAGCGAGTCATGAGCCGTATGACTCACTGAGTCAGATATTCATGGAGCCGACGTATTACCCGAGTCTTGACGCGGCAAAGACGTTTCTCGGAGAGTTCTGGAGTCATTTGGGATGA >Carubv10019166m.g ATGGCTGATTTGGATTTACAGACGAGGAAGCTCCACCTCACCATTCCTCATGAGCCTTGTAAGCTCTCCTCCTTCGTCCCCTCTCCAATCTCCTCCTCTTCCTCCGCCGCTTGCTCTGCCTACGAGCTTTACCTCCGTTTGCCTGAACTCAGATGCCTCTGGTCCTCTCTCTATTTCCCTCGCTGGATCTCCGAGCCGGTTCTCAAACCATCTCTTCAAGCTCTTGAGATCACTTTCCGTTTGATCCTCACCGTTTCTTCTGACACTCGTCCTTACATCAACCGCCGCGAATGGATCCGACGCTTGGATTCCCTTTCCACGAGCCAGATCAAAATCGTTGCTGCTATCTGCGAGAACGACGACGGCGACGAGACCTTGTCCGCTGCTCCGGTCAGCAATGGCTGGAGCTCGTTGAGTTTGCTCTCCGAGATCGCCACGTCTCGTACATCGGAGAGCCTAGGCCAGAAGATCTTGGTTACGATCGAGAATGAGATGCGTTGGTGTAAGTATACGCTCGGTTTAGGAGAACCAAACCTCGCAGGAAAACCGTATCTTCAATACGACGCCATTTGCCGCCCGGAGGAGCTACACAGCCTCAAGAACAATCCTTACTCCGACCACATCGAGAACCAAGAGAATCAAATGCTCTACACTATCCATCAGATTCTTGAATCGTGGGTTTACGTTTCTGTGAATCTCTTGAACCGAATCGAGTCGAGGATCGAAGAGGGGAAGTTCGAAAAAGCTTCTTCCGACATGTACTTGCTGGAGAGAATCTGGAAGCTTTTAACTGAGATCGAAGATTTACACATTCTGATGGATCCTGAAGATTTCTTGAAGGTGAAGAAACAGTTACATGTCAAATCCACTTCTCAAAACGACGCGTTTTGTTTCTGGTCAAAGGGGTTAGTGAGGATGGCTAAGATGTCCAAAGAGCTGAGACACAAAGTGCCAGCTGTACTTGAAGTAGAGGTGGATCCTACCGGAGGTCCAAGGTTGCAAGAGGCGGCAATGAAGCTTTACTCGAGGAAGACAGAGTACGAGAAGATACATTTGCTTCAGGGAATGCAGGCGGTGGAATCTGCGGCCAAGAGATTCTTTTTCGGGTACCAGAAGTTGGTGGCGACGATGATGGGGAGTGCAGAGGCTAATGCTAATAGGACAGCGGCCAATCACGAGCCCTGTGACTCGCTGACTCAAGTGTTTATGGAGCCACCATATTACCCGAGCCTAGACGCCGCAAAGACTTTTCTTGGAGAGTTCTGGAGCCAATTGGGATGCCATAGAAGAAACTGA >Prupe.2G247600 ATGGTTGATTTAGATTGGAAAGCCAAGATGGTCTCCTCTGACATACCCAGTAAATCCCCAAAGCTCTCCAACAAGCTCCACGTTTCGATACCCGGTTCGTTTCGCGCCGCACAAGTCCAAACTGATATTTCGGAGGCTTCCGAAATGGCTTGCTCCACTTACGAGCACTACCTTCGCCTCCCGGAGCTCCGAAACCTCTGGAGCTCCAACGACTTCCCCTGCTGGAGAAACGAGTCCGTTCTAAAACCGTCCCTGCAAGCTCTCGAAATTTCGTTCCGGTTCATCTCGACCGTTTTGTCCGACCCGAGGCCGTACTCGAACCGGCGCGAGTGGAAGCGCCGGCTGGAGTCGCTCACCACCGGCCAGATACAACTCATCGCGATGCTGATCGAGGACGACGAAGAAGACAGCGAGACACGTGGAGCCGCTCCCATCGTCGATCTGAGCACGTCGTACGGCGAGCTCGCTCGGAACGGGAGCTCAGCCGAGGTGTGGAGTTCGGGTGAGACGACGGTAGTGAGCCGCACCAGCGAGGCCAGCTTGCTTCCGCGGCTCGCCACGTGGCAGAAATCAGAAGGCATGGCGCAGAAGATCTTGTACTCGATCGAATGCGAGATGAGGAGCTGTCCGTACACGCTAGGTTTGGGAGAGCCGAACCTAGCCGGAAAGCCGAACCTGGATTACGACGCCGTTTGCAGGCCGAGCGAGCTGCATTCGCTGAAGAAGAGCCCGTACGATCACATCGACAACTACGAGAACCAGACGGTGTACACCACGCACCAGGTCCTCGAGTCGTGGGTGTTCGTTTGCCAGGAGCTTCTCAAGCGAGTCACGCGCCGAATCGAGGCGAGAGACTTCGAAAAAGCCGCTAGTGACTGTTACCTGATCGAACGGATATGGAAGCTTCTGGCGGAGATCGAAGATCTCCACCTTCTGATGGACCCGGACGATTTTCTGAGGCTGAAGAACCAGCTCAGCATCAAGACGGTGGACGATACGGAGTCGTTTTGCTTCAGATCGAAGGGGCTGGTGGACGTGACGAAGCTTTGTAAGGAGTTGAGGCACAGGGTGCCGTACATCTTGGATGTTGAGGTGGACCCCAAGGGTGGGCCCAGGATTCAGGAGGCGGCGATGAGGTTGTATTCGGAGAAGAAGATCGGATCGGATTCGGACTCGGAGAAGATCCACGTGCTGCAGGCGCTTCAGGCGATTGAGTCGGCGCTGAAGCGGTTCTACTACGCGTACAAACAGGTGCTGGTGGTTTTGATGGGTAGCTTGGAAGCGAAGGGAAACCGAGTCGTGGTGAGTACGGAGATATGTGACTCACTGAGTCAGATATTCTTGGAGCCGACTTATTTTCCGAGTTTGGACGCGGCAAAGACGTTTTTGGGCGACAGTTTGAATCACGAACATGGAGGAGGAGGAGTCAGACGGAGTCGGAGGAAACAGTGA >Manes.07G126900 ATGGTTGATTTAGATTGGAAAGCTAAGATGGTCTCCTCTGATCTCCCAAACAAGTCCCCTAAACTATCCAACAAGCTTCATGTCATGATCCCTTCAACGACGACGTTTCGTGGAGTCACCAATATCTCGCCGGTTCCCGCATCTGATTCATCTTGTTCGGCTTACGAGCACTACCTTCGGTTGCCTGAGTTGAGGAAGCTGTGGACTTGTAAGGAGTTTCCAGATTGGAAAAACGAGTCGATTTTGAAACCGGCTTTGCAGGCTCTAGAGATCACATTTCGGCTCGTTTCAACCATTTTATCGGACCCGAGACCGTATGCGAATCGGAGAGAATGGAAGCGGAGGCTCGAGTCGCTTGCTACTTCACAGATTCAGCTGGTTGCTATACTTTGTGAAGACAACGAAGAAGATGGAGACACACGTGGGACGGCACCGGTGTTTGATTTACGTTCATCTAACGGCATTTTGGGTCGGGATGGGAGTTACGCTGAGGTATGGAAGGTCTCACCTGAAACCACCGTGGTCAACTTGACTAGCGAGGCCAGCCTCCTTCCTCTCCTTGCGACGTGGCAGAAATCGGAGGACATCGCGCAGAAAATCCTCTACACCATCGAATGCGAGATGAGGCAGTGTCCATACACTCTAGGTCTCGGAGAGCCGAACCTCGCCGGGAAACCTAACCTCCACTTCGACGCCATTTGCAAGCCAAGCGACGTTCATAGTCTCAAGAAGAATCCTTACGATCAGATAGACAACCACGAGAACCAAACGCTGTACACCATACACCAGATTCTAGAGTCGTGGATTCAAGTAGCTAAAGAGCTCATTAAACGCGTAATTGAAAGAATCGAAAGCAAGAAATTCGATAAGGCATCAAGCGATTGCTATTTGCTCGAAAGAATTTGGAAGCTTTTATCAGAAATAGAAGATTTGCATCTGTTACTGGATCCAGACGATTTTTTGAGGCTCAAAAACCAATTGCTCATGCGATCACTAGATGAAACAGAGGAGTTCTGTTTCCGATCGAGAGCGCTGGTGGAGATAACGAAATCATGCAAGGACTTGAAGCACAAGGTTCCGGAGATTCTCGGCGTGGAGGTTGACCCCAAGGGTGGACCAAGGATACAGGAGGCGGCGATGAGATTGTACAGCGAGAAGAGAGAATTCGATAAGATTAGTTTACTTCAGGGGCTGCAGGCGACTGAGGCGGCGTTGAAGAGGTTTTTCTACGGATATAAGCAGCTGCTGGTGGTGGTTATGGGCAGCTTGGAGGCTAAAGGGAATCGGATTTTGGCGACTTCTGAGACTTGTGACTCACTGAGTCAGCTGTTCATGGAGCCGACTTATTACCCGAGTTTGGATGCAGCCAAGACGTTTTTGGGGGAGTTTTGGAGTCATGAACAGGATGGGTCGGAGAAACGGAATCGAAGAACGTAG >Manes.10G016200 ATGGTTGGTTTAGATTGCAAAGCTAAGATGGTTTCCTCTGATCTCCCAAGCAAGTCACCCAGACTCTCTAACAAGCTTCATGTCCAGATCCCTTCTGCGACGACGTTTCGTGGTGTTACCAATTTCTCGCCGGTTTCCGCTTCCGACTCTTCTTGTTCGGCTTACGAGCACTACCTTCGGTTACCTGAGTTGAGGAAATTGTGGACTTGTAAGGAGTTTCCGGATTGGAAGAACGAATCCATTTTTAAACCGGCTTTGCAGGCTCTTGAGATCACGTTTCGGCTTATTTCCACCGTTTTATCGGACCCGAGACCGTACGCCAGTCGGAGAGAATGGAAACGAAGGCTTGAGTCGCTTGCTACTTCACAGATCGAGCTGATTGCTATTCTGTGTGAAGATGAGGAGGAAGGTGGACACACACGTGGCACTGCACCGATTGTTGATTTGCGCTCATCTAATGGCATTTTGGGTCGGGATGGGAGTTGCGCCGAGGTGTGGAAGGTCTCACCTGAAACCACCGTGGTCAACCGGACCAGCGAGGCCAGCCTACTTCCTCTCCTTTCCACGTGGCAGAAATCCGAGGACATTGCTCGGAAAATTTTCTACTCCATCGAATGCGAGATGAGGCCATGTCCGTACACTCTTGGTCTTGGAGAGCCGAACCTCGCCGGAAAACCTAACCTCGACTACGACGCCGTTTGCAAGCCAAGTGACGTACATAGCCTCAAGAAGAATCCGTACGATCACATAAACAACCACGAGAACCAAACGCTGTACACCACACACCAGATTCTAGAGTCGTGGATCCAAGCAGTTAAAGAGCTTGTTAAACGCGTAATTGAAAGAATTGGTAGCAAGAAATTCGATATGGCGTCAAGCGATTGCTATTTGCTTGAGAGAATTTGGAAGCTTCTATCCGAAATTGAAGATTTGCATCTGTTAATGGATCCAGACGATTTCTTGAGGCTCAAAAACCAGTTGCTCATGCGATCGCTTGACGAATCGGAGGCGTTCTGTTTCCGATCCAGAGCATTGGTGGAGATAACGAAATCTTGCAAGGACTTGAAGCATAAGGTTCCGGAGATTCTGGGCGTGGAGGTGGACCCCAAAGGTGGGCCAAGGATCCAGGAGGCGGCGATGAGATTATACAGCGAGAAGAAGGATTTCGAGAAGATTAGTTTACTTCAAGGGTTGCAGGCGATGGAGGCGGCTTTGAAGAGGTTTTTCTATGGGTATAAACAGCTGCTGACGGTGGTCATGGGGAGCGTAGAAGCTAGAGGAAATCGCGTTTTGGTGAATCCAGAGACATGTGACTCGCTGAGTCAGCTGTTCCTGGAGCCAACTTATTTCCCGAGTTTGGATGCAGCCAAGACGTTTTTAGGCGAGTTTTGGAGTCATGAATTCAGTGGGTTGGAAAAAGGGAATCGGAGACAGTAG >FVE20931 ATGGTCTCCTCAGATATACCCAGCAAATCACCCAGGCTCTCCAACAAGCTCCACCACCTCTCCATCCCCACCTCCTTCCGCGCCGCCCCTCTCCAGTCCGACATCGCCGCCGCCTCCGACCAAGCCTGCTCCACCTACGAGCACTACCTCCGCCTCCCTGAGCTCCGCCGCCTATGGTCCACCACCGAGTTTCCCGCCTGGAAATCCGAGCCTGTTCTCAAGCCCGCTCTCCAAGGCTTGGAGATCTCCTTCCGCTTCGTCTCCACCGTCGTCTCCGACCCGCGGCCGTACGCTAACCGGAGAGAGTGGCGCCGCCGCCTTGAGTCGTTGATCACTAGTGAGGTTCAGCTCATCGCTTTGTTGATCGAGGACGACGAGGAGGACAGCGAGTCACGCGGCGCGGCGCCGATCGTGGATTTGACGACGTCCGGCGGCGCGTTGGCTCGCGACGGGAGCTTTGCCGAAGTGTGGAGAGGCTCCGGCGAGAGCACGGTGGTGAGCCGCACCAGCGAGTCCAGCCTGCTGCCGCGGCTCGCCGCGTGGCAAAAGTCGGAGTCGGTGGCGCAGAAGATTCTCTACTCGATCGAGTGCGAGATGCGGAGCTGTCCCTACACTCTCGGCCTCGGAGAACCAAACCTCGCCGGAAAACCGAACCTCGAATACGACGCCGTTTGCAAACCGTCGGAGCTTCATTCCTTAAAGAAAAGCCCCTACGATAACTACATCGACAACCACGAGAACCAGGCGTTGTACACCACGCACCAGATCCTCGAGTCGTGGGTGTTCGTCTGCCACGAGCTTCTCAAGCGCGTGAACCGCCGTGTGGAGAGCAACGCCGCCGAAAAAGCCGCGAGCGACTGTTACCTTATCGAGCGCGTCTGGAATCTTCTAGCAGAAATCGAGGACCTCCACCTCTTGATGGACCCGGAGGACTTCCTCCGCCTCAAGAATCAGCTCAAAATCAAAACCGTCGACGATACGGAGTCGTTTTGCTTCCGATCAAAAGGGCTGGTTCAAATCACACAGCTTTGTAAAGACTTGAAGCACAAGGTTCCGAAGGTGCTGGGAGTCGAGGTGGACCCGATGGGCGGGCCGAGAATCCAGGAGGCGGCAATGAGGCTCTACTCGGAGAAAACCGGGTCGGGTAAGATCCATTTGCTTCAGGCGATGCAGAGTATCGAGTCGGCGGTGAAGAGGTTCTACTTTTCGTATAAGCAGGTGTTGGTGGTGTTGATGGGGAGCTTGGAGGCGAAGGGGAACAGGGTCGTGGTGGGACCCGAGTACGGCGACGCGCTGAGTCAGATTTATCTGGAGCCGACGTATTTTCCGAGCTTGGATGCGGCGAAGACGTTTCTTGGGGACGGTTTGAGTCATGAGAACGTGGCGGAGAGACGGACGAGGAGGAGGTAG >TCA.TCM_042570 ATGGTTGATTTAGATTGGAAAGCAAAGATGGTTTCTTCCGATATTCCGAACAAATCTGCGAAGCTGTCTAACAAGCTCCAAGTGTCGATTCCGACGTCGTTTCGTTTCTCGAATGTTTCGTCTCCGTTTTCGACTTCCGCTTCGGCTTCCTCGGATTACGACTATTATCTTCGGCTACCGGAGCTTAGGAAGTTGTGGGAGACGAAGGAGTTTCCGGGTTGGCAAAACGAGTGCGTTTTGAAGCCAGCTTTGCACGCTTTGGAGATCACGTTCCGGTTTATTTCGATTGTTTTGTCGGATCCCAGGCCGTATTCGAATCGTCGGGAGTGGACGCGTAGGCTCGAGTCACTCACCACGAGTCAGATCGAACTCATCGCTTTGCTCTGTGAGGATGAAAACGAGGATAAAACCGCCGCGGGTACGGCGCCGATCGTCGATCTGACATCGTCGAATGGAGTTTTAGCTCGCGAGAGCAGCTCCACCCAGGTGTGGAAGATTCACGGAGAAGCGACGGTGGTGAGCCGGACCAGCGAAGCCAGCTTGTTGCCTCGATTAGCCACGTGGCAGAAATCCAAAGACGTCGCGCAGAAAATCCTCTACTCCATCGAGTGCGAGATGAGGCGGTGTCCGTACACTCTCGGTCTGGGAGAGCCGAACCTTTCCGGCAAACCGAACCTCGACTACGATGCCGTTTGCAGGCCGAACGAACTCCACGAGCTTAAAAAGAGTCCGTACGATCACATCGAGAACCACGAGAACGCGACGCTGTACACGACGCATCATATTCTGGAATCGTGGATCCAATCGGCGAAACAGGTGCTGAAACGCATTGCTTCGAGGATCGACGCCGAGAGCTTCGAAGCCGCCGCGAGCGACTGTTACCTGATGGAAAAAATCTGGAAGCTTCTGGCGGAAATCGAAGATCTCCACCTCCTGATGGACCCCGACGATTTCCTTCACCTGAAGAGCCAGTTACTGATAAAGTCCGTCAGCGAGACGGAGGCGTTCTGTTTCCGATCGAAGGGGTTGGTCGAAATAACGAGAATGTCCAAGGAGCTGAAACACAAGGTCCCGTTCATCCTCGGCGTCGAAGTGGATCCCAAGGGAGGTCCCAGGATTCAAGAAGCTGCGATGAGATTGTACGCGGAGAAACAGGAGGGTAGTAAGGTCTTTTTGGTACAAGCCCTGCAAGCCATCGAAGGAGCCTTGAAGCGGTTCTTTTACGGGTTCAAGCAAGTCCTGGTGGTAGTGATGGGGAGTTTGGAAGCGAAAGGGAACCGAGTCGTGGCGAGCTCCGACATGGGTGACTCGTTGAGTCAGATCTTCTTGGAGCCTACTTACTTCCCCAGCCTGGATGCGGCCAAGACTTTTTTGGGCGAGTTTTGGAGCCATGAACATGGTGGGTCTGGATGGACTCGGTGGAGGAAGTGA >AUR62012225 ATGGTACAATCAACCCCAAATCTCACCAAAAAATCCCCCAAACTCACCCCTAAACGAACCACGTCTAACCCCCTCATTTCTCCGGTTCCATTCACCGCCGGAGAATTATCTCCGGCGTCGGAATCATCTTGTTCAGCCTACGAAAGCTATCTCCGCTTACCGGAACTCCATCTGTTATGGAGTTCCGTCGAATTTCCGGGTTGGGAAAACGAGTCCATTATTCGACCCGCTTTACAAGCATTAGAAATCACATTCCGGTTCATTTCACTCGTGTTAAACGACAACAGACCGTATTTGAACCACCGTGAATGGAACCGGAGGTTAGAGTCGTTAGCAAGGGATCAAGTCGAGTTAATCTCTGTATTATGTGAAGACGATGAGACACGTGGCGCAGCGCCGATCGTTGATTTGAGTTCATCGTTTGGTGAGGTGGTCCCACAAACTGGAAGTTCCGCTGAAGTTTGGAAATTAGCTGATAATGAACACAATATTACGGTGGTCTGCCGTAGTAGCGAAGCAAGTCTGTTGCCGCGGTTAGCCACGTGGCAGAAATCGGAGGAGATTTCTTCCAGAATATATTACGCGATTGAGTCGGCTATGAGAAGATGCGCGTATACTTTGGGCCTGGGTGAGCCCAATTTGGACGGAAAGCCCAATTTGGATTACGACGTTGTTTGCCGACCGTGTGAACTGCACGCGCTTAAGAAGGGCGCGTTGGATCATATTCCAAACCCAGAAAACCAGATATTATTCACGATTCACCAGATTTTCGAGTCATGGGTTTTCGCAGCGAAGAAGCTGATCGTCCGAGTAGGAGAGAGGATCAGCAAAGAGGAATTCAACAAAGCAACAGACGATTGTTGGATTCTAGAAAGAATCTGGAAGCTTCTAGAACAAATCGAGAGTCTTCACCTACTAATGGATCCCGACGATTTCCTGCAATTAAAAACGCAATTGAAGATGAAAACGACGTCGGATTCAGAAACCTTTTGTTTCCGATCAAAGGGGTTAATCGAGATAACAAAGCTAAGCAAAGACTTGCGACACAAGGTACCGGAGATTCTAGAAGTGGAGGTGGACCCCATGGGAGGGCCGGTGATACAAGAATCGGCAATGGAGTTATACAGAGAGAAGAGAAGGTTCGAGAAGATTCATCTGTTGCAAGCATTTCAAGGGGTGGAATCAGGTGTGAAAGGGTTCTTCTTTAGGTATAAACAGTTGTTGATGATTATGATGGGGAGTTTAGAAGCCAAGGCTAATTTCGCTGTCGTGGGTGGTTCTGAGTCGTCCGATTTGTTGAGTCAGATCTTTCTAGAACCAACTTATTATCCTAGCTTAGATGGGGCTAAAACTTTTATTGGGGATTTTTGGGAGCACGATCAAACACTTGATAACGGTAATAGTTTGGATAATCGGAGAAATCGGACGGCTAAGCATTGA >AUR62022857 ATGGTACAATCAACCCCAAATCTCACCAAAAAATCCCCCAAACTCACCCCTAAACGAACCACGTCAAACCCCCTCATTTCTCCGGTTCCATTCACCGCCGGAGAATTATCTCCGGCGTCGGAATCATCTTGTTCAGCCTACGAAAGCTATCTCCGGTTACCAGAACTCTATCAGTTATGGAGTTCCGTCGAGTTTCCGGGTTGGGAAAACGAGTCGATTATTCGACCCGCTTTACAAGCATTAGAAATCACATTCCGGTTCATTTCACTCGTGTTAAACGACAACAGACCGTATTTGAACCGGCGAGAATGGAACCGGAGATTAGAATCGTTAGCAAGGGATCAAGTGGAGTTAATCTCGGTATTATGTGAAGACGACGAGACACGTGGAGCGGCGCCGATCGTTGATTTGAGTTCATCGTTTGGTGAGGTGGTCCCACAAACTGGAAGTTCCGCTGAAGTTTGGAAATTAGCAGATAATGAACACACTATTACGGTGGTCTGCCGTAGTAGCGAATCAAGTCTGTTACCGCGGTTAGCCACGTGGCAGAAATCGGAGGAGATTTCTTCCAGAATATATTACGCGATTGAGTCGGCTATGAGGAGATGCGCGTACACTTTGGGCCTGGGTGAGCCCAACTTAGACGGAAAGCCCAATTTAAATTATGACGCTGTTTGCCGACCGTGTGAATTGCACGCGCTCAAAAAGGGCGCGTTGGATCATATCCAAAACCCAGAAAACCAGATATTATTCACAATTCACCAGATTTTCGAGTCATGGGTTTTCGCAGCGAAGAAGTTGATCGTCCGAGTAGGAGAGAGAATCAGCAAAGAGGAGTTCACCAAAGCAACAGACGATTGTTGGATTCTAGAAAGAATCTGGAAGCTTCTAGAACAAATCGAAAGTCTTCACCTACTAATGGATCCCGACGATTTCCTGCAATTAAAAACGCAATTGAAGATGAAAACGACGTCGGATTCAGAAACCTTTTGTTTCCGATCAAAGGGGTTAATCGAGATAACAAAGCTAAGCAAAGACTTGCGACACAAGGTACCGGAGATTCTAGAAGTGGAGGTGGACCCTATGGGAGGGCCGGTGATACAAGAATCGGCAATGGAGTTATACAGAGAGAAGAGAAGGTTCGAGAAGATTCATCTGTTGCAAGCATTTCAAGGGGTGGAATCAGGCGTGAAAGGGTTCTTCTTTAGGTACAAACAGTTGTTGATGATTATGATGGGGAGTTTGGAGGCGAAGGCTAATGGTTCTGAGTCGTCCGATTTGTTGAGTCAGATCTTTCTCGAACCTACTTATTATCCTAGCTTAGATGGGGCTAAAACTTTTATTGGGGATTTTTGGGAGCACGATCAAATGGTTGGTAACGGTAATGGTTCCGATCAACGGAGAAATCGGACGGCTAAGCATTGA >Cla006580.g ATGGTTGATTTGGGTTGGAAGGCCAACATGGTTTCATCTGACAAGACGACGACTAAATCCCCAAAAATCATCCCCATCGCCAACAACAAGCTCAATTTATCTCTTCCCGTTTCGTTTCGTTCTTCAGAGCTCTCCACTGCTTCGCCTTCCTCTTGTTCTTCATACGAGCAGTACCTTCGACTTAACGAACTCAGGAAGCTATGGAGTTCTAAGGAGTTTCCTGAATGGAGAAATGAGTCGGTATTGAAGCCGGGATTACAAGCTTTGGAGATTACCTTCCGCTTTATTTCGACCGTTTTGTCTGATCCACGGCCGTACGTGAACCGGCGGGAGTGGAAGAGGAAGCTTGAGTCTCTCACAACGAGTCAGATCCAACTCATTGCTATGATTTGTGAAGACGACGAAGAGGACGGTGAAGCACGCGGTAGAGTTCCGATTGTCGATCTGAGTTCATCCGATGGCGTGATTACACGCGACGGAAGCTCGGCGGAGGTTTGGAAGATTCGTGGAGAAGCTACCGTTGTGAACAGAACGAGTGAATCGAGTCTTCTTCCTCGGCTTGCATCATGGCAGAGCTCTGAAGACATCGCACAGATGATTCAGTACTCCGTCGAGTGCGAGATGAGGAGATGTCCGTACACGTTAGGGTTAGGGGAGCCGAATTTGGCTGGGAAACCGAATCTTGATTACGACCTAATTTGCAAGCCAAACGAGCTTCATTCTCTGAGAAAGACTCCGTATGATCAAATCGAAAATTACGAGAATCAGACGGTTTATACAACGCACCAGATCCTGGAGTCGTGGATTTACGCTGCGCATGAGCTTCTGAAACGAATTGCAGAGAGAATCGAGAAGAAGAATTTCGCCAGAGCCGCGAGCGATTGCTATCTGTTGGAGCGGATCTGGAAGCTTCTGCAGGAGATTGAAGATCTTCACCTTCTGATGGATCCGGATGATTTCCTAAAGCTGAAGAATCAATTAGCGATCAAATCGCTGCAGGAATCGGAAGCGTTTTGCTTCAGATCGACAACGCTGGTGGAAATTACGAAGCAGTGCAAGGATCTGAAGCACAAGGTGCCGTTCATCTTGGATGTGGAGGTGGATCCAATGGGCGGACCAAGGATTCAAGAGGCGGCGATGAAATTGTACAGCGAGAAGCAAGAATTCGAGAAGATTCATCTGCTTCAAGCTCTACAAGCTATCGAATCGGCGACAAAGAAGTTTTTCTTCGCATACAAGCAAGTTCTGGTTATGGTGATGGGAAGCTTAGAGGCGAAGGGGAACCGAGTCGTAGTGAGTTCGAACTCGGATGATTCACTGAGTCAGATATTTCTGGAGTCCACTTATTTTCCAAGTTTGGATGCTGCTAAGACGTTTCTCGGGGATCTACATAGTGTTTTCGGGTCGGATCGGAGGACCCGGATGAAGCTTTAG >Cc02_g06790 ATGGTGGATTTGGATTGGAAAACAAAAATGATCTCATCCGATATACCAACCACGTCTCCTAGGCTTTCCAATATGCTTCAAATCTCCATACCTTCTAGTACTACACCAACCGTTCGGGTCGCCGATTTATCACCGGCTTCTGAGTCGGCTTGTTCGGCCTACGAACACTACTTGCGACTTCCGGAGCTGAAAAAGCTGTGGAGCTCTCAAGATGTTCCCACCTGGAGAAACGAATCCATACTTAAACCGGCTCTGCAGGGCTTGGAGATTACTTTCCGGTTCATCTCAGCCGTTTTGTCCGACTCTAGACCCTACGCTAACCGGAGAGAATGGAGGCGGCGGCTGGAGTCTCTGGCCACCGGCCAGGTCGAGATTATAGCTTTGCTGTGCCAAGAAGGCGAGGAGGACTACAGGACGCGTGGCACCGCGCCGATTGTTGACCTGACATCGAATTCCGGCGTGTGGGTTCGCGAGAGCAGCTCCGCGGAGGTGTGGAAGGTCACCGGAGGAGATAATAAAACAGTGGTGAGCAGAGCGAGCGAGGCTAGCTTGCTGCCTCGCCTTGCCACGTGGCAGAAGTCGGAAGACGTCGCCCAGAAGATCCTCTACTCCATCGAGTGCGAGATGAGGAGCTGTCCTTATACTTTGGGCTTGGGCGAGCCGAATCTCAGCGGCAAGCCGAGCCTGGACTACGATCGCGTGTGCAAGCCGGCTGAGCTCCACGCCCTGAAAAGATCCCCGTCCGATCACATGAATCTTCAAAACTCTGAAAACCAAACGCTCTACAGCGTTCACCAAATCTTAGAATCATGGATCTACACGTCGGGGCAAATTTTGAAGAGAATCTCGGATCAAATCGAAGAAAGAGAGTTTGAGAGCGCCTGCAGTAATTGCTGGCTACTCGAGAAAATTTGGAATCTGTTGAGCCAAATCGAAGATCTCCATTTACTGATGGATCCGGACGACTTCCTCCGGCTGAAGAATCAACTGTCTATTAAAGCGACGTCGGAGAATGATTTGTTCTGCTTCAGGTCGAGAGAACTGGTTGACATAACCAAGTTCTCAAAAGATTTGAGGCACAAAGTGCCCTTCATTTTGGAGGTGGAGGTGGACCCCAAGGGAGGGCCGAGAATACAAGAGGCGGCCATGGAGTTGTACCGGAGGAAGAATGGGTTTGAGAGGATTCATTTGCTCCAGGGGTTGCAGGCGGTGGAGATGGCGGTTAAGAGGTTCTATTATTCGTACAAGCAGCTGCTGGTGGTGGTAATGGGAAGCGTGGAGGCGAAGGGGAACAAGGGCTTCGTTGGGGTGGATGCAGGGGATACATTGGCTCAGATATTTCTGGAGCCCACTTATTTTCCGAGTTTGGATGCTGCCAAGACGTTCTTGGGGGACTATTGGAGCCATGAACGCCGGTGGTGCAGTCCGGAGAGACGGAGGCAGTGA >Gorai.009G322100 ATGGTTGATTTAGATTGGAAAGCGAAGATGGTCTCTTCCGATATCCCAAACAAATCCCCAAAACTTTCTAATAAGCTTCAGGTTTCGATTCCTACGCCGTTTCGCTTCTCCAATATTTCATCTCCACTTTCGACTTCAGCTTCGGCTTCCTCCGCTTACGATTATTATCTCCGGCTACCGGAGTTGAGGAAGTTATGGGAGACAAAGGAGTTTCCAGCTTGGCAAAACGAGCGCGTTTTGAAGCCAGCTTTGCATGCTCTCGAGATCACATTCAGGTTTATTTCGATTGTTTTGTCTGATCCTAGATCGTATTCGAACCGTCGCGAATGGAATCGTCGACTCGAGTCACTCACCACGAGTCAGATCGAACTCATCGCCATGCTTTGCGAGGACGAAAACGAGGATAAAACGGCCGCTGGCACGGCGCCGATCTTCGATCTAACTTCTTCGAACGGAGTACTAGCTCGCGAGAGCAGCTCCGCCGAGGTCTGGAAGCTTCATGGAGAAACAACGGTGGTCAGCCGAACCAGCAAAGACAGCTTGTTGCCTCGACTCGCCACGTGGCAGAAATCTGAAGATGCCGCGCAGAAAATCCTTTACACCATTGAGTGCGAGATGAGGCGTTGTCCGTACACTCTAGGTTTAGGAGAGCCGAACTTGTCCGGCAAACCGAGCCTCGACTACGACGCCGTTTGCAAGCCAAACGACCTCCACGCGCTGAAAAGGAGCCCGTACGACCACTGCATCGAGAACCACGAGAACGCAACGCTTTTCACGACGCATCAGATCCTGGAATCGTGGATCCAAACGGCGAAACAAGTACTGAAACGCATCGCTTCGAGGATTGACGCTGAAATCTTCGAAACCGCCGCGAGCGATTGTTATTTGTTGGAAAGGATCTGGAAGCTTCTAGCGGAAATTGAAGATCTCCACCTTTTAATGGATCCCGACGATTTCCTTCACCTCAAAAGTCAGCTACTGATAAACCCGGTCAATGAAACGGAAGCGTTTTGTTTCAGGTCGAAAGGCTTGGTTGAAATTACGAAAATGTCCAAGGAGTTGAAACACAAGGTTCCGTTTATATTGGGTGTGGAGGTGGATCCTAAAGGCGGACCCAGGATCCAAGAAGCTGCGATGAGATTGTACTCAGAGAAGCAGGAGGGCAATAAGGTCTTCCTCGTACAAGCTTTGCAAGCCATCGAAGGAGCTTTAAAACGGTTCTTTTACGGTTATAAGCAGGTGTTGGTGGTGGTTATGGGGAGTTTAGAAGCGAAAGGGAACCGAGTCGTGGCCGGCTCCGGCTCGGTCGATTCGTTGAGCCAGGTATTCTTAGAGCCTACTTATTTCCCTAGTTTGGATGCGGCTAAGACTTATTTGGGCGAGTTTTGGAATCATGAACTCGGTGGATCTGGGTTGACTCGATGGAAGAAGTGA >Gorai.011G283600 ATGAAAATGGTTGATCTAGATTGGAAAGCAAAGATGGTTTCTTCAGATATTAGCAACAAATCCTCGAAATTGTCCATTCCGGCGCCGTTTCGGTTGTTGAATATGTCGTCTCCGCTTTCGACTTCGGCTTCGGCTTCATCGGCTTATGAGTACTATCTTCGTTTACCGGAGCTGAGGATGTTATGGGAGGCAAAGGAGTTTCCGGATTGGCAAAACGAGGTCGTTTTGAAACCGGCTTTGCATGCTTTGGAGACTACCTTCCGGTTCATTTCGATCGTTTTATCGGATCCTAGACCGTATTCGAATCGCCGGGAGTGGACGCGTCGACTGGAGTCGCTTGCCACAAGTCAGATCGAACTCATCGCTATGATATGTGAAGATGAAAACGAAGACAAAACGACGGCGGGAACGGCTCCGATCGTTGATTTGACGTCGTCGAACGGTGTGCTTGCTCGTGAGTGTAGCTCCACCGAGGTTTGGAAGGTCCATGGAGAAACCACGGTGGTGAACCGGACCAGCGAATCCAGCTTGCTACCGCGGCTCGCCACGTGGCAGAAATCCGAGGATGTGGCGGAGAAAATCCTTTACTCCATTGAGTGTGAGATGAGGCGGTGTCCGTACACTCTCGGATTAGGAGAACCGAACTTATCCGGTAAGCCCAACTTGGATTACGACGCCGTTTGCAAGCCGAACGAACTCCACGCGGTGAAGAAGAGTCCGTACGATCACGTCGACAACCACGAGAACGCGACGCTTTACACCGTACACCAGATCCTCGAAGCGTGGATCCAAACGGCGAAACAAGTGTTGAAACGCATCGTTTCGAGAATCGACGCCGGTAACTTCGAAACCGCCGCGAACGACGGTTACTTGACAGAAAAGATCTGGAAGCTTCTATCGGAAATCGAAGATCTCCACTTGTTAATGGACCCTGACGATTTCCTTCGTCTCAAAAGCCAATTAATGATAAAATCGGTTAACGAAACGGAAGCGTTTTGTTTCAGATCGAAAGGGTTAGTTGAAATTACCAAAATGTCCAAGGAGTTGAAGCATAAGGTTCCGTTTATTTTGGGCGTGGAAGTGGACCCTAAAGGTGGACCCAGGATACAAGAAGCCGCGATGAAACTGTACGCAGAGAAGGAGGAGGGTAATAAGGTGTTTTTGGTACAAGCCTTGCAAGCCATCGAAGGAGCCTTGAAACGGTTCTTTTATGGGTACAAGCAAGTGCTGGTGGTGGTTATGGGGAGCTTGGAAGCTAAAGGGAACCGAGTCGTGACGAGTTCTGACTCGGGTGACTCGTTGAGTCAGATATTCTTGGAGCCTACTTATTTCCCTAGTTTGGATGCGGCCAAGACGTTTTTGGGCGAGTTTTGGAGTCGTGGACAGGGTGCATCTGGGTTGACTCGGTGGATGAAGAAGTGA >Gorai.013G019200 ATGGTTGAACTTGATTGGAAAGCAAAGATGGTTTCTTCCGATATTCCAAAGAAATCTCCAAAGCTCTCTAACAAACTCCAAGTTTCCATTCCGACGCCGTTTCGTTTCTCCAATATGTCTTCTCCGCTCTCGACTTCACCTTCGGCGTCCAAAGCTTATGATTATTATCTCCGGTTACCGGAGCTGAGGAAGTTATGGGAGACAGAAGAGTTTCCCGCTTGGAAAAACGAGGTCGTTTTGAAGCCGGCTTTGCACGCTTTGGAGATTACGTTCCGGTTCATTTCGATCGTTTTGTCCGATCCTAGACCGTATTTGAACCGTCGGGAGTGGACGCGTCGACTCCAGTCGCTTACCACGAGTCAGATCGAACTCATCGCTATGTTATGCGAAGACGAAAACGATGCTCCGATCCTTGATCTTACGTCGTCGAACGGTGTATTAACACGAGAGAGCAGCTCCGCCGAGGTGTGGAAGATTCACGGAGAAACGACAGTGGTGAACAGGACCAGCGAAGCCAGCTTATTGCCTCGGCTGGTGACGTGGCAGAAATCCGAGGACGTAGCGCAGAAAATTCTCTACTCCATCGAGTGCGAAATGAGGCGGTGCCCTTACACGTTAGGCTTGGGAGAGCCGAACCTCTCCGGAAAACCAAACCTCGACTACGACGCCGTTTGCAAGCCGAACGAACTCCACGCGCTCAAGTCCAGCCCTTACGATCACATCGAGAACCACGAGAACTCGACGCTTTACACCACCAATCAGATCCTCGAATCATGGATCCAGACGGCGAAACAGTTGTTGAAACGCATCGCTTCGGGGATCGACGCCGGTAGCTTCGAAGCCGCCGCCGGCGACTGTTACATATTGGAAAAGATCTGGAAGCTTCTGGAAGAAATCGAAGATCTCCATCTCCTAATGGATCCCAACGATTTCCTTCACCTGAAAAGCCAGTTGCAGATAAAATCGGTTAACGAAACGGAGGCGTTTTGTTTCAGATCGAAAGGGTTGGTTGAAATTACGAAATTATCCAAGGAGTTGAAACATAAGGTCCCGTTCATTCTGGGTGTCGAGGTGGACCCTAACGGTGGGCCAAGGATTCAAGAAGCTGCTATGAGGTTGTACTCGGAGCAAAAGGAGGGCAATAAGGTATCTCTGGTACAAGCATTGCAAGCCATCGAAGCGGCCTTGAAACGGTTCTTTTTTGGGTACAAGCAAGTGTTGATGATCGTTATGGGGAGTTTGGAAGGGAAAGGGAACAGAGTCGTGGCGTGTTCCGACTCGGGTGACTCGTTGAGTCAGATATTTTTGGAGCCTACTTATTTCCCCAGTTTGGATGCTGCTAAGACGTTTTTGGGCGAGTTTTGGAGTCGTGAACAGGGTGAGTCTCGGTTCAAGAAGTGA >C.cajan_19487.g ATGGTCGATTTACATTGGAAATCAAACATGCCAACTTCCGACATGTCTCCCAAGGCACCAAAACTCTCTCTCTCCTTCCATAACCACAACACAGACATCTTCTCCACTGCACCCTCACTCCGCGCCGCATACGAAAACTATCTCCACCTTCCGGAACTCAGAAACCATTGGAACACGCCACACTTCCCTAACTGGACCAACGAACCAATCGTAAAACCCGCTTTACAAGCTCTCGAAATCACCTTCCGTTTCCTCTCCATCCTTCTGTCCGATCCCAGACCTTACTCCAACCGCAGGGAACGCAACCGCAGGCTAGAGTCCCTCGCCATCCACCAAATCGAAATCATCGCAATGCTGTGCGAGGACGAGGACCACAACTCCGCCACACGTGGCACCGCGCCAACTGCTCATCTCACCAACACCGACAATTGCCAGACCAGAAGCTACAGCCAAGAGAGTCTGCTCCCGCGCCTCGCCACCTGGTACAAATCCAAGGACGCGGCGCAGAGGATCCTTCTCTCCGTCGAATGCCAAATGAGGAGGTGTCACTACACGCTGGGTTTGGGAGAGCCCAACCTCGCCGCCAAACCCAGCCTCTTGTACGACCGCGTCTGCAAGCCTCGCGAGATTCACGCGCTCACTGGCCAGCGCGTGGAGAATCACGAGAACGACGCGGTGCACGCCACGCACCAGATCGCCGAGTGTTGGATCCGCGCCGCCTGTAAGCTTGTGGAAAGGATCGGCGACGCCATCCTTTCCAGAAGGTTCGAGGAGGCCGCGGAGGACCTCCACGCGGTGGAGCGGATCTGGAAGCTTCTATCGGAGGTGGAGGATCTTCACCTGGTCATGGATCCGGACGATTTCTTGCGGCTGAAGAACGAGCTGGCGGTGAGGTCGTCGAGAGGCGAGACGGCGTCGTTCTGCTTCCGGTCGAAGGAGCTCGTGGAGTTAACGAAGCTGTGCAGAGATCTGAGGCATAACGTGCCGGAGATTCTGGAAGTGGAAGTGGATCCGAAGGGAGGACCGAGGATTCAGGAGGCGGCGATGAAGCTGTACGTGGCGGAGAAGAAGAGCGCGTTCGAGAAGATTCACGTGCTTCAGGCGATGCAGGCGATTGAGGCGGCGATGAAGAGGTTCTTCTTTTCGTACAAGCAGGTCTTGGCGGTGGTGATGGGAAGCTCCGAGGCGAACGGGAACCGAGTTGGCTTGAGTTACGACTCGGCTGACTCGTTGACTCAGATTTTTCTGGAACCCACGTATTTTCCAAGCTTGGATGCCGCCAAGACTTTCCTAGGCTACTTTTGGGATAATGCCGATTCCAAGTTGGTTTGA >C.cajan_27909.g ATGGTTGATCTAGATTGGCAAACAAAGATGGTTCGCTCCAACATACCTCCCAAGTCCCCAAAGCTCTCTCTCCCAGATAACAACATCCCAATCCCCGCTTTGCAATTCCCCCTTCCCCTTCGCCAAAACGACATCACTGCAGCATCCCCCCCGCTCTGCACCGCATACGACAACTACCTCCGCCTCCCTCACCTCAAAGCCCTCTGGGCCTCCAATCACTTCCCCAATTGGTCCAACGAGCCCATCTTAAAGCCCACCCTACACGCCCTCGAAATCACCTTCGGCTTCCTGGCAACCGTTTTATCAGACCCCAGACCCTACGTCAACAAGCGCGAGTGGACCCGTCGCCTCGAGTCCCTCGCCACGGCCCAAATCCAAATCATATCATTCCTATGCGAAGACGAGGAGCAAAACCCCCAGACACGTGGCAAGGCGCCGGTGAGCGACATTAACTCCATAGCCATAACCACGGGGACGCACAACAGATGCTACAGCGAGGAAAGCATGCTCCCTCGCCTCGCCACGTGGCAAAAATCCAAGGACGTAGCCAAGAGGATTCTCGCCACCGTGGACTGCCAGATGACGCGCTGCACCTACACGCTGGGCTTGGGAGAGCCCAATCTCGCCGCCAAACCGATTCTCCGTTACGACGCCGTTTGCACGCCCAGGGAGATTCATCTGCTCCAAGCCATGGACGACGGCGTCGCCAACTACGAGAACAAGACGGTGCGCGCCACGCACCAGATCGCCGAGTGCTGGACGCGCGCCGCCGGGAAGCTTCTGGAGAGGGTGGCGGAGTCGGTGGAGAGGAAAACGCTGGAAAAAGCGGCGTGTGAGTGCGAGGCGGTGGAGCGGATCTGGAAGTTGTTAACGGAGGTGGAGGATTTGCACGTGATGATGGATCCGGAGGATTTTCTGAGGCTGAAGAAGCAGCTAGGGGTGAGGAGCTGGGGCGAAACAGCGGCGTTTTGCTTCCGGTCGAGGGAGCTTGTGGAGGTGGCGAAGGCGGATCTGAGGCAGAAGGTGCCGGAGATTCTGGAGGTGGAGGTGGACCCCAAGGGTGGGCCCGGGATGATGGAGGCTGCGATGAAGGCTTACGCGGACAAGTTGGAGAAAGTTCAGGTGTTGCAGGCCATGCAATCCATTGAGGTGGCGATGAAGAGATTCTTCTACGCCTATAAGCATGTTGTGTCGGTTGTGATGGGGAGTTCCAGTTCCGATGCCGATGGCTTAACTCACATCTTTCTTCATCCCTCTTATTACCCTAGCTTGGATGCTGCTAAGACCTTTCTTGCCTACTATTGCCAAAATAACCATTGTTAA >Achn139021 ATGGTCGATATGGAGTGCAAAGCAAAGATAATTACCTCCAATTCACCGATCAAATCTCCGAAACTGTCGACGAAGCTCAAAATTGATGTACCGCCGGCAATTCTCGTTGATGATTTATCTCCGGTGTCGGAGTCGGCGTACTTGGCGTACGAGAACTACCTTCGTCTTCCGGAGCTAAACCAGCTATGGAGTTGCAGAGAATTTCCAAGCTGGAAAAACGAATCCCTCCTTAGACCGGCGTTGCAAGCGTTGGAGATCACGTTCCGGTTCGTTTCGACAGTGTTGTCCGATCCGAGATCGTACGCGAATCAGAGGGAGTGGAGGAGACGGATCGAGTCGCTCGCGACGGCTCAGATCGAGCTCGTGGCGTTGATCTGCGAGGACGACGAGACACGTGGCAACGCGCCGATCGTCGATCTGAACTCATCGGAAGGCGTGCTGGCTCGCGGCGACAGCTTGGCGGAGGTGTGGAAGCTCTCCAAAGAGACAACGGTGGTGAGCCGCACCAGCGAAGCCAGCCTGCTGCCTCGGCTCGCCACGTGGCAGAAGTCGGAGGAAGTTGCACAGAAGATTCTGTACTCCATCGAGTGCGAGATGAGGAGGTGTCCGTACACGCTAGGTTTGGGCGAGCCGAACCTCGCCGGAAAACCGAGCCTCGACTACGATCTGCTCTGCAAGCCATCTGATCTTCAAGCTCTGAAGAAAAGCCCCTCCGATCTCATGAACCTCGAGAATCACGAGAACCAAACGCTCTACTCAACTCACCAAATCCTAGAATCATGGATCTACGTTTCGCAGCAACTTCTCAAACGAATCGTAGGTCGAATCGATTCGAAGGACTTCGACAAAGCATCAACCGATTGCTGGCTTCTCGAGCGCACATGGAAACTTCTATCCGAAATCGAAGATCTACATCTACTAATGGATCCAGACGATTTTCTCCGATTGAAGAACCAGCTCTTGATCAAATCCTCCTCCGAATCCGAAGCGTTCTGCTTCAGATCGCGAGGGCTCACCGAGATCACGAAGCTCTCCAAGGATCTGAGGCACAACGTCCCGTTCATCCTCTGCGTGGAGGTGGACCCCAAGGGAGGGCCGAGGATTCAGGAAGCGGCTATGAGGTTGTATCGGAAGAGGATAGAGAGCGAGAAGATTCACCTGCTACAGGCGCTGCAGGCGATCGAATCGGCGCTGAAGAGGTTCTACTACGCGTACAAGCAGTTGATCGTGAACGTCATGGGGAGCTTGGAGGCCAAAGGGAATCAAGCGTTCGTCACCTTCGATTCGAGCGATTCGTTGGCTCAGATCTTCCTGGAGCCGACGTATTTCCCGAGCTTGGACGCTGCGAAGACGTTTCTGGGACATGAATGGAGCCATGAGCGTGGTCAGGACAGTTCCGAGAGACGCATGCAAGGACATAAATGA >Achn140961 ATGATTACCTCCAATTCACCGATCAAATCTCCGAAACTGTCGACGAAGCTCAAAATTTCTGTACCGACGGAGATTCGGGTCGGCGATTTATCTCCGCCGTCGGAGTCGGCGTACTTGGCGTACGAGAACTACCTTCGTCTTCCGGAGCTAAAAAAGCTATGGAGTTGCAGAGAATTTCCGAGCTGGGAAAACGAGTCTCTCCTTAGACCGGCATTGCAAGCTTTGGAGATCACGTTCCGGTTCGTTTCGACGGTGTTTTCCGATCCAAGACCGTATGCGAATCAGAGGGAGTGGAGGAGACGGATCGAGTCGCTCGCGACGGCTCAGATCCAGGTCGTAGCGCTGATCTGCGAGGACGACGAGACGCGTGGCAACGCGCCGATCGTCGACCTGAACTCTTCGGAAGGCGTGCTGGCTCGCGGCGACAGTTTGGTGGAGGTGTGGAAGCTCTCGAAGGAGACGACGGTGGTGAGCCGAGCCAGCGAAGCCAGCTTGCTGCCTCGGCTAGCCACGTGGCAGAAGTCGGAGGAAGTTGCACAGAAGATTCTGTACTCTATCGAGTGCGAGATGATGCGGTGTCCGTACACGCTAGGTTTGGGCGAGCCGAACCTCGCCGGTAAACCTAGCCTCGACTACGATCTTCTCTGCAAGCCATCTGATCTTCAAGGTCTGAAGAAAAGCCCCTCCGATCTCATGAACCTCAAGAATCACGAGAACCAAACGCTGTATACGACTCAACAGATCCTAGAATCATGGATCCACGTTTCGCAGCAACTTCTCAAACGAATCGTAGAGCGAATCGATTCGAAGGACTTTGAAAAAGCATCAACCGATTGCTGGCTTCTCGAGCGCACATGGAAACTGCTATCTGAAATCGAAGATCTACACCTACTAATGGATCCAAACGATTTTCTCCGATTGAAGAACCAGCTCGCGATGAAATCCTCCTCCGAATCCGAGGCGTTCTGCTTCAGATCGCGAGGGCTTACCGAGATCACGAAGCTGTCGAAGGATCTGAGGCACAAGGTCCCGTTCATCCTCGGCGTGGAGGTGGACCCCAAGGGAGGACCGAGGATTCAGGAAGCGGCGATGAGATTGTACCGGAAGAGGAGAGAGAGCGAGAAGATTCACCTGTTGCAGGCGCTTCAGGCCATCGAATCGGCTCTGAAGAGGTTCTACTACGCGTACAAGCAGCTGATCGTTACCGTCATGGGGAGCTTGGAGGCCAAAGGGAATCAAGCGTTCGTGAGTGTCGATTCGAGGGATTCGTTGGCTCAGATCTTCCTGGAGCCGACGTATTTCCCGAGCTTGGACGCTGCGAAGACGTTTTTGGGACATGAATGGAGCCATGAGCGTGGTCAGTACAGTCCCGAGAGACGCAAGCACGGACATAAATGA >Tp4g22310 ATGGTTGATATGGAATGGAAGAGGAAGATGGTGTCATCAGATTTACCTACTAACTCACCTAAGCTTTCTTCTAAGCTTCACGTTACTATTCCGTCGCCGTTCAAGGTCCCTGTCTCGTCTCCGATCTCCTGTTCCGCTCCCGCAGCTTGCTCCGCCTACGAGCTTTACCTCCGTCTCCCTGAGCTGAGGAAGCTCTGGTCATCTCGTGATTTTCCTCTGTGGACGGACGAGCCTATCCTCAAACCGGCTCTTCAGGCTTTAGAGATCACTTTCCGATTGGTTTTAGCTGTTTGTTCCGACACACGACCGTACATCAACCACCGCGAATGGAACCGACGGTTGGATTCGCTCGTTACGAATCAGATCCAGCTTGTTGCAGCGATCTGCGAGGAAGAAGAAGAAGAAGATGGATTGGTTCCAGTCGGCGATGGACGAAGCTCTCTCAGCTTGCTCCCGCAGCTAGCTACGTGGCGTAAATCGGAGGCTTTAGGGAAGAAGATGTTATGTACGATCGATAACGAGATGCGTCGGTGCAAATACACGTTAGGTCTCGGAGAACAAAACATCTCCGGAAAACCGAATCTCCGGTACGACGCGATTTGCCGACCTAACGAGCTATACAGACTCAAGGATAATCCCTACGCAGATCATATCGATAATCAGGAGAATCAAACGCTCTACATCCTTCACCAGATCCTCGAATCGTGGATCCACGCATCTGGAAACCTCTTGAATCGAATCAACACGAGTATCGACGAAGGGAAATTTGCAAAAGCCTCGAACGATGTGTACTTGCTCGAGAGAATCTGGAAGCTTCTTGCGGAGATTGAAGATCTTCACATTCTGATGGATCCAGAGGATTTCCTCAAACTGAAGAAACAGTTGCAAATCAAATCGACGGGGAAAAACGACGCCTTTTGTTTCAGATCTAAAGGATTAGTGGAGATGATGAAGATGTCCAAGGATCTAAGGCAGAAGGTACCGGCGGTGCTGGAGGTTGAGGTGGATCCCACCGGAGGACCGAGATTGCAGGAGGCGGCGATGAGGCTTTACGCCACGAAGAGAGATTGCCATAAGATCCATCTGCTTCAGGGGATGCAAGCCGTGGAGGCGGCGGCGAAGAGTTTCTTCTTTTCGTACAGGCAGCTAGTGGCGGCGATGATGGGAAGCGCTGAGACGAACGCGACTGCGAGTCAGGATTCGTGTGATTCGCTGAGTCAGATATTCATGGAGCCGACGTATTTCCCGAGCCTTGACGCGGCAAAGACGTTCCTCGGAGAATTCTGGAGCCACTTGGGATGA >Tp5g06640 