>PAB00016775 ATGCCTGGACGGGATCCTTCAGAGAGGAATTATCTATCTTCAGTTTTAATACAAGAGCTCTTCCTTACATGGGATCATGATGATGTGGCACAACGTTCTAAAGCGGCTCGCATATTGGTGGTTCTCATGTGCAAGCATGAATTTGATGTGCGGTATCAGAAGCTGGAGGACAAACTATATATTGCACAGCTTTATTTCCCCCTAATTGGACTGATATTGGATGAGATGCCAGTATTTTACAACCTCAGCACAGTAGAGAAGCGTGAAGTTCTAATCTGTATCATGCAGATAATCCGTAATTTGGATGACACATCTCTTATTAAGGCATGGCAACAGAGTATTGCTAGAACAAGGCTCTTTTTCAAGCTTCTGGAAGAATGTCTTGTCCTTTTTGAGCATAGAAAGTCAGCTGACTCTATGATCATTGGTAACTCTCGGAGTCCAGATGTGGAAGGGCCAGTTTCACCCAAGTACTCGGACAGACTCTCTCCAGCAATTAATAGTTATTTGACGGATGCATCTCGACAAGAAATTAGACCACAGGTAACACCAGAGAGTGGGTACTTATGGCAAAGGTTGAGCCCCCAGTTGAGTTCACCGAGTCAACCATACTCCTTACGTGAGGCATTAGCGCAGGCACAATCATCCCGTATAGGAGCTTCCAGCAGAGCATTAAGGGAGAGTCTACACCCAGTATTTAGGCAGAAGTTAGAGCTTTGGGAGGAGAACATAAGTGCAGCTGTCAGTCTCCAGATATTGGAGATAACTGAGAAGTTCTCACGAGCAGCTGCAGATCATAGCATTGGGACTGACTATGCAAAGCTTGACTGTATTACAGCTATATTCATGGCTTTTCTTTCCCGCAGCCAACCATTGGTCTTTTGGAAAGCTTTCTTTCCTGTATTTAACAGTCTGTTTAATCTTCATGGTGCAACACTGATGGCAAGAGAGAATGATCGCTTCTTGAAGCAGGTGGCATTTCATCTACTTCGTCTTGCAGTTTTCCGTAATGATTCCATCAGAAAGAGGGCTGTTGTTGGCCTTCAAATTCTTGTGCGGAATTCCTTCTACTATTTCCAGAATACCGCACGGTTGCGTGTTATGTTGACAATCACTTTGTCAGAATTGATGTCTGACATACAAGTTACTCAGATGAAGTCTGATAGCTCCTTGGAGGAAAGTGGGGAAGCCCGACGTCTCAGGAAGTCACTGGACGAAATGGCAATGGAAGAGAGGAGTGGTGATCTTTTGAAAGGCTGCGGTATTTCTGAGAATGCATTGGATGCTATCTCTGAGGGTTCTACACAGAATCATTGGTCATGGTCAGAAGTCAAGCAATTGTCTGTAACTCTTCTAAGAGCCCTAGATGCAGGAATTGAACATGCTCTCCTGGGTTCTATGATGTCAATAGACAGATATGCAGCAGCAGAGAGCTTTCATAGACTTGCTTGGGCTTATGCACACGTGCCAGATCTGCATATTATGTGGCTTCTTCATTTATGTGATGCTCATCAAGAGATGCAGTCTTGGGCAGAAGCTGCACAGTGCGCTGTGGCTGTTGCTGGGGTCATCATGCAGGCATTGGTAGGACGAAATGATGCTGTGTGGGGAAAGGAGCATGTAACAGCGTTGCGTAAGATTTGTCCAATGGTCAGTAGTGCAGTTATTGGGGAAGCATCAGCTGCAGAAGTTGAAGGATACGGGGCGTCAAAATTGACAGTTGACTCTGCTGTGAAATATTTACAGCTTGCAAATAAGCTATTTTCTCAGGCTGAACTTCATCACTTTTGTGCTAGCATTCTTGAATTAATTATTCCAGTTTACAAAAACAGAAGAGCATTTGGGCAGTTGGCTAAGTGCCATACTTCTCTTACAAACATTTATGAATCGATTCTTGAGCAGGAATCGAGTCCCATACCCTTTACAAATGCTACCTATTATAGAGTTGGGTTTTATGGTGACAACTTTGGAAAATTGGACAGGAAGGAATATATATACAGGGAGGCTCGGGATGTACGATTAGGTGATATAATGGAGAAGCTTAGTCATATTTATGAGTCAAGGTTGGATGGTGGCCAAACATTGCATGTAATTCCAGATTCTAGACAGGTAAATGCAGATGAGCTGCAGCATGGAGTTAGCTACCTGCAGATAACATCAGTTGACCCAGTTATGGAAGATGAAGATCTAGACAGTAGAAAAGAAAGGATCATTTCTCTTTCATCTGGAAGTTGTCGTGCTCGAGTTTTTGATCGCTTCCTGTTTGATACTCCATTTACTAAAAATGGGAAAACTCAAGGAGGGCTGGAAGACCAGTGGAAAAGACGCACTGTTTTGCAAACTGAGGGATCCTTTCCAGCCCTTGTCAATCGACTTTTAGTTGTGAAGTCAGACTCCCGTGAGTTTTCTCCTATTGAAAATGCAATTGGAATGATAGAAACAAGGACTGCTGCACTAAGAAATGAACTAGAAGAACCTCGCAGCTCAGAGGGTGATCAGCTTCCACGTCTTCAAAGTCTACAACGGATTCTTCAAGGCAGTGTTGCTGTGCAGGTAAATAGTGGCGTTCTCGGTGTTTGTACAGCATTCTTGTCTGGGGAACCTGCTACACGACTAAGGTCACAAGAGTTACAACAACTTATTGCTGCCCTGCTAGAATTCATGGCTGTCTGCAAACGAGCAATTCGGGTTCACTCTAGGCTGATCGGAGAGGAGGACCAGGATTTCCACACACAGCTTGTGAATGGTTTTCAGTCACTTACTGCTGAACTTTCTCATTATATTCCAGCCATTCTTTC >PAB00017992 ATGGACTCATTGTTCGACCCCATTACACACTTCGCCATTGGATGCATGCTCTTCAGACCCCCTTGGGCTAGTTCAAAGTTGGCTCGCATAGACTGCAGATTGAGATTGACCAGTAGTTTGATTGATCAAACAAGATTTGCCTGTTGTGCCATCTCAAAGAGATTGAGACCGAGGAGCACTTCATCTTTCGTTGCCCAGTTGACTACAATATCTAAGGATGGTTCCATTGTCTTTTCAGAGAGCTATAGACGCTTGGCAGTTTCTTTAGATTTGTTATCCAGTGGCCAGCGCTTCAGGAAACTTCCCAGACCATCATTCACTGTCGACTCAGAACTTGATCCGTTGCTAAGAGAAAATCTAGAGCAGTGGCCTCATCTGAATGAGTTGGTGCAATGCTACAAGGCTGACTGGGTGAAAGATGAAAACAAATATGGCCATTATGAGAGTATACCATCCATATCGTTCCAAAGCCAAATTTTTGAAGGGCCAGATACTGATATAGAAACTGAGCTACGTCTGGCTAATAACAGGCAGGGGAGGAATGGGGATGCCACCGATGATGATGATCCTAGTACATCAGGAAGGCATTCATCTGACACGAGCTCATCAGATGGTACCTTTCAAAAGCATTTTGGTGCCTCCCCCTTGCCTGCTTATGAACCGGTTTTTGATTGGGAGAATGAGAGGTCCTGCATCTTTGGACAAAGAACACCAGAAGTTCCACCAACTTTATGTGGCAGTGGACTCAAGATATACATCAAGGCTTTATCTCTGGCCTTTCAAGCAGGATTTGTTGAGCCTTTTTATGGTACGATATGTTTATATCATAGAGAGAGGAGAGAAAAACTGTCAGAGGACTTCTATTTCCAGTTCTTACCCAATGAAATGCAAGATGGTATGGTGCCCTTGCAACGCCGTGCTATCTTTTCCTTAGACTCCCCATCTTCATCTGTCTGCCTACTTATTCAGTTGGAAAAGCCTGCAACTGAAGAAGGAGGAGTGACACCATCAGTATACTCTCGCAAAGAACCTGTTCATTTGACAGAGCGGGAGAAGCAGAAGCTGCAAGTATGGGCTAGAATAATGCCATACAGAGAATCTTTTGCTTGGGCTGTTGTTCCTTTGTTTGAGAGCAACATCGGTGGAGGTGTTGGTGGGATTGCCTCTCCAAGTAGCCCACTTGCCCCTAGTATATCAGGGTCGAGTTCACAGGAAAGTAACATTGATCTCATCGGGAGAACAGCATCAGATGGAAGGATGACCCATTACTCAAGCGGCTCTGCTGTAATTGTTGAGATACCCAACTTGAATAGAGTGAAAGAAAGCTATGTTGAGGAGTTGCTTCAGGATCCCAAAAGAAAGGTTCATAAACCAGTTAAAGGCAGTCTTAGGTTGGAAGTTGAAAAACTGCAGGTCAGTCATCTTGACATAGACACTCTTTCTGAAACTGGTAGCCTCAGCAATGATTCGAATGACGCTGGTGAGAGACTTGGAGATACAGGGATGTTGAAAAGCACTGGAAATAGTGCTGGCAGAACATCCAACGGTGGTTCAAAATGGAATCTCCATGAAGCGAGGGAAGTTGGCAGTAGCCGTTCAAATATAATTCAAGGAGCAGTGCTAGAAAATGGGAATGATGATTTCCGGGCTTTGGATTTTCGAGCATTGACAAAGAATGAGCCTTTTTCTCAGCTGCTTCACTGTCTATTTGTGTATCCTTTAACAGTTAGCTTAAGTAGAAAGCGCAATTTGTTCATGAGGGTTGAGTTGCGGAAGGACGATGTAGATATCCGTAAACAGGCACTAGAGGTTATATATCCAAAAGATAGAGGTGTGTCATTTCAGAAGTGGGCTCACACACAGGTTGCTGTTGCTGCTCGAACAGCATCCTACCATGATGAGATTAAGCTTTGTCTTCCAGCTATTCTTACTGCTCAACATCATCTGCTCTTTACATTTTATCATGTTGATCTTCTAACAAAGCTTGAAGCTCCAAAGCCAGTTATTGTGGGATATGCTGCCCTTCCACTAACTACTTATGTTCAGTTGCGATCAGATATAATGTTGCCAATTCTGCGAGAGTTGGTACCTCACTATCTCCAAGAAACTGTCAAGGAGAGGCTGGAGTATTTAGAAGATGGGAGGCTTGTTTTCAAGTTACGCTTGAGGTTATGCTCATCCTTATATCCAATGAATGAGCGGATTAGAGATTTTTTCCTGGAATATGACAGACATATTCTTCGGACAAGTCCTCCTTGGGGTTCTGAGCTTCTTGAGGTAATGTGTTGA >Pp3c10_16640 ATGACCAAATCACAAGTTCTTGAACGCAACGCTCCTATTGTTCTTCCTGTTAAAACATATGTGCAGGTAATGGGTGAGATTGCCTTAAGTGGGCAGCGGTTTAGGCGTATCCCACATCCTTACTCTGGGCAGTCGGCAGACGTTGAGAGTTTGCTAAGTGACAATGTGGAGCCATGGCCACATCTCACGGAGCTGCTTCAAAACTACACCGCAGATTGGGTGAAGGATGAAAGCAAGTATGGACACTATGAAAGCGTGCCAACCCCTGTATTTGAAAACCAGATATTTGAAGGACCTGACACAGATGTAGAGACAGAGCTGCGCCTTTCAAATATTAGACTTGGAAGATATGGAGATGCCACAGACGATGAAGACCCAACGACGTCAGGTAGATACTCTGGAGGATTGTTTTCCGGCCGATTTTCTGGGAGGTCAACAGGAAGTGATGCTCCAGATTCAACCGTTACCAAAGCATCGAAGCACTACGGTGGGGCTCCGCTACTCCCATATGAGCCCGTTTTTAATTGGCTAGCAGCGAGGGCATCTGTATACGGGCAAAGGACACCAGAGATTCCGACAGCACTATCATCGAGTGGTGGGCTGAAGATTTCTGTGAAGATCGCATCTCTCAATTTTCAGGCTGGTCTTGTTGAGCCCTGGTATGGTACAATATGTCTTTATCACCGGGAGAAGCGAGAAAAGCTATCAGAGGATTTCCACTTTCGATGCTTACCACCAGAGTTTCAAGATGAGGCTAGTAATTACCCAAGAAAAGCCGTTTTCTCACTTGAAGCGCCATCACCAGCGATCTGCTTGCTGGTGCAGCTTGAGAAGCATGTTACAGAAGAGGGGGGCATCACTCCTTCTATCTACACGCGTAAAGAACCTGTACATTTGACAGAAAGAGATAAGCAAAAACTGCAAGTATGGGCAAAGATGATACCATTTCGCGAACCATTCGCTTGGTCAATCCTTCCTCTATTCGACGCAATTGTAACTGGAGGTGTAGGAGGCTTTTCGTCTCCAACGAACAGCCCTTTGCCTCCAGGCGTTTTAGGATCTGCTCTTATGGAAACATCCTTGGATTCAGATGGTAGGCTGATTGCCGACTCAAAGCCTGAATCTGTCAGTGTTCCAGTACTGGTTGACGTGCCAACCCTTCATCGTGTAAAAGAAAATTATACAGAGGAGATGCTTCTGGTCGAACATCCCAGCGGCCAATCAAGTATGCTTTCATTTCAGGAGCCAAAGCGTAAAGTGCAGAAGCCAGTGAAAGCAACTCTAAGGCTTGAAATTGAGAGGCTGGGCAGTGATGATCATGAAACGGACTGCATCTCTGAGTGCGGCAGTTTCAATAATTACTCTTTTGATGCTGATTCTCATTCTCTAGGAGCATCATTCTCAGGGCGTTCTGCTCAAGGCCTAGAATCCACGAAGACGTTTCACAATGGACACCAGAAAAGTAACTCTGGACATCGTGACCTACAAGCAGGCATTGGAAGTAGTCTTGATTTGCGACGATCAGAGTTTCGTGCCGTTGAATTTCGACTGGGTCCGAAACCTGAGCCATTATCTCAGCTATTGCATCTCCTCTATGTGTATCCTCAATCTGTTACGCTTAACCGAAAGCGGAATCTTTTTATTCGGCTGGAGCTTAGGGTGGATGATGGTGATATTCGGAAGCCACCCCTTGAGGCTCTTTACCCTAGGGATGCAGACAGCTCAATGCAGAAGTACGTACACACTCAAATTGATGCTAATACAAAGACGCCTCATTTTCATGACGAATTCAAAGTCCAACTTCCTACCAATCTGTCCCCGGACCACCACCTCCTTTTCACTTTCTTCCATGTGGAACTTCAGACGAAACTAGAAGCACCAAAACCAGTCGTTGTAGGATACGCGGTTCTTCCGCTCTTATTCGCTTCTCAAGTTATCCGGTTGGACGGTACCCTGCCTATTGCGAAGGAGTTGTACCCAAACTATTTAAAAGATAATGTGAAGGATCGATTGGAATATCTTGATGATGGCAAAACAGTCTTTAAATTACGGTCCCGTCTGTGCTCGTCTCTTTATCCTGTGAATGAAAGGATTAGGGATTTTTTCTCTGAATATGACCGTCATATTTTGCGGACAAGTCCATGGGGAAATGAACTCATGGAGGCAGTTAATGCATTGAAGAATGTCGAAGCATCTGCTATGCTTCAGTTTCTTCAACCATGTCTGAATATGCTGCTTCGCATGATTGGTGATGGAGGAGAAACGTTGCAGGTTGCTGCATTTCGATCAATGGTTAATATAATCACAAGGGTACAAGGAGAAACATCAGATGGAGACGAACGCAACCGATATCTTGTCCAGTATTTGGACTACGCATTTGACGATTTTGGTGGACGCCATGATCCTGTGTATCCTGGTCTCTGCAGTGTTTGGCGTAGTCTTGCTCGCAGCAAGGCAAAAGGCTACAGAGTTGGACCTGTGTATGATGACGTGCTGTCAATGGCTTGGTTCTTCCTTGAGTTGATTGTGAAGTCCATGGCACTTGAGCAATCTCGTACTTACAGTGAAACTCTGCCTCCAGGTGAAGAGTTGCCACCATTACAGCTCAATGATGAGGTCTTTAAAAGCATTGGGCAGCTTTATGATTGTCTGTTGACGGAGGTTCAGGAGAGAGGAAAGAAGGGGTTGACTCTAGCCAACAAACTCAACAGTAGTTTGGGTTTCTTTTGTTTCGATCTTCTCTCTGTTATTGAACCACGGCAAGTCTTTGAATTGGTTGCGCTTTACTTCAGCAAATTTTGTGGAGTTTGTGAAACAACAATTCATGAGTACAAGCTCAATTTTCTTAGTATCATCTGTGATCACGATTTATTTGTTGAAATGCCTGGCAGAGATCCTACCGAGAGGAATTATTTGGCATCGATGTTGATGCAGGAGCTCTTCATCACTTGGGACCATGAGGATCCAGCTTTAAAGGCCAAGGCATGCCGAATACTTGTACAACTCCTTTGCAAGCATGAGTACGACCTACGGTATCAATCACTCGATGACAAGTTGTATATTGCTCAACGTTACTTCCCTTTAGTTGGTCTGATTTTGGATGAGATGCCAGTATTTTATGCCTTGAGCTCCTCAGAGAAGCGTGAAATCCTGGTGTGTGTGCTCCATATTTTGCGCTATTTGGATGATGGCTCTCTTGTAAAGTCCTGGCAGCAAAATATTGCTCGAACAAGGCTGTTTTTTAAGCTGCTGGAAGAATGCCAAGAACTGTTTGAGTACAAAAAAGCAGGAGCTGATGGCTTGATGGGTGCAATGCCTGTAAATGAGCAAGGAAAAGGGACTCTTTGTTATTCTGAGAAGCTTTCCCCTGCAGTTAATCATTTTCTTTCTGAAGCTTCACGACAAGATGTCAGAGTAACCAAGAGTTCTCCTGGTCCTCAATGGATATTTCCACAGGTAAGTCCAGACGCCAGCACATTCTGGAAGAGAGTAAGCCCGGTTTCAAACAGCCCAAGCAGCCCAAATCAGCCTCATTCTTTGCGCGAAGCTTTGGCGCAAGCTCAATCAGCAGGAAGAGGGGCAGGGATGGCTCTCAAAGAGAGCTTACATCCAATGCTGCGACAGAAATTGGACCTGTGGGAAGAGAATCTCAGCGCTTCGGTAATGCTCCAACTTCTCGAAATTGTTGCGAAATTTATGGACGCCGCATCAAGTCAAGCTATTGCTACGGATTATACCAAGCTTGATTGTATCACAAGCATCATCAGTGGATTTCTAGGACGCAGTCAGCCCCTGCCTTTTTGGAAAGCTTTCTTTCCTGTGTTTAACAATTTGTTTAGTCAATACGGGGCTACTCTGATGAGCCGGGATAATGATAGATTTTTGAAACAAGTTGCGTTCCATCTTCTGCGACTCGGAGTTTTTCGGAATGAAAGCATTCGAAAGCGAGCCGTTGTTGGTCTTCAAATTCTTATTCGAACTGCCTTCCATTATTTCCAAGGTCTATCTCGTTTACGTGTGCTGCTCACCATCACGCTATCAGAGCTTATGTCGGACGTTCAAGTGACTCAACATCGAATGGATGGATCCTTGGAGGAAAGTGGAGAATCACAGCGTCTTCGCAGATCCCTGCGACAAATTGCCCAAGAAAACATTAGTACAGATCTTCTTCGTGAAAGTGGACTTCCTGAAGGCACACTCTCAGCATTGCCAGATGGAGGATGTGAGCAGATCTGGAGCTGGGCTGGTGTTCATGAACTTTCCAACTCTCTGCTTAAAGCTGTTGAGGCTGCAGTTGGACATGCTCTCCTGGGCCCAGAAGTCATGACCGCTGACAAGTATGCGACTGCAGAGGCATACTACGGTTTGGCGAGGGCATACTCCAATGTACCTGACCTACACATTATGTGGCTTCTTTATCTTTGCGAAGTTCATCAAGGAAACCAATCTTACGCAGAAGCTGCTCAATGTGCAGTTTCTGTTGCAGGTGTTGTCATGCAGGCTATAGTAAGTAAAGGAGATCACATGTGGGGCAAGGAGCATGTAGAGGCTCTGCGGAAAATATGCCCTATGCTCACCGGTGCTAGTTTTGGAGAAGCTGCCAGTGCTGAAATAGAGGGCTATGGTTCATCAAAGCTCACTGTAGAATCAGCCGTGAAGTATCTTCAGCTTGCTAACAAACTTTTTGTTCAGGGAGAGCTTTTCCATTTCTGTGCTGAAATTTTGGAGCTTATCATCCCTGTTCATAAAGCAAGGCGCGCCTACGGACAACTTTCGAAATGCCACACTTCTCTGACCAGCATTTATGAGGCCATAGTAGAGCAGGAGTCTAGTCCGATCCCCTTCTCAGATGCAACTTACTATCGTGTGGGATTTTATGGTGAAAGTTTTGGCAGTCTGAATGGCAAGGAGTATGTCTACAGAGAGGCAAGAGATGTGCGATTAGGGGATATCATGAGGAACTTAGGTAACATTTACGAACCTAGAGTTATCGAGGGAAAACAGTCCTTGCATATTATTCCTGATTCTCGGCAAGTGAAACCTGAAGACCTTCATGCAGAGATCTGCTACATGCAAATTACATCTGTTGAGCCTGTTACTGAGGACGATATCTTGGAGAGTAGGCGAGATAGGCACTCTAGTAAGTCGGTTACAACAGTGAGTGCTCGGGTATTCAATCGTTTCCTGTATGATACTCCTTTCACGAAAAATGGCAAGTCACAAGGAGGTCTTGAGGATCAATGGAAAAGACGTACTGTGCTATGGACAGAGGGATCCTTCCCTGCTCTTGTGAATCGCTTGACAGTCGTTAAGTCGGAATCTCGTGAATTTTCTCCAATTGAAAATGCAATAGGCATGATCGAAACCCGCACAGCTGCATTAGCAGGAGAACTCGATGACAATCGATTAAATGAAGGTGACCACCCGTCTCGGTTGCAAAGTCTGCAGCGGATATTGCAAGGGAGTGTTGCCGTGCAGGTAAACAGTGGCGTGCTTGGGGTATGTGCTGCTTTCTTCTCTGGAGAACCTTCAACAAGATTGAGCGCGCAGGATCTGCAGGAACTCATGGCAGCACTCATGGAGTTCATGGCTGTGTGCAAGAAAGCATTACGAATTCATGCACGTCTCATAACAGAAGAGGATCAAGAATTCCATTCTCAACTTGTGATTGGGTTTCAATCTCTCACAGCGGAGCTGTCACACTTCATTCCTGCTATTTTATCTGGGTTCTGA >Pp3c15_8680 ATGGCTCTAACCTTTATTGATTCTACCAAACTTAGTGGGAGAGATTATTTCTCAGACAGCGGCAGAGATTATGAAGACCTTTCAAGCCTTTCCATCCTTTCCTCGAGAATGGGTATGAGTGAAAATGGGTTAAACGGGCCGCATTTCAAGCGTGTGGTGCGCCGATCTTCCAGTCAGAGTTTGGATATAGATCCTTTGCTGAGCGGTAATTTGGATAGCTATCCTCATTTGAAGGAACTGCTACAGAGCTATAAAGCAGAGTGGGTTAAAGATGACAACAAGTATGGGCGTTATGATGCTGTGCTGCCACCTGTATTTGAGTCACAAGTTTTCGAAAGTCCTGATACAGATGTAGAGACAGAGTTGCGCCTTGCAACAAGGGGCCGGTATGTTGACGAGGAAGAGGTTAGCACTTCGGGAAGGCTCTCATCAGAAAGCGACCCAGATGCTGTTTATGCTAAAAAGCACTATGGGGGGCCTCCATTACCTTGCTATTATCCTGTTTTCAATTGGCATGCAGAGAGATCTGCTATCTTTGGTCAAAGGACACCAGAGCTACCACCTTCACTCTCTACCAGTGGATTGAAGATTTCCGTGAAGCTTGTTTCGCTCGCTATGCAAGCTGGACTTGTTGAACCCGTGTATGGAACCATGTGTCTGTACAACAAGGAAAAACGTGAAAAGCTTTCAGAAGACTTTCACTTTCGATTCCTACCTTCAGAATTTCTGGATGACAATTGTGGAGGTCAAAGGAGTGTTCTTTTCTCATTGGAAGCTGGTTCCCCAGCCATTTGTTTACTTATTCAATTTGAAAAACATGTGACTGAGGAAGGAGGAGTTTCTCCATCTGTGTATACCCGCAAAGAACCTGCATATCTATCGGAACGGGAAAAGCAGAAGCTGCAAGTTTGGGCACGAGTGATGCCTTTCAGGGAGCCATTTGCTTGGGCTACAGTTTCGCTTTTTGACTCTAGTGTTACTGGAGGTGTCGGGGGTTTTACATCACCAAGCAGTCCATTACCTTCTAGTTTGTTGGGATCTGGACTAATGGAAGCAGCCGTAGACATTGACGGACAGTTAATTGCAAGTGCCGATTCAAAGCATCATGAGTCTAGGCATCATGAACCTGTCCTTGTCGATGTACCTGGACTGAATCGTGTGAAGGAGAACTACATGGAGGAGACTCTGCTGGATCCGAAACGCCTAACGCACAAGCCGGTAAAGGCAACCCTGCGTCTTGAAGTGGAGAGGGTATCACAAGAAGACGTGGAACGAGGTTCTTTATCTGAATGTGGCAGTTTTAGCAATAGTTCAATAGATGGGGAGGGCAGAGAGTCGTCACTGCCCAGGCATTTACGACATGCTTCTTCCGGTTACTCGAGAGGAGCTTTAAGTGGACGTCTCAAGTTGAGTTCCATGGATAAGCGTCGACTTGCACATTCTGTCAGCGCAAACAGCTTCGACTTTCCTCGTCCTCAGTTCAAAGCCATTGAATTTCGAACATCCAATAGAGGCGAGCCAATGTCACAGGTGTTGCATTGCTTGTATATTTACCCTCAAACAATTAATCTGAGCAAGAAGCGGAATTTATTTGTGCGAGTGGAGCTTCGTAAAGATGATTACGATATTCGGCAACCTCCATTGGAAGCCCTATATCCAAGAGATTCAGACAGCAACATGCAAAAGTATGGCCATTCTCAAGTTGATGTAAATGTCAAAATTCCTCATTTTCATGATGAATTCAAGATTCGTCTTCCAGCTGTGATCACCCCACAGCATCACGTACTCTTCACATTCTTTCATGTGGATCTTCAGATGAAACTTGAGGCTCCAAAGCCAGTGGTTGTCGGATATTCTGTTCTTTCTTTATTTATTGGTGTTCAGGTGCATCGATTAGATGGTACTTTACCTGTAGTGAAAGAGCTCCTCCCTCATTATTTGGATGAGAGTGTCAAGGAGAAAATGGAGTTATTAGATGAAGGCAAAGCAGTTTTCAGGCTTCGATCTCGATTGTGCTCGTCTCTTTATCCTGTGAATGCGAAAATTCGAGAATTCTTTGCTGAATATGACAGATATATCTTACACACATCTCATCCTTTGGGGAATGAACTGTTGGAGGCAATTGGTGGATTGAAGCTTGTCGACCCGTCAGACATGCTACAGTTTCTCCTGCCTACATTGAACATGTTACTGCGCATGATAGGTGACGGTGGGGAGACACTTCAGGTTGCTGCTTTTCGGGCGATGGTGACCATCATCACAAGGTTGCGACAGGAAAGTCCAGATGGAGGGGGAGATCGCAACAAGTACCTGGTTCAATATGTTGATTACTTCTTTGACGATTTTGGAGGTGTTTTGGAACCTGTCTACCCAGGGCTTTGCAGTGTCTGGCGCAGTCTTGCTCGCAGTAAGGCCAAAGGTTACAGGGTAGGTCCCGTCTATGACGACGTACTATCAATGTCATGGTTTTTTCTTGAACTCATTGTGAAGTCTATGGCACTTGAGCAAGCTCGCAAGTTCTCTGAGAACCTTCCTCCTGGTGAGGATTTACCACCTCTGCAACTCAATGACGAGGTCTTGAAAAGCGTTGGTCAGCTCTATGACTGCTTGCTCACTGAGATTCACGACTGCTGTAAGAAGGGTCTACCACTCGTAAAACGACTAAACAATAGCATTGCATTTTTCTGCTACGATCTTCTCTCAGTCATTGAGCCCAGGCAGGTTTTTGAACTGGTGGCGCTTTACTTTGATAAGTTCAGTGGTATCTGTCAATCTATGGTGCATGAGTGCAAGCTCAACTATCTTCGCATAATATCCGATCACGACCTCTTTGTAGAGATGCCTGGTCGGGAACCTTCAGAAAGGAATTACCTAGCAGCTGTTCTAATGCAGGAGCTCTTCATTACTTTCGAGCTTGAGGATGCCTCTTTGAAACTCAAGGCTGCTCGAACACTTGTTGTTCTAATGGCCAAGCATGAATATGATGCTCGATATCAAACCTTGGACGACAAAATGTACATTGCTCAACGCTATTTCCCCTTAATCCTTCACATTTTGGAGGAAATGCCTGTTTTTTACAACTTGAACTCTCCAGAGAAGCGCGAGATTCTGGTGTGTATGCTTCAATACCTTCATCACCTAGACGATACTACTTTGATCAAGGCGTGGCAACAAAGCGCAGCCCAAACAAGACTCTTTTTCAAGTTGCTTGAAGATAGCCAGAATTTGTTTGAGTACAAGAAGGCTGGAGCTGATGGTTTAATGGGTGCCATGTCTAAATCTGACCAAGGTGATGGAGTCATCCGCTACACGGAAAAGTTGTCACCATCTGTTAACTTATTTTTGGCGGAAGCTTCTCGTCACGATGGTCGGTGGTCAAACACTCCAGCTACCTCAGATAACGGTAGTTATTTTTGGAAGCGAGTTAGTCCTCAAATGAGTTCTCCAACGCAAGTGTACAGGGAGATTTCAACCCATGGATTAGGCCTAGGCCCAACCTCTGGAAAATCGAGTGCACAACTTCGTGCTAGTCTGCATCCTATGCTACGACATAAGCTCGAAATGTGGGAGGAAAATCTCAGTGCTTCTGTAACCCTACAGATCTTGGAAATTGTTGAAAAGTTTATGGATGCTGCAGCAGTTCATGTGGCAGTAACTGACTATGTTAAGCTTGACTGTATCACAACTATCTTCATCGGCTTCCTGAGCCGTAGTCAACCCCTACCGTTCTGGAAAGCGTTTCTGCCAGTCTTCAATTCTCTTTTTAAGAGTCATGGCTCAATCTTGATGACTCGAGAGAACGATAGGTTTTTAAAACAAGTGGTGTTTCATCTGCTGCGCCTTGCTGTGTTTAGAAACGAATCCATTCGCAAAATGGCAGTTGTGGGACTTCAGATTCTTGTTCGCAACATCTCAAGGTTGAGAGTTATGCTGACTATCACTCTATCAGAGTTGATGTCAGATGTGCAAGTCACTCAAACAAGAATGGATGGCGTGCTGGAAAGGAGTGGTGAAGCCCAGCGCCTTCAGAATTCTTTAAAGCAAATGGCTATGGCTTCTTACAGCGAAGAGTTGTTGCGTGAATGTGGTCTTCCTGAAGATACATTGGATGCTAATTTTGACAATGAAGGCAAAGAGTTCTGGAATTGGTCAGAAGTGAGCGATTTGTCGGAGACACTTTTGAAAGCACTTGACGCGGCAACTGATCATGCCCTTATGGCGCCATCAATGATGACAGACAAGTATTCTACTACTGAAGGATTTTACTGCCTGGCTTGGGCTTACAAAAATGTCCCAGATTTGCATATTATGTGGCTTTTATATCTGTGTGATGCCCATCAACAAAACCAATCATGGGCTGAAGCTGCTCAGTGTGCAGTTGCTGTAGCAGGTGTTATAATGCAGGCAATAGTTGGACAGAAGGACAATCTTTGGGGTAAAGATCATGTGGCTGCTCTTTGCAAGATTTGCCCTATGCTCAGAGGTTCTGTTGTTGGAGAGGCAGCGTCTGCTGAAGTGGAGGGCTATGGAACATCGAAGTTGACAGTAGAGTCGGCTGTAAAATACCTGCAATTAGCTAACAAACTGTTTATTCAAGCAGAGCTTTTTCACTTTTGTTGCAACATTCTGGAGCTTATCATCCCAGTTTACAAGGCCCGAAGATCTTATGGTCAGCTATCTAAGTGCTACACATCTCTGTGCAGCATTTATGAGGCTTTACAAGAGCAAGAAGCAAGTCCTATTCCGTTCAAGGATGCAACATATTACAGGGTTGGATTTTACGGCTCGCAGTTTGGAAAAATGGACCGCAAAGAGTATGTCTACAGAGAGGCGCGTGATGTCCGTTTAGGTGATGTCATGCAAGCTATGGGAACCATTTATGAGTCTAAAGTAGTGGAAGGTGGTCAAACACTACATATCATTCCTGATTCTCGTCAAGTGAGTGATCAGGATCTTAAACCTGGAGTATGCTACTTACAAATAACATCAGTCGACCCTGTTCTCGAAGATGAGGATCTAGACCTCCGTAAGGAAAGGAAACCTCCCGAGAGTACTTCAAGAGTAACTACGCGAGTCTTTGATCGTTTCTTATTTGACACTCCTTTTACCAAGAATGGACGAACACAGGGAGGGTTAGAAGCCCAGTGGAAGCGTCGAACTATTTTGCAGACTGAGGGGCCTTTTCCTGCTCTTGTCAATCGTTTATTGGTGATTCAGTCAGAATCTCGTGAGTTCTCGCCCATTGAGAATGCCATCGGCATGATTGAGGGCCGCTACAAGGCTTTATTAGGTGAACTTGAAGAGCATGAAAGAATGGATGGCGACCAGGCCCCACGATTGCAGAGCCTGCAGCGAATATTGCAAGGAAGCGTAGCTGTTCAGGTAAACAGTGGAGTACTTGGAGTGTGCACTGCGTTCTTGTCAGGGGAGCCAACAACTAAGCTGCGTTTAGAAGAGCTTCACCAACTAATATCTGTGTTGATGGAGTTTATGGCTGTATGCAAAAAGGCCATTCGCGTTCATTCTAGGTTAATTGGAGAAGAGGATCAAGATTTTCATTCAAATCTAGTGATCGGTTTTCAGTCTCTAAGAGAAGAGCTTTCTCGTTACATTCCTGCCATATTACCCGAACTTTGA >Pp3c1_25190 ATGCATTTGGTCGCTGGAGCGCCTATATGGTCGGTGGAAAGCGTCAAGGAGGGAAAAGGATCCAGGTTCGACGTGTCGGACTCAGTAGGACAATGTAGGGTAGGTAGTCATGATCGGAGGGACGAGGAGGAGACATGGGGACTCAATGCAGAGACAGAAAGCTCTGCATTCTGGGAGCTGAGCTTCGAGACTAGAGCTGTCGTCGACAGCGGATCAATTAAGAAGCAGGGGATGGATGAAATTGCCTTGAGCGGGCAGCGGTTCAAACGTATCCCACACCCGTACATCGGGCAGTCAACAGATCTTGAGTCCTTGCTGAATGGGAATGGAGACCCTTTCCCACATTTCAAAGAGCTTCTTCAAAGCTACAGGGCTGAATGGGTGAAGGATGAGTTCAAATACGGTCATTATGAAGCTGTGCCACCGCCAGCCTTAGAACATCAGATTTTTGAAGGACCCGACACTGACATACAGACAGAGTTTCGGCTTTCTAACGTCAGACTCGGCAGAAATGGTGATGTTACTGATGATGAAGATCCTCAAACTCCACGACGGCTTTCAAGACGTTTTTCTGTACGGTCATCTGGTCGTTTCTCTATGAGATCTACGACTAGTGATGCACCTGAAGCATTGCACACAAATATCTCAAAGCATTATGGGGTTGCTCCGTTACCTCCTTATGAGCCCGTTTATAATTGGCGAGCAACAAGGGCATCTGTACTTGGACAAAGAACTTCGGAACTTCCATCAGCAATATCATCTAGCGGGCTGAAGGTTTCTGTGAAGGTTGTCTCTTTGAATGTTCAGGCCGGACTTGTCGAACCCATGTACGGTACCTTGTGTCTCTATCATCGAGAGAAGCGGGAGAAATTATCAGAAAATTTTCACTTCCGATGTTTACCATCAGAGTTCCAAGATGAGGGTGGTAATTGTCTGAGAAGAGCTATATTTTCACTGGAGGCAGCGTCGCCAGCAATATGTTTGTTGATCCAGCTTGAAAAGCATGTGACTGAGGAAGGAGGAGTAACGGCTCATGTTTATTCTCGAAAAGAACCTGTACACTTGACCGAGAGAGAAAAGCAGAAGTTACAGGTCTGGGCGCGCGTGATGCCATTCAGGGAGCCTTTCGCGTGGGCAGTAGTTGCTCTGTTTGATGCAAATATAACAGGAGGTGTAGGAGGATTCTCATCTTCTCCAAGCAGCCCACTTCCACCAGGACTTTTTGGACCATCTTTGATGGAAGCATCCTTGGATTCTGATGGACGACTTATAGCTGATGCTAAGACAGAATCATCTAGTGTGCCAGTTTTGGTTGATGTTCAGAGCCTTCGCCGGGTCAAAGAAAATTACACGGAGGAAATGCTTCAGGATCCCAAGTACAAAGTGCACAAACCCGTGAAGGCCATCCTTCGTCTCGAGATAGAGAGGTTATCTACTGAAGATCATGACCAAGATTCCATATTTGAGTGTGGTAGTTTTGGTCGTGGGTCCACTGATGGTGATTCCCGCTTGACAGTAGGACCCTCTTTCTCAGGGCGTTTCATGCAGGGGCTGGGCATGACGAAGGTTACGCATAATGGGCGGCAGAAATGGAGCCCTGGAAGAAAACATCGCTATCTGCATTCCGGCAGTGTTGGCAGCATTGAATTTGGAAAGTTTGACTTCCGGGCTATTGAGTTTCGATCGGGTTCGAAAGTTGAGGTTTTACCTCAGCTATTGCACTGCCTGTATGTATATCCTCAATCAGTCAATTTAAGTCGAAAACGCAATCTTTTTGTGCGAGTGGAGCTTCGAAAGGATGATGTAGACATTCGCAAATCTCCTCTCGAGGCCCTTTATCCGAGGGATGCTGACAGCTCTATGCAGAAATATGCACACTCTCAGATCGATGCAAACACCAAGACACCTCACTATCATGATGAGTTCAAAATTCAACTACCTGCCGTTCTCTCTCCTGAGCATCACCTTCTGTTCACGTTTTTTCATGTGGATCTACAGATGAAAATTGAGGCTCCAAAGCCGGTGGTAGTGGGATACTCTGTTCTTCCGCTCATGTTTGTTTGTCAGGTTCAGCGGTTGGACGGCAGCCTACCTATCGCAAAGGAGCTGTATTCCAATTATCTACAAGAAAATGTGAAGGAAAGGTTGGAGTACTTGGATGATGGCAAAACTGTATTTAAATTGAGGTCACGATTATGCTCTTCTCTTTATCCGGTTAATGAGAGGATCCGAGATTTCTTTTCAGAATACGATCGACATGTCTTGCGGACCAGTCCACCCTGGGGTACTGAGCTGATGGAGGCTATTAATGCTCTGAAGACGGTTGAGCCGTCAGCTATGCTCCAGTTTCTTCAACCTATTCTCAACATGCTGCTTCGTATGATTCGCGATGGAGGAGAAACGTTGCAGGTTGCTGCATTCCGTTCAATGGTTAACATCATTACCAGGGTACAAGCAGAGACATCTGATGGGGCTGAAAGAAATCGTTACCTTGTGCATTATGTGGATTATGCATTTAATGATTTTGGTGGGCGTCATGAGCCTGTGTACCCAGGTCTGTGCAGTGTATGGCGCAGCCTTGCTCGAAGCAAGGCGAAAGGCTACCGTGTCGGACCTGTGTATGATGATGTTCTTTCCATGGCTTGGGTGTTCCTGGAGCTAATTGTCAAGTCCATGGCACTTGAACAATCCCGCATTTACTCTGAGTCCCTCCCACCTGGAGAGGAGTTACCACCTTTGCAGCTCATTGATGAGGTCTTTAAAAGTATCGTACAGCTCTATGATTGTTTACTGACAGAGGTTCATGAGCGCTGCAAGAAGGGCATGCTTCTCGCAATGAAGCTGAATAGCAGTATTGCATACTTTTGCTATGACCTTCTCTCTGTAATTGAGCATCGACAAGTCTTTGAGCTGGTTGCGCTTTATTTCAACAAGTTTGCTGGGGTATGTCAATCTCTTGTGCACGAATGTAAGCTTAATTTTCTGCGCATCGTCTGTGACCATGATCTCTTTGTTGAGATGCCCGGTCGAGATCCTACAGAGAGGAATTATTTGGCATCACTGTTGATGCAAGAGCTCTTTGTTACTTGGGATCATGAAGATCTGACTTTAAGATCTAAGGCAGCTCGAATCCTTGTGCAACTTATGTGCAAGCATGAGTATGATGCACGGTATCAAACATTGGAGGACAAAATGTATATTGCCCAACGTTACTTTCCACTAGTTGACCTGATATTGGACGAAATGCCAGTGTTCTATGGCCTGAGCACTACAGAGAAGCGTGAAGTGCTGGTGTGTGTGCTTCACATTCTGCGATATCTAGACGATGCATCTCTTGTTAAAGCTTGGCAGCACAACATGGATAGAACAAAGCTTTTTTTCAAACTCCTGGAAGAATGTCAGGAATTGCTGGAGTATAAGAAGGCTGGAGCAGATGGCTTGATGGGAGCTATGCCAGCGAATGATCAAGGAGAAGGGCCCCTTCGATACTCCGAGAAGCTCTCACCTGCAGTCAATCAGTTTTTGATTGAGGCATCTCGGCAGGATGTCAGACTCACAAAGATTTCTCCAAATGCTCAGTGGATACTTCCACAAACGAGTCCAGAGATTGGTTCATTCTGGAAAAGAGCAAGCCCTGTAACAAATAGTTCAACTAGCCCAGGTCAGCCGCATTCGTTGCGAGAGGCACTAGCCCAAGCACAGTCTGCGGGAAGAAGTGGAGGCAGGTCTCTTCGTGAGACCTTGCATCCTATGCTCCGCCAAAAGTTGGAGCTATGGGAGGAGAACCTTAGTGCCTCTGCTATGCTCCAAATTTTGGAGGTACTTGAGAAGTTTATAAGTGCAGTATCAAGTCAAGCTGTTCTCACTGACTACATGAGGCTTGATTGTATCACAACTATTTTTATTGGTTTTCTGGGACGCAGCCAGCCGTTGCCATTTTGGAAGGCCTTTCTACCTTTCTTCAATAACGTGTTTCGTCGTCATGGCGCTACCTTGATGAGTAGGGAGAATGATAGGTTCTTGAAGCAAGTAGCATTTCATCTACTACGGCTCGGAGTTTTCCGGAATGAGTCCATACGGAAACGTTCTGTTGTTGGCCTTCAAATTCTTGTCCGAAATGCATACCACTACTTTCAAGGCCTTTCAAGACTGCGGGTGATGCTTACAATCACACTTTCTGAGCTCATGTCAGATGTTCAAGTAACACATCCTAAGATGGATGGATCCTTGGAAGAGAGTGGTGAATCTCAACGTCTTCGTAGGTCCTTGCAACAGATTGCACAAGAAAGTATTAGTGCGGATCTTCTACGGGAATGTGGTCTTCCTGAAGATTCTCTTACTGCTTTGCCAGAAGGTGTGAATGGCCAACAATGGAGTTGGGCTGGAGTCGCTGAGCTTTCCACCTCTCTGCTGAAAGCTGTGGATGCTGCTGTAGGACATGCTCTTTTGGGTCCTGAGATTTTAATGAATGACAAGTATGCAACTGCAGAGGCCTACCATGGTTTGGCGACGGCATATACCAACGTGCCCGATCTGCATATAATGTGGCTTCTGTATCTCTGCGAAGTTCATCAAGGCAACCAGTCTTATGCAGAGGCTGCTCAGTGTGCTGTTGCGGTTGCAGGTGTCATCATGCATGCTATAGTAGGAAAAGGTGATCATGTTTGGGGAAAAGAGCATGTTGAGGCACTGGGTAATATTTTCCCAATGCTCACTGGTTCCCGCTTTGGGGATGCTGCAACTGCCGAAATTGAAGGCTATGGGTCATCGAAATTGACTGTCGAATCGGCAGTGAAGTACTTGCAGCTCGCCAATAAACTCTTTGTCCAGGCAGAGCTCTTCCATTTCTGTGCCGGCATATTGGAGCTCATAATTCCCGTCCATAAGTCAAGGCGTGCCTATAGTCAGCTGTCTAAATGTCATACTTCATTGACCAGCATCTACGAAGCTATACTAGAGCAAGAGTCGAGCCCTATCCCTTTCACGGATGCAACATATTATCGTGTGGGATTTTATGGGAAAAGCTTTGGTAGTTTGCACTGCAAGGAGTATGTGTACAGGGAACCACGGGACGTGCGGTTAGGGGACATTATGAAAAATTTAGGAAATATTTATGAGCCTACAGTAATTGAAGGAAAGCAGAACTTGCATATTATCCCCGATTCTCGTCAAGTGAATCCAGAGGATCTTCAAGCTGGCATTTGTTACTTGCAAATTACATCTGTCGATCCTGTTACAGAGGACGAGGATTTGGAAAGCAGGCGAGAAAGACAATCCGGGAGGTCCTCGTCAACATTCAGTGCACGAGTCTTCGATCGATTTTTATTTGACACTCCTTTCACAAAGAATGGAAGATCCCAAGGAGGTTTGGAAGATCAGTGGAAGAGGCGTACGGTTTTGTGGACTGAAGGGCCTTTTCCATCTCTTGTAAATCGTTTAATGGTTGTGAAGTCTGAGTCGCGAGAATTTTCGCCAATCGAAAACGCCATAGGAATGATTGAGACTCGTACAGCAGCTTTAGCAGGAGAGCTCGATGATCAACGTATAAATGAGGGAGATCCTCTGCCCCGTTTACAAGGCCTGCAAAGAATCTTGCAAGGAAGTGTTGCAGTCCAGGTAAATAGTGGAGTGCTAGGTGTCTGCACAGCTTTCTTGTCTGGGGAACCTTCAACACGATTGCGCTCACAAGAACTACAGCAGCTGATAGCAGCACTCTTGGAGTTTATGGCTGTGTGCAAGAAAGCAATTCGAGTACATGCACGACTGATTGGAGAGGAGGACCAAGACTTCCACTCGCAGCTTGTGATTGGATTCCAATCACTCACAGCAGAGCTATCCCACTATATTCCCGCCATCTTGTCAGATGTAACCATACTTGGGAAACACAGCAATGTGCTCAAGCTCTGA >Pp3c4_25310 ATGGGTGAGATTGCCCTGAATGGGCATCGGTTTAGGCGTATCCCACATCCTTACTCTTTGCAGTCAACAGACCTCGAGCTCTTGTCAAATGGGAATTTGGAGCCATGGCCACATTTAAAGGAGCTGCTTCTAAGCTACACTGCAGAATGGGTAAAGGATGAACTTAAGTATGGACGCTATGAAAGTGTGCCACCCCCTACGTTTGAGAACCAGATCTTTGAAGGGCCTGACACTGATGTAGAGACAGAGTTACGCCTTTCAAATATAAGACTTGGAAGGCATGGGGATGCCACGAATGATGAAGATCCGACAACTTCAGGAAGGTTTTCTCAAGGATTATTTTCTGGTCGATTTTCTGGAAGGTCAACAGCAAGTGATGTTCCAGATTCAACTGTTTCTAAAGCACCGAAGCACTATGGTGGAGCTCCCCTCCCTCCATATGAGCCAGTCTTCAATTGGCGTGCAACGAGGGGATCTGTATATGGTCAAAGGACACCTGAGATTCCATCAGCACTATCACCAAGTGGCGGGCTGAGGATTTCTGTGAAGGTTGTGTCTCTAAATATTCAGGCTGGTCTTGTTGAGCCGTGGTATGGTACGGTGTGTTTGTATCACCGGGAAAAGCGAGAAAAACTGTCGGAGGATTTTCACTTCCGATGTTTACCAGCAGAGTTTCAAGATGAGGCTAGTGGCTATCAACGGAAAGCTATTTTCTCGCTTGAGGCACCGTCACCAGCGATCTGCTTGTTGGTGCAGCTTGAGAAACATGTCACAGAAGAAGGAGGTGTTACTCCTTCTGTCTATACGCGTAAAGAGCCTGTACATTTGACTCAAAGAGAAAAGCAAAAATTGCAAGTATGGGCAAGAGTGATGCCGTTTCGCGAACCTTTCTCTTGGTCGACTATACCACTTTTTGATGCTAATATAACTGGAGGTGTGGGGGGTTTCTCGTCATCTCCAACAAGCAGTCCTCTGCCGCCGGGCATTTTGGGGTCGGCTCTTATGGAGGCATCACTTGATTCAGATGGCAAGTTGATTGCTGACTCCAAGACCGAATCTGCTAGTGTCCCAGTTCTGGTTGATGTACCAGGGCTTCATCGTGTAAAAGAGAATTATACAGAAGAGATGCTTCAGGACCCTAAGCGCAAAGTACACAAGCCAATGAAGGCAACTCTACGGCTTGAGATTGAAAGGCTGTCCAATGATGATCACGAGGCGGACTGCATCTCTGAGTGTGGCAGCTTCGGTAACGGCTCCTACGATGCTGATTCCCGTTCAATAGGGGGAGCTTCATTATCAGGGCGTTCTACTCAAGGGCTAGAGTTCACGAAGGCGTTGTATAATGGACATCAGAAGGGCAGCCCTGTGCATCGTGAACTTCATTCAAGCAGTGGAAGTAGTCTTGAGTTGGGGCGGTCAGAGTTTCGCGCTGTTGAATTTCGACTTGGTCTGAAACCTGAGCCATTGCCTCAACTATTGCATTGTCTGTATGTTTATCCTCAATCTGTGAACCTTAATCGGAAGCGAAATCTCTTCATTCGGATAGAGCTCAGAAACGATGACAGTGATATTCGGAAGCCACCTCTCGAGGCTCTGTATCCAAGGGATGCAGATAGCTCAATGCAGAAGTATGCACACTCTCAGATTGATGCCAATACTAAGAATGTGCATTTTCACGATGAATTCAAAGTCCAACTCCCTGCCAAATTGTCACGAGAACACCACCTTCTCTTCACTTTCTTCCATGTGGATCTTCAGATGAAATTGGAAGCTCCAAAGCCAGTGGTTGTAGGATACGCTGTTCTTCCTCTCTTGTTCGCGGCTCAGGTTATTCGGTTAGACGGCACTCTGCCAATCGCCAGGGAATTATATCCGAACTATTTACTAGATAATGTGAAGGATAGGTTGGAATATCTTGATGATGGTAGAACAGTATTTAAACTGCGCTCTCGTCTATGCTCATCTCTTTACCCTGTAAATGAAAGGATACGGGATTTTTTTTCTGAGTATGATCGCCATGTATTGCGGACAAGTCCCTGGGGTAATGAACTGATGGAGGCAATCAATGCATTGAAGCATGTCGAAGCATCTGCTATGCTACAGTTTCTTCAACCGTGTCTGAATATGCTACTCCGCATGATTGGTGATGGGGGAGAAACGTTGCAGGTTGCTGCGTTCCGATCAATGGTCTGTATAATCTCCAGGGTACAAGCAGAGACATCCGATGGCGCTGAACGCAATCGTTACCTTGTTCATTATTTAGACTTTGCTTTCGATGACTTTGGTGGGCGCCATGATCCAGTGTATCCCGGTCTCTGCAGTGTTTGGCGTAGTCTTGCCCGCAGTAAGGCTAAAGGGTATAGAGTCGGACCTGTATATGACGATGTCCTCTCAATGGCTTGGTTCTTCCTGGAGTTGATCGTAAAGTCAATGGCACTTGAACAGTCTCGGTCCTACTGTGAGGCCGTTCCTCCAGGTGAAGAGTTGCCGCCGCTGCAGCTCAATGATGAGGTTTTTAAAAGTATTGGGCAGCTTTATGATTGCTTGCTAACGGAGGTTCAGGAGCGAGGAAAGAAGGGTTTGATTCTTGCCAAGAAACTTAATAGTAGTTTGGGCTTCTTCTGCTACGATCTTCTCTCTGTAATTGAACCACGGCAAGTTTTTGATTTAGTTGCGCTCTACTTCAACAAATTTTCTGGAGTTTGTCTATCAGCAATGCATGAGTACAAACTTACTTTTCTACGTATCATCTGTGACCACGACTTGTTTGTTGAAATGCCTGGTAGAGATCCGTCGGAGAGGTGTGTATGCCTCGATCTGCCTCAAATGAATTACTTGGCATCGATGTTGATGCAGGAGCTATTTATCACTTTCGACCATGAAGACCCAGCCTTGAAGGCAAAGGCATGTCGGATTTTTGTTCAACTCTTGTGCAAGCATGAGTATGATGCTCGGTATCAAACACTGGATGACAAATTGTATATTTCACAACGTTACTTTCCTTTGATTGGACTGATTTTGGATGAGATGCCAGTATTCTATGCCTTGAGCCCGGCAGAGAAGCGTGAAGTTTTGGTGTGTGTGCTCCACATTTTGCGCTTCTTGGATGATGCTTCTCTTATGAAGGCTTGGCAACAAAATGTTGCTCGAACAAGGCTATTTTTTAAATTACTCGAAGAATGTCAGGAGCTGTTTGAGTATAAGAAAGCAGGAGCTGATGGTTTGATGGGTGCAATGCCCGCCAACGAACAAGGAGATGGGCCCCTTCAGTATTCTGAGAAGCTATCTCCTGCAATCAATCATTTTCTTGCTGAAGCTTCACGACAGGATGTCAGGCTCACCAAGAGCTCTCCTGGTGCTCAGTGGTTAGTGCAACAAGCGAGTCCAGACAGCAGCACGTTTTGGAAGAGGGTAAGTCCGATTTCAAACAGCTCAAGCAGTCCAAGTCAGCCGCATTCATTGCGTGAAGCTTTGGCTCAAGCTCAATCAGCAGGAAGAGGGGGAGGTAGGCCTCTTAGAGAGAGCTTACATCCTATGCTGCGGCAGAAACTGGAGTTGTGGGAAGAGAATCTCAGCGCCGCAGTCATGCTGCAACTTCTCGAAATCGTTGAGAAATTTATGGCGGCAACAGCTGGCCAAGCTGTTGCTACGGATTACTCAAGACTTGACTGCATTACAAGCATCATAACTGGGTTTCTAGGGCGTAGTCAGCCCCTACCGTTTTGGAAAGCTTTCCTACCCGTGTTTAAAAATTTGTTTGCCCAACATGGGGCTATTCTGATGAGCCGTGACAACGATAGGTTTCTGAAACAAGTTGCGTTTCATTTACTACGGCTAGGGGTTTTTCGTAATGAATCTATTCGAAAACGTGCTGTTGTGGGCCTTCTAATTCTTGTGAGAACAGCTTTCCAATATTTCAAAGGGCTCTCTCGTCTGCGTGTGTTGCTCACAATCACGCTGTCCGAGCTTATGTCGGATGTTCAAGTGACACAACATCGAATGGATGGATCTTTAGAAGAAAGTGGTGAGTCCCAACGCCTTCGTAGATCGCTGCGGCAAATCGCTCAGGAGAACATTAATGCAGATCTTCTTCGTGAATGTGGACTTCCTGAAGATACACTATCAATAATGCCAGAGGGAGAGTTTGAGCAAAGTTGGAGCTGGACAGGAGTTGCCGAGCTCTCTAGCACTTTGCTTAAAGCTGTTGAGGCTGCTGTTGGACATGCTCTTCTGGGCCCAGAAGTCATGACCACTGACAAATATGCCACTGCTGAGGCATACTATGGTCTGGCTAGGGCATACTCCAACGTTCCTGATCTACACATTATGTGGCTTCTCTATCTATGTGAAGTTCATCAAGGCAACCAGTCTTATGCAGAAGCAGCCCAGTGTGCAGTTGCTGTTGCTGGTGTCATTATGCAGGCTATTGTGGGTAAAGGAGATCACATGTGGGGCAAGGAACATGTCGAAGCATTGCGAAAAATCTGCCCAATGCTTACCGGTGCTAGCTTTGGAGAAGCTGCTAGTGCAGAGATAGAGGGCTATGGGTCATCTAAGCTTACTGTGGAGTCAGCCGTAAAGTATCTTCAGCTTGCAAATAAACTTTTTGTTCAGGGAGAGCTTTTTCATTTTTGTGCTGGTATTTTGGAGCTTATCATTCCTGTTCATAAAGCAAGGCGTGCATACGGACAACTCTCGAAGTGCCATACTTCTCTGACCAGCATTTACGAAGCCATAGTAGAGCAAGAATCTAGTCCGATCCCCTTTACGGATGCAACTTACTATCGTGTGGGTTTCTACGGAAAAAGTTTTGGCAGCCTGAACTGCAAGGAATATGTTTACAGGGAGGCAAGGGATGTGCGATTGGGGGATATTATGAGAAGCTTGGGAAATATTTATGAGCCAAGAGTGATTGATGGAAAACAGTCCTTGCATATTATTCCTGACTCTCGGCAAGTGAAGGTTAATGATCTTCAACCGGAGATCTGCTACCTGCAAATCACATCTGTTGAGCCTGTTACTGAGGATGAGGACCTGGAATGTAGACGAGAGAGACAGTCCTGCAGATCTGCGGCAACGGTGAGTGCTCGGGTGTACAACCGTTTTCTGTTTGATACCCCTTTCACGAAGAATGGCAGGTCGCAAGGAGGTCTAGAGGACCAATGGAAAAGACGTACAGTTCTTTGGACAGAAGGTCCTTTCCCAGCTCTTGTGAACCGTTTAACAGTTGTGAAGTCAGAGTCTCGAGAATTTTCGCCAATTGAGAATGCGATAGGCATGATTGAGACCCGTACAGCTGCCTTAGCAGGGGAGCTAGATGACCACCGTTTGAATGAAGGTGACCATCTCCCTAGGTTGCAAAGTCTGCAACGGATACTGCAAGGAAGTGTCGCAGTGCAGGTGAACAGTGGAGTGCTTGGAGTTTGTGCTGCTTTCTTATCTGGGGAGCCTGCAACAAGACTCAAGCCACAGGAACTTCAGCAGCTCATAGCAGCACTTCTGGAGTTCATGGCCGTGTGCAAGAAAGCTATACGGGTGCATGCAAGACTTATTGGGGAGGAGGATCAAGAATTTCATTCGCAGCTTGTGATTGGGTTCCAATCTCTCACTGCCGAGCTCTCACGCTTCATTCCTTCCATCCCGTCAGATTTGTGA >Pp3c3_15370 ATGGGTGAGATTGCCTTGAGTGGGCAGCGGTTTAAGCGTATCCCACATCCTAACTCTGGGCAGTCGGCAGACGTTGAGCTCTTGTTGGATGACAATGTGGAGCCATGGCCACATTTAAAAGAGGTGCTTCAAAGCTACACTTCAGATTGGGTGAAGGATGAAAGCAAATACGGACATTATGAAAGTGTTCCACTTCCTGTATTTGAAAACCAGATTTTTGAAGGACCTGACACAGATGTAGAGACAGAGCTACGCCTTTCCAACATAAGGCTTGGGAGGCATGGAGACACTACAGATGATGAAGATCCAACGACGTCTGGAAGATATTCCGGAGGGTTGTTTTCAGGTCGATTTTCTGGGAGGTCAACAGGAAGTGATGCTCCAGATTCAATCGTCACCAAAGCACCGAAGCATTATGGTGGGGCTCCGCTACCTTCATACGAGCCAGTTTTTAGTTGGCGGGCAGCGAGGGCATCCGTATGTGGTCAAAGAATACCAGAGATTCCAACGGCATTTTCATCGAGTGACGGGCTGAGGATTTCCGTGAAGGTCGTATCTCTCAATATTCAAGCCGGTCTTGTTGAGCCGTGGTATGGTACAATATGTGTCTATCATCGGGAGAAGCGAGAAAAGCTTTCAGAGGATTTTCACTTTCGATGTTTACCAGCTGAGTTTCAAGATGAAGGTAGTGGATCTCAAAGGAAAGCTATTTTCTCTCTGGCAGCACCATCACCAGCAATCTGCTTATTAGTGCAGCTTGAGAAGCATGTCACAGAAGAGGGGGGTGTTACTCCTTCTGTCTACACACGTAAAGAACCTGTACATTTGACAGAACATGAGAAACAAAAACTGCAAGTATGGGCAAGAGTAATGCCGTTTCGTGAACCATTCGCTTGGTCGATGATTGCGCTGTTTGACGCGAATGTTACTGGGGGTGTGGGAGGCTTCTCGTCATCTCCAACAAGCAGCCCGTTGCCTTCAGGCATTTTGGGGTCTGCTCTCATGGAGGCATCACTGGATTTAGATGGCAGGCTGATTGCTGACTCAAAGGCCGACTCTGCCAGTGTTCCAGTTCTGGTTGATGTGTCGAGCCTTCATCGTGTGAAAGAGAATTATACAGAGGATATGCTTCTGATTGAACAACCTGGCGGCCAATCAAGCGTGCTTTCTTTCCAAGATCCAAAGCGTAAAGTGCACAAGCCAGTGAAGGCAATTTTGCGTCTTGAGATTGAGAGGCTGGGCAGTGATGATCATGAGGCGGATTGCATCTCCGAGTGCGGCAGTTTCAGTAATGGCTCCTTTGATGCTGATTCTCGTTCTATAGGAGCATCATTATCAGGGCGTTCTTCTCAAGGGCTTGAATTCACGAAGGCGCTATATAATGGATATCAGAAAAATAGTCCTGTACATCGTGACTTACTTTCAGGCAGTGGAAGTAGTCTTGATCTGGGGCGATCAGAGTTTCGTGCTGTTGAATATCGACTGGGTCCGAAACCTGAGCCATTGTCACAGCTGTTGCACTGCCTCTATGTTTATCCACAATCTGTCACACTTAACCGAAAGCGAAACCTTTTCATTCGGCTGGAGCTCAGGGTGGATGATAGCGATATTCGAAAGCCACCCCTTGAGGCTCTTTATCCCAGGGATGCTGATAGCTCTATGCAGAAGTATGCCCACTCTCAGATTGATTCTAATACGAAAACGCCTCACTTTCATGACGAGTTCAAAGTTCAACTTCCTGCCAATCTGTCTCCGGACCATCACCTCCTGTTCACATTCTTTCATGTGGATCTTCAGATGAAACTTGAAGCACCAAAGCCAGTGGTTGTAGGATACGCAGTTCTGCCGCTCTTATTCGCCTCTCAGGTTATCCGGTTGGATGGTACCCTGCCTATTGCAAAGGAACTGTACCCTAATTACCTAAAAGACAATGTGAAGGATCGATTGGAATATCTTGATGATGGTAGAACGGTATTTAAATTAAGGTCCCGTTTGTGCTCATCGCTGTATCCTGTTAATGAGAGGATTCGGGACTTTTTCTCCGAGTATAATCGTCACGTTTTGCGGACCAGTCCATGGGGAAACGAACTTATGGAGGCAATCAATGCTTTAAAGAACGTTGAAGCATCTGCTATGCTTCAGTTTCTTCAACCATGCCTGAATATGCTACTTCGCATGATTGGTGATGGTGGAGAAACGCTGCAGGTTGCTGCGTTCCGATCAATGGTCAATATCATTACCAGGGTACAAGGCGAAACATCAGATGGAGCTGAGCGGAATCGATATCTTGTTCAATATGTGGACTACGCATTTGATGATTTTGGTGGGCGCCATGATCCGGTGTATTCTGGTCTCTGCAGCGTTTGGCGTAGTCTTGCTCGCAGCAAGGCCAAAGGCTACAGAGTTGGACCTGTGTACGACGATGTGTTGTCCATGGCTTGGTTCTTCCTTGAGTTGATTGTGAAGTCAATGACACTCGAGCAGTCTCGTACGTATAGTGAAGCCCTTCCTCCAGGTGAAGAGTTGCCACCATTACAGCTCAATGATGAGGTCTTTAAAAGCATTGGGCAGCTGTATGATTGTTTGCTGACGGAGGTTCAAGACAGAGGAAAGAAGGGCTTGGTTCTCGCCAAGAAACTTAACAGCAGTTTGGGCTTCTTCTGCTACGATCTTCTCTCTGTTATTGAACCGCGCCAAGTCTTTGAGTTAGTCGCGCTCTACTTCAATAAATTTGCTGGGGTTTGTCAATCAGTAATTCATGAATACAAACTTAATTTTCTCCATATCATCTGTGATCACGACTTGTTCGTTGAAATGCCTGGCAGAGATCCTACGGAGAGGAATTATTTGGCATCAACGTTGATGCAGGAGCTATTCATCACTTGGGATCATGAGGATTCAGCCTTAAAGGCAAAGGCATGTCGAATACTTGTACAACTCCTTTGCAAGCATGAATACGACTCACGATACCAAACACTTGATGACAAATTGTACATCTCACAGCGTTACTTCCCTTTAGTTGGATTGATCTTGGATGAGATGCCAGTATTTTATGGGTTGAGCTCAACAGAAAAGCGTGAAATCCTGGTGTGTGTGCTCCACATTTTACGCTACCTGGATGATGCTTCTCTTATAAAGGCTTGGCAACAAAATGTTTCTCGAACAAGGCTGTTTTTCAAGCTTCTTGAAGAATGTCAAGAGCTGTTTGAGTACAAAAAAGCAGGAGCGGACGGCTTGATGGGTGCAATGCCTACCAATGAACAAGGCGAAGGGCCTCTTCGGTATTCTGAGAAGCTTTCTCCTGCAGTTAACCATTATCTAGCTGAATCTTCTCGACAAGATATTAGGGTTACAAAGAGTTCTCCCGGAGCTCAGTGGATAGTTCCACAGGCGAGTCCAGACGCCAGCATATTCTGGAAGAGAGTAAGCCCAATTTCAAACAGCTCAAGCAGCCCAAGTCAGCCTCACTCTTTGCGCGAAGCTTTGGCGCAAGCTCAGACAGCAGGAAGAGGAGCAGGGGTGACTCTTAAAGAAAGCTTACATCCTAAGCTGCGGCAGAAACTGGATGTGTGGGAAGAGAGTCTCAGCGCTTCGGTTATGCTGCAACTTCTGGAAGTCGTTGAAAAATTTATGGAGGCCACGACAAGCGAAGTTGTCGCTACAGATTATATCCGACTTGATTGTATCACAAGCATCATCACTGGATTTTTAGGACGCAGTCAACCCTTGCCCTTCTGGAAAGCTTTCTTTCCTGTGTTAAACAATTTGTTTAGTCAACATGGGGCTGTTCTGATGAGCCGGGATAATGATAGGTTTTTGAAACAAGTTGCTTTTCATCTTCTGCGACTCGGAGTTTTTCGTAATGAGAGTATTCGGAAAAGAGCCGTTGTTGGTCTTCAAATTCTTGTTCGAACTGCCTTCCAATATTTCCAAGGGCTGTCTCGTCTACGTGTGCTGTTAACAATCACGCTATCAGAACTTATGTCTGATGTTCAAGTGACTCAACATCGAATGGATGGATCCTTAGAGGAAAGTGGTGAATCTCAGCGCCTTCGCAGATCGCTGCGACAGATTTCTCAGGAAAACATCAGTTTAGATCTTCTTCGTGAATGTGGACTTCCCGAAGATGCACTGTCGGGAAAACCAGATGGAGGTTGTGAGCAGAACTGGAGCTGGGCTGGAGTTGCTGAACTGTCCAGCACTCTGCTTAAAGCTGTTGAGGCTGCAGTGGCACATGCTCTACTGGGGCCGGAAGTCATGTCAGCTGATAAGTATGCAACTGCTGAGGCATACTACGGTTTGGCGAGGGCATACTCCCATGTACCTGACCTACACATCATGTGGCTTTTATATCTTTGTGAAGTTCATCAAGGAAACCAGTCTTATGCAGAAGCCGCTCAATGCGCAGTTGCTGTTGCAGGCGTCATTATGCAGGCCATTGTAGGTAAAGGAGATCCCATGTGGGGCAAGGAACATGTGGAGGCTCTGCGAAAAATATGCCCTGTGCTCACTGGTGCTAGCTTTGGAGAAGCTGCTAGTGCTGAAATAGAGGGCTATGGTTCATCAAAGCTCACTGTGGAATCAGCTGTGAAGTATCTTCAGCTTGCCAACAAGCTTTTTGTTCAGGGAGAGCTTTATCATTTCTGTGCGGGCATTTTGGAGCTTATTATCCCAGTTCATAAAGCAAGGCGTGCCTACGGACAACTCTCAAAATGTCACACTTCTCTGACAAGCATTTATGAAGCCATAGTAGAGCAGGAGTCTAGTCCGATCCCCTTCTCAGATGCAACTTATTATCGTGTGGGATTTTATGGCAAAAGCTTCGGGAGTCTGAATGGCAAGGAGTATGTTTACAGAGAGGCAAGAGATGTGCGATTAGGGGATATCATGAGGAATTTGGGAAATATTTATGAGCCCAGGGTTATCGAGGGGAAACAGTCTTTGCATATCATTCCTGATTCTCGACAAGTTAAACTTGAGGACCTTCAAGCGGAGATCTGCTACATGCAAATCACATCTGTTGAGCCTATTACTGAGGATGAGGACATGGAGAGTAGTCGAGATAGACAATCCAATAAGTCAACAGCGACGGTTAGTGCCCGAGTGTTCAATCGATTTTTGTATGATACTCCTTTCACAAAAAACGGCAAGTCACAAGGAGGTCTAGAGGATCAATGGAAAAGACGTACTATGCTATGGACAGAAGGACCTTTTCCTGCTCTTGTGAATCGTCTAACGGTTGTAAAGTCGGAGTCTCGTGAATTTTCGCCTATTGAAAATGCTATAGGCATGATCGAAACTCGAACATCCGCATTAGCAGGGGAACTTGATGACAACCGATTGAATGAAGGAGACCATCCGTCCCGGTTGCAAAGCCTTCAAAGAATATTGCAAGGGAGTGTTGCAGTTCAGGTAAACAGTGGTGTGCTTGGAATATGTGCTGCTTTCTTGTCTGGAGAACCTGCAACAAGGCTAAACCCGCAGGAACTACAGCAACTTATAGCAGCACTCTTGGAGTTTATGGCTGTGTGCAAGAAGTCGATACGAATTCATGCACGACTTATAGGAGAAGAAGATCAAGAGTTCCATTCGCAACTTGTGATTGGATTCCAATCACTCACAGCTGAGCTGTCGCACTTCATACCTGCTATTTTATCAGAGTTGTAA >Pp3c9_15160 ATGGCTTTAACCAGCATGGATTCTGGCAAACTCAGCGGGCGAGATTATTTTTCAGACAGCGGCAGAGATTATGAAGGTTTTTCGAGCCTCTCCATTCATTCTTCGAGAACGGGCGTGAGTGAAAATGGAGTTAACGGGCAGCGGTTCAAGCGCATCATACACCGATCATCTAGTCAGAGCCTGGATTTGGACCCTTTGCTGAGCGGAAATTTGGACAGCTGGCCTCATTTGAAGGAGCTATTACAGAGTTACAAAGCAGAGTGGGTTAAAGACGACAATAAATATGGGCGTTACGATGCTGTACCCCCTCCTGCATTCGAGCCACAAATCTTCGAAGGCCCTGATACAGATGTTGAGACAGAGTTGCGTCTTGCAGCAAGGGGCCGGGATGCTGAAGAGGAAGAAGTCAGCACATCAGGAAGGCTTTCGTTAAGAAGTGATCCAGATGCTGCATATGTGAAAAAGCACTATGGAGGGCCTCCTTTACCATGCTACTATCCTGTTTTCAACTGGCATGTCGAGAGATCCGCTGTCTACGGTCAAAGAACACCAGAGCTACCACCTTCACTCTCCACGAGTGGATTGAAAATTTCAGTGAAACTTGTATCGCTCACAATGCAAGCTGGGCTTGTTGAACCTGTCTATGGAACAATGTGTCTGTACAACAAAGAGAAGCGCGAAAAGCTTTCGGAAGATTTTCATTTCAGATTTCTTCCCTCAGAGTTTCAAGATGATAATGGTGGAGGTCAGAGGAGTGTGCTTTTCTCATTGGAAGCTGGTTCACCGGCCATATGTTTGCTCATTCAATTGGAGAAGCATGTGACTGAGGAAGGAGGAGTCTCTCCCTCTGTTTATACTCGCAAAGAGCCCGCATTTTTATCAGAGAGAGAGAAGCAAAAGCTGCAAGTCTGGGCACGGGTGATGCCTTTTAGGGAACCTTTCGCGTGGGCCACTGTGTCGCTCTTCGATTCTAGTGTGACAGGAGGAGTAGGCGGTTTCACCTCACCCAGCAGTCCATTACCTTCTAGTTTATTGGGGTCGGGCCTGATGGAAGCAGCTGTTGACATTGACGGGCAGTTGCTTACATCCGGCGATTCTAAGCACCATGATACTAGACAACATGAGCCTGTCCTTGTCGATGTTCCTGGTCTTAATCGTGTGAAGGAGAACTATATGGAGGAGACTCTGCTGGATCCGAAACGTTTAGCGCACAAACCCGTGAAGGCTACCCTGCGTCTTGAAGTAGAAAGGGTATCACAAGATGAAGTGGAACAAGACGCTATATCTGAATGTGGCAGTTTTAGCAACAGTTCAATTGAAGGGGAGGGTAGAGAAGCCTCATTATCCAGGCATTTACCGCAGGCTTCTTCTGGTGTATCGAGGGGAGCTTTCAGTGGACGTCCCAAGTGGAGTTCCATGGACAAGCGTCGACTTGCGCATTCCGCTAGCGCTAACAGCTTCGAATTTCTGCGACCTCATTTCAAAGCTATTGAGTTTCGAACCTCGAATAGAGGCGACCTTATGTCCCAGATGTTGCATTGCTTGTATATATATCCACAAACTTTGAATCTCAGCAAGAAGCGAAATTTGTTTGTACGTGTGGAGCTTCGTAAGGACGACTACGATATTCGAAAACCTCCACTAGAAGCTCTTTATCCAAGAGATACTGACAATAACATGCAAAAGTACGGTCATTCTCAAGTTGATATCAACTCTAAAACTCCCCATTTTCACGATGAATTCAAGATTCGCCTTCCTGCTGTGATCACTCCACAGCATCACCTACTTTTCACCTTCTTTCATGTCGATCTTCAGATGAAATTGGAGGCTCCGAAGCCAGTTGTTGTTGGATATTCAGTTCTTCCTTTGCTTATTGGTGTCCAGGTGCAACGGCTAGATGGTACTTTACCCGTAGTAAAAGAGCTCCTCCCTCATTACTTGGAGGAGAGTGTTAAGGAACAAATGGAATTACTGGACGAGGGGAAAGCAGTTTTCAGGCTTCGTTCCAGATTGTGTTCATCTCTTTACGCCGTGAATGATAAAATCCGAGATTTCTTTGCTGAATATGACAGATATGTCCTTCACACAAATCAGCCTTTGGGGAGTGAGCTGTTGGAGGCAATTAATGGGTTGAAGCATGTTGAGCCATCAGCCATGTTGCAGTTTCTGCTGCCTTCACTGAACATGTTACTTCGCATGATAGGTGACGGCGGGGAGACTCTTCAGGTTGCTGCATTCCGGGCAATGGTGAACATCATCTCAAGGGTACAACAAGAAAGTTCAGATGTAGGAGCAGACCGTAACAAGTATTTGGTGCAATATGTTGATTACTCCTTTGATGATTTTGGAGGTGTTTCCGAACCTGTGTATCCAGGCCTTTGTAGTGTCTGGCGTAGCCTTGCTCGCAGTAAGGCAAAAGGCTACAGGGTAGGCCCTGTCTACGACGACGTATTATCAATGTCATGGTTTTTTCTTGAACTCATTGTGAAATCCATGGCACTTGAGCAGGCCCGCAAGTACTCTGAGAATCTTCCTCCCGGCGAAGATTTACCGCCTTTGCAACTTAATGACGAGGTCTTGAAAAGTGTTGGCCAGCTTTATGATTGCTTGCTTACAGAGGTCTACGACCGCTGTAAGAAGGGTCTAGCACTTGCAAAACGTCTGAATAGTAGCATAGCTTTTTTCTGCTATGATCTTCTCTCAGTGGTTGAACCTAGACAAGTTTTTCAGCTGGTGGCGCTGTACTTTGATAAATTTAGTGGTGCCTGTCAATCTATGCTGCATGAGTGTAAGCTGAATTTTCTTCGCATCATTGCTGATCATGATCTCTTTGTAGAGATGCCTGGTCGGGATCCTTCAGAAAGAAACTATCTCGCATCTATATTGATGCAGGAGCTCTTCATTACTTTTGACCATGGGGATACCATTTTGAAAAGCAAAGCTGCTCGGACTCTTGCTGTCCTCATGGCTAAGCACGAATACGATGCCCGATACCAAACTTTGGATGACAAATTGTACATTGCACAACGCTATTTTCCATTGATCACTCACATTCTCGAGGAAATGCCTGTTTTCTACAACTTGAATCCTCCGGAGAAGCGCGAGATATTGGTGTGCATGCTCCAATATCTTCATCATTTAGACGATCCTACGTTGATCAAGACGTGGCAACAAAGTGCAGCCCAAACAAGACTGTTTTTCAAGTTGCTTGAAGACTGCCAGAATTTGTTTGAGTACAAGAAGGCTGGAGCTGATGGGTTAATGGGTGCCATGCCACTGTCTGACCAAGGTGATGGAAGTACCCGGTACACAGAAAAATTATCACCATCTGTTAATTTGTTCTTGGCGGAAGCTTCTCGTCAGGATAGTCGGTGGTCAAGCGCCCCAGCCACTGCAGACAATGGTAGTTATTTCTGGAAGCGGGTTAGTCCACAAATGAGCTCCCCAACCCAAACATACCGAGAAACTCCAATGCAGGGACTAGGCCCAGGCAACATCCTTGGAAGAACGAGTGCACAACTTCGTGCTAGTCTGCATCCTATGCTACGACACAAACTTGAATTGTGGGAGGAAAACCTTAGTGCTTCCGTGACCCTACAGATATTGGAAATTGTAGAGAAGTTCATGGATGCTGCAGCAGGCAATGTGGTAGTTACGGACTATGTCAAGCTTGACTGTATCACAACCATCTTTATTGGCTTTTTAAGCCACAGCCAGCCTCTACCATTCTGGAAAGCTTTTCTGCCAGTTTTCAATACCCTTTTCAAGAGTCACGGGTCAATATTGATTACTCGAGAGAACGACAGGTTTTTGAAACAAGTGGTTTTTCATTTGCTGCGCCTTGCTGTATTCAGAAACGACTCTATTCGCAAAATGGCAGTTGTGGGACTTCAGATTCTAGTTCGCACTTCATTCTGTTTCTTTCAGAACATCTCAAGGCTGAGAGTTATGCTGACTATCACTCTGTCAGAGTTGATGTCCGATGTGCAAGTCACGCAAACAAAAATGGATGGTGGACTTGAAAAGAGTGGTGAAGCCCAGCGTCTTCAGAGCTCTTTAAAACTAATAGCTATGCCTTCTCATAGCAAGGACTTATTGCGTGAGTGCGGTCTTCCCGAAGATGCATTGAAGGCTAGAGTTAACAACCAGGGTGAAGATTTATGGAAGTGGTCAGAAGTTAGTGATTTATCGGAGACTCTTTTGCAAGCACTTGATGCAGCGACTGAGCATGCCTTAATGGCACCATCAATGATGACAGATAAATATTCCACTACTGAAGGGTTTCATGGCCTAGCTTGGGCTTATAGAAACGTCCCAGATTTGCATATTATGTGGCTTTTATATCTATGTGATGCTCATCAGCAGAACCAATCGTGGGCAGAAGCTGCTCAGTGTGCAGTTGCTGTAGCAGGTGTTATCATGCAGGCTATAGTTGGGCAGAAGGACAATGTATGGGGTAAAGATCATGTGGCTGCCCTTTGCAAGATTTGTCCAATGCTTAGAGGTTCTGTTGTTGGTGAGGCTGCTTCTGCGGAAGTAGAGGGTTATGGCACATCCAAGCTGACAGTAGAGTCGGCTGTAAAGTACCTGCAATTAGCTAACAAGCTCTTCATTCAAGCAGAGCTCTTTCACTTTTGCGCTGACATTCTAGAGCTTATTATCCCTGTCCATAAGGCCCGAAGATCATATGGCCAATTATCAAAATGCTACACGTCTTTGTGCAGCATTTATGAGGCTTTACAAGAGCAAGAAGCAAGCCCCATTCCGTTCAAGGACGCAACATACTACAGGGTTGGGTTCTACGGCAAGCAGTTTGGGAAAATGGACCGGAAGGAGTATGTCTACAGGGAGGCACGTGATGTTCGTCTTGGTGATGTTATGCAAGCAATGGGAACCATTTACGAGTCCAAAGTTGTCGAAGGGGGTCAAACATTGCATATCATTCCTGATTCCCGTCAAGTGAGTGACCAAGATCTTAAACCTGGAGTATGTTATTTGCAAATTACCTCTGTTGATCCCGTCCTCGAAGATGAGGATCTAGATATCCGCAAAGAAAGGAAACCCTCGGAAGGAATCTCAAGAGTTACCACACGAGTTTTTGATCGTTTCTTATTCGATACTCCTTTTACCAAAAATGGACGAACACAGGGAGGGTTAGAAGCTCAGTGGAAACGTCGAACAATTTTGCAAACTGAGGGACCTTTCCCTGCGCTCGTGAATCGCTTGTTGGTCATCAAATCAGAGTCCCGTGAATTCTCGCCCATTGAGAACGCTATTGGCATGATTGAGGGCCGCTATAAAGCCTTGTTAGGAGAACTCGAAGAGCATGACCGAATGGATGGCGACCAGGCACCACGGTTGCAAAGTCTGCAACGAATATTGCAAGGAAGCGTGGCAGTCCAGGTTAATAGCGGAGTTCTTGGAGTGTGCACTGCGTTCTTGTCAGGGGAACCAACACCCAAGCTTCGGCCAGAAGAGCTTCAGCAACTAATTTCTGCTTTAATGGAGTTTATGGCTGTATGCAAGAAGGCCATTCGCGTTCATGCCAGGTTAATTGGAGAGGAAGATCAAGATTTTCATTCAAATCTTGTCATTGGTTTTCAGTCTCTAACAGCCGAGCTTTCCCATTACATTCCTGCCATTTTATCAGAGCTATGA >SMO011G0025 