ATGGCTAATTTGGATTTGCAGAGGAAGATGGTATCTCCCAAGAAGCCTTTTAAGCTCTCTGTCTCCTCTCCAATCTCCTCTTCTTCCTCCGCCGCTTGCTCCGCCTACGAGCTTTTCCTCCGTTTGCCGGAACTCAGAAATCTCTGGTCCTCTCTCGATTTCCCTCAATGGACCTCCGAACCTGTCCTCAAACCAGCTCTTCAAGCTCTAGAGATCACTTTCCGTTTAATCCTCACCGTCGCTTCCGGCACACGTCCGTACATCAACCGTCGCGAGTGGCTCCGACGTTTAGACTCTCTCGCGACGAGCCAGATCAAAATCGTGGCGTCAATCTGCGAGGATGAAGACGACGACGACGAGAGCGTACGTCCGGTCAGCAATGGCTGGAGCTCGTTGAGCTTGCTTTCGGAGATAGCCACGTGTCGGACATCGGAAAGCATTGGACAGAAGATCTTGTGTACGATCGAGAACGAAATGCGTTGGTGTAAGTATACGCTCGGTTTAGGTGAACCGAACCTCGCCGGAAAACCGTATCTTCAATACGACGCCGTCTGTCGCCCGGAAAAACTACACAGCCTCAAGAACAATCCTTACGCCGATCATATCGAGAATCAAGAGAATCAAACGCTCTACACTATTCATCAAATTCTCGAATCGTGGATTTACGCTTCCCTGAATCTACTAAACCGGATCGAATCGAGAATCGAGGAGGGAAAATTCGAAAAAGCTTCTTCCGACGTGTACTTGCTAGAGACGACATGGAAGCTTCTAACGGAGATAGAAGATCTACACATTCTCATGGATCCAGAAGATTTCCTCAAGGTGAAAAAACAGTTACAGATCAAGTCGACGTCACAAAACGACGCGTTTTGTTTCAGATCCAAGGGGCTAGTGGAGATGGCGAAGATGTCGAAAGAGCTAAGACGGAAAGTGCCAGCTGTCCTCGAGGTGGAGGTGGACCCCACCGGAGGTCCGAGGTTGCAGGAGGCGGCGATGAAGCTCTACTCGAGGAAGACGGAGTACGAGAAGATACATTTGCTGCAGGGGATGCAGGCGGTGGAATCGGCGGCCAAGAGATTTTTCTTCGGGTACCAGAAGCTGGTGGCGGCGATGATGGGGAGTGCGGAGGCGAACGCGAATAGAACGGCGGCGGGTCATCACGAGTCGTGTGACTCGTTGACTCAGGTGTTTATGGAGCCAACGTATTACCCGAGCCTAGACGCTGCAAAAACTTTTCTGGGAGACTTCTGGAGCCATTTGGGATGCAATGGAAGACACTGA >Ca_10320.g ATGGTTGATTTACATTGGAAATTAAACATGCCCAATTCCGACATGCCTTCCAAAGCTCCAAAACTTTCTCACTCCGAGAAATCTTCACCACGCACCTGCCTACCCTCTTTGCCACTACCTTCAATCACCAACGACATATCCGCGGCGGCGCCACCACTTTGTTTAGCTTACGACCACTATCTCCGCCTCCCGGAGCTCCGTAAGCTTTGGAATTCAAGAGAATTCCCTAACTGGAACAACGAATCAATCCTAAAACCAGCTTTACATGCACTCGAAATCACGTTCCGTTTCCTCTCTACGGTTCTCTCCGACCCCAGACCCTATGCTAACCACAGAGAATGGAACCGCATAATAGAGTCCATTGCCACGCGACAAATTGAAATAATCGCTATGCTATGCGAAGACGAGGAAAATAACCCCGAAACACGTGGCACAACACCAACCGCTTATCTCAGCAGCGGCAATAGCAATATCAGAAGCTACAGCGAAACTAGTCTTTTACCACGACTTGCCACGTGGTACAAATCAAAAGACGTAGCGCAGAGGATCCTTCTCTCTGTAGAGTGCCAAATGATGAGGTGTACCTACACGCTAGGTTTGGGAGAACCGAACCTCGCGGGAAAACCGACCCTCCGATACGACGACGTTTGCAAACCGAACGAAATCCACGCACTTAAAACGACGCCGTACGACGACCGAATCGAGAACTACGAAAATCACGCGGTTCACGCGACGCACCAGATCGTGGAGTCATGGATTCACGCGTCGCGGAAGCTTCTAGAAAGAATCGGCGAATCGATAAACGGAAGAAGGTTTGAGAAGGCGGCGGAGGATTGTTACACGGTGGAGAGGATCTGGAAGCTTCTAACGGAGGTTGAGGATGTTCATCTGATGATGGATCCAGGCGACTTCTTGAAACTGAAGAATCAATTATCGATGAAATCTTCTTGTTACGAAACGGCGTCGTTTTGTATGCGGTCAAAGGAGTTAGTTGAAGTGACGAAGATGTGTAGGGATTTGAGGCATAGAGTGCCGGAGATATTGGATGTTGAAGTGGATCCTAAAGGTGGGCCCAGGATACAAGAAGCGGCAATGAAACTTTATGTAATGGAGAAGATAAGTGGTTTCGAGAAGGTTCATTTGTTGCAGGCTATGCAGGGTATTGAGGTTGCGATGAAGAGATTCTTCTATGCGTATAAGCAGGTGTTGGCGGTGGTGATGGGGAGTTCTGAAGCTAATGGAAACCGAGTTGGGTTGAGTTGTGATGGCGGTGACTCGTTGACTCATATGTTTCTTGAACCTACCTATTTTCCAAGTTTGGATGCTGCGAAGACGTTTCTTGGATACTTTTGGGATAATGATAATAAATGGGTGTGA >Ca_12499.g ATGCTAAACTCAAAAAATATATCTCCCAAATCACCCAAACTCTCTTTACCCTTTCCCACTTTAAAGCTTCCACTTCCACTTTTACCAAACGACATCTCTACAGCGTCGTCCACACTTTGCACCTTATACGACAACTACCTCCGCCTCCCTCACCTCAAAACCCTTTGGGCCTCCAACAACTTCCCTAATTGGGCCAACGAGCCCATCATAAAACCCGCTTTACACGCTCTCGAAATCACTTTCCGATTAATCTCAACCGTTTCATCAGACCCAAGACCCTACGTCAACAAACGCGAATGGGCCCGACGGGCCGAATCACTCGCCAAAGCCCAAATCCAACTCATCTCCATACTCTGCGAAGACGAAGAACATAACCCAAACTCACGTGGCAATGCTCCTGTGACTGACGTCAGCAATATAAGCCAAATCAGAAGCTATAGCGAACAAAGCTTGCTCCCAAAACTCGCCACGTGGCAGAAATCAAAGGATATAGCACAGAGAATCCTTTCCACCGTGGAATACGAAATGATGAGGTGTCCTTACACGTTAGGTTTAGGAGAACCGAATTTTAACGGAAAGAAAATTCTCCGTTACGACGACGTTTGCAAACCGAATTTGTTACACTCGCTAGAAACAACGCCGTTCGATCACGTCGGGAACTACGAAAACAGAACGCTACACGCGACGCACCAGATTATGGAATCGTGGACACGCGCCGCGCGCGTGTTGATGGATCGAGTGAACGAAGCGATTGACGGTAAAAGATTCGAGAAAGCCGCGAGTGAATTACACGCGGTGGAGAAGATCTGGAAGGTTCTAATAGAGATCGAAGATATGCATTTGATGATGGATCCGGAGGATTTTCTGAAACTGAAGAAACAATTAGGGATTCGAAAATGGAACGAAACGGTGCCGTTTTGTTTCCGTTCGAAGGAGTTGGTGGAGATAATGAAGATGAGGAAGGTGCCGGAGATATTGGAAGTGGAGGTGGACCCCACAGGTGGGCCCGGAGTGATGGAAGAAGCGATGAAGGTTTATTTGGAGAAGAAGAGTGAGAAGGTTCATGTGTTGCAAGCGATGCAGGGGATTGAGTTGGTGATGAAGAGATTTTTCTTTGCGTATAAACAGGTTGTGACGGTTATGATGGGAACTACTGAGTCAAATTCGGAATCGTTGAGTCAGATATTTTTTGAACCTACTTCTTTTCCTAGCTTGGATGCTGCTAAGACTTTTCTTGGCTATTATTTGGAAAATTATGAAAATACAATTCATTGGTAA >Peaxi162Scf01313g00013 ATGGTTGATTACGACAGGAAAACAACAAAGATGATATCCTCAGACATGCCTAGCAAATCGCCAAGGATTTCAAATAAGCTTCAAGTTTCAATACCAGCGCCACCTATTCGGGTAACGGAGCTGTCGACGGCGTCTGATTCAGCTTGTTCAGCTTATGAACACTATCTTCGGCTTCCTGAGCTGAAGAAGCTATTGGGTTCTGTAGAATTCTCGAGTTGGAAGAATGAGTCGTTGCTTAAACCGGCTTTGATAGGCTTGGAAACAACATTCCGGTTCGTTTCTATTGTGTTGTCTGATCCTAGACCGTATGCGAACCGGAGAGAATGGAAGCGAAGGCTTGAATCATTGGCGAGGAGTCAGATTGAAATCATAGCCCTGTTGTGTGAAGATGAAGAAGATGAGCCAGAGACACGTGGCACAGCCCCAGTCGGTGATCTAACATCATCGACTACTGTTTTGTCTCGTCAGAGTAGTTCCGCTGAGGTGTGGAAGCTTTCTGACGAGACGACAGTAGTCAGCCAGACGAGCGAGGCAAGCTTGTTGCCTAGACTCGAGGCTTGGCAAAAATCTGAAGATATTGCGCAGTCGATACTTTATTGTATCGAGTGCGCAATGAGGAGGTGTCCATATACCCTCGGCTTAGGCGAGCCAAATTTGAGCGGCAAGCCCAGCCTTGACTACGATAAAGTAGTCAAGCCAGCTGAGCTTCATGCTCTAAAGAAAAGCCCATCCGATCGCATGAATTTGGGAAATTTCGAAAACCAAACGCTATACACGACGCATCAGATTCTTGAAATATGGATCTACGCGTCAAAAATGCTTCTCACAAGAATTTCCGAGAGAATTGACCGGAAAGACTTTGATAAAGCAATTAACGACTGCTGGTTATTGGAGAAAACGTGGAAACTGTTGAGCGAAATCGAAGATCTTCACTTGCTAATGGATCCTGATGACTTTTTGCGCCTAAAAAACCAACTATCCATCAAAGCAACTGCTGAATCAGAGCTATTCTGCTTCCGGTCCAAAGGACTTGTAGAAATTACCAAACTGTCTAAAGATTTAAAGCACAAAGTTCCCAAGATTCTAGATGTCGAGGTGGATCCTCAGGGCGGGCCGAGAATCCAAGAAGCAGCCATGGAATTGTTCAGGAAAAAGGAAGGGTTTGAGAAAATTCACTTGCTTCAAGCATTACAAGCAATTGAAATGGTAGTGAAGAAGTTTTACTATTCGTATAAGCAGTTGTTAGTAATTGTTATGGGAAGTTTAGAAGCAAAAGGGAACACAACAATTATGGCCGTTGATTCAAGTGATGCATTGGCTCAGATCTTCCTTGAGCCAACATATTATCCGAGTTTGGATGCTGCAAAGACATTTCTTGGAGAATATTGGAGTCATGAACATGGGAAGTATAGTCCAGAGAGAAGAAGCAAGGACTAA >HBR0141G006 ATGCTTGATCTAGATTGGAAAGCTAAGATGGTCTCTTCTGATCTCCCAAACAAGTCCCCTAAACTCTCTAACAAGCTTAATGTTATGATCCCTTCAACGACGCCGTTTCGTGGGGTTACCAATATCTCGCCGGTTTCTGCTTCCGACTCTTCTTGTACGGCTTACGAGCACTACCTTCGGTTACCTGAGTTGAGGAAATTGTGGACTTGTAAGGAGTTTCCCGATTGGAAAAACGAGTCCATTTTTAAACCGGCTTTACAGGCTATAGAGATCACGTTTCGGCTCATTTCTACGGTTTTATTGGACCCGAGACCGTACGCGAACCGTAGAGAATGGAAACGGAGGATCGAGTCGCTTGCTACTGCGCAGATCGAGCTTATTGCTATTCTGTGTGAAGACGACGAAGATGGAGACACACGTGGCAAAGCGCCGGTTGTTGATATGTGCTCATCTAAAGGCATTTTGGGTCGGGATGGGAGCTGCACTGAGGTATGGAAGGTGTCACCTGAAACCACTGTGGTCAACAAGACCAGCGAGGCCAGCCTCCTCCCTCTCCTCGCCACGTGGCAGAAATCTGAGGACATGGCGCAGAAAATCTTCTATTCCATCGAATGCGAGATGAGGCGGTGTCCGTACACTCTAGGTATCGGAGAGCCGAACCTCGCCGGCAAACCTAACCTCGACTACGACGCCGTTTGCAAGCCAAGCGACGTTCACAGTCTGAAGAAGAATCCGTACGATCACATAGAGAACCACGAGAACCAAACGCTGTACACCACAAACCAGATTCTGGAGTCATGGATCCAAGTAGCTAAACAGCTTGTTAAACGCGTAATTGAAAGAATTGAAAGCAAGAAATTCGATAAGGCGTCAGGCGATTGCTATTTGCTCGAGAGAATTTGGAAGCTTCTATCCGAAATAGAAGATTTGCATCTGTTAATGGATCCAGACGATTTCTTGAAGCTCAAAAACCAGTTGCTCATGCGATCGCTGGACGAATCGGAGGCGTTCTGTTTCCGATCGAGAGCGCTGGTGGAGATAACGAAATCGTGCAAGGAATTGAAGCACAAGGTTCCGGAGATTCTAGGCGTGGAGGTGGACCCCAAGGGTGGGCCGAGAATCCAGGAGGCGGCGATGAGACTGTACAAAGAGAAGAGGGATTTCGAGAAGATTAGTTTACTTCAAGGGTTGCAGGCGACAGAGGCAGCGTTGAAGAGGTTTTTCTATGGGTATAAGCAGTTGCTGGCTGTGGTTATGGGGAGCTTGGAAGCTAAAGGGAATCGGGTTTTGGTGAGTCCGGACACTTGCGACTCGCTGACTCAGCTGTTCCTGGAACCGACTTATTTCCCGAGTTTGGATGCGGCCAAGACGTTTCTGGGCGAGTTTTGGAGTCATGAACACAGTGCGTTGGAGAAACGGAATCGAAGAAAGTACTCAAAGAAGTAG >HBR0839G062 ATGGTTGATTTAGATTGGAAAGCTAAGATGGTGTCCTCTGATCTCCCGAACAAATCCCCTAAACTCTCTAACAAGCTTCATGTCATGATCCCTTCCACGACGCCGTTTCGTGGGATCACCAATGTCTCGCCGGTATCTGCTTCTGACTCTTCTTGTTCGGCTTACGAGCACTATCTTCGCCTACCTGAGTTGAGGAAGTTGTGGACTTTTAAAAAGTTTCCCGATTGGAAAAACGAGTCGATTTTGAAACCGGCTTTGCAGGCTCTAGAGATCATGTTTCGGCTCGTTTCCACCGTTTTATCGGACCCGAGACCCTACGCTAACCGGAGAGAATGGAAACGGAGGCTCGAGTCACTTGCTACTTCTCAGATCGAGCTGATAGCTATCCTGTGTGAAGAAGAGGAAGAAGATGGAGACACACGTGGGACGGCACCGATCCTTGATTTACGCTCATCTAACGGCATTTTGGCTCGGGATGGGAGTTACGCTGAGGTATGGAAGGTCTCATCTGAAACCACCGTGGTCAACAGGACCAGCGAGGCCAGCCTTCTCCCTCTACTCGCCACGTGGCAGAAGTCCGAGGACATCGCACAGAAAATCCTTTACTCCATCGAATGCGAGATGAGGCAGTGTCCATACACTCTAGGTCTCGGAGAGCCGAACCTCGCCGGAAAACCTAACCTCGATTACGACGCCGTTTGCAAGCCAAGTGACGTTCATAGTCTCAAAAAGAATCCATACGATCATATAGACAACCACGAGAACCAAACGCTGTACACCACACACCAGATTCTAGAGTCATGGATTCAAGTAGCTAAAGAGCTCATTAAACGCGTAATTGAAAGAATCGAAAGCCAGAAATTCGACAAGGCATCAAGCGATTGCTATTTGCTCGAGAGAATTTGGAAGCTTCTATCCGAAATAGAAGATTTGCATCTGTTAATGGATCCAGACGATTTCTTAAGGCTCAAAAACCAGTTGCTCATGCGATCTCGGGATGAAACAGAGGAGTTCTGCTTCCGATCCAGAGCGCTGGTGGAAATAACGAAAGCATGCAGGGACTTGAAGCACAAGGTTCCGGAGATTCTAGGCGTAGAGGTGGACCCCAAGGGTGGACCCAGGATACAGGAGGCGGCGATGAGATTGTACAGCGAGAAGAGGGAATTTGATCAGATCAGTTTACTTCAGGGGTTGCAGGCGACGGAGGCTGCGTTGAAGAGGTTTTACTATGGATATAAGCAGCTGCTGGTGGTGGTTATCGGCAGCTTGGAGGCTAAAGGAAACCGGGTTTTGGCGAGTCCTGAAACTTGCGACTCACTGAGTCAGCTGTTCCTGGAGCCGACTTATTTCCCGAGTTTGGATGCAGCCAAGACGTTTTTGGGCGAGTTTTGGAGTCATGAACAGAGTGGGTTGGAGAAACGAAATCCAAGAAAATAG >Potri.010G191300 ATGGTTGATTTAGATTGGAAAGCAAAGATGGTATCCTCTGATCTCCCAAACAAATCCCCAAAACTCTCCAACAAACTCCAAATCTCAATCCCAGCCATTCCGTTTCGTGGCGTCTCGAATATCACTCCGACTCCTGCTTCCGACTCCTCTTGTTCAGCTTACGAGCACTGCTTCCGCCTCGCAGAGCTACATCAGATATGGAACCGCAAAGAATTTCCTAATTGGAAAACAGAGTCTATTCTAAAGCCAGCCTTGCAAGCTCTAGAAATCACTTTCCGGTTCATTTCAACGGTTTTATCAGATGCAAGACCATACGCGAATCGGAGAGAATTGACTCGGAGGATCGAGTCACTCACCACCTCTCAGATTGAGTTAATCGCGATCATCATCGAAGACGAGGCAGAAGGTAGCACAACGCGTGGTACGGCTCCGATCGTTGACTTGAGCTCATCGAACAGTGTTCTGGCTAGAGATGGAAGCTATGCGGAGGTCTGGAAGGTTCCAGGTGAAACTACAGTGGTCAGTAAAACCAGCGAGGCAAGTCTGCTGCCTAGGCTCGCAACGTGGCAGACATCAGAAGATGTAGCTCAGAAAATCTTGTACTCTATCGAGTGCGAGATGAGACGGTGCCCGTACACACTAGGTCTCGGCGAGCCAAACCTAACCGGCAAGCCAAACCTTGAATACGACGCTGTTTGCAGGCCGAACGAAATCCACGCCCTCAAAAAGAGTCCTTACGATCACACAAACAACCAGGAAAACCAATCATTGTATACCACGCATCAAATCTTAGAGTCATGGATCCACGTGGCAAAACAAATAATCCAGCGCGTAACTGAAAGAATCGAAAGCAAAGAATTTTCAAGAGCAGCAAACGATTGTTATCTAGTCGAGAGAATCTGGAAACTTCTAGCAGAAATTGAAGACTTGCATCTACTGATGGATCCAGATGATTTCCTGAGGCTAAAAAATCAGTTACAAATGCGATCGCTAGACGAAACGGCTCCGTTTTGTTTCAGATCGAGAGAATTGGTGGAGATAACCAAATCGTGCAAGGAATTGAAGCATAAGGTACCGGAGATTTTAGGCGTTGAAGTGGACCCAAAAGGTGGGCCCAGGATACAAGAAGCGGCCATGAGGTTGTACAGTGAAAAAAGGGAGTTTGAGAAGGTTTACTTGCTTCAGGCTTTACAGGCAATTGAGGGTGCTTTGAAGCGGTTCTTTTATGCGTATAAACAGGTGTTGGTTGTTGTTATGGGGAGTTTGGAGGCCAAAGGGAATGGCGTTTTGGTGAGTTCCGAGAGTTGTGACTCGTTGACTCAGTTGTTCCTTGAACCCACTTATTTTCCGAGTTTGGATGCTGCTAAGACTTTTTTAGGAGAGTCGTGGAGTCATCGACAGCATACTGCGATGGAGAGACGGAGTCGGAGGAAGCAGTGA >Potri.008G066000 ATGATAGATTTAGATTGGAAAGCAAAAATGGTATCCTCCGATCCCCCGAACAAACCCCCCAGACTCTCTAGCAAGCTACATGTCTCCATCCCGGCTATACAGTTTCGTGGCATCTCAAATACCTACCCGATTCCCGCTTCCGACTCTGTTTGTTCAGCTTACGATTACTATCTCCGCCTCCCAGAGCTACGAAAGCTATGGAACCGAAAAGAGTTCTCGAATTGGAAAACAGAGTCTATACTAAAACCAGCTTTACAAGCTCTAGAAATCACTTTCCGCTTCGTTTCGACGGTTTTATCCGACAAAAGACCGTACGCGAACCGGAGAGAATGGACACGGAGGATCGAGTCACTCACCACCTCTCAGATCGAGTTAATCGCGTCCATCATCGAAGATGAGGCAGAAGATAGCACAACGCGTGGCACGGCTCCAATCGCGGACTTGAGCTCAACGGAAGGTGCAAGCCTGCTCCCTAGGCTCGCCACGTGGCAGACATCTGAAGACGTAGCACAGAAAATCCTGTACTCCATAGAGTGCGAGATGAGACGGTGCCCATACACACTAGGACTCGGCGAGCCAAACCTGAACGGAAAACCAACCCTGGAATACGACACTGTTTGCAGGCCGAACGAAATCCACGCCCTCAAAAAGAGTCCGTACGATCACATCAAGAACCAGGAAAACCAATCGGTGTACACCACGCATCAAATCCTAGAGTCATGGATACATGTGGCAAAACAAATTATCCAGCGCGTAACAGAAAGAATTGGAAGCAAAGAATTTTCAAAAGCATCAAATGACTGCTATTTAATCGAGAGAATCTGGAAACTTCTAGCAGAAATTGAAGACTTGCATCTACTAATGGATCCAGATGATTTTTTGAGACTTAAAAATCAGTTACAGATGCGATCATTAGACGAAAACTCTCCGTATTGTTTTAGATCGAGGGAGTTGGTGGAGATAACGAAATCGTGCAAGGAACTGAAGCACAAGGTGCCGGAAGTTTTGGGTGTTGAAGTGGACCCAAAAGGTGGGCCCAGGATACAAGAAGCAGCCATGAGGTTGTACAGTGAAAAAAAGGAGTTTCAGAAGGTTTATTTGCTTCAGGCTTTGCAGGCAATTGAGGGTGCTCTAAAGAGGTTCTTTTATGCGTATCAACAGGTGCTAGTTGTTGCTATAGGGAGTTTGGAGGCCAAAGGGAATGGGGTTTTGGTGAGTTCAGAGAGTTGTGACTCGTTGACTCAGTTGTTCCTTGAACCTACTTATTTTCCTAGTTTGGATGCTGCTAAGACTTTTCTGGGAGAGTCTTGGAGTCATGAACAACCTAATAGGGTGGAGAGACGGAGTCGGAGGATGCAGTGA >Araip.0D8F4 ATGGTTGATTTAGAGTGGAAATCAAAGATGGCAAGGTCCAACATCAACATGCACCATCCCAAGTCCCCAAAACTCACCGTTTCAGACAAATCCGTACTTCAACCAAACTTACCCGCTTTGCAGCTACATCTTACACCAAACGACTTCAAAACAGCGTCGTTTTCCCTTTGTGAAGCTTACGACAACTACCTCAGCCTCCCTCAGCTACGAACACTCTGGGCCTCAAACAACTTCCCCAACTGGGCCCACGAACCCATCATCAAGCCCGCTCTCCACGCCCTCGAGATCACCTTCCGATTCATCTCAACCGTTTTCTCAGACCCAAGGCCGTATGCCAACAAACGCGAGTGGGCCCGCAGGCTCGAGTCCCTCGCCAAGGCCCAGGTACAGCTCATCGCAACGCTCTTCGAGGACCAGGAAGAAAGCCCTGAGACACGTGGCGAAGTTCCGGTTAGTGACATCAGCAGTAGCGGTTACAGAAGCTACAGCGAGGCTAGCTTGCTTCCAAGGCTCGCCACGTGGCACAGATCCAGGGATGTGGCTCAGAGGATCCTCGCCACCGTGGAAGCCGAGATGACGAGGTGTCCATACACTTTAGGCTTGGGCGAACCAAACCTCGCCGGAAAACCGATCCTCCGTTACGACGCCATTTGCAGGCCAAACGAGCTTCATTCCCTTAAAACGACGCCGTTGGATCACCTGGATAACTTCGAGAACTTGAATCTCCGCGCGACGCACCAGATTGTGGAGTCCTGGTCACGCGCCGCGCGCGTGCTGCTCGAGAGTGTTGCGGAGTCGGTGGAAGGAAGAAGGTTCGAGAAGGCCGCAAGGGAGTGCTACGCAGTGGAGCGGATCTGGAAGCTTCTAACGGAGATCGAGGACCTTCACTTATTGATGGATCCAAACGATTTGATGAAGCTGAAGAAGCAGATCGAGATTCGGTGTTTCGGCGATACGGCGGCATTTTGCTTCCGGTCAAAGGAGCTAGTGGAGGTGACGAAGATGTGTAGGGAGATGAAGAGGATGGTGCCGGAGATATTGGAGGTGGAGGTTGATCCGAAGGGAGGGCCGGGGATAGTGGAGGCCGCGATGAGGGTTTATGCGGAAAAGAAGAAGGAGAGTGTGGTGGAGGTGTTGCAAGCGATGCAGGGAATAGAGGCGGCGATGAAGAGATTCTTCTTCGGTTACAAGCAGGTTGTGGCGGCGGTGATGGGGAGTGCGGAGGCTGGCGGGAACCGAGTTTACGGCGACTCGCTGAGTCAGATATTCCTGGAGCCAACGTATTTCCCGAGCCTCGATGCAGCAAAGACGTTCCTGGGGTACTATTGGGATAATCACGAAAATGCCCTTGCTTGA >Araip.TX94X