CTGCAAGCAGATGCGGAGCACTGCCCCCATCTCAAGCTTGTCTTGCAATCCTACAGCTCGGCCTGGCTCACGGATGACGCCAAGTACGGCCACTACCAAAGCGTCTCGCGGCCTGCCTTTCACAATCAGATTTTCGAGGGACCCGACACCGATGTAGAAACCGAGTTACACCTCTCCAACCTGCGCCAGGGCCCAAGCGCGTGTGACAGCGAAGAGGCCACCAATACTCCCGGGCGTACAAAGAAGCTGAAGCAGCATCTCGGCCCCTCCCCTCTTCATGCTTACGAGCCTGCATTCAACTGGGAATCCGAGAGAGGCGCTATAAGTGGCCAGCGACTGCCGGAACCCCCTCCAGCTTCTCTTGGCAGTGGTCTCAAGGTTGCCGTCAAGGTCTTACAACTCAAGCTTCAAGCAGGTTTCGTGGAGCCAATCTATGGGAGCCTCAGCCTCTATCATCGAGAAAGGCGGGAAAAACTGTCTGAAGATTTTTATTTCGAGTTCCTTCCTGGCGAATTTTGCGAGGGAACGGTGGCTATCCAAAGGCGTGCCATCTTTTCGGTGGATGCTCCTTCGGCATCCATTTGTATGCTTGTGCAGCTCGAGAAGCATGCAACTGAGGAAGGTGGCGTAAAATCCTCTGTGTATTCGCGTAAGGAGCCTGCTCATTTGACGGAAAGAGAGAAGCAAAGGCTCCAAGTATGGGCTCGAATAATGCCATTCAAAGAGCCGTTCGCTTGGGCCACCGTCCCGTTGTTTGACTTGAGTGTAACTGGGGCAATGACAGGTATCTCTTCTCCAAGCAGTCCCCTCTCTGGAGCAGACGCGGTTGGGGAAGCGGGGAAGCGTCTTGGCCACCCCATCATGCTAGACGTTCCGGGCCTTAATCGTGTAAAGGAATGCTACAATGAAGACTGGCTTCAGGATCCGAAGAAGAAAGCTCATAAACCTATCAAAGCTACGTTGCGCTTTGAAGTCGAGCGCCTTGCCCCCGAGGATCTAGATCCAGACGCAGCATCAGTATGTAGCAGTCCTGACAACCAGGATAGTCAGGTCGGCGATGCAGATGGAAGGAGCAGTGATGCGGATTTGGACAACAGAAAGAGACGGGTTGGGAACGTTGAGGTGAAGCAGCGATTGCTGCCTGCAGATGTAAGTGATCATCCTCTTATGGAGTTTCGGCATTTTACAAAGAGTGAGCCTTTTACGCAGTCGATACACTGCCTTTACGTGTACCCGCTGTCTGTAACGTTTAGTAAGAAGAGGAATCTCTTCATCAGGGTGGAGGTCCGAAAGGATGACATTGATCTCCAGACGCCTGCAATGGAGGCTATTTACCCCCGTGACGCTGAATCCGGCATGCGAGAGTGGGCATATTCTCAAATTGCTGTGGCTTCTCGAACGGCATATTACCATGACGAATTTAAAATGAATTTGCCGGCGGTACTAACGGCACAACATCACATTCTTTTTACTTTATTCCACGTGGATCTTAATATGAAACTCGAGGCTCCAAAACCAGTAGTCGTCGGCTACGCTATCCTGCCCCTCTTAGCTGGTGCTCACATGCGCTTTTCTGATGCCAGCCTTCCGATCCTAAAGGATCTTGTTCCGCATTATCTTCAAGACTCTGTAAAGGACAAAATTGAGCATTTGGAAGATGGGAGGGCATTGCTGAGGCTGCGCTTGCGTCTTTGTTCCTCATTATATTCAGTAAACGAGCGCATTAGGGACTTCACTATAGAATTTGATCGCCACATTTTAAGGGCCAATGCTCCCTGGGGTTCCGAGCTTTTGGAGCCAATCAACAGTCTGAAGAATGTGGATTCAACGTCCATGCTACAATTTTTGCAACCTTTGATGAATATGTTGTTGCATCTGATCAGTGACAGCGGGGAAACCCTTCAGGTTGCTGCATTTCGTGCCATGGTGAATATACTTACAAGGGTGCAACAAGAATCGTCTGACGGGGCCGAACGAAACCGCTATCTTGTTCAATTTATTGACTACGCTTTTGATGATTTCGGTGGGCGTCGGCCTCCTGTTTACCCTGGATTGTGTAATGTTTGGAGGGGCTTGGCTAGAAGCAAGGCAAAAGGCTACCGAGTTGGACCTGTATATGATGACGTGCTGTCAATGGCTTGGGTGTTCTTCGAACTGATCGTTAGATCTATGGCTTTAGAACAAGCTAGACTTTTCCCGGAAAACCTTCCTACTGACGAGGATGCTCCACCTTTGCAACTAACGGATGAAGTTTTTCGCTGCGTGTCAAATTTGTACGATTGCTTGCTTACGGAAGTTCACGATCGATCCAAAAAGGGCCTCAGCCTAGCCAGAAGGTTGAACAGCAGTCTGGCATTCTTTTGCTATGATTTACTTTCCGTTGTTGATCCCCGACAAGTGTTTGAGCTTATTGCTCTGTACTTTGACAAGTTTACGGGTGTTTGCCAATCTTCTTTGCACGAGTGTAAGTTGACTTTCTTACAAGTCATCTGCGACCACGATCTTTTTATTGAAATGCCAGGAAGAGACCCTTCTGAAAGAAACTATCTTGCTTCAAGCCTTATGCAAGAACTTTTCCTGACGTGGGATCACGATGATTTATCACAAAGATCGAAGGCAGCACGCATTTTGGTGGTCCTCACATGCAAGCACGAGCTCGACTGCCGCTACCAGAAGCTCGAGGACAAGCTGTACATATCACAACTATACTTCCAACTTGTTGGCATGATTCTGGATGAAATGCCAGTGTTTTACAATCTTAATGCGACAGAGAAACGAGAAGTTCTAATTTGCGTTGTACAAATTATCCGACATCTTGATGATATGTCATTGATAAAAGCATGGCAGCAGAGCGTCGCTCGTACGAGACTTTTCTTTAAGCTTATGGAAGAATGTCTCTCCCTCTTTGAGCATAGGAAGATGCATGATTCCTTGGGTGGAGCTTTACCAATGCAAACACCGGAAAGCGAAGGTGCATACTCACCCAAATACTCTGATACGCTGTCGCCCGCAGTTCATACTTTTTTTAGCCAAGCTTCTCGACAGGAGCTGAAGCCTCAGGCAACTCCTGAAAATGGTCACCTGTGGAAAAAGCCAAGTCCTCATTTAAATTCTCCAAGTCAGCCCTACTCTCTACGAGAAGCTTTGGCGCATGCACAGTCTTCTCGAAAAATGGCATCGAACAGAGCTCTTCGCGAGAGCCTGCACCCAATGCTGAGGCAGAAACTCGAGCTTTGGGAGGAGAACCTTAGCACTTCAGTGAGCCTACAGGTGCTCGAAATAGTGGAGAAATTCATAGACGTTGCGTCTGTGCACAGCATTGCTACTGACTACGTAAAGCTGGATTGTGTCACTGCTATTTTTACGGGATTCTTCTCCCACAGCCAACCTCTTATATTCTGGAAAGCATTCTTTCCTGTCTTCAACAACCTCTTTACACGTCATGGAGCGACGCTAATGGGCAGAGAAAATGATCGTTTCCTGAAGCAGATTGCGTTCCATCTCTTGCACCTTGCCGTGTATCGGAACGACTCGATACGAAAGAGAGCTGTTGTGGGCCTTCAAATTCTTATTCGGAGCTCCTTTTATTACTTTCAAAGTACAGCCAGGTTGCGCGTCATGCTGACAATAACACTCTCAGAACTAATGTCTGAAGTGCAGGTCACCCAGATGAAGCCTGATGGCAGTTTTGAAGAGAGCGGCGAAGCTCGCCGTTTGAAAAGATCACTGCAAGAAATGGCTTCAGAAGAAATAAGTGATGGCCTGTTGAAAGAATGTGGTCTCCCGGCGAATTGTCTAGATGCCGCGGTTGATGGAGATCGTGATAATCTCTGGCGGTGGTCGGAAGTTCGAGAAATGTCTGTGGCCCTGCTGCAAGCTCTGGATGCAAGCATCGAGCACGCTCTCCTGGGGACCATAATGACAACGGACAAGTATGCGGCAGCAGAAAGTTTCCACAGCTTGGCAGTCGCATACGCACATGTGCCTGATTTACACATAATGTGGCTGCTTCACCTTTGTGACGCCCACCAAGAAATGCAGTCGTGGGCCGAAGCTGCGGAGTGTGCTGTAGCCGTAGCGGGCGTGATTATGCAGGCTTTGGTAGCGAGAAACGATTTAGTTTGGGGGCGAGATAATCTGGAGGCGCTCCGCAGGATCTGTCCGATGCTTGCCACCTCAGTGGAGGCATCGGCTGCCGAAGTAGAAGGCTATGGGGCGTCGAAGTTGACGGTGGATTCAGCTGTCAAGTATCTACAGCTTGGCAACAAGCTCTTTGCGCAGGCCGAGCTCTTCCATTTCTGTGCGGCGATTGTGGAACTGGTGATTCCTGTGCACAAGAGCAGGAAAGCCTATGGTCAGCTTGCCAAGTGCCACACATCGCTGACGGCTATTTACGAGTCAATTGTGGAGCAGGAGTCGAGCCCGCTGCCCTTCATCGATGCGACATACTACCGTGTCGGCTTCTACGGGGAACAGTTTGGGAAGCTCAATCGACGGGAGTACGTATACAGGGAAGCCAAAGATGTGCGCCTGGGTGATATCATGGAGAAGCTGGGCCACATCTACGAGCTGGTTCTGGGTGCCGACCAAACGCTGCACATAATACCAGATTCGCGCCAGGTCAAAGCCGACGAACTAGAAAGTGGCGTGTGCTATCTGCAAATAACTTCGGTGGATCCGATATTTGAAGGCGAGGACTTGGAGAGTCGGAAGGAACGAATAGCTGGTCGACCATCGGCTTGCAGCTGTGCTCGTGTGTTCGATCACTTTCTGTTTGATACACCGTTTACCAAGAACGGCAAGTCGCAAGGCGGACTGGAGGACCAGTGGAAGAGGCGGACGGTCGTGCAGACGCACGGCTCATTTCCCGCTCTGGTAAACCGGCTTCTCGTGATCAAATCGGAGTCGAGAGAGTTCTCTCCCATAGAGAATGCCATAGGCATGATCGAAGCGAGGACGGCTACGTTGAGAAATGAACTCGAAGAGCCTCGCAACTCCGAGGGTGACCATCTCCCTCGGCTGCAGAGCTTACAAAGGATCCTTCAGGGCAGCGTTGCAGTACAGGTGAACAGCGGTGTGCTAGGAGTATGCTCGGCTTTCCTTTCTGGAGAGCCAGCGACAAAGCTCCGGTCCCAGGAGCTCCAGCAGCTGATTGCTGCATTGCTAGAGTTTATGGCTGTGTGCAAGCGAGCGATACGCATCCACTCGAGGCTCATCGGGGAGGAAGACCAAGATTTCCATTCGCAGCTGGTGAATGGCTTCCAGTCTCTCACTGCAGAACTGTCACACTATATCCCGGCCATTTTATCAGAGCTGTAA >Pbr033594.1.g ATGCTCAGCCTGCGGCCTCGCCGCGATTCCACTCCGTACACCACCAAATGGCAGAACAAGTTTGAGGAGAATTTGGAGCAGTGGCCACATCTGAAGGAGCTGGTGCAGTGCTACACAACAGACTGGGTGAAGGACGACACCAAGTATGGTCACTACGAGAGTATTGGACCGCCCTCATTCCAGAACCAGATTTATGAGGGTCCTGACACTGACATCGAAACTGAAATGCATCTTGCAAGTGCAAGGCAAACCAAGGTGGAAGATACTACTGATGATGACGTCCCCAGTACCTCGGGACGACAATTCACAGAAGCTACTGTATCGGATTCAGTACAGTCCAATGATCCAAAGCATTTTGGTCAATCTCCCCTTCCTGCTTATGAACCAGCATTTGATTGGGAGAATGAGAGGTCAATGATATTCGGACAAAGGATTCCGGAAACTCCAATATCTCATGGATTGAAGATCTCAGCGAAGGTTCTTTCCCTGTCATTTCAAGCGGGATTAGCTGAGCCATTTTATGGTACAATGTGCTTATACAATAGGGAGAGAAGAGAAAAATTGTCAGAGGACTTTTATTTTCGACATGCACCAACTGAAAAGCAGGATATTTCTTTTGAACCTCGCGGAATCTTCTATTTAGATGCTCCATCATCATCAGTTTGTCTGCTAATCCAATTAGAGAAGCATGCCACAGAAGATGGCGGGGTTACACCTTCAGTTTATTCGCGCAAAGAACCAGTACACTTGACTGAGAAAGAAAAGCAAAAACTGCAGGTGTGGTCTCAAATAATGCCTTACAGAGAGTCCTTCGCCTGGGCTATTGTTTCATTATTTGATAACAGCATTGGTGCAGCTTCTGGTGGGTCTGCTTCCCCAAGCAGTCCTCTGGCTCATAGTATACCTGGTACAAGTTCTCATGATGGTGTGTTTGAGCCTAGTGCAAAGGTCATATTAGATGGGAAGCTAGGATATCCAAGTCGAAGCTCTGTTGTTGTCGAAATATCAAACTTAAATAAAGTTAAAGAATGCTATACTGAGGACTCACTTCAGGATCCCAAACGTAAGATTCATAAACCTGTGAAAGGTGTTATGAGGCTGGAAATCGAGAAACACCAGAATGACCATGATGACTCGGAAAATATATCAGAAAGTGGTAGTGTGAATAATGATTCTATTGATGACCGCATTACCGATTCCACATTTGGGAAGCTCCCAAGTAATGGTTTGGATGGTCCTCAGGGTAGCAGCTCTAAGTGGAATTCTTCCGACACCAAAGAAAGATCTGGAAATGGACCAAATGCTCATGGAAATTCAATTCCCAGTGCTGACGATTTTCAAGCTTTTGACTTCCGTACGACGACAAGAAATAAGCCTTTCTTGCAGCTTTTTCATTGTCTTTATGTATATCCTATGACTGTTAGTTTGAGTCGGAAGAGGAATTTGTTCATAAGGGTTGAACTTCGGGAGGATGATAATGATATTCGTAGACAGCCTTTGGAGGCAATGTATCCAAGGGAACCCGGTGCATCACTCCAGAAGTGGGTTCACACACAAGTGACCGTTGGTGCTAAGGTGGCCTGCTACCATGATGAGATCAAACTCTCCCTACCTGCTACCTGGACACCGACACATCATCTTTTATTTACTTTTTTTCATGTAGATCTTCAAACAAAATTAGAAGCTCCAAAACCTGTAGTAATTGGATATGCGGCACTTCCATTATCCACGTATGCTCAGTGTAGGTCTGAAATTTCTTTGCCAATTATGAGAGAGCTGGTTCCACATTATCTCCAGGATATGGGCAGAGAGAGGTTGGATTATTTGGAAGATGGAAAGAATATCTTTCGATTGCGCTTAAGACTTTGTTCGTCGCTGTATCCTATCAATGAGCGGATAAGAGATTTTTTTCTTGAATACGATAGGCACACTCTTCGAACAAGTGCACCTTGGGGTTCTGAGCTTTTGGAGGCTATTAACGGTTTGAAGAATGTTGATTCCATTGCTTTGCTTCAGTTTCTGCATCCAATTTTGAATATGCTTCTGCATCTAATAGGAAATGGTGGAGAAACCCTCCAGGTTGCAGCTTTCAGAGCCATGGTCAATATTGTCACCCGGGTGCAGCAAGAGTCAGTTGACGATGCTGAAAGAAACCATTTCCTAGTTAACTACGTAGATTACGCTTTTGATGACTTTGGGGGTCGGCAACCACCAGTTTATCCTGGCTTGTCAACTGTTTGGGGAAGTTTGGCTCGTAGTAAGGCTAAAGGATATCGTGTTGGACCTGTGTATGATGATGTTTTGGCAATGGCTTGGTTTTTCCTTGAGCTAATTGTCAAGTCAATGGCGTTAGAGAAGATGCGTCTTTTCTATCATAATCTTCCTTTAGGTGAAGATATTCCGCCTATGCAGTTGAAAGAAGGTGTATTCAGATGTGTAATGCAGTTATATGATTGCCTACTAACAGAAGTGCATGAACGTTGTAAGAAGGGATTAAGCTTAGCAAAGCGTTTAAACAGCAGTTTAGCTTTCTTTTGTTATGACCTCTTGTCCATCATTGAACCTCGCCAAGTTTTTGAATTGGTGTCTTTGTACCTGGACAAGTTTTCCGGGGTTTGTCAACTGGTTCTTCATGATTGCAAGCTCACATTTCTACAAATTATATGCGATCACGACCTTTTTGTGGAAATGCCTGGGAGAGACCCTTCTGACAGGAATTACCTTTCGTCTATTTTAATACAAGAGCTATTTCTTACATGGGATCATGACGATTTGTCTCTGCGGGCAAAGGCAGCTAGAATTTTAGTAGTCCTTTTGTGCAAACATGAGTTTGATGCACGATACCAAAAGCCAGAAGATAAACTATATATAGCCCAGCTCTATTTTCCACTTATTGGACAGATTCTTGATGAAATGCCTGTATTTTACAACCTCAATGCTGTTGAAAAGCGTGAAGTTTTGGTCGCAATTTTGCAAATTGTACGGAACCTTGATGATTCATCACTTGTCAAGGCGTGGCAGCTGAGCAGTGCTAGAACTAGATTGTTTTTCAAACTCATGGAGGAATGCCTTGTTCTATTTGAGCACAGAAAACCTGCTGATATCACGCTTATGGGATCTAGTTCTCGCAGTCCTGTTGGTGGCGATGCCCCTGCTTCCCCTAAGTATTCTGATAGACTTTCCCCTGCGATCAACAACTATCTGTCTGAAGCATCTAGACAAGAAGTCAGACCTCAGGGTACTCCAGAAAATGGTTATTCGTGGCAGAGAGTAAATTCTCAGTTAAGCTCCCCTAGCCAGCCGTATTCCTTGAGAGAAGCACTAGCTCAGGCACAATCTTCTAGAATTGGAGCTTCTTCTCAAGCGTTAAGAGAATCTTTGCATCCAATATTGAGACAAAAATTGGAGCTCTGGGAAGAAAACTTGAGTGCTTCTGTCAGTCTTCAGGTTTTGGAAATAACTGAGAAGTTCTCCATAATGGCAGCATCCCACAGCATCGCCACTGACTATGGAAAATTTGATTGCGTCACAGCCATATTTATGAGCTTCTTCTCTCGAAATCAACCTTTGTCTTTCTGGAGATCATTGCTTCCTGTCTTCAACGGTGTCTTCAATCTTCATGGTGTAACTTTGATGGCTAGGGAAAATGACCGCTTTTTAAAGCAAGTAACCTTTCATCTTCTTCGACTTGCGGTTTTCCGAAATGATAATATCAGAAAAAGGGCTGTTATTGGGCTCCAAATGCTTATGAGGAGTTCTTTCTATTACTTTATGCAAACAGCAAGGTTGAGGGTCATGCTGATCATCACATTGTCTGAGTTGATGTCTGAAGTACAAGTGACTCAGATGAAGGCTGATGGAACACTAGAAGAGAGTGGTGAAGCACGGCGTCTTCGAAAGTCACTTGAGGAAGCGGCAGATGAAGCTAAGAGCCCCAGTCTATTGAGAGAGTGTGGAGTTCCTGACGGTGCTCTGTTAGAAATTCCAGAAAAAATGACAGAAAATAGATGGTCCTGGTCAGAAGTGAAATTTCTCGCTGACAGTCTTCTTCTTGCTCTTGATGCCAGCTTGGAACATGCACTTCTGGGCTCTTTGATAACTATGGATAGATATGCAGCTGCTGAAAGCTTCTATAGACTTTCTATGGCATTTGCCCCTGTCCCAGACCTTCACATAATGTGGTTACTGCATTTATGTGATGCACATCAGGAAATGCAGTCTTGGGCTGAAGCTGCTCAGTGTGCTGTTGCTGTGGCTGGTATTGTAATGCAGGCCCTTGTTGCTAGAAATGATGGTGTTTGGAGCAAAGATCACATAACTGCTTTACGTAAAATTTGTCCGATGGTCAGCATTGAGATCAGCTCTGAGACAACTGCAGCTGAGGTAGAGGGATATGGTGCATCAAAACTTACCGTTGACTCTGCTGTGAAGTATCTACAACTCGCAAATAAGTTGTTTTCTCAAGCTGAACTCTTTCATTTCTGTGCAAGCATACTGGAACTTGTTATTCCAGTTTATAAAAGCCGGCGGGCGTATGGACAACTGAGTAAATGTCACACAATGCTTACCAATATCTATGAATCAATCCTTGAGCAGGAGTCAAGTCCAATTCCATTCACTGATGCGACGTACTATAGGGTGGGTTTTTACGGTGACAGATTTGGAAAGTTGGATAGAAAGGAATATGTATACAGGGAGCCCCGCGATGTAAGGCTAGGTGACATAATGGAGAAACTTAGTCACATATACGAATCTAGGATGGATGGCAATCACACCTTACACATTATTCCAGATTCTAGGCAGGTGAAGGCAGATGAATTGCAGCCTGGAGCCTGCTACCTGCAGATAACAGCTGTTGATCCAGTCATGGAAGATGAGGATTTGGGAAGTAGACGGGAGAGAATCTTTTCGCTTTCAACTGGAAGTGTTCGTGCACGAGTCTTTGATCGTTTCTTGTTTGATACCCCATTTACGAAGAATGGAAAGACTCAAGGTGGGTTGGAGGACCAGTGGAAGAGGCGGACTGTTCTTCAAACAGAAGGTTCATTCCCAGCTCTTGTGAATAGGCTATTAGTTACCAAATCCGAATCGCTTGAGTTCTCCCCAGTAGAAAATGCCATTGGAATGATTGAAACTCGGACAGCTGCTTTACGAAATGAACTTGAAGAGCCTCGCAGTTCTGAAGGGGATCAACTCCCACGTCTCCAGAGCCTACAAAGAATTCTTCAAGGCAGTGTTGCCGTCCAGGTCAACAGTGGGGTACTGAGCGTGTGCACTGCATTCCTATCGGGCGAGCCTGCAACAAGATTGCGGTCCCAGGAACTCCAGCAACTGATTGCTGCACTCCTCGAATTTATGGCCGTGTGCAAGCGTGCAATCCGTGTGCACTTCAGATTGATCGGTGAGGAAGATCAGGAGTTCCACACTCAACTTGTGAATGGATTTCAATCTCTGACGGCCGAGTTGTCCCATTACATCCCAGCCATTCTGTCAGAGCTGTGA >Carubv10007699m.g ATGGAGAACAACAATCTTGGTCTTCGTTTTCGTAAGATACTTCGTCAGCCTGTTGCTCTCCCAAAGCTCGATCCTTTGCTTGATGAGAATCTGGAACAATGGCCGCATTTGAACCAATTGGTTCAATGCTATGGCACTGAATGGGTCAAGGATGTTAATAAATATGGACATTATGAAAATACTCGACCTGATACTTTCCAGAGTCAGATTTTTGAAGGACCTGACACTGATACTGAGACTGAAATTCGTCTTGCTAGTGCTAGGAGTGCAACTATTGAGGAGGATGTAGCTAGCATATCCGGGAGGCCTTTTTCTGAATCTGGATCCTCCAAGCACTTTGGGCAACCTCCCCTCCCTGCTTATGAACCAGCTTTTGACTGGGAAAATGAAAGAGCTATGATATTTGGCCAAAGAACTCCTGAATCACCTGCCGCAAGCTATTACAGCGGATTGAAGATCTCGGTCAGAGTTTTGTCTCTAGCTTTTCAGTCTGGCTTAGTTGAACCATTTTTTGGCTCAATTGCATTGTACAATCAAGAGAGGAAGGAGAAACTCTCTGAGGATTTTTATTTCCATATTTTGCCGACGGAAATGCAGGATGCTAAACTTTCTTCTGAAAATCGTGGAGTATTTTATCTAGATGCCCCATCAGCATCAGTTTGCCTGCTTATTCAATTAGAAAAAACAGCAACAGAGGAGGGAGGCGTTACAACATCTGTCTATTCCCGTAAAGAGCCTGTGCACTTAACTGAGAGAGAAAAGCAAAAGTTGCAGGTCTGGTCTCGCATTATGCCTTACCGAGAGTCTTTTGCTTGGGCAGTTGTTCCACTTTTTGATAATAATATTACCACAAACAGTGGTGAATCTGCTTCCCCTAGCAGTCCTCTTGCTCCCAGTATGACTGCGTCAAGTTCCCATGATGGTATTTTTGAACCCATTGCAAAGATCACATCAGATGGAAAGCAAGGTTATTCAGGTGGAAGTTCTGTCGTAGTTGAAATATCTAATTTAAACAAAGTTAAAGAGAGTTACTCTGAAGAGTCAATTCAGGACCCCAAACGAAAGGTTCACAAACCTGTTAAAGGGGTTCTAAGACTGGAAATTGAGAAACATCGGAATGGACCGGGAGACTTTGAAGATCTATCTGAGAATGGAAGTATCATAAATGACTCCCTTGATCCGACTGACCGCCTCAGTGACCTGACTCTTATGAAGTGTCCCAGTTCTGGTTCTGGTGGACCCCGTAGTGGCGGTTCGAAGTGGAATTCAGAGGATGCAAAGGATGTTTCGAGAAACCTAACAAGTTCAAGTGCGACTCCTGACTTAAATTGTTATCATGCTTTTGATTTCTGCTCTACAACAAGAAACGAGCCTTTTCTACATCTCTTCCATTGCCTTTATGTGTATCCTGTAGCTGTTACTTTAAGTCGGAAGAGGAATCCATTTATCCGTGTAGAATTGAGAAAGGATGACACAGATGTCCGAAAACAACCACTCGAGGCAATTTATCCAAGAGAGCCTGGTGTTTCACTCCAGAAGTGGGTTCATACACAGGTTGCTGTTGGTGCTAGGGCTGCTAGCTACCATGATGAAATTAAGGTGTCTCTTCCTGCCACATGGACGCCATCACATCATCTATTATTCACCTTCTTTCATGTTGATCTCCAGACAAAGCTTGAAGCTCCAAGACCAGTTGTTGTTGGATATGCATCACTTCCGTTATCTACCTATATCCACTCACGGTCTGATATTTCTCTACCAGTAATGAGAGAACTGGTTCCCCACTATCTGCAAGAAACCACCAAGGAGAGGTTGGATTATTTGGAAGATGGCAAGAATATTTTTAAGTTGCGACTGAGACTTTGTTCATCTCTTTATCCCACTAATGAACGTGTCAGGGATTTCTGTCTAGAGTATGATAGACATACCCTCCGGACAAGTCCTCCCTGGGGTTCAGAACTGTTGCAGGCAATAAACAGTTTGAAGCACGTTGATTCTACTGCCTTGCTTCAGTTTCTTTACCCAATTCTTAACATGCTCCTTCATCTCATTGGCAACGGTGGAGAAACTCTTCAGGTTGCAGCATTCAGAGCCATGGTGGATATTTTAACTCGGGTGCAGCAGGTGTCGTTTGATGATGCTGACCGAAATCGTTTTCTGGTCACCTATGTTGATTATTCTTTTGATGATTTTGGAGGCAATCAACCACCGGTTTATCCTGGATTAGCAACTGTATGGGGAAGTTTAGCTAGAAGCAAGGCTAAAGGTTACCGGGTTGGACCTGTATATGACGATGTACTATCAATGGCATGGTTTTTCCTCGAGTTGATTGTTAAATCAATGGCACTGGAGCAGGCACGTCTCTATGATCACAATCTACCTTCAGGCGAGGATGTTCCACCCATGCAGCTCAAAGAAAGTGTTTTCCGATGTATCATGCAATTGTTTGATTGTCTTTTAACTGAAGTACATGAACGTTGTAAAAAGGGGTTAAGCCTGGCGAAACGTCTGAACAGCAGTTTGGCCTTCTTCTGTTATGATCTTTTATATATCATTGAGCCCTGCCAAGTCTACGAACTGGTATCATTATACATGGACAAGTTTTCTGGTGTATGCCAATCTGTTTTACACGAATGCAAGCTTACATTTTTGCAAATTATCTCCGACCATGATCTTTTTGTAGAAATGCCTGGCAGAGACCCATCAGACAGGAACTATTTATCATCCATATTAATACAGGAGTTATTTCTCTCCCTGGATCATGACGAGCTTCCTCTGCGGGCCAAGGGAGCAAGAATTTTAGTGATCCTCTTATGCAAGCATGAATTTGATGTGCGGTACCAGAAAGCAGAAGATAAGCTGTATATTGCACAACTATATTTTCCTTTTGTTGGCCAGATTTTAGATGAAATGCCTGTTTTTTATAACCTAAATGCTACTGAAAAGCGTGAGGTTTTAATTGGTGTGCTGCAAATTGTTCGTAATCTGGATGACACATCACTTGTCAAGGCATGGCAGCAGAGCATCGCTCGTACTAGATTGTATTTCAAACTAATGGAAGAATGCCTCATACTTTTCGAGCACAAGAAGGCAGCTGACAGCATCCTTGGGGGAAACAATTCGCGTGGTCCTGTTAGTGAAGGAGCTGGATCACCAAAGTACTCCGAGCGACTTTCTCCTGCTATCAACAATTATCTGTCAGAGGCTTCTCGCCAAGAAGTCAGGCTAGAGGGAACACCTGATAATGGGTACCTGTGGCAGAGAGTTAATTCTCAGTTGGCCTCCCCTAGCCAACCTTATTCTCTAAGAGAAGCTTTAGCTCAAGCACAATCTTCACGGATTGGAGCTTCAGCCCAGGCACTAAGAGAATCGCTACACCCTATTTTGAGGCAAAAACTGGAACTTTGGGAAGAGAATGTAAGTGCCACTGTTAGCCTCCAGGTTTTGGAGATCACCGAAAAATTTTCATCAATGGCAGCCTCTCACAATATTGCGACGGACTATGGAAAATTGGACTGCATTACTACAATATTGACAAGTTTCTTCTCTCGAAACCAGTCATTAGCCTTCTGGAAAGCCTTCTTTCCAATTTTCAACAAAATCTTTGATCTTCATGGGGCTACACTGATGGCCAGGGAAAATGATCGCTTCTTAAAACAGATAGCCTTCCATCTCCTCCGGCTTGCTGTTTACCGCAATGACAGTGTCAGGAAAAGAGCTGTTATTGGTCTTCAAATACTAGTCAAGAGCTCGCTATACTTTATGCAGACTGCTAGGCTGAGGGCTTTGCTGACCATTACACTGTCAGAACTCATGTCGGATGTCCAAGTGACTCATATGAAAACAGATAATACATTAGAAGAGAGTGGAGAGGCACGACGGCTTCAACAGTCATTAAGCGAAATGGCTGATGAAGCTAAGAGTGTCGATTTGTTGAGGGAGTGTGGTCTTCCTGATGATACACTGTTGATAATTCCTGAGAAATTTACCGAGAACCGATGGTCATGGGATGAAGTGAAACATCTTTCTGACAGCCTTGTTCTTGCTCTTGATGCCAGCCTCGGGCATGCCCTTCTGGGATCTGTGATGGCTATGGATCGATATGCTGCAGCAGAGAGCTTCTACAAACTTGGAATGGCATTTGCTCCTGTTCCTGATCTTCACATAATGTGGTTGCTGCATCTATGTGATGCCCACCAGGAAATGCAGTCTTGGGCTGAAGCTGCACAGTGTGCTGTGGCAGTTGCAGGTGTGATAATGCAGGCCTTGGTGGCTAGAAATGATGGTGTGTGGAGCAAGGATCATGTGTCTTCCTTGCGTAAGATTTGCCCGATGGTAAGTGGCGAGTTTACAACAGAGGCATCTGCAGCTGAAGTCGAGGGTTATGGTGCTTCAAAGCTAACAGTTGACTCAGCCGTCAAGTATCTACAGCTTGCTAATAAGCTTTTCTCTCAAGCTGAGCTCTACCATTTTTGTGCAAGCATTTTGGAACTTGTTATTCCAGTTTACAAGAGCAGGAAGGCTTATGGGCAGTTGGCTAAGTGTCACACCCTACTTACTAATATTTACGAGTCCATTCTAGACCAAGAATCAAACCCAATCCCATTTATCGATGCTACATATTACCGGGTGGGATTTTACGGGGAAAAGTTTGGGAAGTTGGACAGGAAAGAATATGTATACCGAGAACCACGAGACGTGCGACTAGGGGATATAATGGAAAAGCTGAGCCATATTTATGAATCAAGAATGGACAGCAACCATATTCTGCACATCATTCCAGATTCGAGACAAGTGAAGGCAGAAGAATTGCAAGCAGGAGCGTGCTACCTGCAAATTACGGCTGTTGATGCTGTGATGGAAGATGAGGATCTTGGGAGCAGAAGAGAGAGAATATTTTCTCTTTCGACTGGAAGTGTTCGAGCAAGAGTGTTTGATCGCTTCTTGTTTGACACACCATTTACAAAAAATGGTAAGACACAAGGTGGATTAGAAGATCAATGGAAGAGAAGAACGGTGCTGCAAACAGAGGGTTCATTCCCTGCCCTTGTGAATAGGCTGTTGGTTACCAAATCTGAATCCCTTGAATTCTCGCCAGTGGAGAATGCAATTGGAATGATTGAAACGCGGACAACCGCCCTGAGAAATGAGCTAGAGGAACCTCGTAGCTCGGATGGGGATCACCTACCCCGGCTTCAAAGTCTGCAGAGGATTCTCCAAGGAAGTGTGGCAGTGCAGGTGAATAGTGGGGTGTTGAGCGTGTGCACAGCTTTCTTATCAGGAGAGCCTGCAACTAGATTGCGTTCGCAGGAACTGCAGCAACTGATAGCGGCACTGCTTGAATTCATGGCAGTTTGTAAGCGAGCCATTAGGGTTCACTTTAGATTAATTGGAGAAGAAGATCAGGAATTCCATACGCAGCTTGTCAATGGATTTCAGTCTCTCACTGCAGAACTCTCACATTACATTCCTGCAATCTTGTCCGAACTTTAG >Prupe.3G108400 ATGGTCAGCAATGAGATCTGCTCTGAGACTTCTGCAGCTGAGGTAGAAGGATATGTACTACAACTCACAAATAAGCTATTTTCTCAAGGCGAGCTGTTTCATTTTTGTGCAAGCATTCTGGAACTTGTTATCCCAGTTTACAAAAGCAGGAGGGCATATGGACAGCTGAACAGGGTTGGGTTTTACGGTGGCAGATTTGGAAAGTTAGATGGAAAGGAATGTGCATATAGGGAGGCCTGTGATGTACGGCTAGGTGACATAGTGGAGAAACTTAGTCATATATATGAGTGTGGGATGGATGGCAATCACACCTTGCACATTATTCCAGATTCTAGGCAGGTAAAGGCAGATGAATTGCAGTCTAGTGTCTGCTACCTTCAGATAACTGCTGTTGATTCAGTCATGGAAGATGAAGATTTGGGAAGCAGAAGGGAGAGAATCTTTTCTCTTTCCACTGGTAGTGTTTGTGCACGAGTCTTTGAGCGTTTCTTTTTTGATACCCCATTTACGAAAAATGGAAAGACTCAAGGTGGATTGGAAGACCAGTGGAATCTTCAGAAAATGCCATTGGGAATGATTAATAGTCGGACAGCTGCTTTACGAAATGAACTTGAAGAGCCTCGCAGTTCTGAAGGGGATCAACTCTCACGTTTCCAGACCCTACAGGGAATTCTTCAAGTCAGTGTTGCAGTTCAGGTTAACAACGGGGTACCGAGTGTGTGCACTGCTTTCCTGTCTGGTGAGCCTGCAACAAGGTTGCGGTCGCAGGAACTGCAGCAACTCATTGGCGCGCTCCTTTAA >Prupe.4G132800 ATGCTCAACCTGCGGCCTCGCCGCGATTCCACTCCGTACACGACCAAATGGCAAAACAAGTTTGAGGAGAATTTGGAGCAATGGCCACATCTGAAGGAGCTGGTACAGTGCTACACAACAGACTGGGTGAAGGATGAGAACAAGTATGGTCACTACGAGAATGTTGGACCGCCGTCATTTCAGAACCAGATTTATGAGGGTCCTGACACTGATATTGAGACTGAAATGCACCTTTCAAGTGCAAGGCGAACCAAGGTGGAAGATACTACTGATGATGATGTTCCAAGTACCTCGGGACGACAATTTATGGACGCTACTGTATCCGATTCAGTACACTCCAACGATCCAAAGCATTTTGGTCAATCTCCCCTCCCTGCCTATGAACCAGCTTTTGATTGGGAAAATGAAAGGTCAATGATATTTGGCCAAAGGGTTCCCGAAACACCAATATCTCATGGATTGAAGATCTCAGTGAAAGTTATGTCCCTATCTTTTCAAGCGGGATTAGCTGAACCATTTTACGGAACAATTTGCTTATACAATAGGGAGAGAAGAGAAAAACTGTCAGAGGACTTCTATTTTCGTCATGCACCAACTGAAAAGAAGGATATTTCTTTTGAACCTCGTGGAATCTTCTATTTGGATGCTCCATCATCATCTGTTTGTCTCCTAATCCAGTTAGAGAAGCATGCCACAGAAGAAGGCGGGGTTACACCTTCAGTTTATTCTCGTAAAGAACCAGTACACTTGACCGAGAAAGAAAAGCAAAAACTGCAGGTGTGGTCTCAAATAATGCCTTACAGAGAGTCCTTCGCCTGGGCTATTGTTTCATTATTTGATAACAGCATTGGTGCAGCTTCTGGTGGGTCTGCTTCACCAAGCAGTCCTCTTGCTCCTAGTATATCTGGTTCAAGTTCTCATGAGGGTGTGTTTGAGCCTAGTGCAAAGGTTACATTAGATGGGAAGCTAGGTTATTCAAGTCGAAGCTCTGTTGTTGTCGAAATATCAAATTTAAATAAAGTCAAAGAATGCTATACTGAGGACTCACTTCAGGATCCCAAACGCAAGATCCACAAACCTGTGAAAGGTGTTTTGAGACTTGAAATCGAGAAGCACCAGAATGACCATGTTGACATGGAAAATATATCAGAAAGTGGTAGTGTGACCAATGATTCTATTGATGATCGCATTACCGATTCCACATTTGGGAAGCTCCCAAGTAATGGTTTGGATGGTCCTCAGGGTAGCAGCTCTAAGTGGAATTCTTTCGATGCCAAAGAAATGTCTGGAAATGGATCAAATGCTCATGGAAATTCAGTTCCCAGTTCTGATGATTTTCAAGCTTTCGACTTCCGTACTACAACAAGAAATGAGCCTTTCTTGCAGCTTTTTCATTGTCTGTATGTGTATCCTACGACTGTTAGTTTAAGTCGGAAGAGGAATTTGTTCATAAGAGTTGAACTTCGGGAGGATGATAATGATATTCGTAGGCAGCCTTTAGAGGCAATGTATCCACGGGAGCCAAGTGCATCACTTCAGAAGTGGGCTCACACACAATTGACTGTTGGGGCAAGAGTGGCCTTTTACCATGATGAAATAAAACTCTCTCTCCCTGCCACCTGGACACCAACACATCATCTTTTATTTACTTTTTTTCATGTTGATCTTCAAACAAAATTAGAAGCTCCAAAGCCGATAGTAATTGGATATGCGGCACTTCCATTATCCACACATGCTCAGTTGCGCTCTGAAATTTCTTTGCCAATTATGAGGGAGCTGGTTCCACATTATCTCCAGGATATGGGCCGAGAGAGGTTGGATTATTTGGAAGATGGAAAGAATATATTTCGATTGCGCTTAAGGCTTTGTTCGTCGTTATATCCTATCAATGAGCGCATAAGAGATTTTTTCCTTGAATACGATAGGCACACTCTTCGAACAAGCGCACCTTGGGGTTCTGAACTTCTGGAGGCTATTAACAGTTTGAAGAATGTTGATTCCATTGCTTTGCTTCAGTTTCTTCATCCAATTTTGAATATGCTTCTCCATCTAATAGGCAATGGTGGAGAAACCCTCCAGGTTGCAGCATTCAGAGCCATGGTTAATATCGTGACCCGGGTACAGCAGGAGTCGGTTGATGATGCTGAAAGAAATCACTTCCTAGTTAACTATGTTGATTATGCGTTTGATGACTTTGGAGGTCGTCAACCACCAGTTTATCCTGGCCTGTCAACTGTTTGGGGAAGCTTGGCTCGTAGTAAGGCAAAAGGATACCGTGTTGGACCTGTGTATGATGACGTTTTGGCAATGGCTTGGTTTTTCCTTGAGCTAATTGTCAAGTCAATGGCATTGGAGAAGATGCGTCTTTTCTATCATAATCTTCCATTAGGTGAAGAGATTCCGCCTATGCAATTGAAAGAAGGTGTATTCAGATGTATAATGCAGTTGTATGATTGCCTACTAACAGAAGTGCATGAACGTTGTAAGAAAGGATTAAGCTTGGCAAAGCGTTTAAACAGCAGTTTGGCTTTCTTTTGTTATGATCTCTTGTCCATCATCGAACCTCGGCAAGTTTTTGAATTGGTGTCCTTGTACTTGGACAAGTTTTCTGGGGTATGTCAATTGGTTCTGCATGATTGCAAGCTCACATTTTTGCAAATTATATGTGATCACGACCTTTTTGTGGAAATGCCTGGGAGAGACCCTTCTGATAGGAACTACCTTTCGTCTGTTCTAATACAAGAGCTATTTCTTACTTGGGATCATGATGATTTATCTCTGCGGTCAAAGGCGGCTAGAATTTTAGTAGTCCTTTTGTGCAAGCATGAGTTTGATGCTCGATACCAAAAGCCCGAAGATAAACTTTATATTGCGCAGCTATATTTCCCACTTATTGGACAGATTCTAGATGAAATGCCTGTGTTTTACAACCTCAATGCTGTTGAAAAGCGTGAAGTTTTAGTCGCTATTTTGCAAATTGTCCGGAACCTTGATGATGCATCACTTGTCAAGGCGTGGCAGCAAAGCATTGCTAGAACTAGATTATTTTTCAAACTCATGGAGGAATGCCTTGTTCTATTTGAGCACAGAAAACCTGCTGATGGCATGCTTATGGGATCTAGTTCTCGCAGTCCTGTTGGTGATGGCCCTGCTTCCCCCAAGTATTCTGACAGACTCTCTCCTGCAATCAACAACTATCTGTCCGAGGCATCTAGACAAGAAGTCAGACCACAGGGTACACCTGAAAATGGGTATTCGTGGCAGAGAGTAAATTCTCAGTTAAGCTCCCCTAGCCAGCCGTATTCCTTAAGAGAAGCTCTGGCTCAGGCACAATCCTCTAGAATTGGAGCTTCTGCTCAAGCACTAAGAGAATCTTTGCATCCAATATTGAGACAAAAATTGGAGCTCTGGGAAGAAAACTTGAGTGCTTCTGTCAGTCTTCAGGTTTTGGAAATAACCGAGAAGTTTTCCACAATGGCAGCATCCCATGGCATCGCCACTGACTATGGAAAATTTGATTGCGTCACAGCTATATTCATGAGCTTCTTCTCTCGAAATCAACCATTGTCTTTCTGGAGATCACTGCTTCCTGTCTTCAACAGTGTCTTCAATCTTCATGGTGCAAATTTGATGGCAAGGGAAAATGACCGTTTTTTAAAGCAAGTCACTTTCCATCTTCTTCGACTTGCTGTGTTTCGAAATGATAATATCAGAAAAAGGGCTGTTATGGGGCTCCAGATGCTTATAAGGAGTTCTTTCTACTACTTTATGCAGACAGCAAGGTTGAGGGTCATGCTGATCATCACATTATCAGAGTTGATGTCTGATGTACAAGTGACTCAGATGAAGTCTGATGGAACACTAGAAGAGAGTGGTGAAGCAAGGCGTCTTCGGCAATCACTGGAGGAAGTGGCAGATGCCTCTAAGAGCCCCAGTCTTTTGAGAGAGTGTGGACTTCCTGAGAGTGCTCTGTTAGACATTCCAGAAAGAATGACAGAAAATAGATGGTCCTGGTCAGAAGTGAAGTATCTCTCTGAAAGCCTTCTTCTTGCTCTTGATGCCAGCTTGGAACACGCACTCCTGGGCTCTTTGATGACTATGGACAGATATGCAGCTGCAGAAAGCTTCTATAGACTGGCTATGGCATTTGCCCCTGTCCCAGATCTTCACATAATGTGGTTACTGCATTTATGTGATGCACACCAAGAAATGCAGTCTTGGGCAGAAGCTGCTCAGTGTGCTGTTGCTGTGGCTGGTATTGTAATGCAGGCCCTTGTGGCGAGAAATGATGGTGTCTGGAGCAAAGATCACATAACTGCTCTACGTAAAATTTGTCCAATGGTCAGCAATGAGATCAGCTCTGAGACTTCTGCAGCTGAGGTAGAAGGATATGGTGCATCAAAACTTACTGTTGACTCTGCAGTGAAGTACCTACAACTCGCAAATAAGCTATTTTCTCAAGCTGAACTCTTTCATTTCTGTGCAAGCATTCTGGAACTTGTTATCCCAGTTTACAAAAGCAGGAGGGCATATGGACAGCTGAGTAAATGTCACACGATGCTTACTAATATCTATGAATCAATACTTGAGCAGGAATCAAGTCCAATTCCGTTCACTGATGCAACATACTACAGGGTTGGGTTTTACAGTGACCGATTTGGAAAGTTAGATAGAAAGGAATATGTATACAGGGAGGCCCGTGATGTAAGGCTAGGTGACATAATGGAGAAACTTAGTCATATATACGAGTCTAGGATGGATGGCAATCACACGTTACACATTATTCCGGATTCCAGGCAGGTAAAGGCAGATGAATTGCAGCCTGGTGTCTGCTACCTGCAGATAACTGCTGTTGATCCAGTCATGGAAGATGAAGATTTGGGAAGCAGAAGGGAGAGAATCTTTTCGCTTTCCACTGGTAGTGTTCGTGCACGAGTCTTTGATCGTTTCTTGTTTGATACCCCATTTACGAAAAATGGAAAGACTCAAGGTGGATTGGAAGACCAGTGGAAGAGGCGAACTGTTCTTCAGACTGAAGGTTCATTCCCAGCTCTTGTGAATAGGCTTTTAGTTACCAAATCGGAATCACTTGAGTTCTCCCCAGTAGAAAATGCCATTGGGATGATTGAAACTCGAACAGCTGCCTTACGAAATGAACTTGAAGAGCCTCGCAGTTCCGAAGGGGATCAACTCCCACGTCTCCAGAGCCTACAGAGAATTCTTCAAGGCAGTGTTGCAGTTCAGGTTAACAGTGGGGTACTGAGTGTGTGCACTGCATTCCTGTCTGGTGAGCCTGCAACAAGGTTGCGGTCGCAGGAACTGCAGCAACTCATTGCTGCGCTCCTTGAATTTATGGCGGTATGCAAGCGTGCCATCCGTGTACACTTCAGATTGATTGGTGAGGAAGATCAGGAGTTCCACACACAGCTTGTGAATGGATTTCAATCTCTAACTGCTGAGTTGTCTCATTACATCCCTGCCATTCTGTCAGAGCTGTGA >Manes.17G018400 ATGGATAATAATAGTGGTAACAATGGGGGGCAGCGCTTCCATAGAATATCTCGCCAATCTCTTGCTCGTCTTAAGTTGGACCCGTTGCTTGATGAAAATCTTGATCAGTGGCCTCATCTTAATGAACTTGTTCAATGCTATAGAACTGACTGGGTAAAGGATGAAAATAAGTATGGTCACTATGAAAGCATAGCTCCAGTATCTTTTCAAAACCAGATTTTTGAAGGGCCTGATACTGATATTGAGACAGAAATGCAGCTTGCAAATTTAAGACGAAGTAAGGCTGAAGATGCTAGTGATGCTGACATCCCGAGTACCTCTGGAAGGCAATTTACAGAGGCCACCTCTGACTTGTTGCAGTCGCATGTTTCGGAGCATTTTGGTCATTCCCCTCTCCCTGCTTATGAACCAGCTTTTGACTGGGAAAATGAGAGGTCGGTGATATTTGGCCAAAGGATTCAAGAAACTCCAATGGCCCCATATGGCAGAGGATTGAAGATCTCTGTGAAAGTCCTGTCCCTTTCATTTCAAGCAGGACTAGTTGAGCCGTTTTATGGTACCATTTGCATATATAATAAGGAGAGAAGAGAAAAGTTATCGGAGGATTTTTATTTTTCTGTGCTGCCAACAGATGCACAAGATGCAAAAATTCCATATGAACCTCGTGGAATTTTCTATTTAGATGCTCCATCTGCATCAATTTGTCTGTTGATCCAGCTAGAGAAACCTGCTACAGAAGAAGGCGGGGTTACCCCATCTGTTTATTCACGTAAAGAACCTGTCCACTTGAGTGAGAGAGAGAAGCAGAAATTACAGGTGTGGTCACGAATTATGCCTTATAAACAGTCATTCGCCTGGGCAATTGTTCCATTATTTGATAACAGTGTTGGTGCAACTTCTGGAGGGCCTGCATCCCCAAGCAGCCCACTTGCTCCAAGTGTGTCCGGATCAAGTTCACATGACGGTGTGTTTGAGCCTGTAGCAAATTTCACACTGGACGGGAAATTGGGTTATTCAAGTGGAAGCTCGGTGGTGGTTGAAATTTCAAACCTAAATAAAGTTAAAGAAAGCTATACTGAGGACTCTCTTCAGGATCCTAAACGCAAGGTTCACAAACCAATCAGAGGTGTTCTCAGACTAGAAATTGAGAAGCACCAGACAGGCCATTCTGACTTGGAAAACCTATCAGAAAGTGGTAGCATGACCAATGAGTCTGTTGATCCAGGAGACAGGATTACTGATTCCACTCTTAGAAGATGCCCTAGCAATGGCTCTGACTGTCCTCAATCTAGCAGCTCCAAGTGGAATACCTATGATGGGAAAGAAAGTTCTGGAAATAGTCCTAGTATTCATGGAAACCCTGAGATGAGTGCTGATGATTTCCAAGCATTTGACTTCCGCACAACAATGAGAAATGAGCCTTTCTTGCAGCTTTTTCATTGCTTGTATGTTTATCCTTTAACTGTTACTTTGAGTCGGAAGAGGAATTTGTTCATTCGTGTGGAACTAAGGAAGGATGATGCAGATGTTCGTCGACAACCTTTGGAGGCAATGTATCCTAGGGAACCAGGAGCATCACACCAAAAGTGGGCTCACACGCAGGTTGCTGCTGGGGCTAGAGTGGCTTGCTTCCATGATGAGATTAAACTTTCCCTTTCTGCCATCTGGACACCGTTACATCATCTCTTGTTCACTTTCTTCCATATTGATCTTCAAACAAAGTTGGAAGCTCCAAAGCCAGTGGTAATTGGATATGCAGCGCTTCCATTATCTACACATGCTCAGTTGAGATCAGAAATTTCTTTACCAATCATGAGAGAGCTAGTTCCACATTATCTCCAGGATATTGGCAAGGAGAGGCTGGAGTATTTGGAAGATGGGAAGAATGTTTTCAGATTGCGCATGAGGCTTTGTTCATCATTGTATCCGATAAATGAGCGCATTAGAGATTTTTTCCTTGAATATGATAGGCACACTCTTCGAACAAGTCCACCGTGGGGTTCAGAACTTCTGGAGGCCATTAACAGTTTGAAGAATGTTGATTCCACTGCCTTGCTTCAGTTTCTTCACCCAATTTTAAACATGCTTCTCCATCTTATAGGCAGTGGTGGAGAAACTCTTCAGGTTGCGGCCTTCAGAGCTATGGTCAATATCTTAACTAGGGTGCAACAAGAATCAGTTGATGATGCTGAACGAAACCGTTTTCTTGTTAACTATGTTGATTATGCTTTTGATGACTTTGGTGGCCGTCAACCTCCAGTTTATCCTGGTTTGTCCACTGTGTGGGGAAGCTTGGCTCGCAGTAAGGCCAAAGGCTACCGTGTTGGGCCGGTATATGATGATGTTTTGGCAATGGCTTGGTTTTTTCTCGAGTTAATCGTGAAGTCAATGGCATTGGAGCAAACTCGTCTTTTCTATCATAGTCTTCCACTAGGTGAAGATGTGCCGCCAATGCAATTAAAAGAAGGTGTTTTCAGATGCATAATGCAATTGTATGATTGCCTTCTAACCGAAGTGCATGAGCGTTGTAAAAAGGGTTCAAGCTTGGCAAAACGCTTGAATAGTAGTTTGGCCTTCTTTTGTTATGATCTTTTGTCCATCATTGAACCTCGGCAAGTTTTTGAATTGGTGTCCTTGTACTTGGACAAATTTTCTGGGGTATGTCAATCAGTTCTCCATGAATGCAAGCTAACCTTTCTGCAAATTGTATGTGATCATGATCTTTTTGTGGAAATGCCTGGGAGAGACCCTTCAGATAGAAACTACCTTTCATCTGTTCTAGTACAAGAGCTTTTCCTCACTTGGGATCACGATGATCTATCTCAGAGAGCAAAGGCAGCAAGAATGTTAGTAGTTATCTTATGCAAGCATGAATTTGATGCTCGTTACCAAAAGCCTGAAGATAAATTGTATATTGCACAACTATATTTGCCTCTTATTGGCCAGATTCTAGATGAGATGCCTGTATTCTATAACCTGAATGCTGTTGAAAAACGTGAAGTTTTAATTGCTATTCTGCAAATTGTGCGCAATCTGGATGACACATCACTTGTCAAGGCATGGCAGCAAAGTATTGCACGAACTAGATTGTTCTTCAAACTCATGGAGGAATGCCTTGTTCTTTTCGAGCACAGAAAACCTGCTGATGGCATGCTCATGGGCTCTAGTTCTCGCAGCCCAGTCACAGATGGACCTTCTTCCCCCAAGTACTCTGATAGGCTTTCTCCTGCAATCAATAACTATCTGTCTGAGGCATCACGACAAGAAGTTAGGGCTCAGGGAACACCTGATAATGGATATTTGTGGCAGAGAGTGAATTCCCAGTTAAGCTCCCCTAGCCAGCCATATTCGTTGAGAGAAGCTCTTGCTCAGGCACAATCTTCAAGAATTGGAGCTTCAGCCCAAGCACTTAGAGAATCTTTGCATCCAATATTGAGACAAAAGCTGGAGCTTTGGGAAGAAAATCTGAGTGCAGCTGTGAGTCTTCAGGTGCTGGAGATAACTGAAAAGTTTTCCATGATGGCAGCATCCCATAGCATTGCTACTGATTTTGGAAAACTTGACTGCATTACAGCCATATTTATGAGCTTCTTTTCTCGAAATCAGCCACTGGCTTTTTGGAAAGCTCTTTTTCCTGTATTCTACAGTGTCTTTGATCTTCATGGGGCAACACTAATGGCAAGGGAGAATGATCGCTTTCTTAAGCAGGTTGCTTTTCATCTGCTACGGCTTGCTGTTTTCAGAAATGAAAACGTTAGGAGAAGAGCTGTTATTGGGCTCCAGATACTAGTGAGGAGCTCGTTCTATTATTTTATGCAAACAGCAAGATTGCGGGTTATGCTGACTATTACATTGTCAGAGCTGATGTCTGATGTGCAAGTGACTCAGATGAAATCTGACGGAACACTAGAAGAGAGTGGTGAAGCACGACGCCTTCGCAAGTCTTTGGAGGAAATGGCAGATGAATATAAGAGCACCAACCTATTAAGGGAATGTGGGCTACCTGAAAATGCATTGGTGGCAATTTTGGAAAGCTCAGCAGAAAATCGATGGTCCTGGTCAGAGGTGAAATATCTCTCTGATAATCTAATCCTGGCTCTTGATGCTAGCCTGGAACATGCACTTTTGGCTTCTGTGATGACTATCGATAGATATGCAGCTGCAGAGAGCTACCATAAACTTGCTATGGCATTTGCACCTGTTCCTGACCTTCACATAATGTGGTTGTTGCATTTGTGTGATGCTCATCAGGAAATGCAGTCCTGGGCAGAAGCTGCACAGTGTGCCGTGGCTGTTGCCGGTGTTGTAATGCAGGCCCTTGTGGCTAGAAATGATGGTGTTTGGAGCAAAGATCATGTAACTGCCCTACGTAAAATTTGTCCTATGGTCAGCAGTGAAATCTCTTCTGAGGCATCTGCAGCAGAAGTGGAGGGATATGGTGCATCTAAGCTCACTGTTGACTCTGCTGTAAAATATCTACAGCTTGCAAATAAGCTTTTCTCTCAAGCTGAGCTCTTTCATTTCTGTGCAAGCATTCTGGAGCTAGTAATACCAGTTTATAAAAGCAGGAGGGCATATGGGCAGTTGGCTAAATGTCATACAATGCTTACTAATATCTATGAATCAATCCTTGAGCAGGAATCCAGCCCAATTCCATTCACTGATGCGACATACTACAGGGTGGGATTTTATGGTGATAGATTTGGGAATCTGGACAGGAAAGAATATGTATATCGAGAACCCCGAGATGTACGGCTAGGTGACATAATGGAGAAATTAAGTCATATATATGAATCTAGGATGGATGGAAATCACACTTTGCATATTATTCCTGATTCAAGACAAGTTAAGGCAGATGAATTGCAGCCCGGAGTATGCTACTTGCAGATAACTGCTGTTGATCCAGTGATGGAAGACGAAGATTTGGGAAGTCGACGGGAAAGAATTTTTTCTCTTTCCACTGGAAGCGTCCGTGCGCGAGTCTTTGACCGGTTCTTGTTTGACACCCCATTTACAAAAAATGGTAAGACCCAAGGTGGTCTGGAAGACCAGTGGAAGAGGCGGACTGTCCTTCAGACTGAAGGTTCTTTCCCTGCTCTAGTGAATAGGCTTTTGGTAATCAAATCTGAATCTATTGAGTTCTCCCCGGTGGAGAATGCAATTGGGATGATTGAAACTCGGACAGCTGCCTTACGAAATGAGCTTGAGGAGCCTCGTAGTTCTGAAGGGGATCAACTCCCACGCCTCCAGAGTTTGCAGAGAATTCTTCAGGGCAGTGTTGCAGTTCAGGTAAATAGTGGAGTTTTGAGTGTCTGCACAGCCTTCTTATCTGGTGAGCCTGCAACAAGGTTACGTTCACAAGAGCTGCAACAACTCATAGCTGCACTTCTAGAATTCATGGCTGTTTGTAAGCGTGCCATTCGTGTGCATTTTAGATTGATTGGTGAGGAAGACCAAGATTTCCACACTCAACTTGTGAATGGATTTCAGTCTCTTACAGCGGAATTATCTCATTACATCCCTGCAATTCTTTCAGAGCTCTGA >Solyc08g016050.2 ATGTTGTACATCTTCATATATCATGCTATTTTTCTGGAAGACAGACTAGATATATCCAAATTATCTGCATGTGGGAACTATCTTTCATCTATCTTAATTCAAGAGATTTTCCTTACATGGGATCATGATGACTTGTCAATGAGGGCAAAAGCTGCAAGAATCTTGGTGGTCCTCATGTGTAAGCACGAGTTTGATATTCGCTACCAAAAGCTAGAGGATAAATTATATATTGCTCAATTATATTTTCCCCTTGTTGGCCAGATCCTGGATGAGATGCCTGTCTTTTACAATCTGAGTACAATTGAAAAGCGTGAAGTCTTGATTATATTTCTGCAAATAGTGCGCAACTTGGACGATGAAACACTTGTTAAAGCTTGGGAGCAGAGCATTGCCCGTACCAGATTATTCTTTAAACTTTTAGAAGAGTGCTTGATGCATTTTGAGCATAGGAAACCTGCTGATGGCATGCTTGTTGGTAGTAGTTCTCGTAGTGTGATTGGGGAAGGACCTGCATCCCCAAAATATTCTGACAGACTTTCACCTGCAATTAACCAGTATATGTCTGAGGCAGCAAGGCAAGAAGTCAGAGGAACTCCGGATAATGGTTATTTGTGGCAGCGGGTTAACTCCCAATTAAGCTCGCCTAGTCAGCCATATTCTTTGAGAGAAGCCCTAGCTCAAGCCCAGTCCTCCAGAATTGGAGCTTCAGCACTAGCATTAAGGGAATCCTTGCATCCAATCTTAAGGCAAAAGCTGGAACTTTGGGAAGAGAACCTGAGTGCTGCCGTTAGTCTTCAAGTTTTAGAAGTTTCTGAGAAGTTCTCACGGACTGCCGCAACGAAGCGTATTGCTACTGATTATGGAAAACTTGACTGTATCACATCCATATTTATGAATGTGTTCTCACGAAATCAACCACTCTCTTTCTGGAAAGCACTATTTCCTGTCTTCAACAGTGTTTTCGAACTTCATGGAGCTACATTGATGGCAAGAGAAAATGATCGTTTCTTAAAGCAAATTGCTTTCCACCTTCTTCGGCTTGCAGTGTTTCGAAATGACAATGTCAGAAGAAGGGCTGTAATTGGCTTGCAGATACTTATTCGGAGCTCGTTCTCTTATTTTATGCAGACGGGAAGATTAAGAGTCATGCTAACCATTACTTTGTCAGAGTTAATGTCTGAAGTTCAAGTAACACAAATGAAACCTGATGGAACGCTAGAAGAAAGTGGTGAAGCTCGTCGTCTTCGAAATTCTTTGGAGGAAATGGCAGATGAGGCTAAGAGTTCCTCCTTATTACTTGAGTCTGGGCTCCCACAAAATGCACTGGCTGCTGTTCCAGAAGGATCAGAAGAAAACCTCTGGTCCTGGTCTGAGGTGAAATTTCTTTCTGAGAGTCTTCTGATGGCTCTTGATGCCAGCCTGGAACATGCACTTCTGGGTTCTGTTATGAATGTCGACAGATATGCAGCTGCAGAGAGCTTTTATAAACTAGCGATGGCATTTGCTCCTGTACCAGATCTTCACATAATGTGGTTACTGCATCTTTGTGAAGCTCATCAGGAAATGCAGTCTTGGGCTGAAGCTGCTCAATGCGCTGTTGCTGTTGCTGGTGTAGTGATGCAGGCCCTTGTGTGTAGGAATGATGGTGTCTGGAGCAAGGATCACGTGAGTGCATTACGCAAAATATGCCCCATGGTCAGCAGTGACATCACTTCTGAGGCTTCAGCAGCTGAGGTGGAGGGATATGGTGCTTCAAAACTCACAGTTGACTCGGCTGTGAAGTATTTACAGCTTGCAAATAAGCTTTTCCATCAGGCTGAGTTGTTCCATTTCTGTGCAAGCATTCTAGAACTTGTAATCCCAGTAAATAAAAGCAGGAAGGCATATGGACAGCTTGCAAAATGCCACACAACACTTACTAATATCTACGAGTCTATCCTTGAGCAGGAGTCTAGCCCTATTCCTTTCACGGACTCGATAATGGATGGAACTACATTACACGTAATTCCTGATTCAAGGCAAGTCAAAGCAGATGAGTTGCAGCCTGGAGTCTGCTACCTGCAAATAACTGCAGTTGATCCTGTAATGGAGGATGAAGATTTAGGAAGTAGAAGGGAAAGGATATTCTCTCTCTCTACAGGAAGTGTCCGTGCTCGAGTCTTTGACCGGTTTTTGTTTGATACCCCTTTCACTAAAAATGGAAAGACACAAGGAGGCTTGGAAGACCAATGGAAACGGCGAACAGTTCTGCAAACTGAGGGATCTTTTCCTGCGCTAGTGAATAGACTCTTGGTTATCAAATGTGAATCCCTTGAGTTCTCCCCAGTCGAGAACGCAATTGGAATGATTGAAACTAGGACAGCTGCATTAAGGAATGAACTTGAAGAGCCTAGAAGCTCAGAAGGCGATCAACTTCCCCGTTTGCAGAGCTTACAGAGGATTCTTCAAGGTTCAGTAGCAGTTCAAGTTAACAGTGGAGTCCTCAGCGTCTGTACAGCTTTCCTTTCTGGTGAGCCTGCAACTAGGTTGCGTTCGCAAGAGCTACAACAACTCATTGCTGCCCTTCTTGAATTTATGGCTGTGTGCAAACGTGCTATTCGAGTACACTTTAGGTTGATCGGGGAAGAAGATCAGGATTTTCATACTCAGCTTGTAAACGGGTTCCAGTCTCTCACTGCAGAACTATCACATTATATTCCTGCAATTCTTTCGGAGCTTTAG >Solyc08g016070.1 