ATGTGCAGTCTCTGTAATTGCTTCCGGTCGAAGGAGCTAGTGGAAGTGACGAAGATGTGTAGGGAGATGAAGAGGATGGTGCCGAAGATATTGGAGGTGGAGGTTGATCCGAAGGGAGGGCCAGGGATAGTGGAGGCCGCGATGAAGGTTTATGCGGAAAAGAAGGAGAGTGTGGTGGAGGTGTTGCAAGCGCAGGGAATAGAGGCGGCAATGAATATATTCATCTTCGGTTACAACCTCCCTCAGCTACGAACACTCTGGGCCTCAAACAACTTCCCCAACTGGGCCCACGAACCCATCATCAAGCCCGCTCTCCACGCCCTCGAGATCACCTTCCGATTCATCTCAACCGTTTTCTCAGACCCAAGGCCGTATGCCAACAAACGCGAGTGGGCCCGCAGGCTCGAGTCCCTCGCCAAGGCCCAGGTACAGCTCATCGCAACGCTCTTCGAGGACCAGGAAGAAAGCCCTGAGACACGTGGCGAAGTTCCGGTTAGTGACATCAGCAGTAGCGGTTACAGAAGCTACAGCGAGGCTAGCTTGCTTCCAAGGCTCGCCACGTGGCACAGATCCAGGGATGTGGCTCAGAGGATCCTCGCCACCGTGGAAGCCGAGATGACGAGGTGTCCATACACTTTAGGCTTGGGCGAACCAAACCTCGCCGGAAAACCGATCCTCCGTTACGACGCCATTTGCAGGCCAAACGAGCTTCATTCCCTTAAAACGACGCCGTTGGATCACCTGGATAACTTCGAGAACTTGAATCTCCGCGCGACGCACCAGATTGTGGAGTCCGTGCTGCTCGAGTGTTGCGAAGTCGGTGGAAGGAAGGGTTCGAGAAGGCCGCGAGGGAGTGCTACGCAGTGGAACGGATCTGGAAGCTTCTAA >Araip.Z9VMD ATGGATCCAAACGATTTGATGAAGCTGAAGAAGCAGATCGAGATTCGGTGTTTCGGCGATACGGCGGCATTTTGCTTCCGGTCAAAGGAGCTAGTGGAGGTGACGAAGATGTGTAGGGAGATGAAGAGGATGGTGCCGAAGATATTGGAGGTGGAGGTTGATCCGAAGGGAGGGCCAGGGATAGTGGAGGCCGCGATGAAGGTTTATGCGGAAAAGAAGGAGAGTGTGGTGGAGGTGTTGCAAGCGCAGGGAATAGAGGCGGCAATGAATATATTCATCTTCGGTTACAAGTAG >RCO.g.29669.000023 ATGGTCGATTTAAATTGGAATGCAAAAATGGTTTCCTCCGATCTCTCAAACAAGTCACCAAAGCTCTCTAACAAACTCCACGTCACCATCCCTTCCACCACACCGTTTCGCGGTGTTTCTAATATTTCCCCCGTTTCTGCTTCCGACTCCGCCTGCGCCGCCTACGACCACTACCTACGGCTTCCGGAGTTGCGAAAGTTATGGAATTCTAAAGATTTTCCTGACTGGGAAAACGAGTCGGTTTTAAAGCCGGCTTTACACGCTTTAGAAATCACTTTCCGGTTTGTTTCGACGGTTTTATCGGATCCGAGACAGTACACGAACCGTAAGGAATGGAAACGCAGAATCGAGTCTCTCGCTACTTCGCAAATTGAGATTATCTCTCTCCTCTGTGAAGACGAACAAGATGATGTAGAGATACGCGGGACGGCTCCGATCGTCGATTTAAGCTCATCGAACGGCGTTTTAGCTCGCGGCGGAAGCTACGCTGAGGTGTGGAAGGTCTCACCGGAAACCACCGTCGTCAACAGAACCAGCGAGAGCAGCCTCTTGCCTCGTCTTGCCACGTGGCAGAAATCTGAAGATATCGCGTTGAAAATTCTTTACTCGATTGAATGTGAAATGAGAAGGTGTCCGTACACATTGGGTGTTGGAGAACCAAATTTAAGTGGGAAGCCTAATCTCGATTACGACACCGTTTGTAAGCCCAACGATGTGCGTAACCTAAAGAAGTGTCCGTACGACAATTTAGAGAATCACGAGAATCAAACATTATACACGACGCATCAGATATTGGAGTGCTGGATTCAAGTAGCAAAGGAGTTGATCAATCGCGTGATTAAGAGAATCGAAAGCAAAGAACTTGATAAAGCGTCAAGCGACTGTTATACAATTGAAAGGATTTGGAAGGTTTTGACAGAAATTGAAGACTTGCATTTGTTAATGGATCCCGACGATTTCTTGAGGTTGAAGAAACAGCTGGTTATAAAATCAGATAATGAAACAGCACCATTTTGCTTTAGGTCAAAAGCACTAGTGGAGATGACGAGAATGTGCAAGGATTTGAAGCATAAGGTGCCTGAGATTTTAGGGGTGGAGGTGGACCCAAATGGAGGGCCGAGAATTCAGGAGGCGGCGATGAGATTGTACAGTGAAAAGAGAGAGAGTGAGGTTGAGAAGATACATTTGCTACAAGGGTTGCAGGCCATGGAGGCTGCATTGAAGAAGTTTTATTATGGGTATAAGCAGTTATTAGTGGTGGTTATGGGCAGTTTAGAGGCTAAAGGGAATAGGGTTTTGGTGAGTCCTGAAAGTTGTGACCCGTTGAGTCAGTTGTTTCTTGAGCCTACCTTTTTCCCTAGTTTGGATGCTGCCAAGACCTTTTTGGGTGACTTTTGGAGCCATGAACATGGCGGTTGCGGCGGTGGGGTGGAGAAACGGGATCGGAGGAAATAG >Ciclev10031447m.g ATGGTTGATCTAGATTGTAAAACGAAAATGCCTAGCAAGTCTCCAAAGCTTTCTAATAAACTTCAGGTTTCGATTCCGACGCCGTTCCGGGGAGCCACTAAATCGCCTGTTGCTTGTTCAGATGCGGCTTGTTCGGCTTACGAGCAGTATCTCCGTCTTCCGGAGCTGAGGAAGCTATGGAGCTCGAGGGACTTTCCCAACTGGGAAAACGAGGCCGTTTTGAAACCGGCTCTGCAAGCTTTGGAGATCACCTTCCGGTTCGTTTCGATCGTCCTCTCCGATCCAAGGCCGTACGCCAACCGGCGCGAGTTCAAGCGGCGGCTGGAGTCGCTGGCTACCAGTCAGATCCAGCTCATCGCGTCTCTATGCGAGGACGATGACCGCTCCGGCACGGCTCCGATCGTCGATTTGACGACGGAGAACGGCTTCTTGGCTCGCAATAGAAGCTCCGCTGAGGTGTGGAAGGTTCCAGGCGGGGAATCGACGTTGGTTAACAGAACAAGTGAATACAGCCTGCTGCCTCGTCTGGCCACGTGGCAGAAATCCGAGGACGCGGCGGATAAAATTATGTACATCATCGAGTGCGAGATGAGAGGGTGCCGGTACACTCTCGGCTTAGGCGAGCCAAACCTCGCCGGGAAACCAAACCTCGAATACGACGCCGTTTGCAAACCACACGAGCTCCACTCTCTGAAAAAGAACCCCTACGATCACCAAATAAACAATCACGAGAATCAGACTCTCTACACAGCACACCAAATCCTCGAATCGTGGATCTTCACAACGCAGCAGCTCCTAAAACGCATCGTTTCCAGGATAGAGAGTAAGCAATTCGAAGAAGCGTCAAACGACTGCTATCTACTCGAAAGAATCTGGAAACTTCTGTCGGAGATCGAAGACCTCCACCTGTTGATGGATCCGGACGATTTCTTGAGGCTGAAGAATCAGCTATCGATATCCTCGTCATCCGAATCCGGCCCGTTTTGTTTTAGATCACGTGGGCTGTTTGAAATTACGAAACAGTCCAAGGAATTAAAACACAATGTACCGTTAATACTAGGAGTGGAGGTGGACCCGAGGGGTGGGCCCAGGGTGCAGGAGGCGGCGATGAGAATGTACAACGAGAAGAAAGAAAGAGACTTCGCGAAGATTCATCTGGTTCAGGCACTGCAAGCGGTGGAGGCCGCGTTGAAGCGGTTCTTTTACGCGTATAAGCAGTTGCTGGCGGTGGTGATGGGGAGCTTAGAGGCGAAGGCCAACGGAGTTGTGGTGGTCAGTGGGGCATCGAGTGACTCGCTGAGTCAGTTATTTCTTGAGCCGACTTATTATCCGAGTTTGGATGCTGCCAAGACTTTCTTGGGAGAGTTTTGGAGTCATGAAATTGAAAAGAAACATTAA >Bv2_024040_gkaf ATGGTTCAATCAACACCAAATCTCACAAAAAAAACCCCAAAACGCATCACTTCAACGCCGGTAATTTCACCGGTACCGGTAATCGCCGGTGAATTATCACCGGCATCGGAATCTTCATGTTTAGCATACGAATCATATCTCCGGTTACCGGAGCTCCGAGAATTATGGAGTTCAAAAGAATTTCCAGGGTGGAAAAACGAGTCAATAATTAAACCGGCTTTACAAGCTTTAGAAATAACTTTCCGGTTTATTTCAATTATTTTATCCGACGCTAGACCGTACGTGAACCGGCGTGAATGGAATCGTCGATTGGAGTCATTAACTCGAGATCAGGTCGAGTTAATCTCGATATTGTGCGAAGATGATGAAACATCTGGTTCTGCTCCAATAATGGATCTGACGTCATCTTTCGGTGAAGTGATGTCACAAACTGGAAGTTTTACAACAGAAGTATGGAAACATGAAACTACTTCGGTAGTATGTCGTAGTAGTGAATTTAGTCTACTTCCTCGACTTGCCACGTGGCATAAATCAGATGAGATTTCTTCTAGAATATTCTACGCGGTTGAGAGCGCTATGAAGAGATGTCCATATAGTTTGGGCTTAGGTGAGCCCAATTTAGATGGAAAGCCCAATTTGGATTACGACGTCGTTTGTCGTCCTACTGAAATCCACGCGCTTAAAAAAGGCACGTTGGATTATATTCAAAATCCAGAGAATCAGATTTTATTCACAATTCATCAGATTTTCGAGTCGTGGGTTTTTTGCGCGAAACAATTGTTGATTCGTGTAGGAGAGAGAATCAACAAAGAAGAATTCAACAAAGTTGCAGATGATTGTTGGGTTTTAACAAGAATCTGGAACATTCTAGAAGAAATCGAGAATTTACATTTATTAATGGATCCAGATGATTTTCTACATTTGAAAACTCAATTACGGATGAAAACGACGTCGGATTCTGAAACATTTTGTTTCAGATCAAGAGGTTTAATTGAAATTACAAAATTAAGTAAAGATTTACGTCACAAAGTTCCAGAAATTCTAGCCGTTGAAGTGGACCCCATGGGTGGACCAGTAATACAAGAATCAGCAATGGAGTTATATAGAGAGAAGAGAAAGTTCGAGAAGATTCATGTTTTGCAAGCATTTCAAGGTGTTGAATCTGCTGTGAAAGGTTTTTTTTATAATTATAAACAATTGTTGGTGATTATGATGGGAAGTTTAGAAGCTAAGGCTAATTTTGCTGTAATTGGTGGTGGTTCTGAATCGTCTGATTTATTGGCTCAGATCTTTCTAGAACCTACTTATTATCCTAGCTTAGATGGTGCCAAGACTTTTATTGGTGATTTTTGGGATCATGATCACACGGTTGTGAGTGGGTGTGATAGGAAAAATCGGGTTGCGAAAAATTGA >MDO.mRNA.g.3157.13 ATGTCCTGCTCCACCTACGAGCAGTACCTCCGCCTCCCGGAGCTCCGACAGCTCTGGAGCTCCCACGACTTCCCCTCTTGGAAGAACGAGTCGATTCTCAAACCGGCTCTCCAAGCTCTCGAAATCACGTTCCGCCGAACCTCGCCGGGAAAACCGAACCTGGATTACGACGCCGTTTGCAAGCCGAGCGAGCTGCATACGCTGAGGAAGAGCCCGTACGACCCCCACGTCGACAGCTACGAGAACCAGACGGTGTACGCCACGCACCAGGTCCTCGAGTCGTGGGTCCACGTTTGCCGGGAGCTTCTCAAGCGCGTAACGAGCCGCATCGAATCTCGAGACTTCGAAAAGGCTGCGAGCGACTGTTACGTGATCGAACGGATGGAAGCTCCTGGCGGAGATAGAGGATCTCCACCTTCTGATGGACCCGGCCGATTTTTTGAGGCTGAAGAATCAGCTGCAGATCAAGACGGTGGACGATACGGAGTCGTTTTGCTTCAGATCGAAGGCGCTCGTGGAGGAGGCGGCGATGAGGCTGTACTCGGAGAAGAAGGCCGGTTCGGACTCCGACTCCGGCTCGGAGAAGATCCACGTGCTGCAGGCGCTTCAGGCGATGGAGTCGGCGCTGAAGCGTTTCTACTACGCGTACAAGCAGGTGCTGGTGGTGTTGATGGGGGCTTGGAGGCGAAGGGGAACCGAGTTGTGGTGAGTCCGGAGACCTGTGACTCGCTGAGGATATTTCTGGAGCCGACTTATTTCCCGAGCTTGGACGCGGCGAAGACGTTTTTGGGGGATAGTATAAATCACGATATACACAGCGGAGAGGCGGAGTCGGCGGATGCAGTGAGCGATTGA >MDO.mRNA.g.345.58 ATGTCCTGCTCCACCTACGAGCACTACCTCCGCCTCCCGGAGCTCCGAGAGTTCTGGAGCTCCCACGACTTTCCATCGTGGAAAAACGAGTCGATTCTCAAGCCGGCTCTCCAAGCTCTCGAAATCTCGTTCCGCTTGCTACCTCGGCTCGCCACGTGGCAGAAATCGGAAGGGATGGCGCAGAAGATACTGTACTCGATCGAGTGCGAGATGAGTAACTGTCCGTACTCGTTGGGCCTGGGGGAGCCGAACCTCGCCGGGAAGCCGAACCTGGATTACGACGCCGTATGCAAGCCGAGCGAGCTGCATTCCCTGAGGAAGAGCCCGTACGACGCCCATGTCGACAACTACGAGAACCAGACGGTGTACGCCACGCACCAGGTCCTCGAGTCGTGGGTCCACGTTTGCCGGGAGCTTCTCATGCGCGTGGTAAGCCGCATCGAATCTCGAGACTTGGAAAAGGCCGCGAGCGACTGTTACGTGATCGAACGGATATGGAAGCTCCTCGCGGAGATAGAGGATCTTCACCTTCTGATGGACCCGGCCGATTTTCTGAGGCTGAAGAACCAGCTGCGGATCAAGACAGTGGACGATACGGAGTCGTTTTGCTTCAGATCGAAGGCGCTCGTGGAGGAGGCGGCGATGAGGCTGTACTCGGAGAAGAAAGCCGAGTCAGACTCGGAATCCGTCTCGGAGAAGATCCACTTGCTGCAGGCGCTTCAGGCGATTGAGTCGGCTTTGAAGCGATTCTACTACGCGTACAAGCAGGTGCTGGTGGTGTTGATGGGGAGCTTGGAGGCGAAGGGGAACCAAGTCGTGGTGAGTCCGGAGGCGTGTGACTCGCTGAGTCGGATATTTCTGGAGCCGACTTATTTTCCGAGCTTGGACGCGGCGAAGACGTTTTTGGGGATAGTTTGA >Bo3g034610 ATGGTTGATATGGATTGGAAGAGGAAGATGGTGTCATCGGAGCTTTCTTCCAAGCTCCACGTCACTATTCCGTCTCCGTTCAAGGTCCCCGTATCCTCTCCCATCTCATGCTCCGCTCCGGCAGCTTGCTCCGCCTACGAGCTTTACCTCCGCCTCCCTGAGCTGAAAAAGCTCTGGTCGTCTCGTGAGTTTCCGCAATGGAACGATGAGCCGATTCTCAAACCGGCTCTCCAAGCCTTGGAGATCACTTTCAGATTGATCCTATCCGTTTGCTCCGATACAAGACCTTATACAAACCACCGCGAATGGAACCGACGGTTGGATTCTCTCGTCACGAATCAGATCCAGCTTATAGCAACGATCTGCGAAGAGGATGAAGAAGGCGATCGATCAGCTCCACTCGGCGATAAACGGAGCTCGCTCAGCTTGCTACCTCACCTAGCCACGTGGCGCAAATCGGAAGCGTTAGGGAGGAAGATCTTGTGCACGATCGATAACGAGATGCGTCGGTGCAAGTACACGCTCGGACTCGGAGAACAGAACATCGCCGGGAAACCGAATCTCCGGTACGACGCCGTTTGCAAACCTAACGAAGTTTACAGCCTCAAGGATAATCCGTACGCGGATCACATCGAGAACGAAGAGAATCAGACTCTCTACGTCCTCCACCAGATCCTCGAGTCGTGGATCCACGCTTCGGGAAACCTCTTGAGACGTATCAACACGAGGATCAGCGAAGGGAGATTCGGAGACGCGGCGAGCGATGTGTACTTGGTGGAGAGGATCTGGAAGCTTATGGCGGAGATCGAAGATCTCCACGTTCTAATGGATCCTGAGGATTTTCTGAAGCTGAAGAAACAGTTACAGATCAAATCCAACGGTCAAAACGATGCGTTTTGTTTTAGGTCTAGAGGACTAGTGGAAATGATGAAGATGACGAAGGATCTAAGGGAGAAGGTGCCGGCGGTGCTGGGTGTTGAGGTTGATCCCACCGGCGGTCCGAGGCTGCAGGACGCGGTGATGAGGTTGTACGCTACGAAGGGAGATTGTGATAAGATTCATCTGCTTCAAGGGATGCAAGCGGTGGAGGCGGCGGCGAAGAGATTTTTCTTTGCGTATAAGCAGTTGGTGGCGGTGGTGATGGGAAGCGCGGAGACGAGTCAAGAGTCGCGTGACTCGCTGAGTCAGATATATATGGAGCCGACGTATTTCCCGAGTCTTGACGCGGCGAAGACGTTTCTGGGAGAGTTCTGGAGTCACTTGGGATGA >Bo4g025670 ATGGTTGATACAGATTGCAAGAGGAAGATGGTGTCACCGGACTTACCTAGCAAGCTCCACGTCACCATCCCCTCGCCGTTCAAGCTCCCCGTCTCATCCCCAATCTCCTGCTCCGCTCCTTCCTCTTGCTCCGCCTACGAGCTCTACCTCCGTCTCCCCGAGCTCAGAAACCTCTGGTCATCACGTGACTTCCCTCACTGGACGCACGAGCCTATCCTCAAACCGTCTATCCAAGCTCTGGAGATCACTTTCAGATTGGTCTTAGCCGTTTGCTCCGACGCGAGACCGTACATCAACCACCGCGAGTGGAACCGACGGTTGGATTCTATCCTCACGAGTCAGATCAAACTCATAGCATCCATCTGCGAAGAGGAAGAAGATGAATCAGCTCCTGTCGGAGATAAACGAAGCTCTCTCAGCTTGCTACCACAGCTAGCCACGTGGCGTAAGTCGGAAGCCTTTGGGAAGAAGATCTTGTCCACGATCGATAACGAGATGAGGTTCTCTAAGTACACGCTCGGTCTCGGAGAACAGAACATCTCCGGGAAACCTAGTCTCCAATACGACGCCGTTTGCAGACCGAACGAGTTATACATCCTCAAGAATAATCCTTACGCTGATCATATCGATAACAACGAGAACGAAACGTTATACATCATTCACCAGATCATAGAATCATGGCTCCACGTTTCCATAAACCTATTGAAACGCATCAACACGCGTGTTGACGAAGGGAGGTTCGGAGAAGCGTCGGGAGACGTCTACTTGGTCGAGAGTATATGGAAGCTTCTCACCGAGGTTGAAGATCTCCACCTCCTGATGGACCCCGAGGACTTCCTCAAGTTAAAGAAGCAGTTGCATATCAAGACGGCCGGTAAAAACGACGCGTTTTGTTTCAGGTCGAGAGGTTTGGTGGAGGTGATGAAGATGTCTAAAGGTTTGAGGGAGAAGGTGCCGTTTGTGGTGGGCGTTGAGGTGGATCCCACGGGAGGACCGAGGCTGCAAGAGGCGGCGATGAGGCTTTACGCGAGAAAGGGAGAGGAGTGTGATAAGATTCATTTGCTTCAAGGGATGCAAGGTGTGGAAGCTGCGGCGAAGAGGTTCTTTTTCGCGTATAAGCAGGTGGTTGCGGCGGTGATGGGGAGCGCGGAGATGAACACGGAGTGTGACTCGGTGAGTCAGATATTCATGGAGCCGACTTATTTCCCGAGTCTTGACGCGGCGAAGACGTTCTTGGGAGAGTTCTGGAGCCACGTTGGGTGA >Bo4g188730 ATGGTTGATACAGATTGGAAGAGTAAGATGATGTCATCAGAATCACCTAAGCTTTCTTCAAAGCTCCACGTCACTATCCCTTCGCCGTTCAAAGTCGTCGCCGTCTCGTCTCCCATCTCATGCTCCGCTCCAGCAGCTTGCTCCGCCTACGAGCTTTACCTCCGTCTCCCCGAGCTTAAAAACCTCTGGTCATCACGTGACTTCCCCCGCTGGTCAAACGAGCCTATCCTCAAACCGTCTCTCCAAGCTCTGGAGATCAGTTTCAGATTGGTTTTATCCGTTTGCTCCGACGCGAGACCGTACATCAACCACCGCGAGTGGAACCGGCGGTTAGATTCTCTCGTCACGAGTCAGATCCAGCTCATAGCATCGATCTGCGAAGAAGAGGACGATCAATCAGCTCCGGTCAGCGACGGACGAAGCTCTCTCAGCCTGCTACCACAGCTAGCCACGTGGCGAAAAACGGAGTCCCTAGGGAAGAAGTTTTTGTGCACGATCGATAACGAGATGCGTCGGTGCAAGTACACGCTCGGACTCGGAGAACAGAACGTCTCTAACAAACCGAATCTCCGATACGACGCCGTTTGCAAACCGAACGGTCTTTACAGACTCAAGGACAATCCTTACGCGGATCACGTGGATAACGACGAGAATCAGACGCTCTACGTCCTCCACCAGATCCTCGAGTCGTGGATCCACGCATCTCTAAGCCTCCTGAACAGAATCGACGAGAATATCAATGAAGAGAGATTTGGTAAAGCGTCCAGCGACGTTTACTTGCTGGAGAGGATCTGGAGGCTGATGACGGAGATCGAAGATCTACACATACTAATGGACCCGGAGGATTTTTTGAAACTGAAGAAGCAGTTACAAATCAAATCGACCGGTAAAAACGACGCGTTTTGCTTCAGGTCGAGAGGACTAGTGGAGATGACGAAGATGTCGAAGGATCTGAGGCAGAGGATACCGAAGATTCTAGAGGTCGAGGTTGATCCCACGGGAGGACCGAGGCTGCAAGAGGCGGCGATGAGGATGTACGCGAGGAAGAAAGGAGAGTGCGATAAGATTCATCTGCTTCAAGGGATGCAGGCTGTGGAAGGTGCGGCGAAGAGTTTCTTCTTCGCGTATAAGCAGTTAGTTGCGGTGATGATGGGAAGCAGTCAGGTGTCGTGTGACTCGCTGAGTCAGATATTTATGGAGCCTACTTACTATCCGAGTCTTGACGCGGCAAAGACGTTTTTAGGGGAGTTGTGGGGTAACTTGGGGTGA >Bo8g090250 ATGGCTGATTTGGATATGGAGAGGAAGATGGTATCTCCCAAGAAGCTCCACGTCACCATTCCGGAGCCTTTTGACCTCTCCGTCTCCTCTCCCATCTCCTCCTCATCCTCCGCCGCCGCCTACGAACTCTACCTCCGTTTGCCGGAACTCAGAAACCTCTTGTCCTCTCTTGGCTTTCCTCAATGGGTCACCGAGCCGGTCCTCAAACCAGCTCTTCAGGCTCTTGAGATCACTTTCCGTTTGATCTTGACCGTTGCTTCCGACACACGTCCATACATCAACCGACAAGAGTGGACCCGACGCTTGGACTCGCTCGTCACAAGCCAGATAAAGATCGTTGCGTCACTCTGCGAAGACGATGACGAATGCGTACCGGTTAGCAATGGCTGGAGCTCAATGAGCCTGCTGTCCGAGATAGCCACGTGTCGGACAACGGAGAGCATTGGTCAGAAGATCTTGTGTACGGTCGAGAACGAAATGCGTTGGTGTAAGTATACACTCGGTTTAGGTGAACCGAACCTAGCAGGAAAACCGTATCTCCAATACGACGTCGTTTGCCGCCCGGAAGAGCTGCAAAGCCTCAAGAACAACCCTTACGCTGATCATATCGAGAATCAAGAAAACCAAACGCTCTACACGATTCACCAGATTCTTGAATCTTGGATTCACGTTTCACTGAATCTCCTAAACCGAATCGAATCAAGAATCGACGAGGCGAAGTTCGAAAAAGCGTCTTCCGACGTGTACTTGCTAGAGACAATATGGAACCTTCTGAGTGAGATAGAGGATCTACACATTCTTATGGATCCAGAAGACTTCTTGAAGGTCAAGAAACAGTTAAAGATCAAGTCTACATCACAAAACCACGCGTTTTGTTTCAGGTCCAAGGGGTTAGTGGAAATGGCCAAGATGTCTAGAGAGCTCAGACAGAAAGTGCCAGCTGTCCTCGAGGTTGAGGTGGACCCTACAGGAGGTCCGAGGTTGCAAGAGGCGGCGATGAAGCTTTACTCGAGTAAGACTGAGTACGAGAAGATACATTTGCTTCAGGGGATGCAGGCGGTTGAGTCTGCTTCCAAGAGATTCTTCTTCGGGTACCAGAAGCTAGCGGCGGCGATGATGGGAAGCGCGGAGGCTAACGCGAATAGAACGGCGGCGAGTCATCACGAGACGTGTGACTCGCTGACTCAGGTGTTTATGGAGCCAACGTATTACCCGAGCCTAGACGCCGCAAAGACTTTCCTAGGAGAGTTCTGGAGCAATTTGGTATCCCGACACTGA >Cpa.g.sc19.206 ATGGTGGATTTGGATTGGAAAGCGAAGATGGTTTCTCCTGATATCCCAAACAAGTCTCCCAAGCTCTCTAACAAGCTCCACGTATCTATTCCGACGTCGTTTAGCCTCTCCATGGCTTCTCCCGCTTCCGCTTCCGCTCCGGCTTGTTCCGCTTACGATTATTATCTTCGCCTTCCGGAGTTGAGGAAGCTTTGGAGGGTGAAGGAATTTCCGGAGTGGGAGAGCGAGTCGATTGTCAAGCCGGCTTTGCAGGCTTTAGAGATTACTTTTAGGTTCGTGTCGATTGTGTTGTCGGATCCGTTGCCATATGTCAACCGGAGAGAGTGGAAGCGGCGACTCGAGTCGCTGGCCACCAGACAGATCGAGCTTGTCGCGGAGATCTGTGAGAACGATGTGGCTACCGGAAGAGGCGGTGCGGCTCCGATTGCCGATGTAAGCTCTTCGAGCGGGGTGTTGGAGAGGGATGGTAGCTCGGCAGAGGTTTGGAAGCTTGGCGGTGGCGCGGAGAAGACGACGTTCGTGAACCGAACCAGCGAGGCTAGCTTGCTTCCTCGTCTTGCCACGTGGCGGAAATCCGAGGACATAGCACAGAAGATCTTGTACTCCATTGAGTGCGAGATGAAGAGATGTCCGTACACCCTCGGGCTAGGGGAACCGAACCTTGCCGGCAAGCCGAGCCTGGAATACGACGCCGTTTGCCGGCCTAACGAACTACATGCCCTGAAAAGAAATCCTTACGACCACGTAAAGAACCACGAGAACCAAAAGCTATACACCACACACCAGATCCTGGAGTCGTGGATCCAGGCGTCGAAGGAGCTACTAGAACGCATTGTTAGGCGAATCGAGAAGAAGGAATTCAAAGAAGCCGCCAACGACTGCTACCTGCTGGAGAGGATCTGGATGCTTCTCGCCGATATCGAAGACCTCCACCTGTTGATGGACCCTGAAGATTTCCTAAAGCTGAAGAATCAGTTACAGATAAAGTCCCTATCTCAAAACGAAGCGTTTTGTTTCAGATCGGTAGGTTTGGTTGAAATTACCAAACTGTCCAAGGAGCTGAAGCACAAGGTGCCTTTCGTCTTGGGGGTGGAGGTGGACCCCACGGGTGGGCCCAGAATTCAGGAGGCGGCCATGGAACTCTATAGAGAGAAGAGGGAGCCGGAGAAGATCCATCTTCTTCAAGGGTTGCAAGCTATAGAGGCGGCTTTGAAGAGGTTCTTCTTCGCATACAAGGAGGTCTTGACGGTTGTTATGGGGAGCTTGGAGGCCAACGCAAGCAGAATCCTGGTGAATTCGGAGTCGTGCGACTCACTGAGTCAGATTTTCCTCGAGCCCACTTACTACCCTAGCCTGGACGCCGCCAAGACCTTCCTCGGTGAGTACTGGGGTCACGAACCCGGGGTGGAGAAGCGGAATCCGAGGAATCACCGAGTCGGTTGA >LOC_Os01g63690 ATGGCAACGCCCAAGCTGTCCCCTGTATCGCCGGTGCGGCCGGAAGATAAGCAGCGCGCGTCCTCCTCGTCGTCGTCGGGGGCGGTGGCTGCGCCTCTGAGGGTGCAGGACGATACGGCGGTCGAGGAGTACGAGCAGTACCTGCGGCTTCCGGAGCTCGCAAGGCTGTGGAAGGATAGGTGCTGTCCGGAGTGGGCCGACGAGGGCCTCGTCAAGCCGGCGCTGCAGGCGCTGGAGATCACCTTCCGCTTCATCTCCGTCGCGCTCTCCGACCCGCGGGGCTACGCCAGCCGCCGCGAGCTCGCGCGGCGGCTGGAGGCGCTCGCGGCAAGGGAGGTGGAGCTGGTGGCCGCGCTCTGCGAGGGCGAGCAGTGCCCGCCGCTGGCCGAGCTGAGCGCGTCCAAAGGCGTGCTCCCGCGGGAGCGGAGCGCGTCTGAGGTGTGGAAGATTCCCGGTAGCGCCGCCGCGGTGGTGTGCCAGGTCAGCGAGGCCAGCCTGCTCCCGCGGCTCGCCGCTTGGGACAAGTCCGAGACCGTGGCGGCCAGGATCAAGTACGCCATCGAGAGCCAGATGCAGGGCTGCGTGTTCACCCTCGGCCTCGGCGAGCCCAACCTCGCCGGCAAGCCGGTGCTCGAGTACGACCGCGTCGTGAGGCCGCACGAGCTGCACGCCCTCAAGGCGAAGATCGCGCCGGAGCCCAAGACCGGCTACCGCAACAAGGAGAACGAGGCGCTGTTCACTATCCACCAGATACTCGAGTCCTGGCTGTGCGCGGCCTCACAGCTTCTCACCCGCCTAAACAACCGGATCGAAGCAAGAAACTGGGAGGCCGCGGCGAGCGACTGCTGGATCCTGGAACGCGTCTGGAAGCTGCTCGCCGACGTCGAGGACCTGCACCTGCTGATGGACCCGGACGACTTCCTGCGGCTCAAGAGCCAGCTCGCAATACGGGCGGCACCGGGCTCCGACGCGTCCTCCTGCTTCCGCTCCAGGGCGCTGCTGCACGTCGCTAACGCCACGAGGGACCTCAAGAAGCGTGTGCCATGTGTGCTTGGCGTCGAGGTGGACCCCAACGGCGGGCCGAGGGTGCAGGAGGCAGCCATGAGGCTGTTCCACAGCCGGCGGCGCGGCGAGGGCGAGGAGGCCGGCAAGGTGGAGCTGCTGCAGGCGTTCCAGGCCGTGGAGGCGGCGGTGAGGAGGTTCTTCTTCGCGTACCGGCAGCTCGTGGCGGCGGTGATGGGCACCGCGGAGTCGTCGACCAACCGCGCGCTGTTCTCGCCGGCGGAGGAGATGGACCCCCTGGCGCAGATGTTCCTCGAGCCGCCCTACTTCCCCAGCCTCGACGCCGCCAAGACGTTCTTGGCCGACTACTGGGTACGGCGGATGGCCGGTGACGGTGACTCTGCTTCGTCCAGGCGAAGCTGA >Medtr3g070230 ATGGTTGATTTACACTGGAAACTAAACATGCCCAACTCCGACATGTCTTCCAAATCTCCAAAACTATCTATCTCCGAAAAATCATCACCACGCAATTCCTTACCATCATTACAACTACCCTCAATCACCAACGACATCTCCGCAGCAGCACCTCCTCTTTGCGCGGCATACGACTACTATCTCCGACTCCCAGAGCTCTCGAAGCTCTGGGAGTCACGAGAATTCCCCAATTGGAGCAACGAATCAATCCTAAAACCAGCTTTACAAGCACTAGAAATCACTTTCCGTTTCATCTCTACAGTTCTCTCCGACCCTAGACCCTACACGAACAGTAGGGAATGGAGCCGGAGACTCGAATCCCTCGCTACATGGCAGATTGAGATAATCGCCATGCTATGCGAAGATGAAGAAAATAACCCCGAGACACGTGGTACAGCACCAACCGCTTATCTCAGCAGCGGTGAAAGCAAGATAAGAAGCTACAGTGAAACAAGTCTTCTTCCACGCCTTGCTACATGGTACAAATCCAAGGACGTAGCACAGAGGATTCTTCTCTCCGTAGAGTGTCAAATGATGAGATGCTCTTATACTTTAGGTTTAGGTGAACCAAACCTCGCCGGAAAACCGAGCTTAAAATACGACACCGTTTGCAAGCCGAACGAAGTTCATAATCTCAAAACAACTCCCTATGACGACAGAATCGATAACTACGAAAATAACGCGGTCCACGCAACTCATCAGATAGTCGAGTCGTGGATCCACGTTTCTCGTAAACTTCTAGAAAGAATCACAGACGCGATTATTTCTAGAAGGTTTGAGAAAGCAGTTGAGGATTGTTACACGGTGGAGAGAATCTGGAAGCTTTTAACTGAAGTTGAAGATATTCATCTGATGATGGATCCTTTCGATTTCTTGAAGCTGAAGAATCAACTATCATTGAAATCATCATGTTACGAAACTGCATCGTTTTGCATGAGATCAAAGGAGTTGGTTGAAGTAACAAAGATGTGTAGAGATTTAAGGCATAAGGTTCCTGAGATATTGGAAGTTGAAGTGGATCCCTTAGGTGGTCCAAGGATTCAAGAAGCTGCGATGAAACTCTATGTGGCGGAGAAGATGAATGGATTTGAGAAGATTCATTTGTTGCAAGCTATGCAAGGTATTGAGGTAGCTATGAAGAGATTCTTCTATGCGTATAAGCAGGTGTTGGTGGTGGTGATGGGAAGTTCTGAGGCTAATGGAAACCGAGTTGGAGTGAGTTGTGATGGCGGTGACTCGTTGACTCATATGTTCCTTGAACCTACCTACTTTCCTAGCTTGGATGCTGCTAAGACTTTTCTTGGATACTTTTGGGATAATGATAATAAATGGGTGTGA >Medtr5g082150 ATGGTTGATTTAGAATGGAAATCAAAGATGCTAAACTCAAATATAGCCCCCAAATCACCAAAACTTTCTTTACCCTTACCAACTTTCCATCTCCCTCTTCCACTTACAACAAACGACATCACAACAGCCTCATCCACACTTTGCACAACATATGACAACTATCTCCACCTCCCTCACCTCCAAACCCTTTGGTACTCATCAACCTTTCCCAACTGGGCCAACGAGCCCATCATAAAACCCGCTTTAACCGCTCTAGAAATCACTTTCTGTCTCATCACAACCGTTTTATCCGACCCAAGACCCTATATCAACAAACGCGAGTGGACTCGACGTGTTGAATCTCTAGCAAAATCTCAAATCCACGTCATCGCATTACTCTGCGATGACGAGGAACAAAACACTAATACTTGTGGCAAAGCTCCGATAACCGAGCTTAGCAAAATATACCAAGACCAATTCAGAAGCTATAGCGAACAAAGCTTGCTACCAAAACTCGCCACGTGGCAGAAATCAAAACAAATAGCACAGAGACTATTTTCCACTGTGGAATCTGAAATGATGACGTGTAATTACACGTTAGGTTTAGGAGAACAAAATTTCAACGGTAAACCGATTCTCCGTTACGACGAAATTTGCAAACCGAATTTCATCCACTCATTAGAAACGACACCGTTTGATCATATCGGAAACCACGAGAACAGAATTCTACACGCGACACACCAGATTTTGGAATCATGGACACGCGCAGCGCGTGTGTTACTAGAGCGCGTGAACAATTCCATTGATAACAAAACATTTGAGAAAACCGCGAGTGAGATTTACGCGGTGGAAAGAATCTGGAAGATTCTAACGGAAATCGAAGATTTACACATGATGATGGATCCAGAAGATTTTCTGAAACTGAAGAAGCAATTAGGTTTAGGAACAAGAACGATGAATGAAATGAAAGAAATTCACGAAACGGTGCCGTTTTGTTTTCGTTCAAAAGAGTTTGTTACAGTAACAAAAATGTGTAGAGATTTGAAGCAGAAGGTGCCGGAAATTTTGGAAGTTGAAGTGGACCCCACGGGTGGGCCAGGGGTAATGGAGGAAGCAATGAAGGTTTATTCAGAGAAGAAAGAGTTTGAGAAGGTTCATTTGTTGCAAGGGTTGCAAGGGATTGAGATAGAAATGAAGAGATTTTTTTATGGTTATAAACAAGTTTTGGTTGTTATGATGGGAAGTAGTGAGATGAATTTGGAATGTTTGAGTAGGATTTTTCTTGAACCTACTTGGTTTCCTAGCTTGGATGCTGCCAAGACTTTTCTTGGGTATTATTGGGAAAATAGTGAGAATAGTAGAAATACTTGGTGA >AT2G40000 ATGGTTGATATGGATTGGAAGAGGAAGATGGTATCATCAGATTTACCAAACTCACCTAAGCTTTCTTCAAAGCTTCACGTAACTATTCCATCACCGTTCAAAATCGTCCCTGTTTCATCTCCGATCTCATGTTCAGCACCTGCTCTTTGCTCTGCTTACGAGCTTTACCTTCGTCTCCCTGAGCTAAGAAAGCTCTGGTCATCTCGTGATTTTCCTCAATGGACATCAGAGCCGATTCTCAAACCAGCTCTTCAAGCTTTGGAGATCAGTTTCAGATTAGTTTTCGCCGTTTGTTCTGATACTAGACCGTACATCAACCACCGTGAATGGAACCGGAGGCTAGATTCTCTCATCACGAAGCAGATCCAGCTTGTAGCAGCGATCTGCGAAGATGAAGAAGAAGAAGGTATATCAGCGGAGGCTCCGGTCGGCGGTGGACGGAGTTCGTTGAGTTTGTTACCGCAGCTAGCTACGTGGAGGAGATCAGAGGCTTTGGGGAAGAAGATCTTATATACGATCGATAACGAGATGAGTCGGTGTAAGTACACGCTCGGACTCGGTGAACAAAACATCGCCGGAAAACCAAATCTCCGGTACGATGCGATTTGCCGACCAAACGAGATCTATAGCCTCAAGGATAATCCATACGCAGATCATATCGATAATCACGAGAATCAAACTCTCTATATCATTCACCAGATCCTCGAATCGTGGATCTACGCATCTGGAAATCTTCTGAATCGAATCGTCTCAAGTATCGAAGAAGAGAAATTCGGAAAAGCTTCAAACGATGTTTACTTGCTGGAGAAGATCTGGAAAATTTTAGCGGAGATTGAAGATCTTCATATGTTGATGGATCCGGAAGATTTTTTGAAATTGAAGAAACAGTTACAGATCAAATCGACGGGTAAAAACGATGCGTTTTGTTTCAGATCTAAAGGATTAGTGGAGATGATGAAGATGTCGAAAGATCTGAGACAGAAAGTACCGGCGGTCTTGGCGGTTGAGGTAGATCCAACCGGAGGACCAAGATTACAAGAGGCGGCGATGAAGCTTTACGCGAGGAAGACAGAGTGCGATAAGATTCATTTGCTTCAGGGGATGCAAGCGGTGGAAGCGGCGGCGAAGAGTTTCTTCTTTGGGTATAGGCAGTTAGTGGCGGCTATGATGGGAAGTGCGGAGATGAACGCGACGGCGAGTCAAGAGTCGTGTGACTCACTGAGTCAGATATTTATGGAGCCGACGTATTTCCCGAGCCTTGACGCGGCAAAGACGTTTCTGGGAGAGTTTTGGAGTCATTTGGGATGA >AT3G55840 ATGGCTGATTTGGATTTACAGAGGAAGATGGTATCTCCGAAGCTCCACGTCACCATTCCTGAGCCGTGTAAGCTCTCCTCCGTCTCTTCTCCAATCTCCTCCTCTTCTTCCGCCGCTTGCTCTGCTTACGAGCTTTACCTCCGTTTGCCTGAACTTAGAAACCTCTGGTCCTCTCTCTATTTCCCTCACTGGATCTCCGAGCCCGTTCTCAAACCAGCTCTTCAAGCTCTTGAGATCACTTTCCGGTTAATCCTCACCGTTGCTTCTGACACACGTCCTTACATCAACCGCCGCGAATGGATCCGACGGTTGGATTCCCTCACTACCAGCCAGATAAAAATCGTGGCGGCTATCTGCGGAGATGAAGACAACTACGAAGAGAACGTATCGGCGGCTCCGGTCAGCAATGGCTGGAGCTCGTTGAGTTTGCTTTCGGAGATCGCCACGTGTCGTACATCGGAGAGTGTTGGACAGAAGATCTTGTCTACGATCGAGAATGAGATGCGTTGGTGTAAGTATACGCTCGGTTTAGGAGAACCAAACCTCGCCGGAAAACCGTATCTTCAATACGACGCCGTTTGTCTCCCGGAGGAGCTACATAGCCTCAAGAACAATCCTTACGCAGATCACATCGAGAACCAAGAGAATCAAATGCTCTACACTAGTCATCAGATTCTTGAATCGTGGATTTACGTTTCTGTGAATCTTTTATATAGAATCGAATCGAGAATCGAAGAGGGAAAATTCGAAAAAGCTTCTTCAGACGTCTACTTGTTGGAGAGAATCTGGAAGCTTCTATCAGAGATTGAAGATTTACACATTCTTATGGATCCTGAAGATTTCTTGAAGGTGAAGAAACAGTTACAAATCAAATCGACGTTTCCAAACGACGCATTTTGTTTTAGGTCAAAGGGCTTAGTAGAGATGGCGAAGATGTCCAAAGAGCTGAGACAGAAAGTGCCAGCTGTTCTTGAGGTGGAGGTGGATCCCACCGGAGGTCCGAGGTTGCAAGAGGCGGCGATGAAGCTTTACTCGAGGAAAACAGAGTACGAGAAGATACATTTGCTTCAGGGAATGCAGGCCGTGGAGTCTGCAGCCAAGAGATTCTTCTTCGGATACCAGAAGTTGGTTGCAGCGATGATTGGGAATGCAGAGGCGAATGCAAATAGAACGGTGGCGAATCACGAGTCCTATGATTCACTGACTCAGGTGTTTATGGAGCCACCGTATTACCCGAGCCTAGACGCCGCAAAGACATTTCTGGGAGAGTTCTGGAGCCAATTGTGA >COL.COLO4_25636 ATGGTTGATTTAGATTGGAAAGCAAAGATGGTTTCTTCAGATATCCCAAACAAATCCCCAAAACTATCTAACAAGCTTCAAGTTTCAATCCCGACGCCGTTTCGGTTCTCGAATATTGCCTCTCCGCTTTCGACTTCTTCCTCTTCCGCTTCCTCAGCTTATGATTATTACCTTCGGCTTCCCGAGCTTCGGAAGTTATGGGAGGTGAAGGAGTTTCCGGATTGGAAAAACGAGCGCGTTTTGAAGCCGGCTTTACATGCTTTGGAGATCACCTTCCGGTTCATTTCGATTGTTTTATCGGATCCTAGGCCGTATTCGAATCGCCGGGAGTGGACCCGTCGGCTCGAGGCACTCACCACGAGTCAGGTTCAGTTAATAGCCATGCTCTGTGAAGACGAAGACGCGGATAAAACCACCGCCGGGACGGCTCCGATCGTTGATCTGACATCGTCGAGCGGTGTCCTAGCACGTGAGAGCAGCTCCGCCGAGGTGTGGAAGATTCATGGAGAGACGACGGTGGTGAACAGGACCAGCGAAGCCAGCTTGTTGCCTCGTCTCGCCACGTGGCAAAAATCAGAAGACGTCGCTCAGAAAATCCTCTACTCGATCGAGTGCGAGATGAGGCGGTGTCCGTACACTCTAGGCTTGGGAGAGCCGAACCTATCCGGCAAACCGAACCTCGACTACGACGCCGTTTGCAAGCCGACCGAACTCCACGCGCTCAAGAAGAGCCCTTACGATCACATCGACAACCACGAGAATGCGACGCTCTACACGACGCACCAGATCCTAGAATCGTGGATCCAATCCGCGAAACAAGTGTTGAAACGCATCGCTTCCAGAATCGAGGCTAACAACTTCGAAGCCGCCGCGAGCGACTGTTATTTAATGGAAAAGATCTGGAAACTTCTATCGGAGATCGAAGACCTCCACCTCTTAATGGACCCCGACGATTTCCTCCACCTGAAAAGCCAGCTGTTGATAAAATCGGTCAACGAAACGGAGGCGTTTTGCTTCAGATCGAAGGGGTTGGTTGAAATTACAAAAATGTCCAAGGAGTTAAAACATAAAGTACCTTTTATCCTCGGTGTCGAGGTGGATCCTAAAGGTGGGCCCAGGATTCAGGAAGCTGCGATGAGATTGTACACAGAGAAGCAGGAGGGCAATAAGGTCTTTTTGGTACAGGCTTTGCAAGCCATCGAAGGAGCCTTGAAACGATTCTTTTACGGGTACAAGCAAGTTCTGGTGGTGGTTATGGGGAGTTTGGAAGCGAAAGGGAACCGAGTCGTGGCGAGTTCTGACTCGGGTGACTCGTTGAGTCAGATCTTCTTGGAGCCTACTTATTTCCCTAGTCTTGACGCGGCTAAGACGTTTTTGGGTGAGTTCTGGAGTCATGAAAACGGTGGGTCTGGGTTGACTCGGTGGAGGAAGTGA >Vradi03g08740 ATGGTTGATTTACATTGGAAATCAAAGATACCTGCTTCCGACATGTCTTCCAAATCTCCAAAACTCTCCCTCCCCGCCAACTCCTTACCCTCTCTTCAACTACCCTTCCGCACCACAGACATCTCTCCCGCTCCACCTGCACTCTGTGCTGCATACGATTACTATCTCTCTCTCCCACAACTCAGAACCCTTTGGAATTCAAGAGACTTTCCCAATTGGAACAACGAACCCATTTTAAAACCTGCCCTGCAAGCTTTGGAAGTCACCTTCCGTTTTCTTTCCATTGTTTTCTCCGATCCCAGGCCTCATTCCAACCACAGGGAATGGAACCGTGTCATAGAGTCTCTCGCCATTCATCAGATTGAGATCATAGCCATGCTGTGCGAAGACGAGGAGCTCAATTCTCAGACACGTGCCACCGTCCCAACCGCTGATCTTACTGTAGATAGCTCCAACAATAGCGAGAGCCGAAGCTACAGCGAGGCCAGCCTTCTTCCGCGGCTTGCCACGTGGTACAAATCCAAGGACGTGGCGCAGAGGATTCTTCTCACCGTTGAGTGCCAAATGAGGAGGTGTAGCTATACGCTAGGTTTGGGAGAGCCGAACCTGGCGGCGAAACCGAGCCTGCTCTACGACCGCGTCTGCAGACCGAGTGAAATCCACGCGCTCAAGACTACACCCTACGACGAACGCGTGGAGAACTACGAGAACCACGCTGTGCACGCCACGCACCAGATTGCGGAGTCGTGGATCCACACTTCGCGGAAGCTTCTGGAGAGGATCGCCGATGCTATCCACTGTAAAAGGTTGGAGCAGGCGGCGGAGGACTGCCACGCGGTGGAGCGCATCTGGAAGCTTCTCGCGGAGGTGGAGGATCTTCACCTGATGATGGATCCGGACGAATTCCTGCGTTTGAAGAACCAGCTCTCGGTGCGGTCCTCGAGCGGCGAAACGGCGTCTTTCTGCTTCAGGTCAAAGGAATTGGTGGAAGTGACGAAAATGTGCAGAGATCTGAGGCACATGGTGCCGGAGATATTGGAGGTGGAGGTGGATCCGAAGGGAGGACCGAGAATTCAAGAAGCGGCGATGAAACTGTACGTCTCGAAGAGCGCGTTCGAGAAGGTTCACCTGTTGCAGGCGATGCAGGCGATAGAGGCGGCGATGAAGAGGTTCTTCTACGCGTATAAACAAGTTCTGACGGTGGTGATGGGAAGCTCGGAGGCCAACGGCAACCGAGTTGGGCTGAGTTGTGACTCGGCTGACTCGTTGACTCAGATATTCCTTGAACCGACGTATTTTCCAAGCTTGGATGCCGCCAAGACTTTCCTTGGGTACCTCTGGGATAATAACGATTACAAGTGGCCATAA >Vradi06g04660 ATGGTTGATCTAGATTGGCAAACAAAGATGGTTTGTTCCAACATGCCTCCCAACTCACCCAAACTCTCTCTCTTAGAAAACAACATCCCAATCCCAATCCCTACTTTGCAAATCCCCCTTCCTCAAAACGACATCACGCCAGCCTCCTCCCCGCTTTGTGCTGCCTACGACAACTACCTTCGCCTCCCCGACCTAAGAAATCTTTGGGCCTCCAACAACTTCCCCGATTGGCCCAACGAGCCCATCATAAAGCCCGCCTTACACGCCCTCGAAATCACCTTCCGCTTTCTCGCAACCGTTTTATCAGACCCCAGGCCTTACGTTAACAAGCGCGAGTGGACCCGACGCCTCGAGTCTCTCGCCGCGGCGCAGGTCCAGATCATTGCCGTGCTCTGCGAAGACGAGGAGCAAAACCCCCAGACACGTGGCAAGGCACCCGTCAGTGACGTCAACGACTTCCTCACGGGTCAAAGAAGAAGCTACAGCGAGGAGAGCTTGCTCCCACGTCTCGCCACGTGGCACAGATCCAGGGACGTGGCGAGGAGGATCCTCGCCACCGTGGAATGCGAGATGATGAGGTGCACGTACACGCTGGGTCTGGGTGAGGCCAATCTCGCGGGAAAAAAGGTTCTCCATTACGACGACGTTTGCAGGCCGACCGAGATCCGATCCCTGGAGACCACGCCGTACGATCACGTGGAGAACTACGAGAATAGGACGGTGCACGCGGCGCAGCAGATCGTGGAGTGCTGGACGCGTGCTGGGAGGAGGTTGGTGGAGAGATTGGTGGAGTCGGTGGAGAGGAGAGAGTTGGAGAAGGCGGCGAGTGAGTGCCACGCGGTGGAACGGATCTGGAAGCTTCTGGCGGAGGTTGAGGACGTGCATGTGATGATGGATCCGGAGGATTTTCTTCGGCTGAAGAAGGAATTGGGGATGGGAAGGCAAGGCGAAACGGTGGCGTTTTGCTTTAGGTCTAAGGAAGTTGTGGAGTTGGCGAGGGTGTGTAGGGATCTGAGGCAGAAGGTGCCGGAGATATTGGAGGTGGAGGTTGACCCGAAGGGTGGGCCAGGGATGATGGAGGCGGCGATGAAGGTGTACGCGGAGAAAACGAAGAAGGGGTTGGAAAAGGTTGTTGTTTTGCAGGGTATGCAAGCGATTGAGGTGGCGATGAAGAGATTCTTCTTCGCTTACAAGCAGGTTGCGTCGCTTCTGATGGGAAGCTCCGAGGCCGATGGGTTAACTCAGATATTCCTTCAACCCACCTATTTCCCTAGCTTGGATGCTGCCAAGACATTCCTCAGTTATTACTGGGAAAATAACGCCAATAATCAAACTCAAAATTTGGTAGTTAAATTAGTTAATTAA >UGI.Scf00004.788 ATGGTTGATTTGGATTGGATGAACAAGATGATCTCCTCCGAGATCCCTACAAAGTCCCCGCGATTCGTCAACAAGCTACAGATTTCGGTTCCGCCGCGGCGAGGAGGTGTGGAAGAGCTTGCGCCGGCGTCCGACGCCGCCTGCTCCGCCTACGACCAGTACCTTCGCCTCCCCGCGCTGAGGAAGCTATGGGGATTGAATGAGTTTCCGGGGTGGAGGAGTGAGGCGGTGATGCGCCCGGCGATGATGGCGTTGGAAATCACGTTTAGGTTTATATCCGCGGGGGTTTCGGATCCGAGGCCGTACGTCAACCGCCGGGAGTGGCGGCGGAGGCTGGAGGCGTTGGTGGAGAGCGAGGTGGATTTGGTGGCTTGGATTTGTGAGGACGATGAGGAGGATGTGGAGACGCGCGGCACGATACCGATTTTGGATCTGACTTCCGATGGGGGCGCCGTGGCTCGAGAAAATAGCTCGGCGGAGGTGTGGAAAATGGCGGATGATACGGTGGTGGTGAGCCAAATCAGCGAGGGAAGTATCCTACCGAAGCTGGCCACGTGGCAGAAGACAGAGGACGTTGCGAAGAAGATCCAGTTCTGTATCGAGTGCAGGATGAAATCGTGCCCGTTCACTCTAGGTTTGGGAGAACCGAACCTGAGCGGAAAACCGAGCGTCAATTTTGATCTCATCTGTAGGCCCGCGGAGCTCCACGCGCTCAAGAAGAGCCCATACGACGACGTAGAGGGGAGCAATTTCGAGAACCGTAGCGTCTACTCCACGCACCAGATCCTCGAATCGTGGATCCGCGTCGCCAAGGAGCTGATTGTGAGAATCTCCGATGAAATCGACGGCGGGCGCTACGATAGAGCTGCCGGAAATTGTTGGATTCTGGAGAAAGTGTGGAAAATCATGGCGCAAATCGAAGATCTGCACATGCTCATGGATCCCGACGATTTCCTCAGATTGAAGAATCAGTTGATGATCAAGGCGAATTCACCATCGGAGCTCTTCTGTTTCCGATCGCGCGACCTCGTCGAGATCACGAAATCCTCAAAGAATCTGAGACACAGGGTCCCGGCTGTCCTAGGAGTGGAAGTTGATCCCACCGGTGGTCCGAGGATTCAAGATGCCGCCATGGAATTATACCGCTTGAAGGAGGATCCCTCCAAAATCCACCTCCTGCAAGCGATGCAGGCAGTGGAAGCTGCGGTGAAGGGATTTTTCTTCTCATACAAGCAGCTCCTCACGGCGCTGATGGGAAGCTTGGAGGCCAACGGCGGTGGCGGCGGCGAATCGGGCGACGTGTTAGGCCAGATTTTCCTCGAGCCGACGTATTTCCCAAGCTTGGACGCCGCGAAAACGTTTCTCGGTGAGCGGTTGAGCCGCGGACACAGTCCCGAACGGCGCCGCCGCAACGGTCATGTCTGA >Migut.F00698 ATGGTTGATTTGGATTGGAAAAATAAGATGATCGGTTCTGATATACCTAGTAAATCACCTAAATTCGGCAACAAGCTCCAGATTTCTATCCCGCCGGCCAAAATCCGGCTTGCTGAGCTGTCGGCGGCGTCGGACTCGTCTTGTTCGGCGTACGAACACTATCTTCGCCTTCCGGAGCTTAGGAAGCTATGGTGCGCCACCGAGTTTCCCGGCTGGAAAAGCGAGTCGGTTATCAAACCGGCTTTTACCGGTTTAGAGATTACCTTCCGGTTTATCTCGACCGTGTTGTCCGACCCGAGGAAATACACCAACCGCCGGGAATGGAGGCGGCGGTTGGAGGCTCTGACGACGAGCCAGATCGAGATTATTGCTCTTCTGTGTGAGGACGATGAAGAAGATCCGGAGACGAGAGCTACGATCCCGATCGCGGATCTGACGTCCGACGGCGGCGTATTGGCGTCGAATAACAGCTCCGCCGAGGTGTGGAGGATGGCGGACGACACGGTGGTGGTGAGCCAGGTCAGCGAGGAGAGCCTGCTGCCGCGGCTGGCTGGGTGGGAGATGTTCGAGGATGTTGCGAGGAAGATCCGGTTCTCGATCGAGTGTCAGATGCAGGGTTGTCCGTACACCCTCGGCTTGGGTGAGCCGAATCTAAGCGGCAAGCCGAGCCTAAGCTACGACCTAATCTGCAAGCCGGCTGAGCTTCACGCGCTGAAGAAATGCCCAAACGACGATGTTGATTCGAAGAACATGGAGAACCGAATCCTCTACGCAACGCACCAGATTCTAGAATCGTGGACCCGTGTCGCCGGAGAGCTTCTGACGAAAATCTCCGACGAAATCGATTCCCGGCGATACGAGAGAGCGTCGAGCCATATTTGGACGTTGGAAAAAGTGTGGACGATTATTAACCAGATCGAAGATTTGCATCTACTGATGGATCCAGACGATTTCTTGCGGCTGAAGAATCAGCTGATGATAAAAGCGACTTCCGAATCGGAGCTCTTCTGTTTCCGATCGAGAGAACTCGTACACGTCACGAGATCTTCAAAGGAGCTGAGGCACAAGATTCCGGCGGTTCTGGAGGTGGAGGTGGACCCTACCGGCGGGCCTAGGATACAGGACGCCGCCATGGAACTGTACAGGAGGAAGGAGGAGTTTGCGAAGATCCACCTTCTCCAGGGGATGCAGGCGGTGGAGGCGGCGGTGAAGAGGTTTTACTTCTGTTACAAGCAACTGTTGGCGGTGGTGATGGGGAGTCTGGAGGCGAAGGGTAACGTTGGATCGGGAGATTTACTGAGTCAGATATTTCTGGAGCCGACTTATTTCCCGAGTTTGGACGCCGCCAAGACGTTTCACGGAGAGCAGTTGAGCCACGGAACTGGAAGGCATAGTCGGTAA >AL4G37600 ATGGTTGATATGGATTGGAAGAGGAAGATGGCATCATCAGATTTACCAAACTCACCTAAGCTTTCTTCAAAGCTTCACGTAACTATTCCATCACCATTCAAAATCGTCCCTGTTTCGTCTCCGATCTCTTGTTCCGCACCAGCGCTTTGCTCTGCTTACGAGCTTTACCTTCGTCTTCCTGAGCTAAGAAAGCTCTGGTCATCTCGTGATTTTCCTACGTGGACGTCAGAGCCGATTCTTAAACCGGCTCTTCAAGCTTTGGAGATCAGTTTTAGATTAGTTTTCGCCGTTTGTTCTGATACTAGACCGTACATCAACCACCGTGAATGGAACCGGAGGTTAGATTCTCTCGTCACGAAGCAGATCCAGCTTGTAGCAGCGATCTGCGAAGAAGACGATGAAGAAGAAGGTGACTCGGCGGCTCCGGTCAGCGATGGACGGAGTTCGTTGAGTTTGTTACCACAGCTAGCTACGTGGAGGAGATCAGAAGCTTTAGGGAAGAAGATCTTATCTACGGTCGATAACGAGATGAGTCGGTGTAAGTACACGCTTGGACTCGGTGAACAAAACATCGCCGGGAAACCAAATCTCCGGTACGATGCGATTTGCCGACCTAACGAGATCTATAGCCTCAAGGATAATCCATTCGCAGATCATATCGATAATCAAGAGAATCAAACGCTCTATATCATTCATCAGATCCTCGAATCGTGGATCTACGCATCTGGAAATCTTCTGAATCGAATCGTCTCCAGTATCGAAGAAGAGAAATTCGAAAAAGCTTCGAACGATGTTTACTTGCTGGAGAAGATCTGGAAACTTTTAGCGGAGATTGAAGATCTTCATATGTTGATGGATCCGGAGGATTTTCTGAAATTGAAGAAGCAGTTACAGATCAAATCGACGGGGAAAAACGATGCGTTTTGTTTCAGATCTAAAGGATTAGTGGAGATGATGAAGATGTCGAAAGATCTGAGGCAGAAAGTACCGGCGGTGTTGGCGGTTGAGGTAGATCCAACCGGAGGACCGAGATTACAAGAGGCGGCGATGAAGCTTTACGCGACGAAGAGAGAGTGCGATAAGATTCATCTGCTTCAGGGGATGCAAGCGGTTGAAGCGGCGGCGAAGAGTTTCTTCTTCTCGTATAGGCAGCTAGTGGCGGCGATGATGGGAAGCGCCGAGACGAACGCGACGGCGAGTCAAGAGTCGTGTGACTCGTTGAGTCAGATATTTATGGAGCCGACGTATTTCCCGAGTCTTGACGCGGCAAAGACTTTCTTGGGAGAGTTCTGGAGTCATTTGGGATGA >AL5G37130 ATGGCTGATTTGGATTTACAGAGGAATATGGTATCTCCAAAGCTCCACGTCACTATTCCGGAGCCGTGTAAGCTCTCCTCCGTCTCCTCTCCGATCTCCTCCTCTTCTTCCGCCGCTTGCTCTGCCTACGAGCTTTACCTCCGTTTGCCGGAACTTAGAAACCTCTGGTCCTCTCTCGATTTCCCTCATTGGATCTCCGAGCCGGTTCTCAAACCATCTCTTCAAGCTCTTGAGATCACTTTCCGATTAATCCTCACCGTTGCTTCTGACAGACGTCCGTACATCAACCGCCGCGAATGGATCCGACGGTTGGATTCTCTCTCCACGAGCCAGATCAAAATCGTGGCGGCTATCTGCGAAGATGAAGGCTACGACGACGATAACGTATCGGCGGCTCCGGTCAGCAATGGCTGGAGCTCGTTGAGCTTGCTTTCGGAGATCGCCACGTGTCGTACATCCGAGAGTGTTGGGCAGAAGATTTTGTCTACGATCGAGAATGAGATGCGTTGGTGTAAGTATACGCTCGGTTTAGGAGAACCAAACCTCGCCGGAAAACCATATCTCCCATACGACGCCGTTTGTCGCCCGGAGGAGCTACACAGCCTTAAGAACAATCCTTACTCTGATCACATCGAGAACCAAGAGAATCAAATGCTCTACACTATTCATCAGATTCTTGAATCGTGGATTTATGTTTCTGTGAATCTTTTGTATCGAATCGAATCAAGAATCGAAGAGGGAAAATTCGAAAAAGCTTCTTCCGACGTTTACTTGCTGGAGAGAATCTGGAAGCTTTTAACGGAGATAGAAGATTTACACATTCTGATGGATCCTGAAGATTTCTTGAAGGTGAAGAAACAGTTACAAATCAAATCAACTTCTCCAAACGACGCGTTTTGTTTCAGGTCCAAGGGGCTAGTGGAGATGGCCAAGATGTCCAAAGAGCTGAGACAGAAAGTGCCAGCTGTTCTTGAGGTGGAGGTGGATCCCACCGGAGGTCCGAGATTGCAAGAGGCAGCGATGAAGCTTTACTCAAGGAAGACAGAGTACGAGAAGATACATTTGCTTCAGGGAATGCAGGCAGTGGAGTCGGCAGCGAAGAGATTCTTCTTTGGGTACCAGAAGTTGGTTGCAGCGATGATTGGGAATGCGGAGGCGAATGCGAATAGAACCGTGGCGAGTCACGAGTCCTATGATTCTCTGACTCATGTGTTTATGGAGCCACCGTATTACCCGAGCCTAGACGCCGCAAAGACATTTCTGGGAGAGTTCTGGAGCCAATTGTGA >GSVIVG01032858001 ATGGTTGATTTAGATTGCACAGCGAAAATGGTCTCACCTGATATGCCCAAAAAGTCGCCCAAATTTTCAAATAAGCTTCAGGTTTCGATCCCCTCTGCGTTTCGTGCCGGTGATTTATCGTCCGCTCCTTCGCCTGAATGTTCAGCGTACGAGTACTACCTCCGGCTGTCGGAGCTTAAGAAGCTATGGGATTCGAGAGAGTTTCCGAATTGGAAGAATGAGTCTCTTATCAGGCCGGCTTTGCAAGCGTTGGAGCTCACCTTCCGGTTCGTTTCCACCGTTTTGTCAGACCCCAGACCGTACGCAAATCGTCGAGAGTGGAAGCGGAGGCTCGAGTCCTTGACGACCAATCAGATTCAGCTCGTAGCGATCTTGTGCGAGGAGGAGGAAGAAGAAGGGGAGATGCCGACACCGGTGGTGAGCCGAACCAGCGAAGCGAGCTTGCTTCCAAGGCTGGCCACGTGGCCGAAATCGGAAGATATTGCACAGAAAATCATGTACTCGATTGAATGCGAGATGCGAGGGTGTCCGTACACGCTAGGTCTGGGAGAACCGAACCTCGTAGGGAAGCCAAACCTGGAGTACGACCTAGTCTGCAAGCCATCAGAGCTTCATTCTCTGAAGAGGAATCCGTACGATCACGTCGAGAACTATGAGAACCAGACGCTGTACACCACTTCCCAGATCTTGGAGTCATGGATCTACACAGCGCAACAGCTTCTCAAACGGATAGCAGAGAGAATCGAGGAGAGAGACTTGGAAAAAGCCTCAAGCGACTGTTGGTTGCTGGAACGAATCTGGAAACTTCTGGCAGACATCGAAGACCTCCATCTCCTAATGGACCCGGACGATTTTCTCAGGCTGAAGAAGCAGCTCTCGATCAAATCCTCGCCGGAATCAGAACCATTCTGCTTCAGATCACGAGGACTCGTTGAGATCACGAAATCGTCAAAAGATCTGAAACACAAGGTTCCCTACCTCTTGGGCGTTGAGGTGGATCCAAAGGGAGGGCCAAGGGTTCAGGAGGCAGTGATGAAGCTGTACCGCGAAAAGGTAGGGTCGGAGAAGATTCATTTGCTTCAGGCTTTGCAGGCGATTGAATCAGCATTGAAGAGGTTTTTCTATGCATATAAGCAAGTGATGGTGATGGTCATGGGAAGTTCGGAAGCGAGGGTGAGCCGGCCACTGTTGAGTTCCGATTCAACGGACTCGTTGTCTCAAATCTTCATGGAACCCACATATTATCCCAGTTTGGATGCGGCGAAGACGTTTTTGGGAGACTTCTGGGACCATCAACATGGCACCTACGCTTCCAATAGATCAGATGGTAATTTTGAAAGCTCATGGATGATCACTTGTAACAAAAAATCCAGGTTTGATTTCGTTGCAAGTAAAACTAAAGTCCAATCCTCCACCACCTGGTGA >TPR.G2520 ATGGTTGATTTACATTGGAAACTAAACATGCCCAATTCAGACATGTCTTCCAAATCTCCAAAACTTTCTCTCTCCGAAAAATCATCACCACGCAAATCCCTACCCTCATTACAACTACCTTCAATCTCCAACGACATCGCAGCAGCCGCACAACCTCTTTGTGCAGCTTACGACCACTATCTCCGTCTCCCAGAGCTTCGCAAGCTTTGGGAAACAACAGAATTCCCCAACTGGAGTAACGAACCAATCATAAAACCAGCTTTGCAAGCACTCGAAATCACGTTCCGTTTTATCTCTACGGTTCTCTCTGACCCAAGACCATACGCAAATCGTACAGAATGGAACCGTAGACTTGAATCTATTGCTACACGTCAGATTGAGATTATTGCCATGCTATGCGAAGACGAGGAACAAAACCTGGAGACACGTGGCACAGTACCAACCGCTTATCTCAGCAGCGGCGATAGCAAAATCAGAAGCTATAGTGAAACGAGTCTTCTTCCAATTCTTGCCACGTGGTACAAATCAAAGGACGTAGCACAGAGGATTCTTCTCTCTGTAGAATGTCAAATGATGAGGTGTTCTTATACGCTAGATTTATCATGGTACGGTGGTTGTGAAAGAGGGTACCGTGAACGTCTCTTAGATACGTTGGTTGTGAAAGAAGAGGAAGAAAATCTCGTGGATTGTTGTAATTGTCAAACCAAGTTGTATGACTTTGTACTCAAAGAATATCTTCGTCATGGAGATGTGTGGATATCTAGAATTCATGGCGAAGATAATAAGCGTGTGACTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTTTTCCTGTTGTGAAAGGTGTTCCCTTTAATGGGTGGCTTTGGTTTTGGCGAGATACATGTGATACCGTTTCGCCTTCTGCCTTCATCTGTCATGTGTCAAGCCTACTCTGA >ATR0618G085 ATGGTAGAATTGAAGTGGAAGAATCAGATGGCCGAGCAACGAGAGCTGAACTCTGCAACAAACCATAGAAAACCCATCGCAAGCGATTCCATGCCTGTTCATCACAATTTTGTAGAGGACTCGGCTGATCCTTTAAAGCTGAACCAGTCAGATTGCTTAGCCTATGAACAATACCTTCACCTTGGCCGTTTATGGGCTCTTTCTCGCTCTAGACAGTTCCCTGAATGGAGGAACGAGCCTCTTCTGAAACCTTCACTCCAAGCCCTAGAAATCACCTTCCGCTTCATCTCTCTGGTTCTCTCTGATCCTCGTCCTTACATCAACAAATCGGAGTGGAAACGAAGGCTAGAATCCCTCGCTTGCCTTCAAATCGAGCTCATAGCTTCAATCTGTGAAGATGATGAAGACGATAGAGAAAACATCGCAAGTTGCTCTGCTCCTACTGTGAATCTCCATCTCTCCAATGGAGTCTTAACCAGAGGAGGCAGCTTACAAGAAGTGTGGAAGATCAATGGCGCTTCTTCTGCTCTGGTGAGTCAAACCAGTGAGCAAAGCCTGTTGCCAAGGTTGGGGGCATGGCAGAAATCACAGGACATAGCCTCGAAGCTCTGGTTTTCAATCGAGTGCCATTTCCAGAGAGCCCCATTTACCCTAGGGTTAGGAGAGCCAAACCTCTCTGGAAAACCAGTCCTGGAATACGATCTGGTGTGCAAGCCGTCAGAGGTCCACTCTCTAAAGAGAAGCCCTCTCGATCCTCACCTCAACAACCACGAAAACCAGAGCCTTTACACAACGCACCAGATCCGGGAGTCATGGCTGATCACTGCTCAAGAGCTCCTCAAAAGGATCCACGAAACCCTAGAATCCAAAGATTTCAAGGCCTCTGCGAAGAACTGCTGGCTTCTCGAGAAGATCTGGAAGCTACTGGCTGAGATCGAGGACCTCCATCTCCTCATGGACCCCGACGACTTCCTCCGCCTCAAGAAACAGCTCGCCATCAAAACTCCAACGGACTCCGGCGCCTTCTGTCTCAGATCTAGGGTTTTAATGGCGGTCTCGGAGGCCTGCAAAGATCTAAAGCACAGAGTCCCTGCAATCCTTGGCGTTGAAGCCGACCCCAGTGGCGGCCCATCCCTTCAAGAAGAGGCCATGAGACTGTATCATGGCCATGGAAATTGGAGCTCCATCCATTTGTTACAGGCTTTGCAGGCCATTGAAGCAGGCCTGAAGAAGTTCTTCTTCTCTTACCAGCAGCTGGTTATTGTGGTCATGGGGAGCTCTGAAGCCATGGGAAGCCATGGAAACCCTAGAAATGGAGCTTTGTCACAGTTGTTCATGGACCCTCCATATTTTCCAAGCTTAGATGCAGCCAAGACTTTCTTAGGTGATTTCTGGCAATACGAAGCAAAGGCCGCTAGTGTCAGGTTTAGCTGA >ATR0693G017 ATGGTTGAGATTTGGGGAAAAGAGACTTGCCGGAAAGAAAGGTACCCGCTGGAAAATGGCCCCTCCAAATCGGATGAAGAAGAGAGAGAAAAGATCGCAAGTTGCTATGCTCCTACTGTGAATCTCCATCTCTCCAAAGGAGTCGTAACCAAAGGAGACAGCTTACAAGAAATGTGGAAGATTAATGGCGCTTCTTTCACTCCCAGTCAGCAAAGCCTCTTGCCAAGGTTAGGGGGCATGCCAAGGTTAGGGGCATGGCATAAATCACAAGACATAGCCTTGAAGCCCTGGTTCTCTATTGAGTGCCATTTCCAGAGAGCCCCATTTACCCAAGAGTTACAAGCGCCAAACCTCTTTGGAAAACCAGTCCTAGAATACGATCTGGTGTGCAAACTTCAGAGCTCCACTCTCTAA >Zm00001d042811 ATGGCAACGCCCGATTTGTCCCCGGTCTCGCCGGTGCGGCGGGACGACAAGCAGTGCGCGCCATCCTCCTCGTCGTGCACAATTCTGAGAGTGCAGGACGCGTCCGCGGCCGAGGCGTACGAGCAGTACCTGCGGCTGCCGGAACTGTCGAGCCTGTGGGAGGCCGGGTGCTTCCCGGAGTGGGCGAGCGAGGGCCTGGTGAAGCCGGCGCTGCAGGCGCTCGAGGTCACCTTCCGCCTGGCGTCCCTCGCGCTCTCCGACCCGCGCGGGTACGCCAGCCGCCGCGAGCTCGCGCGCCGGCTGGAGTCGCTCGCGGCGCGGGAGGTGGGGCTGGTGTCCGCGCTCTGCGAGGGCGACCGGAGCGCGCCGCTCGCCGAGCTGGGCGCCTCCGGTGGCGTGCTCCCGCGCGAGCGCAGCGCGTCCGAGGTGTGGCAGCTGCCCGGGAGCGCCGCCGCGGTCGTGTGCCAGGTCAGCGAGGCCAGCCTGCTCCCGCGCCTCGCCGCGTGGGACAAGTCCGAGACGCTCGCGGCCAAGATCATGTACGCCATCGAGAGCCAGATGCAGGGCTGCGCCTTCACGCTCGGACTCGGCGAGCCCAACCTCGCCGGCAAGCCCGTGCTCGAGTACGACCGCGTCGTGCGCCCGCACGAGCTGCACGCGCTCAAGCCCAAGCCAGCGCCGGAGCCCAAGTCTGGGTACCTCAACAGGGAGAACGAGACGCTGTTCACCATGTACCAGATACTCGAATCGTGGCTGCGCGCCGCGTCGCAACTCCTCGCCCGCCTCAACGAACGGATCGAAGCCAAGAACTGGGAAGCGGCGGCTGCCGACTGCTGGATCCTGGAGCGCGTGTGGAAGCTGCTCGCCGACGTCGAGGACCTCCACCTGCTGATGGACCCGGACGACTTCCTGCGGCTCAAGGGCCAGCTCGCTGTACGAGCGGCTCCATGGTCTGACGCGTCGTTCTGTTTCCGGTCCAGGGCGCTCCTGCACGTCGCTAACACCACTAGGGACCTCAAGAAGCGTGTGCCCTGGGTGCTCGGTGTCGAGGTGGACCCCAACGGCGGCCCGCGGGTGCAGGAGGCAGCCATGATGCTGTACCACAGCCGTAGGCGCGGCGAGGGCGAGGAGGCGGGCAAGGTGGAGCTGCTCCAGGCCTTCCAAGCAGTGGAGGTGGCCGTGAGAGGATTCTTCTTCGCGTACCGGCAGCTCGTGGCGGCGGTGATGGGCACGGCGGAGGCGTTGGGCAACCGGGCGCTGTTCGTGCCGGCGGAGGGGATGGATCCATTGGCCCAGATGTTCCTCGAGCCACCCTACTACCCCAGCCTGGATGCCGCCAAGACGTTCCTAGCGGATTACTGGGTTCAGCAGATGGCGGGGGCCTCTGCTCCGTCAATACAAAGCTGA >Zm00001d012321 ATGGCAACGCCCAAGCTGTCCCCGGTCTCGCCGGTGCGGCAGGACGGCAACGACAAGCCGTGCGCGCCATCCTCCCCCTCCTCCTCCCCGTCGACCGTTCTGAGTGCGCAGGACGCGTACGAGCAGCACCTGCGCCTGCCGGAGCTGTCGAGCCTGTGGACGGCCGGATGCTTCCCGGAGTGGGCGGGCGAGGGCCTGGTCAAGCCGGCGCTGCAGGCGCTGGAGGTCACCTTCCGCCTCGCGTCCCTGGCGCTCTCCGACCCGCGCGGGCACGCCGGCCGCCGCGAGCTCGCGCGCCGGCTGGAGTCCCTCGCGGCGCGGGAGGTGGAGCTGGTGTCGGCGCTCTGCGAGGGCGACGGCCGGGGCGCGCCGCTCGCCGAGCTGAGCGCCTCCGGGGGCGTGCTCCCGCGGGAGCGCAGCGCGTCCGAGGTGGTGGTGTGGCAGCTGCCCGGGAGCGCCGCCGCGGTCGTGTGCCGGGCCAGCGAGGCCAGCCTGCTCCCGCGCCTCGCCGCGTGGGAGAAGTCTGAGGCGCTCGCGGCCAGGATCACGTACGCCGTCGAGGGCCAGATGCAGGGCTGCGCCTTCACGCTCGGCCTCGGCGAGCCCAACCTCGCCGGCAAGCCCGTGCTCGAGTACGACCGCGTCGTGCGCCCGCACGAGCTGCACGCGCTGAAGCCCGACCCTGCGCCGGAGCCCATGTCCGGCTACCGCAACCGGGAGCTCGAGACTCTGTTCACCATGTACCAGATACTCGAGTCCTGGCTCCGCGTCGCGTCGCAGCTGCTCACCCGCCTCGACGAGCGGATCGAAGACAAGTGCTGGGAGGCGGCGGCCGGCGACTGCTGGATCCTGGAGCGCGTGTGGAAGCTGCTCGCGGACGTCGAGGACCTCCACCTGCTGATGGACCCGGACGAGTTCCTACGGCTCAAGAGCCAGCTCGCCGTACGAGCGGCGCCGGGGTCTGAGTCCGCGTCCTTCTGTTTCCGGTCCACGGCGCTCCTGCACGTCGCTAGCGCCACTAGGGACCTCAAGAAGCGTGTGCCCTGGGTGCTCGGTGTCGAGGCGGACCCCAGCGGCGGCCCACGGGTGCAGGAGGCGGCCATGAAGCTGTACCACAGCCGTAGGCGCGGTGAGGGCGAGGAGGCAGGCAAGGTGGACCTGCTCCAGGCCTTCCAGGCGGTGGAGGTGGCCGTGAGAGCATTCTTCTTCGGGTACCGGCAGCTGGTGGCGGCGGTGATGGGCACGGCGGAGGCGTCGGGCAACCGGGCGCTGTTCGTGCCGGCGGAGGAGATGGATCCGCTCGCCCAAATGTTCCTGGAGCCGCCATACTACCCTAGCCTGGACGCCGCCAAGACGTTTCTAGCGGATTACTGGGTTCAGCTTCAGCAGATGGCGGAGGCCTCTGCTCCGTCAAGACAAAGCTGA >AH016368 ATGGTCGATTTCGATTGCAAGACAAAGATGGTTCAATCAACCCCAAATCTCTCTAGAAAATCCCCCATAATTTCACGTAATAAATCGATTTCTTCAATTTCACCTGTACCAATTTTCGCCGGAGAATTATCTCCGGCGTCGGAACCGTCATGTATAGCTTACGAGACATACCTTAAATTACCTCAACTCCGTCAACTATGGAGTTCTAAAGAATTTCCTTGTTGGGAAAACGAGTCAATAATTAAACCGGCTTTACAAGCTTTAGAAATCACTTTCCGGTTTATTTCTCTCGTTTTATCCGATGCTAGACCGTACGTGAACCGGAGAGAATGGAAACGGAGATTAGAATCATTAACTAGAAATCAAGTGGAGATAATCTCACTTTTGTGTGAAGATGATGATACACGTGGCGCATCTCCGATCGTTGATTTGAGTTCATCGTACGGTGAGGTGATTCCACAAACAGGAAGTTCAGCGGAAGTTTGGAAACTTGCAAATGGGGTACACGATACTACCGTGGTCTGCCGTACCAGTGAATTTAGTCTCTTACCACGACTTGCCACGTGGCATACATCGGAAGAAATTTCTTCTAGAATATTTTATTCTATTGAATCTTCCATGAGAAGGTGTCCGTATACTTTAGGCCTGGGCGAGCCCAACTTAGACGGGAAGCCCAATTTGGATTACGACGCCGTTTGCCGTCCTTCAGATCTCCACGCGCTGAAAAAGAGCGCGTTGGATAATATTCAAAATCCCGAAAATCAAATTTTATTCACAATTCATCAGGTTTTCGAATCGTGGGTATTTTCATCAAAACAATTGTTAACCAGAATTGGAAATAGAATCAGCAAAGAAGAATTCGCTAAAGCAGCAGATGATTGTTGGATATTGGAAAGAATCTGGAAGCTTCTAGAAGAAATCGAGAATCTTCATCTACTAATGGATGTTGATGATTTCTTGCATTTGAAAACACAATTGAGGATGAAAACGACGTCGGATTCTGAAACATTTTGTTTCAGATCAAAAGGATTAATCGAGATTACGAAATTAAGCAAAGATCTAAGGCATAAAGTTCCAGAAATTCTAGGCGTTGAAGTGGATCCAATGGGAGGTCCGATAACTCAAGAGTCTGCAATGGAATTGTATAGAGAGAAAAGAAGGTTCGAGAAGATTCATCTGTTACAAGCTTTCCAAGGGGTGGAATCTGCTGTGAAAGGGTTTTATTTTAACTATAAGCAGTTGTTGATGATCATGATGGGAAGTTTAGAAGCTAAGGCTAATTTTGCTGTCGTGGGTGGTTCTGAACCGTCTGATATGTTGAGTCAGATCTTTTTGGAACCTACGTATTATCCCAGCTTAGATGGTGCAAAAACGTTTATCGGTGATTCTTGGGAGCATGATCAAACGGCTGTAATTCGATCTGGTAAACAGTGA >AH023070 ATGGTACAATCTACTCCAAATCTTTCTAAGAAATCTCCTAAAATCTCGCGTAATTTATCTACACCGTCGATTTCTCCGATTCCGATTCTCGCCGGTGAGTTATCTCCGGCATCGGAAACTTCTTGTGTAGCTTACGAAGCTTATCTTAAATTACCGGAACTCCGGCAACTATGGAGTTCTAAGGAATTTCCTTGTTGGGAGAATGAGTCGGTTATTAAACCGGCTTTACAAGGTTTAGAAATTACTTTCCGGTTTATTTCACTCGTTTTATCCGATTCTAGACAGTATTTGAACCGGAAAGAATGGAGCCGGAGATTGGAATCTTTAGCGAAGGATCAAGTGGAGTTAATCGCTTTGTTATGTGAAGATGATGATACGCGTGGCGCTGCGCCTATCGTTGATTTGAGTTCATCGTTTGGTGAGGTTATACCACAAACAGGAAGTTCAGCTGAAGTTTGGAAACTTGCAAATGGGGCGCATGAAACTACCGTGGTCTGTCGTACCAGCGAATCTAGTCTCTTACCACGACTGGCCACGTGGCAGACGTCGGAAGAAATTTCTTCTAGAATATTCTATTCGATTGAGTCTGCAATGAGAAGGTCGGCGTATACTCTCGGCCTTGGAGAGCCTAATTTAGACGGAAAACCTAATTTGGATTACGACGCTGTTTGCCGTCCTTCTGAACTTCACGCGCTTAAAAAAAGTGCGTTGGATAATATTCAAAATCCGGAGAATCAAATTCTGTTCACAATCCATCAGATTTTCGAGTCATGGATTTATTCATCAAAACAATTGTTGATTCGAATAAGTGATAGAATCAGCAAAGAAGAATTTACAAAAGCAGCAGATGATTGCTGGATTTTGGAGCGAATCTGGAAGCTTCTAGAACAACTCGAGAATCTTCATCTGTTAATGGATGTTGATGATTTCTTGCATTTGAAAACACAATTAAGGATGAAAACGACGTCGGATTCTGAAACATTTTGTTTTAGATCTCGAGGACTAATCGAGATAACGAAGCTAAGCAAAGATTTAAGGCATAAAGTTCCAGACATTCTAGGCGTTGAAGTAGACCCGATGGGAGGCCCGATTATTCAAGAATCGGCAATGGAGTTGTACAGAGAGAAAAGAAGGTTCGAGAAGATTCATCTTTTACAAGCATTTCAAGGAGTAGAATCTGCTGTGAAAGGGTTTTATTTCAATTATAAGCAGTTGTTGATGATCATGATGGGAAGTTTAGAAGCTAAGGCTAATTTTGCTGTCGTGGGTGGTTCTGAATCGTCCGATTTGGTGAGCCAGATTTTCATGGAACCGACTTATTATCCCAGTTTAGATGGGGCTAAAACTTTTATTGGTGATTCTTGGGAGCATGATCAACTGGCTTTGTTTCGGGTCAGTAGACATTAA >NNU_03790 ATGGTCGATTTGGATTGGAAGGCAAAAATGGTTTCATCCGACATGTCCTGCACCTCGCCCAAATTCTCCAATAAATCTCGTGGTTCGCTACCGTCTCCTCTTCGCTTCGCCGTCAGCGATTTATCCCCCGCTCCCTCATCTGCCTGTTTAGCTTATGAACAATTCGTCCGCCTTCCAGAGCTCAGCAAACTCTGGACGTTTAATGAGTTCCCTGGCTGGAAGAACGAGTCCATTCTCAAACCAGCGTTGCAAGCTCTGGAAATCACGTTCCGCTTTATCTCAGTTGTTTTATCCGATCCTAGACCGTACGTGAATCAGCGCGAGTGGAGACGCCGACTCGAGTCCCTGGCTACTCACCAAATCGACATCATTGCTATTCTCTGCGAAGATGACGTAGAGGCTGCCGAGACTCGTGGAACTGCGCCTATCGCCGATCTCAATTCTTCTAACGGTGTTTTGGCTCGTAACAGGAGCTCCGCCGTATGGAACCATCCAGGTGGAACGCCCGTTGTGAGCCGCACCAGCGAAGCAAGTTTGCTTCCTCGCCTTGCGACATGGCAGAAGTCGGAGGATATTGCTTCCAAGATCTTGTTTTCCATCGAGTGCGAGATGCGGAGGTGTCCGTTCACGTTAGGTTTGGGCGAGCCAAACCTAGCTGGAAAACCCAACCTCGAATACGACCTCATCTGTAAACCGTCTGACCTCCATTCCTTGAAGAAAAGCCCATCCGATCGAAGGAATCTCGACAACCACGAGAACCAGACGCTCTTCACCACTCACCAGATATTGGAATCGTGGATACAGGTATCTCGGGAGCTTCTCCGACGAATTGAAGAAAGAATCGATGGCCAGGAATTCGGGACAGCAGCGAGCGACTGCTGGTTACTCGAGCGAATTTGGAAGCTTCTCACAGAGATAGAAGACCTGCACCTTCTTATGGATCCGGACGATTTTCTCCGCCTGAAGAACCAGCTTGCGATTAAAGCTTCGACGGAATCCGAAGCCTTTTGCTTCCGGTCCAAGGCACTGATTGAAATAACTAAATCTTCTAAAGATCTGAAGCAGAGGGTTCCGGCGGTCTTGGGCGTGGAAGTGGATCCGAAAGGAGGTCCAAGGGTTCAGGAAGCGGCGATGAAGCTCTTTCATGGCCATCGAAAGGGGGATTTTGAAAAAATCCACCTAGTTCAAGCGTTTCAGGCTATCGAGTCGTCTTTGAAAACTTTCTTCTTTTCGTATAGACAATTGATAGGAGTGGTCATGGGGAGCTTGGAGGTGAAGGCGAATCGAGCTCTGATCTATGCGGATTCTTCTGATACTCTGTCTCAGATCTTCTTGGAACACACATATTTTCCAAGCTTGGATGCCGCGAAGACATTTTTGGAGGATTTCTGGCATCACGAGCTTGGGATCGCCGGCTCGAATGGGCCAGACAGAGCCCGGACCAAACAGTAA >NNU_18566 ATGGTATCGTCCGATATGTCCTGCACATCACCGAAACTCTCCAATAAGTCTCGCGTTTCGCTCCCCTCTCCGCTTCGTGTCGTCGTCACCGATTTATCCGCTGCCCCGTCATCTGCTTGTCTTGCTTACGAACAATATCTTCGCCTCCCTGATCTCTGCAGGCTATGGACGTCCAAAGAGTTTCCCGGCTGGAAGAACGAATCCATTCTCAAACCGGCGTTGCAAGCCCTCGAAATCACGTTCCGGTTTATCTCGCTCGTCTTATCCGATCCTAGACCGTACGTCAACCAGCGCGAGTGGAAACGTCGACTCGAGTCCCTGACTACTCGCCAGATCGAGCTCATCGCCCTCCTCTTTGAAGATGATGTCCAAGTCGCCGAGACTCGTGGAACTGCGCCTATCGTCGATGTCAGCTCATCTAACGGTGTCTTGGCTCGTGATAGGAGCTCGGCTGTGTGGAAGCATCCGGGTGGAACTCCCGTCGTGAGTCGAGCCAGCGAAGCAAGCTTGCTTCCTCGGCTAGCTACCTGGCAGAAATCAGAGGATATCGCTACCAAGATCTTCTTCGCCATCGAGTGCCAGATGCAGAAGTGTCCATTCACGTTAGGTTTGGGCGAGCCGAACCTTGCCGGGAAACCTAACCTGGAGTACGATCTCATCTGCAAGCCCTCCGATCTCCATTCCCTTAAGAAAAGCCCATCCGATCAAAAGAATCTCGACAACCACGAGAACCAGACCCTCTTTACTACTCACCAGATATTGGAATCATGGATCTTCGTATCTCGGGAGCTTCTCCGACGTATCGGTGAAAGAATAGATGCCCAGAATTTCGAAAGAGCAGCAAGCGATTGCTGGTTACTTGAACGAATCTGGAAACTTCTCACAGAGGTGGAGGATCTCCATCTTCTTATGGATCCGGACGATTTTCTCCGCTTGAAGAACCAACTCGGTATCAAAGCATCGGTGGAATCCGAAGCCTTTTGCTTCCGGTCCAAGACACTGATTGGAACCATCAAATCTTCGAAGGATCTGAAGCACAAGGTCCCGGCGATCTTAGGCGTGGAAGTAGACCCAAAGGGAGGGCCGAGGATTCAAGAAGCAGCAATGAAGCTATATCATGGACATAGAAAGGAAGATATCGAGAAAATCGATCTACTTCAGGCGTTGCAGGCCATCGAAAATGCTCTGAAAAGGTTCTTCTTCTCGTATCGGCAGCTAATAGGGATGGTGATGGGCAGCTTGGAAGTAAAAGGAAATCGAGCTCTGGTGTATATGGATTCTTCTGATGCGCTGTCTCAGATCTTCTTGGAACCAACATATTTTCCAAGTTTGGATGCTGCGAAGACGTTTTTGGGGGACTTCTGGCATTACGAGTGCGGGATCGCCAGTAAGAATGGATCCGACAGAGATCGGACCAAATAG >NNU_24369 ATGAGTTCCCTGGCTACAAGAACGAGTCCATTCTCAAACCAGCTTGCAAGCTCTGGAAATCAGCACGAGTGGAGATGCCAACTCGAGTCCCTGGCTACTCACCAAATTAAGATCATTGCCATTCTTTGCAAAGATGACGTAGAGGTTGTCCAAACTTGTGGAACTGCGCCTATGGCGGTTCTCAATTCTTCTAACGATGTTTTGGCTCGTAACAGGAGCTTTGCCATATGGAACCATCCAGGTGGAACACCCATTGTGAGTCACACCAACGAAGCAAGTATGCTTCCTCGCCTTGTGACATGGCAGAAGTCGGAGGATATTGCTTCCAAGATCTTGTTTTCCACCAAGTGA >NNU_24370 ATGAATCAATGGCTAGGAATTCGGAACAGCAGCAAGCTACTGCTGGTTATTCAAGCAAGTTTGGAAGCTTTTCACAGAGTAGAAGACCTTTACCTTTTTATAGATCCAGAGGGTTTTCTCCGCCTGAAGAACCAACTTGCGGTTAATGCTTTGATAGAATCCGAAGCCTTTTACTTCCGGTCCAAGGCACTGATTGAAATAACTAAATCTTCAAAGTATTTGAAGCAGAGGGTTCCGATAATTTTGGGCATGGAGGTGGATCCGAAAGGAGGGCCAAAGGTGTAG >Glyma.02G255400 ATGGTTGATCTAGATTGGCAAACAAAGATGGTTCACTCCAACATCATGCCTCCAATGTCCCCCAAACTCTCTCTCCCGGATCATAACATTCCAATCCCAACTTTGCAACTCCCCCTTCGCCAAAACGACATCACCGCAGCGTCGTCTCCTATCTGCGCTGCATACGACAACTACCTTCGTCTCCCTGAGCTCAGAGCCCTCTGGGCCTCCAAGGACTTCCCCAATTGGGCCAACGAGCCCATCTTAAAGCCCGCCTTACACGCCCTCGAAATCACCTTCCGCTTACTCGCAACCGTTTTCTCCGACCCGAGACCGTACATCAACAAACGCGAGTGGACCCGACGCGTCGAGTCTCTCGCCACGGCCCAAATCCAGATCATAGCCATGTTATGCGAAGACGAAGAAGAAAACCCCGAGACACGTGGCAAGGCACCCGTGACTGACATTAACGGCTTTACCGGTCAAAGCAGAAGCTACAGCGAGGAAAGCCTGCTCCCGCGCCTCGCCACGTGGCAGAAATCCAAGGACGTGGCGCAGAGGATTCTCAATTCGGTGGACTACGAGATGGGGAGGTGCACCTACACCTTAGGTTTAGGAGAGGCGAATATCGCGGGAAAGAAGATATTTCTCTTCGACGCGGTTTGCAGGCCGAGGGAGATTCACTCGTTGGAGACGACGCCGTTTGATGATTACGTGGGGAACCACGAGAACAAGACGCTGCACGCCACGCAGCAGATCGCCGAGTGTTGGACGCGCTCGGTGAAGAAGCTGCTGGAGAGAGTAACGGAGTCGGTGGAGAAAAAGGCGTTGGAGAAGGCCGCGAGTGAGTGCCATGCGGTGGAGCGGATCTGGAAGTTGTTAACGGAGGTTGGGGACATGAACCTCATGATGGATCCAGAGGATTTCTTGAGGCTGAAGAAGGAGTTAGGGATGATGAGAACTGCGGGCGAAACGGTGGCGTTTTGCTTCAGGTCGAGGGAGCTTGTGGAGGTGGCGAGGGTGTGTAGGAATCTGAGGGAGAAGGTGCCGGAGATATTGGAGGTGGAGGTGGACCCCAAGGGTGGGCCCGGGATGATGGAGGCGGCGATGAAGGTTTACTCGGAGAAAGAGAAAGGGAAGGTTCATGTTTTGCAGGGGATGCAGGGGATTGAGGTGGCGATGAAGAGGTTCTTCTACGCGTATAAGCAGGTTGTGACGGTTATGATGGGGAGCTCCGAGGCCGATAATGGGTTCACCAAGATATTCCTTGAACCCACTTATTTCCCTAGCTTGGATGCTGCCAAGACCTTTCTTGGTTATTACAACCAAAATTAA >Glyma.11G228100 ATGGTTGATTTACATTGGAAATCAAAGATGCCAAGTTCCGACATGCCTTCCAAAACTCTCAAACTCTCTCTCTCCGACAACAAGTCCTTACCCTCTTTGCAACTACCCTTCCGCACCACAGATATCTCTCACGCCGCACCTTCTGTTTGCGCCACTTACGACTACTATCTCCGTCTTCCTCAACTCAGAAAGCTTTGGAACTCCTCAGATTTTCCTAATTGGAACAACGAACCAATCTTAAAACCTATCTTGCAAGCTCTCGAAATCACCTTCCGCTTTCTCTCCATTGTTCTCTCCGATCCAAGACCTTACTCCAACCACAGAGAATGGACTCGCAGGATAGAGTCTCTTATCACACATCAAATTGAAATCATTGCCATACTTTGTGAAGATGAGGAACAAAATTCCGACACACGTGGCACTGCACCAACCGCTGATCTCAGCAGGAACAATAGCAGCGAGAGCAGAAGCTACAGCGAGGCAAGCCTGCTTCCGCGGCTTGCCACGTGGTACAAATCCAAGGACGTAGCGCAGAGGATCCTTCTCTCAGTTGAATGCCAAATGAGGAGGTGTTCCTACACGCTGGGTTTGGGTGAGCCGAACCTAGCGGGCAAACCGAGCCTGCTCTACGACCTCGTGTGCAAGCCGAACGAGATCCACGCGCTGAAGACGACGCCGTACGATGAGCGCGTAGAGAATCACGAGAACCACGCGTTGCACGCGACGCACCAGATCGCCGAGTCGTGGATCCACGCGTCGCGGAAGGTTCTAGAGAGGATCGCAGACGCGGTCCTCTCCAGAACCTTCGAGAAGGCGGCTGAGGACTGCTACGCCGTGGAAAGGATCTGGAAGCTTCTCGCGGAGGTGGAGGACCTCCACCTGATGATGGATCCGGACGATTTCTTGAGACTGAAGAATCAGCTCTCGGTGAAATCCTCCGGCGGCGAAACGGCTTCGTTCTGCTTCAGGTCGAAGGAGTTGGTTGAACTGACGAAGATGTGCAGAGATCTGAGGCACAAGGTGCCGGAGATATTGGAGGTGGAGGTGGATCCGAAGGGAGGACCGAGGATTCAAGAGGCGGCGATGAAGCTCTACGTTTCGAAGAGCGCGTTCGAGAAGGTTCACTTGTTGCAGGCGATGCAGGCGATTGAGGCGGCGATGAAGAGATTCTTCTACGCGTATAAGCAGGTGTTGGCGGTGGTGATGGGAAGCTCCGAGGCTAACGGTAACCGAGTTGGGTTGAGTTGCGACTCGGCTGACTCGTTGACTCAGATTTTCCTTGAACCGACGTATTTTCCAAGCTTGGATGCCGCCAAGACTTTTCTTGGATACTTGTGGGATAATAACGATAATAACAAATGGATATGA >Glyma.14G061200 ATGTGTGTCTCCCTCTCGTATAAATACACTACCATCTTCCATTTCCTCTTCAAATCCAATTCACCAAACATGGTTGATCTAGATTGGCAAACAAAGATGGTTCACTCCAACATGCCTCCAAAGTCCCCCAAACTCTCTCTCCCGGATAATAACATTCCAATCCCCCTTCGCCAGAACGACATCACCGCAGCGTCGTCTCCAATCTGCGCTGCCTACGACAACTACCTCCGCCTCCCTGAGCTCAGAGCCCTCTGGGCCTCCAACGACTTCCCTAATTGGGCCAACGAGCCCATCTTAAAGCCCACCTTACACGCCCTCGAAATCACCTTCCGCTTACTCGCAACCGTTTTATCCGACCCGAGGCCGTACATAAACAAGCGCGAGTGGACCCGGCGGGTGGAGTCTCTCGCCACGGCCCAAATTCAGATCATAGCTATGCTGTGTGAAGACGAAGAAGAAAACCCCGAGACACGTGGCACGACGCCACCGGTGAGTGACATTAACGGCTTCATCGCTCAAAGCAGAAGCTACAGCGAGGAGAGCCTGCTCCCGCGCCTCGCCACGTGGCACAAATCCAAGGACGTGGCGCGGAGAATCCTCGATTCGGTAGAGTACCAGATGATGAGGTGCACGTACACCTTAGGTTTAGGAGAGGCGAATCTCGCGGGTAAGAAGATATTCCTTTACGACGCCGTTTGCAGGCCGAGCGAGATTCACTCGTTGGAGACGACGCCGTTTGATTACGTGGGGAACTGCGAGAACAAGACGCTGCACGCGACGCAGCAGATCGCGGAGTGTTGGACGCGCGCGGTGAGGAAGCTGCTGGAGAGAGTGGCGGAGTCGGTGGAGAGAAAAACGTTGGAGAAGGCGGCGAGGGAGTGTCACGCGGTGGAGCGGATCTGGAAGTTGTTAACGGAGGTTGAGGACGTGCACGTGATGATGGATCCGGAGGATTTCTTGAGGTTGAAGAAGGAGTTGGGAATGATGAGAAATTGCGGGGAAATGGTGGCGTTTTGCTTCAGGTCGAGGGAGCTCGTGGAGGTGGCGAGGATGTGTAGGGATCTGAGGCAGAAGGTGCCGGAGATATTGGAGGTGGAGGTGGACCCCACGGGTGGGCCCGGGATGATGGAGGCGGCGATGAAGGTTTACTCGGAGAAAGAGAAAAGGAACGGGTTCGAGAAGGTTCATGTTTTGCAGGGGATGCAGGCGATTGAGGTGGCGATGAAGAGGTTCTTCTACGCCTATAAGCAGGTTGTGGCGGTTATGATGGGGAGCTCCGAGGCCGATAATGGGTTCACTCAGATATTCCTTGAACCCACTTATTTCCCTAGCTTAGATGCTGCCAAGACCTTTCTCGCTTATTATTGGGAAAATAATAATCAAAATGTGGTTCCCTGCTAG >Glyma.18G029300 ATGGTTGATTTACATTGGAAATCAAAGATGCCTAGTTCCAAAACACCAAAACTCTCTCTCTCCGACAACAAGTCCTTACCCTCTTTGCAACTACCCTTCCGCACCACAGATATCTCTCCCGCCGCTCCTTCCGTTTGCGCCGCTTACGACTACTATCTCCGTCTTCCTCAACTCAGAAAGCTTTGGAACTCCACTGATTTTCCTAATTGGAACAACGAACCGATTCTAAAACCAATTTTGCAAGCTCTCGAAATCACGTTCCGCTTTCTTTCCATTGTTCTCTCCGATCCCAGACCTTACTCCAACCACAGAGAATGGACTCGCCGGATAGAGTCTCTCATCATGCATCAAATTGAAATCATTGCCATACTTTGTGAAGAAGAGGAACAAAATTCCGACACACGTGGCACTGCACCAACCGCTGATCTCAGCAGCAGCAATAGCAGCGTGAGCAGAAGCTACAGCGAGGCGAGCCTGCTTCCTCGGCTTGCCACGTGGTACAAATCCAGGGACGTGGCGCAGAGGATCCTTCTCTCCGTGGAATGCCAAATGAGGAGGTGCTCCTACACGCTTGGTTTGGGCGAGCCGAACCTAGCGGGGAAGCCGAGCCTGCTCTACGACCTCGTGTGCAAGCCGAATGAGATCCACGCGCTGAAGACGACGCCGTACGACGAGCGCGTGGAGAACCACGAGAACCACGCGGTGCACGCCACGCACCAGATCGCGGAGTCGTGGATTCACGCGTCGCGGAAGGTTCTGGAGAGAATCGCGGACGCGGTGCTCTCCAGAACCTTCCTGAAAGCAGCAGAGGACTGCTACGCCGTGGAGAGGATCTGGAAGCTTCTCGCGGAGGTGGAGGACCTCCACCTGATGATGGATCCGGACGATTTCTTGAGGCTAAAGAATCAACTCTCGGTGAAATCCTCGAGCGGCGAAACGGCATCGTTCTGCTTCAGATCGAATGAGTTAGTGGAACTGACGAAGATGTGCAGAGATCTGAGGCACAAGGTGCCGGAGATATTGGAGGTGGAGGTGGATCCGAAGGGAGGACCGAGGATTCAAGAGGCGGCGATGAAGCTCTACGTTTCGAAGAGCGAGTTCGAGAAGGTTCACTTGTTGCAGGCGATGCAGGCGATTGAGGCGGCGATGAAGAGATTCTTCTACGCGTATAAGCAGGTGTTGGCGGTGGTGATGGGAAGTTCAGAGGCTAACGGTAACCGAGTTGGGTTGAGTTGCGACTCGGCTGACTCGTTGACTCAGATTTTCCTTGAACCGACGTATTTTCCAAGCTTGGATGCCGCCAAGACTTTTCTTGGATACCTGTGGGATAATAACGATAATAACAAATGGATATGA >MELO3C008286 ATGGTTGATTTGGGTTGGAAGGCAAACATGGTTTCCTCCGACAAGACCACCACCACCACCACCACCACTAAATCCCCTAAGATCATCCCCATCGCCAACAACAAGCTTAATCTATCTCTTCCCGTTTCCTTCCGCTCTTCAGAGCTCTCCACTGCTTCACCTTCCTCTTGTTCCTCATACGAACAGTACCTTCGTCTCAACGATCTCAGGAAGTTATGGAGTTCTAAGGAGTTCCCTGAATGGAGGAATGAGTCGGTGTTGAAGCCGGGTTTACAGGCTTTGGAGATTACTTTCCGGTTCATATCGACCGTTTTGTCTGATCCACGTCCGTACGCGAACCGGCGGGAGTGGAAGAGGAAGCTTGAGTCTCTTACCACCACTCAGATCCAACTCATTGCTATGATTTGTGAAGACGACGAAGAGGACGGTGAATCACGCGAAGCCACTGTTGTGAACAGAACGAGTGAATCGAGTCTTCTTCCTCGACTTGCGTCATGGCAGAGCTCTGAAGACATTGCGCAGTTGATTCAATACTCCGTTGAATGTGAGATGAGGAGATGTCCGTACACGTTAGGGTTAGGGGAACCGAATTTGGCTGGGAAACCGAATCTTGATTACGACCTAATTTGTAAGCCAAACGAGCTTCATTCTCTGAGGAAGAGTCTGTACGAACAAATCGAAAATTACGAGAATCAAACGGTTTACACAACGCACCAGATCCTGGAGTCGTGGATTTACTCCGCGCATGAACTTCTGAAACGAATTGAAGAGAGAATCGAGAAGAAGAATTTCGCGGGAGCTGCGAGTGATTGTTATATGATGGAACGGATCTGGAAGCTTCTACAAGAGATTGAAGATCTTCATCTTCTAATGGATCCGGATGATTTCCTAAAGCTGAAGAATCAGCTAGCGATCAAATCACTTCAAGAATCAGAAGCGTTTTGCTTCAGATCGACGACGTTGGTGGAGATTACAAAGCAATGCAAGGATCTGAAGCACAAGGTGCCGTTGATCTTGGATGTGGAAGTTGATCCAATGGGGGGACCAAGGATTCAAGAGGCGGCGATGAAATTGTACAGCGAGAAACAAGAGCCGGAGAAGATCCATCTTCTTCAAGCTATGCAAGCGATTGAATCGGCGATAAAGAAATTCTTCTTCGCATACAAGCAAGTTCTGGTAATGGTGATGGGAAGCTTAGAGGCGAAGGGGAACCGAGTTGTGGTGAGTTCGAACTCGGAGGATTCATTGAGTCAGATATTTCTAGAACCCACTTATTTTCCGAGTTTAGATGCTGCTAAGACGTTTCTTGGGGATTTACATAGTGTTTTCGGGTCGGATCGGAGGACCCGGATGAAGACTTAG >Eucgr.G03040 ATGGTGGACTTCGACTGCAAGACCAAGGTGGTCTCCTCCCCCGACGCTTCCCTCGGCTCGCCCAAGTTGCCCCCCGGCAACGGCGGCAGCGTGCAGCTCCCGTTCTTGCTCCCCGCCGCGCCGTTCCGGTGCCCCCCCGGCCCGGCCGCCGCCGCCGCCACCTCCGCCTCGGCTCATGCCGTCGCCGCCTACAAGCAGTACCTGCGTCTGCCGGAGCTGCGGAAGCTCTGGGGGGCCCGGGAATTCCCCGAGTGGAGGGCCGAGCCGCTGCTCCGGCCCGCCCTGCAGGCCCTCGAGATCACCTTCCGGTTCGTCTCGACCGCGCTCTCCGACCCGAGGCCGTACACCAACCGCCGCGAGTGGAGGCGGCGGCTCGAGTCCCTCGCCGCTGGTCAGATCCGGCTCATCGCAGCCATCGTGGAGGACGAGGAGGCGGAGGAGGGCGGCGGCGCGGCTCCCCTCGTCGGCTTGAGCTCAGCCGGCGGCGCGCTGGCGCGGGGCGGCAGCTCGGCCGAGGTGTGGAGGATCCCGGGGGCCGCCGAAGCGGCGGTGAGCCGAGCCAGTGAGGCGAGCCTCCTGCCCCGGCTCGCCACGTGGCACACCTCGGAGGACGTGGCGCAGCGGATCCTGTACGCGATCGAGTGCGAGATGCGGGGGTGCCCGTTCACCCTCGGGCTCGGCGAGCCGAACCTGATCGCCAAGCCAGCGCTGCTGTCGAGCGAGCTCCACGCCCTGAAGCAGAGCGTCAGCTCGAGCGAGCACGTCGAGAGCTACCACCAAAACCCAGTTGCTCCACGCGCGCACCAGATTCTGGAATCGTGGATCTGCGCTTCCAGCGAGCTCCTGAAGCGCATCGAGGAGAGGATCGAGGAGGCGCGATTCCAGCAAGCCGCGAGCGGCTGCTACCTGCTGGAGAGGATCTGGAAGCTTCTCGCGGAGATCGAGGACCTCCCACCTGCTGATGGACCCGGAGGACTTCTTGAGGTTGAAGAAGGACCTCGCGATCAAGGCCGAGGCGGCGTCCTTCTGCTTCCGGTCCAAGGCCCTCGTCCAGGTCACCGGCAAGTGCAAGGACCTGAAGCACAAGGTACCGCGCGTCCTCGGCGTGGAGGCGGACCCCAACGGCGGGCCGCGGCTGCAGGAGGCGGCGATGCGGCTGTACCGCGAGAAGAAGGGGGAGGCCGCCGCCGCCGAGCGAATCCACCTCCTGCAGGCGATGCAGGCGGTGGAGGCGGCGGTGAAGCGGTTCTTCTTCGCCTACAAGCAGGTGTTGGCGGCGGTGATGGGGAGCCTGGAGGCGAGGGGGCCCAGGACGGCGGCGGCGGCGGCGGCGGCGGCTGGGGCGGGTGCGGAGGCAGGCGACTCGCTGAGCCAGGTGTTCCTGGAGGGCACTTACTTCCCGAGCTTGGACGCGGCGAAGACGTTCCTGGGGCGGATGCTGAGCAGCGGCGAGAACGCGAAACGCGGCGGCCGGAGCTCGGACCGGCGCGACTCCGGGAGGGCCCGTAG >Eucgr.J00236 ATGCCCTCCTCTCTCTCCTCTTCTCCTCCTCAATTTCGAATTACCAAAGCCAAGCCAAACCTAAACCGACGAGTGGAGGGAGAAATCCTTCGTTTCCTTTTTAAGTCGTTTGATGCTGCGAAGATGGTCGATCTAGACTGGAAAGCAAAGAGAGCCACGTCAACTGCCGCCGCCCCCGACATGTCCCGGAAGTCCCCCCGGCTCTCCAACAAGCTCCACCTGCTGATCCCCACGCCGTTCCGCGGCGGCACCGACGTGCCCGCCGCCTCGGGCTCGGCCTCCTCGGCCTACGAGGCGTACCTGCGCCTCCCCGAGCTGCGGCGGCTCTGGGGCTGCAGGGAGTTCCCCGACTGGAAGTCCGAGCCCCTCCTCCGCCCGCCCCTCCAGGCGCTCGAGATCACCTTCCGGCTCGTCTCGACCGTGCTGTCGGACTCCAGGCCGTACGCGCACCGGCGCGAGTGGAAGCGGCGGCTCGAGGCGCTGGCCGCGACCCAGATCGGGCTCATAGCGGCTATAATCGAGAGCGAGGAGGACGAGGCGGAGACGCGCGGCGGCGCGCCGATCGCGGACGTGACTTCGGGCGTCGGCGTGCTGGCTCGCAACTGCAGCTCGGCGGAGGTCTGGCGGCTCCCCGGGGGCGAGGCCGCGGGCACGGTGGTGAGCCGCACGAGCGAAGCCAGCCTGCTGCCCAGGCTGGGGACGTGGCAGACGTCGGAGGACGTGGCGCAGAAGATCCTGTACACCATCGAGTGCGAGATGAGGCGGTGCCCGTACACGCTGGGCCTGGGAGAGCCGAACCTGACGGGGAAGCCGAGCCTGGAGTACGACGCCGTCTGCAAGCCCGGCGAGCTTCGCTCCCTCGCGAAGAATCCGTACGATCACCAGATCCAGAATCACGAGAACCAGAACCTGTACACGACGCACCAGATCCTGGAGTCGTGGGTTCAGGCGTCGAACGAGCTCTTGAATCGCGTCGCGGAGCAAATCGAGAGCAACAGCTTCGAGACGGCAGCGACGTACTGTTACTTGCTCGAGCGGACATGGAAGCTAATGACGGAGATCGAAGACCTCCACCTGTTGATGGATCCGGAGGATTTCCTCCGGCTGAAGAACCAGCTCGACCTCCGGAGCGAGGCGGCGGCGTTCTGCTTCCGCTCGAGAGGGCTCGTCGCGATGACGAGGAAGTGCAGGGACCTGAAGCACAAGGTGCCGTACATCCTCGGCGTCGAGGTGGACCCGAAGGGAGGGCCGAGGGTTCAGGAGGCGGCGATGAGGCTGTTCGGCGGCGGCGAGAAGAGGGAGCAGTACGCCAAGATCCACCTCCTGCAAGCGCTGCAGGCGATCGAGGCGGCGATGAAGAGGTTCTTCTTCGCGTACCGGCAGGTGCTCGGGGTGGCGGTGGGGAGCCTGGAGGCGACGGCGAGCCGAGCGGCGATGAGCCTCGAGCGGGACGACTCGCTGAGCCAGATGTTCCTGGAGCCGACCTACTTCCCCAGCTTGGACGCCGCTAAGACGTTCCTGAGCGACTCGTTGAGCCGAGAGCGCGGTCAGGCGTCTTGA >DCAR_011797 ATGCTCAATATTGACTGCAAATCAAACATGATCACTTCAAACACTCCTAACAAATCTCCCAGGGTTTCGAATAAGCTCTCCGGTTTAGCTCCGCCGCCGCCGGTTCTCGCCACCGACGTAGCTCCGGCGAACGATGCTGATTGTGCGGCGTACGAGCAGTATATTCGGTTACCGGAGCTGAAGAAGCTGTGGAGTGTTCGAGAATTCGCCGGTTGGGTGAATGAACCGGTGATGAAACCGGCTTTATCGGCTTTGGAGATCACTTTCCGGTTCGTGTCGACCGTTATGTCTGATCCGAGGCCGTACACGAATCGAAGAGAGTGGACACGCCGACTCGAATCACTCGGAACGAGTCAGCTCCAAATCATAGCTCTGTTATGTGAAGACGAAGAAAACAGTTCGAGTCGCGGCAAAGCGCCTATCACGGATTTGAGCTCCGATGGAGCCGCTTTGTCGCGCGAAAATAGCTCCGCGGAGGTATGGAAACTCCGCGGAGAAACAACAGTAGTGAGCCGAGGCAGCGAGGTGAGCTTGCTGCCTCGGCTTGCTACGTGGCAAAAAACAGAAGATATTGCCGAGAAATTTGTGTACTCAATTGAATGCGAAATGAGGAATTGTCCGTACACATTAGGGTTAGGCGAGCCGAATTTGAGCGGAAAGCCGACTCTGGATTATGATCTCATCTGCAAGCCGGTACAGCTTCATGCTCTGAAACGGAGTCATTTGAATATCGAAAATTCGGAGAATCAATCTCTCTACACGATTTACCAAATTCTGGAGTCGTGGATTGATGTTTCAAATGAGCTTCTGAAACGGATTGGATCACAATTAGATAACGGAGAACTAAAATCCGCTTTAAATGATTGCTGGATTGTCGAAAGAATATGGAAGTTGTTAGCGGAGATTGAAGATCTTCACTTACTCATGGATCCTGATGACTTCCTGAGACTAAAAACTCAGCTGATGATCAAGTCCGAAGCCTTTTGTTTTCGATCTCGTGGTCTCGTTGAGATTACGAAGCTTTCCAAGGATCTGAAGCATAAAGTCCCGCAGATTTTGGGCGTAGAGGTGGATCCAACAGGAGGACCTGCTATTCAGGAAGCCGCGATGAAGTTGTACCAGAAGACGGGGGAATCAGGATTGGAACGGATACATTTGCTCCAGGCATTGCAGGGAATCGAATCGGCGTTGAAGCGGTTTTATTATTCGTATAAACAAGTAATTGTGAACGTTATGGGGAGCTTGCAGGCCACAGGGAAGTTCGTGTATGCTGATTCGGCGGACTTGCTCGGACAGATCTACTTGGAACCGACTTATTTCCCGAGTTTGGATGCAGCGAAGACGTTTTTGGGGGAGTATTGGCTTACTCACGGGAAGAAATGA >THA.LOC104810079 ATGGTGGATTCAGATTGGAAGACGAAGATGGTTTCATCAGACTTACCCACCAACAAGTCCCCGAAGCTCTCTCCCAAACCCCGCGTCACGATTCCGGCGGTTCCGATCAACGTCCCTGCATTGTCGCCGGTGTCCTGTTCCAGCTCCGCCGCTTGCTCTGCCTACGAGCTCTATCTCCGCCTCCCGGAGCTCAGGAGTCTCTGGTCCTCCAGAGGTTTCCCTCTGTGGAATTCCGAGCCCGTCCTGAAGCCGGCTCTTCAGGCGCTCGAGATCACTTTCCGACTGATCCTCGCCGTCTTCTCCGACGAGAGGCCGTACACCAATCGTCGAGAGTGGAGGCGGAGGCTGGAGATGCTGGCCACGAGCCAGGTCCAGTTGGTGGCGGCGATCTGCGAGGACGACGCCGAGGCGGAGGAGGCAGATAACGGTGGGTTAGCTCCGGTGGGAGATCGCCGGAGCGAGCTCAGCTTGCTTCCTCAGCTCGCCACGTGGCGTAAGACGGAAGACGTTGGGTTGAAGATCCTGAGCACTATCGACACCGAGATGCGGCGGAGCAGGTACGCGCTAGGGTTGGGCGAACGGAATCTCACCGGGAAAAAGTATCTCCGGTATGACGCCGTCTGCCGGCCGAACGAAATTCACAGCCTCAAGAACAATCCATTCTCCGATCACATCGACAACCGCGAGAATCAGATACTATACACAGTTCATCAGATCCTCGAATCGTGGATTCAAACCTCTTTGGTTCTCCTAAACCGGATCGAATCCAGGATAGGGGAGGGGAAATTTGAAGAGGCGTCGAGCGATGTGTACTTGCTCGAGCGTATCTGGAAGCTTCTCTCGGAGATCGAAGATCTCCACCTCCTGATGGACCCGGATGATTTCCTGAAGCTGAAGAATCAAATACAGATCAAATCGTCCTCACACAACGACGCGTTCTGCTTCAGATCGAGAGGGATCGTGGAGATGGCGAAGAGGTCGAAGGAGCTCCGGCAGAAAGTTCCGGCGGTCCTCGCCGTGGAGGTGGACCCCGCCGGAGGGCCGCGGCTGCAGGACGCGGCGATGAGGCTTTACGCGAGGAAGAGGGAACCGGAGAAGATCCACCTGCTTCAGGGGATGCAGGCGGCGGAGGCGGCCGCGAAGCGGTTCTTCTTCGCCTATCGGCAGCTTGTGGCTACGGTGATGGGGAGCGCTGAGGCGACGGCGAGTCACGATCCGAGTGACTCGCTGACGCGAGCGGTCATGGAGCCCACTTACTTCCCCAGCTTGGATGCCGCCAAGACGTTTCTTGGAGAATTCTGGGGCCGTTGGGGAGCGACGACTGATTAA >THA.LOC104824309 ATGGTGGATTTAGATTGGAAGACGAAGATGGTTTCATCAAACATACCCACCAACAAGTCCCCGAAGCTCTCTGCAAAGCTCCACGTCACGATTCCGGCGCCGTTCAAGGTCCCTTTAACGTCGCCGGTGTCCTGCTCGAGCTCCGCCGCTTGCTCCGCCTACGAGCTCTACCTGCGCCTCCCAGAGCTCAGGAGTCTCTGGTCCTCCAGAGATTTCCCTCAGTGGAATTCCGAGCCGATCCTGAAGCCCGCTCTTCAGGCGCTCGAGATCACTTTCCGGCTGATATTAGCCGTCTTCTCCGATGAGAGGCCGTACATCAATCGCCGCGAGTGGAGGCGGAGGCTTGAATCGCTGGTCATGAGTCAGGTCCAGTTGGTGGCGGCGATCTGCGAGGACGACGACGCTGCGACGGCGGAGGAGGACGACGGTGGATTTGCTCCGGTAGGAGATCACCGTAGCGAGCTCAGCTTGCTTCCTCAGCTCGCCACGTGGTGGAAGACAGAGGACGTTGGAATGAAGATCCTGAGCACGATCGAGAACGAGATGCGGCGGAGCAGGTACGCACTAGGGTTGGGTGAACGGAATATCGCCGGGAAAAAGTATCTCCGGTACGACGCCGTTTGCCGGCCGAGTGAAATTCACGGCCTCAAGAACAATCACTACTCCGATCACATCGATAACCCCGAGAATCAGGTCTTGTACTCAGTTCATCAGATCCTCGAATCGTGGATTCATACCTCTGGAAGTCTCCTTAGACGAATCGAGTCCAGGATCGGAGATGCGAAATTCGAAGAAGCGTCGAGCGATGTGTACTTGCTCGAGCGGATCTGGAAGATTCTGACGGAAATCGAAGATCTCCTCCTCCTGATGGATCCGGATGATTTCCTGAAGCTGAAGAACCAATTACAGATCAAATCGACCTCCAAAAACGACGCGTTCTGCTTCAGATCGAGAGGGCTGGTGGATATGGCGAAGATGTCGAAGGAGCTCCGGGAGAAAGTCCCGGCCGTGCTCGCCGTCGAGGTGGACCCCAGCGGAGGGCCGAGGATGCAGGATGCGGCGATGAGGCTCTACGCGAGGAAGAGAGAATCGGAGAAGATTCATCTGCTTCAGGGGATGCAGGCGGTGGAGGCGGCGGCGAAGCGGTTCTTCTTCGCCTACCGGCAGCTCGTGGCGGCGGTGATGGGGAGAGCGGCGGCGAGTAACGAGTCGAACGACTCGCTGAGTCGGGCGTTCATGGAGCCCACATACTTCCCGAGCCTGGACGCCGCCAAGACGTTTCTGGGAGAGTTCTGGAGCCGTTGGGGTTAA >Brara.C02045 ATGGTTGATATGGATTGGAAGAGGAAGATGGTGTCATCGGAGCTTTCTTCCAAGCTCCACGTCACTATTCCGTCTCCGTTCAAGGTCCCTGTATCCTCTCCCATCTCCTGCTCCGCTCCGGCAGCTTGCTCCGCCTACGAGTTTTACCTCCGCCTCCCTGAGCTGAAAAAGCTCTGGTCATCTCGTGAGTTTCCTCAGTGGAACGATGAGCCGATTCTCAAACCGGCTCTCCAAGCCTTAGAGATCACTTTCAGATTAGTCTCATCCGTTTGCTCCGATGCAAGACCGTACACAAACCACCGCGAATGGAACCGACGGTTGGATTCTCTCCTCACGAATCAGATCCAGCTCATAGCAGTGATCTGCGAAGAAGAAGACGAACGATCAGCTCCACTCGGCGATAAACGGAGCTCGCTCAGCTTGCTACCACATCTCGCCACGTGGCGCAAATCGGAAGCGTTAGGGAGGAAGATCTTGTGCACGATCGATAACGAGATGCGTCGGTGCAAGTACACGCTCGGACTCGGAGAACAAAACGTCTCTAACAAACCGAATCTCCGATACGACGCCGTTTGCAAGCCTAACGAAGTTTACAGCCTCAAGGACAATCCGTACGCGGATCACATCGATAACGAAGAGAATCAGACTCTCTACGTCCTCCACCAGATCCTCGAGTCGTGGATCCACGCTTCTGGAAACCTCTTGAGACGTATCAACACGAGGATCGAGGAAGGGAGGTTCCGAGACGCGGCGAGCGATGTGTACTTGGTGGAGAGGATCTGGAAGCTCATGGCGGAGATCGAAGATCTCCACGTCCTGATGGATCCTGAGGATTTTTTGAAGCTGAAGAAACAGTTACAGATCAAATCCAACGGTCAAAACGACGCGTTTTGTTTTCGGTCTAGAGGATTAGTGGAGATGATGAAGATGACGAAGGATTTGAGGGAGAAGGTTCCGGCTGTGCTGGGTGTTGAGGTGGATCCCACGGGGGGTCCGAGGCTGCAGGAGGCGGTGATGAGATTGTACGCGACGAAAGGAGATTTCGATAAGATTCATCTGCTTCAAGGGATGCAAGCGGTTGAGGCGGCGGCGAAGAGATTCTTCTTTGCGTATAAGCAGTTGGTGGCGGTGGTGATGGGAAGCGCGGAGACGAGTCAAGAGTCGTGTGACTCGCTGAGTCAGATATTTATGGAGCCGACTTATTTCCCGAGTCTTGACGCGGCGAAGACGTTTCTGGGAGAGTTCTGGAGTCACTTGGGATGA >Brara.D02425 ATGGTTGATACGGATTGGAAGAGTAAGATGGTGTCATCAGAATCACCTAAGCTTTCTTCAAAGCTCCACGTCACTATCCCTTCGCCGTTCAAAGTCGTCGCCGTCTCGTCCCCCATCTCATGCTCCGCTCCAGCAGCTTGCTCCGCCTACGAGCTTTACCTCCGTCTCCCCGAGCTCAGAAGCCTCTGGTCATCACGTGACTTCCCTCGCTGGTCAAACGAGCCTATCCTCAAACCGTCTCTCCAAGCTCTGGAGATCACTTTCCGATTGGTTTTATCCGTTTGCTCCGACGCAAGACCGTACATCAACCACCGCGAATGGAACCGGCGGTTGGACTCTCTCGTCACCAGTCAGATCCAGCTCATAGCATCGATCTGCGAAGAAGACGATCAATCAGCTCCGGTCTCCGATGGAAGAAGCTCTCTTAGCCTGCTACCACAGCTCGCCACGTGGCGAAAAACGGAGTCCCTAGGGAAGAAGTTTTTGTGCACGATCGATAACGAGATGCGTAGGTGCAAGTACACGCTCGGACTCGGAGAACATAACGTCTCCAACAAACCGAATCTCCTATACGACGCCGTTTGCAAACCGAACGATCTTTACAGACTCAAGGACAATCCCTACGCGGATCATGTAGATAACTACGAGAATCAAACGCTCTACGTCCTCCACCAGATCCTCGAATCGTGGATCTACGCTTCTCTAAGCCTCCTCAACCGAATCGACGAGAATATCAATGAAGAGAGATTTGATAAGGCATCGAGCGATGTTTACTTGCTGGAGAGGATCTGGAGGCTGATGACGGAGATGGAAGATCTACACATCCTAATGGACCCGGAGGATTTTTTGAAACTGAAGAAGCAGTTACAAATAAAATCGACCGGTAAAAACGACGCGTTTTGCTTTAGGTCGAGAGGACTAGTGGAGATGACGAAGATGTCGAAGGATCTGAGGCAGAAGATACCGAAGATTCTAGAGGTTGAGGTTGATCCCACGGGAGGACCGAGGCTGCAAGAGGCGGCGATGAGGATGTACGCGAGGAAGAAGGGAGAGTGCGATAAGATTCATCTGCTTCAAGGGATGCAGGCTGTGGAAGGTGCTGCGAAGAGTTTCTTCTTCGCGTATAAGCAGTTAGTTGCGGTGATGATGGGAAGCAGTCAGGTGGAGAGTGACTCGCTGAGTCAGATATTTATGGAGCCGACTTATTATCCGAGTCTTGACGCGGCAAAGACGTTTCTAGGAGAGTTCTGGGGTAACTTGGGATGA >Brara.E00580 ATGGTTGATACAGATTGCAAGAGGAAGCTGGTGTCACCGGACTTACCTACCAAGCTCCACGTCACCATCCCTTCGCCGTTCAAGCTCCCCGTCTCATCCCCCATCTCCTGCTCCGCTCCTTCCTCTTGCTCCGCCTACGAGCTCTACCTCCGTCTCCCCGAGCTCAGAAACCTCTGGTCATCACGTGACTTCCCTCGCTGGTCGCATGAGCCTATCCTCAAACCGTCTCTCCAAGGTTTAGAGATCACTTTCAGATTGGTCTTAGCCGTTTGTTCCGACAATAGACCGTACATCAACCACCGCGAATGGAACCGACGGTTGGATTCGATCCTCACGTGTCAGATCAAACTCATATCATCCATCTCCGAAGAAGATGAAGCAGCTCCTGTCGGGAATGAACGAAGCACTCTCAGCTTGCTACCACAGCTAGCCACGTGGCGTAAGTCAGAAGCCTTTGGGAAGAAGATCTTATCCACGATCGATAAGGAGATGAGGTTCTCTAAGTACACGCTCGGTCTCGGTGAACAGAACATCTCCGGGAAACCTAATCTCCAATACGACGCCGTTTGCAGACCGAACGAGTTATACAGCCTCAGGAATAATCCTTACGCGGATCATATCGATAACAACGAGAACGAAACGTTATACATCCTTCACCAAATCATAGAGTCATGGCTCCACGTGTCTTCAAACCTCTTGAAACGTATCAACACGAGTATTGATAAAGGGAGGTTCGGTGAAGCGTCGAGAGACGTCTACTTGGTGGAGAGTATATGGAAGCTTCTTATTGAGGTAGAAGATCTTCACCTCCTGATGGATCCTGAAGACTTTCTTAAACTCAAGAAGCAGTTGCATATCAAGACGGCCGGTAAAAACGACGCGTTTTGTTTCAGGTCGAGAGGTTTGGTGGAGGTCATGAAGATGTCTAAAGGTTTGAGGGAGAAGGTGCCGTTTGTGTTGGGCGTTGAGGTGGATCCCACGGGAGGACCGAGGCTGCAAGAGGCGGCGATGAGGCTTTACGCGAGGAAGGGAGAGGAGTGCGATAAGATTCATTTGCTTCAAGGGATGCAAGGTGTGGAAGCTGCGGCGAAGAGGTTCTTCTTCGCGTATAAGCAGGTGGTTGCGGCGGTGATGGGGAGCGCGGAGATGAACACGGAGTGTGACTCGGTGAGGCAGATATTCATGGAGCCGACTTATTTCCCGAGTCTTGACGCGGCGAAGACGTTCTTGGGAGAGTTCTGGAGCCACGTTGGGTGA >Brara.I03831 ATGGCTGATTTGGATATGGAGAGGAAGATGGTATCTCCCAAGAAGCTCCACGTCACCATTCCGGAGCTTTTTGACATCTCCGTCTCCTCTCCCATCTCCTCCTCATCCTCCGCCGCCGCTTACGAACTCTACCTCCGTTTGCCGGAACTCAGAAATCTTTGGTCCTCTCTTGGCTTTCCTCAATGGGTCACCGAGCCTGTCCTCAAACCAGCTCTTCAGGCTCTTGAGATCACATTCCGTTTGATCTTGACCGTTGCTTCCGACACACGTCCATACATCAACCGACAAGAGTGGACCCGACGGTTGGACTCGCTCGTCACAAGCCAGATAAAGATCGTTGCATCACTCTGCGAAGACGATGACGAATGCGTACCGGTTAGCAATGGCTGGAGCTCAATGAGCTTGCTATCCGAGATAGCCACGTGTCGGACAACGGAGAGCATTGGTCAGAAGATCTTTTGTACGGTCGAGAACGAAATGCGTTGGTGTAAGTATACACTCGGTTTAGGTGAACCGAACCTAGCCGGAAAACCGTATCTCCAATACGACCTCGTTTGCCGCCCGGAAGAGCTGCAAAGCCTCAAAAACAACCCTTACGCTGATCATATCGAGAATCAAGAAAACCAAACGCTCTACACGATTCACCAGATTCTTGAATCTTGGATTCACGTTTCACTGAATCTCCTAAACCGAATCGAATCAAGAATCGACGAGGCGAAGTTCGAAAAAGCGTCTTCCGACGTGTACTTGCTAGAGACAATATGGAACCTTCTGAGTGAGATAGAGGATCTACACATTCTGATGGATCCAGAAGACTTCTTGAAGGTCAAGAAACAGTTAAAGATCAAGTCTACATCACAAAACGACGCGTTTTGCTTCAGGTCCAAGGGACTAGTGGAAATGGCCAAGATGTCTAAAGAGCTCAGACAGAAAGTGCCAGCTGTGCTCGAGGTTGAGGTGGACCCTACAGGAGGTCCGAGGTTGCAAGAAGCTGCGATGAAGCTTTACTCGAGTAAGACTGAGTACGAGAAGATACATTTGCTACAGGGGATGCAGGCGGTTGAGTCTGCTTCCAAGAGATTCTTCTTCGGGTACCAGAAGCTAGCGGCGACGATGATGGGAAGCGCGGAGGCTAACGCGAATAGAACGGCGGCGAGTCATCACGAGACGTGTGACTCGCTGACTCAGGTGTTTATGGAGCCAACGTATTACCCGAGCCTAGACGCTGCAAAGACTTTCCTAGGAGAGTTCTGGAGCAATTTGGTTTCCCGACACTGA >Cucsa.136520 ATGGTTGATTTGGGTTGGAAGGCAAACATGGTTTCCTCCGACAAGACTACCACCGCCACCACCACTAAATCCTCTAAGGTCATCCCCATCCTCAACAACAAGCTTAATCTATCTCTTCCTGTTTCCTTCCGTTCTTCTGAGCTCTCAACTGCTTCACCTTCCTCTTGTTCCTCATACGAACACTACCTTCGTCTCAATCATCTCAGGAAGTTATGGAGTTCTAAGGAGTTTCCTGAATGGAGGAATGAGTCCGTGTTGAAGCCGGGTTTACAGGCTTTGGAGATTACTTTCCGCTTCATATCGACCGTTTTGTCTGATCCACGTCCCTATGCGAACCGCCGGGAGTGGAAGAGGAAGCTTCAGTCTCTTACCACCACTCAGATCCAACTCATTGCTATGATTTGTGAGGACGACGAAGAGGACGGTGAATCACGCGGTAGAGTTCCGATTGTCGATCTCAGTTCATCAGACGGTATGATTACTCGAGACGGAAGCTCCGCGGAGGTTTGGAAGATTCATGGAGAAGCTACTGTTGTGAACAGAACGAGTGAATCCAGTCTTCTTCCTCGACTTGCGTCATGGCAGAGCTCTGAAGATATTGCGCAGTTGATTCAATACTCTGTTGAATGTGAGATGAGGAGATGCCCGTACACGTTAGGGTTGGGGGAGCCGAATTTGGCTGGGAAACCGAATCTTGATTACGATCTAATTTGTAAGCCAAACGAGCTTCATTCTTTGAGGAAGAGTCCGTACGAACAGATCGAAAATTACGAGAATCAAACGGTTTACACAACGCACCAGATCCTGGAGTCGTGGATTTACTCGGCGCATGAACTTCTGAAACGAATTGAAGAGAGAATCGAGAAGAAGGATTTCGCCGGAGCTGCGAGAGATTGTTATATGATGGAACGGATCTGGAAGCTTCTACAAGAGATTGAAGATCTTCATCTTCTAATGGATCCGGATGATTTCCTAAAGCTGAAGAATCAATTAGCGATAAAATCACTTCAAGAATCAGAAGCGTTCTGCTTCAGATCGACGACGTTGGTAGAGATTACAAAGCAATGCAAGGATCTGAAGCACAAGGTGCCGTTGATATTGGATGTGGAAGTTGATCCAATGGGGGGACCAAGGATTCAAGAGGCGGCGATGAAATTGTACAGCGAGAAACAAGAGTCGGAGAAGATTCATCTTCTGCAAGCTCTGCAAGCGATTGAATCGGGGATAAAGAAATTCTTCTTCGCATACAAGCAAGTTCTGGTGATGGTGATGGGAAGCTTAGAGGGGAAGGGGAACCGAGTTGTGGTGAGTTCGAACTCGGATGATTCATTGAGTCAGATATTTCTGGAACCAACTTATTTTCCGAGTTTAGACGCTGCTAAGACGTTTCTTGGAGATTTACATGGTGTTTTCGGGTCAGATCGAAGGACCCGGATGAAGATTTAG