ATGAGAACAAGTATGGTCACTATGAAAGCGTCAGCCCGACTTCATTTCAGAGTCAAATATATGAGGGTCCTGATACTGATATTGAAACAGATGCATCTTGCAAATGCTAGACGGCCTAAAATTGAGGATTCAGTTGATGGTGAAATTCCCAGCACTTCTGGGGCACAACTCTCTGAAGATAATTTCTCTGACCTCTCAAATGCCAAAGTCTCCAAGCATTTTGGTGAATCCCCTCTACCGACTTATGAACCAGTTTTTGACTGGGAAAATGAAAGATCATTAATATTTGGGCAAAGGATTCCTGAAGCTCATATGTCCCAGTATACGAGCGGTCTGAAGATTGCTGTGAAAGTCCTATCATTGTCATTTCAAGCTGGACTAGTTGAGCCGTTTCATGGCACAATTTGTTTATATAATAGGGAGCGAAGAGAAAAACTTTCTGAGGATTTTATTTTCCATGTATTGCCTACCGAAATGCAAGAAGCAAGCAGTTCCTATGAAAGGCGTTGCATTTTTCATCTAGATGCTCCATCAGCATCTATTTGTCTGCTAATACAACTAGAAAAACCTGCCACTGAAGAAGGTGGAGTGTCTCCTTCTGTTTATTCACGAAAGGAACCAGTTCATCTGACAGAGAGAGAGAAACAGAAACTACAAGTATGGTCGCGGATCATGCCATACAGGGAGTCCTTTTCCTGGGCCATCATTCCACTCTTTGATAGTAACATAGCTTCTGTGGGTGGCTCTGCTTCTCCCAGCAGTCCTCTTGCTCCCAGCGTCTCTGCGTCAAGTTCACAAGAGGGCATCACTGAGCCACTTTCAAAAATTACTGCAGATGGAAAGCTTGGTTATTCAAATGGGAACTCCATTGTCGTTGAAGTGTCTAACTTAAACAAAGTCAAAGAAGGATACACTGAGGAATCTCTCCAGGATCCAAAGAGAAAGGTTCATAAACCAGTAAAAGGTGTCTTGAAATTGGAAATTGAAAAACTGCCAGCTAGTTCTACTGAAACTGAAAATGCTTTGGACAGTGGTAGTTTGATCTATGATTCTCTTGATCATGGCGACCATTTGAATGATTCAACTTCTATGAAATTCCCTACTAATGGTACCTTTTCCAAGTCTAAATCCTCTGAAATGAAAGAGCTTGTTCGGAATGGTTCAGTTGCTCATGAAAATGTGGAAAATACTGCTGATGATTTTGAAGCTTTTGACTTCCGCACAACGACAAGGAATGAACCGTTCTTGCAGCTCTTTCATTGCTTATATGTCTACCCTTTGACTGTTAGTATGAGTCGGAAACGAAACATGTTTATTCGAGTTGAACTGAGAAGGGACGACACAGATATTCGAAAACCACCTCTAGAGGCTATGCATCCAAGGGAACCAGGTGTACCACTTCAGAAATGGTCTCACACACAAGTTGCTGTGGGGGCAAGGGTTGCCAGCTACCATGATGAAATCAAAGTTTCTTTGCCTGTTATTTGGACACCATCACATCACCTTTTGTTTACATTCTATCATGTTGATCTTCAGACAAAACTTGAAGCACCAAAGCCGGTGGTAATTGGATACGCTTCACTTCCATTATCGACACATGCACAGTTCAGATCTGAGATATCCTTGCCAATCATGAAAGAATTGGTTCCTCATTATCTTCAAGAAAGTGGCAAGGAGAGGCTGGATTACTTGGAAGATGGAAAGAATATCTTCAAGCTTCGTTTACGACTATGTTCATCATTATACCCAGTTAGTGAGCGCATTAGGGATTTTTTCCTAGAGTATGACAGGCATACTCTACGGACAAGTCCCCCTTGGGGATCTGAACTTCTTGAGGTAATATAA >CAN.G68.16 ATGGAGATTTCATCTAGTGGAAATCGATTTCGGAGAATACCACACCACTCTATTGCTGGTTCCTTGAATTTAGATCCACTGCTTGATGAAAATTTGGAGCAGTGGCCACATTTAAATGAACTTGTGCAGTGTTACAGAACCGACTGGGTAAAAGATGAGAACAAGTATGGTCACTATGAAAGCGTGAGCCCGACTTCATTTCAGAGTCAAATATATGAGGGTCCTGATACAGATATTGAAACAGAGATGCATCTTGCAAATGCTAGGCGGCCTAAGATTGAGGATTCAATTGATGGTGAAATGCCTAGCACTTCCGGGACACAACTCTCTGAAGATAATTTCTCTGACCTCTCAAATGCCGAAGTCTCTAAGCATTTTGGTGAATCCCCTCTACCGACTTATGAACCAGTTTTTGACTGGGAAAGTGAAAGGACATTAATATTTGGGCAAAGGATTCCTGAAGCTCATATGTCCCAGTATACGAGCGGTCTGAAGATTGCCGTAAAAGTCCTATCATTGTCATTTCAAGCTGGACTAGTTGAGCCGTTTTATGGCACAATTTGTTTATATAATAGGGAGCGAAGAGAAAAACTTTCAGAGGATTTTATTTTCCATGTATTGCCTATCGAAATGCAAGAAGCAAGCAGCTCCTATGAAAGGCGTTGTATTTTCCATCTAGATGCTCCATCAGCATCTATTTGTCTGCTAATCCAACTAGAAAAACCTGCCACTGAAGAAGGTGGAGTGTCTCCTTCTGTTTACTCACGAAAGGAGCCAGTTCATCTGACAGAGAGGGAGAAACAGAAACTACAACTATGGTCACGGATCATGCCTTATAGGGATTCCTTTTCCTGGGCCATCATTCCACTCTTTGATAGTAACATAGCTTCTGTGGGTGGCTCTGCTTCTCCCAGCAGCCCTCTTGCTCCAAGCATCTCTGCTTCAAGTTCTCAAGAGGGTATCACTGAGCCACTTTCAAAAATTACAACAGATGGAAAGCTTGGATATTCAAACGGAAGCTCCATCGTCGTTGAAGTGTCGAACTTAAACAAAGTCAAAGAAGGATACACTGAGGAATCTCTCCAGGATCCAAAGAGAAAGGTTCATAAACCAGTAAAAGGTGTCTTGAAATTGGAAATCGAAAAGCTGCCAGCTAGCTCTGCTGAAGCTGAAAATGCTTTGGAGAGTGGGAATCTGATCTATGATTCTCTTGATCATGGTGATCATTTGAATGATTCGACTTTTATGAAATGCCCTACTAATGGTTCCTTTTCCAAGTCTAAATCCTCTGCGATGAAAGAGCTTATTAGGGATGGTTCAGCTACTCATGAAAATATGGAAAATACTGTTGATGATTTTGAAGCTTTTGATTTCCGCACGACGACAAGGAACGAACCGTTCTTGCAGCTCTTTCACTGCTTATATGTCTACCCATTGACTGTTAGTATGAGTCGGAAACGAAACATGTTTATACGAGTTGAGCTGAGAAAGGATGACACAGAGATTCGAAAACCACCTCTAGAGGCTATGCATCCAAAGGAACCAGGTGTACCACTTCAGAAATGGTCTCACACACAAGTTGCTGTTGGGGCTAGGGTAGCCAGCTACCATGATGAGATCAAAGTTTCTTTGCCTGCTATTTGGACACCATCACATCACCTTTTGTTTACTTTCTATCATGTTGATCTTCAGACAAAACTTGAAGCACCAAAGCCGGTGGTAATTGGATACGCTTCACTTCCATTATCAACACATGCGCAGTTCAGATCTGAGATATCCTTGCCAATCATGAAAGAATTGGTTCCGCATTATCTTCAAGAAAGTGGCAAGGAGAGGCTGGATTACTTGGAGGATGGAAAGAATATCTTCAAGCTTCGGTTACGACTATGTTCATCATTATACCCAGTGAGTGAGCGCATTAGGGACTTTTTCCTCGAGTATGATAGGCATACTCTACGGACAAGCCCCCCTTGGGGATCTGAGCTTCTTGAGGCTATCAATAGTTTGAAGAATGTTGATTCCACTGCTTTGCTTCAATTTCTTTATCCAATCTTAAACATGCTTCTCCATCTTATTGGTAATGGGGGAGAGACTCTTCAGGTTGCTGCCTTTAGAGCTACGGTTAATATTTTAACAAGGGTGCATCAAGAGTCGGTTGATGAAGCTGAGAGAAATGCTTTCCTAGTTAACTTTGTTGATTATGCTTTTGATGATTTTGGGGGCCACCAGACGCCAGTCTATCCTGGTTTGTCCACAGTGTGGGGAAGTTTGGCTCGCAGTAAGGCAAAAGGGTACCGCGTTGGGCCTGTCTATGATGATGTCCTGGCAATGGCTTGGTTTTTTCTTGAGCTAATTGTCAAGTCAATGGCGCTGGAGCAGGCTCGATCCTTTTATCACAATCTTCCATCGGGTGAGGATGTCCCGCCAATGCAATTGAAAGAAGGCGTTTTTAGATGTGTTGTTCAATTGTACGATTGCCTTTTAACAGAAGTTCATGAGCGCTGCAAGAAAGGTCTAAGCTTGGCCAAGCATTTAAATAGTAGTTTGGCTTTTTTTTGTTATGATCTTTTATCCATCATCGAGCCTCATCAAGTTTTTGAACTGGTGTCCTTGTACCTCGATAAATTCTCTGGAGTGTGTCAAACAGTGCTGCATGACTGCAAGCTTACCTTTCTACAAATCATATGCGATCATGATCTTTTTGTTGAAATGCCTGGACGAGATCCTTCTGATCGGAATTATCTTTCATCTATCTTAATCCAAGAGATTTTCCTTACATGGGATCACGATGACTTGTCAATGAGGGCAAAAGCTGCAAGAATCTTGGTGGTCCTCATGTGTAAGCACGAGTTTGATATTCGCTACCAAAAGCAAGAGGATAAATTATATATTGCTCAATTATATTTTCCCCTTGTTGGTCAGATCCTGGATGAGATGCCTGTCTTTTACAATCTGAGTACAATTGAAAAACGTGAAGTCTTGATTATCTTTCTGCAAATAGTGCGCAACTTGGATGATGAAACACTTATTAAAGCTTGGGAGCAGAGCATTGCCCGAACCAGATTATTCTTTAAACTCTTAGAAGAGTGCTTGATGCATTTTGAGCATAGGAAACCTGCTGATGGCATGCTTGTTGGTAGTAGTTCTCGTAGTGTGATAGGGGATGGACCTTCATCCCCAAAATATTCTGACAGACTTTCACCTGCAATTAACCACTATATGTCTGAGGCAGCAAGGCAAGAAGTCAGAGGAACTCCAGATAATGGTTATTTGTGGCAGAGGGTCAACTCCCAGTTAAGCTCACCTAGTCAGCCATATTCTTTGAGAGAAGCCCTAGCTCAAGCCCAGTCCTCCAGAATTGGAGCTTCAGCACTAGCATTAAGGGAATCGTTGCACCCAATCTTAAGGCAAAAGCTGGAACTTTGGGAAGAGAACCTGAGTGCTGCTGTTAGTCTTCAAGTTTTAGAAGTTTCTGAGAAGTTCTCACGGACTGCCGCAATGAAGCGAATTGCTACTGATTATGGGAAACTTGAATGTATCGCATCCATATTTATGAATGTATTCTCACGAAATCAACCGCTCTCTTTCTGGAAAGCACTCTTTCCTGTCTTCAACAGTGTCTTTGAACTTCACGGAGCTACATTGATGGCAAGAGAAAATGATCGTTTCTTAAAGCAAATTGCTTTCCACCTTCTCCGGCTTGCAGTGTTTCGAAATGACAATATCAGGAAAAGGGCTGTAATTGGGCTGCAGATACTTATTCGGAGCTCGTTCTCTTATTTTATGCAGACGGGAAGATTAAGAGTCATGCTAACCATTACATTGTCAGAGTTAATGTCTGAAGTTCAAGTAACACAAATGAAACCTGATGGAACACTAGAAGAAAGTGGTGAAGCTCGTCGTCTTCGAAATTCTTTGGAGGAAATGGCAAATGAGGCTAAGAGTTCCTCCTTATTAGTAGAGTCTGGGCTCCCAGGAAATGCACTGGTTACTGTTCCAGAAGGATCAGCAGAAAACCGCTGGTCCTGGTCTGAGGTGAAATTTCTCTCTGAGAGTCTTCTTATGGCTCTTGATGCCAGCCTGGAACATGCACTTCTGGGCTCTGTTATGAATGTCGACAGATATGCAGCTGCAGAGAGCTTTTATAAACTAGCGATGGCATTTGCTCCTGTGCCAGATCTTCACATAATGTGGTTACTGCATCTTTGTGAAGCTCATCAGGAAATGCAGTCTTGGGCTGAGGCTGCTCAATGCGCTGTTGCTGTTGCTGGTGTAGTGATGCAGGCACTTGTGTGTAGGAATGATGGTGTCTGGAGCAAGGATCATGTGAGTGCATTACGCAAAATATGCCCCATGGTCAGCAGTGACATCACTTCTGAGGCTTCAGCAGCTGAGGTGGAGGGATATGGTGCATCAAAACTCACAGTTGACTCGGCTGTGAAGTACTTACAGCTTGCAAATAAGCTTTTTCATCAGGCTGAGCTGTTCCATTTCTGTGCAAGCATTCTAGAACTTGTAATCCCGGTAAATAAAAGCAGGAAGGCATATGGACAGCTTGCAAAATGCCACACTACACTTACTAATATCTACGAGTCCATCCTTGAGCAGGAGTCAAGTCCTATACCTTTCACAGACGCCACATATTATAGGGTTGGATTTTATGGTGAGAAGTTTGGGAAGCTGGACAGGAATGAATATGTTTATAGAGAGCCTCGTGATGTGCGATTAGGTGACATAATGGAGAAATTGAGCCATATCTACGAGGCGAGAATGGAAGGAACTACATTACACATAATTCCTGATTCGAGGCAAGTCAAAGCAGATGAGTTGCAGCTTGGAGTCTGCTACCTGCAAATAACTGCAGTTGATCCCGTAATGGAGGATGAAGATTTAGGAAGCAGAAGGGAAAGAATATTCTCTCTCTCTACGGGAAGTGTCCGTGCTCGGGTCTTTGATCGGTTTTTGTTTGATACCCCTTTCACTAAAAATGGAAAGACCCAAGGAGGATTGGAAGACCAATGGAAGCGGCGAACAGTTCTGCAGACCGAGGGATCTTTTCCTGCCCTAGTGAATCGACTCTTGGTTATCAAATCAGAATCCCTTGAGTTCTCCCCAGTTGAGAACGCAATTGGAATGATTGAAACTAGGACAGCTGCATTAAGGAATGAACTTGAAGAGCCTCGAAGCTCAGAAGGTGATCAACTTCCCCGTTTGCAGAGTTTACAGAGGATTCTTCAAGGCTCAGTTGCAGTTCAAGTTAACAGTGGAGTCCTCAGCGTCTGCACAGCTTTCCTTTCTGGTGAGCCTGCAACTAGGTTGCGTTCACAGGAGCTACAACAACTTATTGCTGCTCTTCTTGAATTTATGGCTGTATGCAAACGTGCTATTCGAGTACACTTTAGGTTGATCGGGGAAGAAGATCAGGATTTTCATACTCAGCTTGTAAATGGGTTCCAGTCTCTCACTGCAGAACTATCACATTATATTCCTGCAATTCTTTCAGAGCTTTAG >FVE18510 ATGCTCAGCCTCCGGCCCCGCCGCGACTCCACTCCGGCCACCACGAAATGGCACAACAAGGTAATGCCCCTGATGCCCTCTGTTTCTTGGCTCCAAGAATCAAACTTTACTGTAATGTGGTTCTGCTTTGGAGTTTTGGGGACATGGTTTGAGGAGAATTTGGAGCAGTGGCCACATCTGAAGGAGCTGGTGCAGTGCTACACTACAGACTGGGTTAAGGATGACAATAAGTATGGCCATTACGAGAGCGTTGGCCCGCCGGCGTTTCAGAACCAGATTTATGAGGGGCCTGACACTGATATTGAGACTGAAATGCACCTTGCCGGTGCAAGGCGAACCAAGGCGGACGATACCACTGATGATGATTTACCAAGTACCTCAGGGCGCCAATTCACGGATGTAGCCTCTGATTCAGCACACTCCAATGATCCAAAGCATTTTGGTCAATCTCCTCTCCCTGCTTATGAACCAGCTTTTGATTGGGAAAATGAAAGATCATTGATATGCGGTCAAAGGATTCCAGAAACTCCATTATCTCACGGCTTAAAGATCTCAGTGAAAGTTCTGTCACTATCATTTCAAGCGGGACTAGTTGACGCTCCATCATCATCAGTTTGTCTTCTCATCCAATTAGAGAAGCATGCCACAGAAGAAGGCGGGATTACACCTGCAGTTTATTCTCATAAAGAACCGGAGGCGCCACTTTGCTGTCTGGATCATGAAGTGGATTTAGGAGAATTCTGGGTACAATTGACTGAGAAAGAAAAGCAAAAACTGCAGGTCTGGTCTCAAATAATGCCTTACAGAGAGTCCTTTGCCTGGGCTATGGTTTCATTATTTGATAACAGCATCGGTGCAGTTTCTGGTGGGTCTGCTTCCCCAAGCAGTCCTCTTGCTCCTAGTATATCAGGTAGCTCTCATGATGGTGTGTTTGAGCCCAGTGCTAAAGTCACATTAGATGGGAAGCTAGGTTATTCAAGTCGAAGCTCCGTTGTTGTCGAAATATCAAACTTAAATAAAGTTAAAGAAAGCTATACTGAGGACTCATTTCAGGATCCCAAACGCAAGATTCATAAACCTGTGAAAGGTGTTTTGAGGCTAGAAATCGAGAAGCATCAGAATGACCATGTTGACTTGGAAAATTTATCTGAAAGTGGTAGTGTGACCAATGATTCTATTGATGATCGCATTAACGATTCCACGTATGGGAAGCTCCCAAGTAATGGTTTGGATGGTCCTCAGGGTAGCAGTTCTAAATGGAATTCTTTTGATACCAAAGAGATTTCTGGAAATGGATCAAATTATCATGGAAATCCAGTTACTGGTCCTGATGATTTTCAAGCTTTCGACTTCCGTACTACAACAAGAAACGGGCCTTTCTTGCAGCTTTTTCATTGTCTCTATGTATATCCCATGACTGTTAGTTTAAGTCGGAAGAGGAATTTGTTCATAAGGGTTGAACTTCGGGAGGATGATACTGACATTCGTGGACAGCCTTTAGAGGCAATGTATCCAAGGGAGCCAGGTGCATCACTACAGAAGTGGGCTCATACACAAGTTACTGTGGGGGCGAGGGTAGCATGCTACCATGATGAGATCAAACTTTCCCTCCCGGCTACGTGGACACCAACACATCATCTCTTGTTTACTTTCTTTCATGTTGATCTTCAAACAAAGTTGGAAGCACCAAAGCCTGTAGTAATTGGATATGCGTCACTTCCACTGTCCACACTTGCGCAGTTGCGATCTGAAATTTCATTGCCAATCATGAAAGAGTTGGTTCCACATTATCTTCAGGATATGGGCAGAGAGAGGTTGGATTATTTGGAAGATGGAAAGAATGTCTTCCGATTGCGCTTAAGACTTTGTTCGTCGTTATACCCGATCAATGAGCGAATAAGAGACTTTTTCCTTGAATATGATAGGCACACTCTTCGAACAAGCGCACCTTGGGGTTCTGAACTTCTTGAGGCTATTAACAGTTTGAAGAATGTCGATTCCATTGCTTTGCTTCAATTTCTCCATCCAATTTTGAACATGCTTCTCCATCTAATAGGCAATGGTGGAGAAACCCTCCAGGTTGCAGCTTTCAGAGCCATGGTTAATATCGTTACCCGTGAGGACGTCCCTCCGTTCTCCACCATCTGGCGCCGACGACGGCGCGCCTCCACCCCAGCGGACTCCAGCAGCGTCCCCGACCATTTTCCCTGCCCAAAACTGGAAAAGAACGGACTCGCCGGTGAGGGAAAGTGGTCGGGGACGCTGCTGGAGTCTTCTGGGGTGGAGGCGCGCCGTCGTCAGCGTCGGAGGGTGGAGAATGAGGGACCTCTGCACTTTAAGCCTGATGCGGACGGTAATTTCACAAACATGCACATGCAGAAATATGACCTGCTTCATCCTGTGCTTGATATGGAGTCGGTTGATGATGCCGAAAGAAACCATTTCCTCGTCAACTATGTTGATTATGCTTTTGATGACTTTGGGGGTCGCCAACCACCAGTTTATCCTGGTTTGTCAACTGTTTGGGGAAGTTTGGCTCGTAGTAAGGCTAAAGGATACCGTGTTGGACCTGTGTATGATGATGTTTTGGCAATGGCTTGGTTTTTCCTTGAGCTGATTGTCAAGTCAATGGCTTTGGAAAAGATGCGACTCTTCTATCATAATCTTCCATTAGGTGAAGACATTCCTCCTATGCAATTGAAAGAGGGTGTATTCAGATGCATAATGCAGTTGTATGATTGCCTACTAACTGAGGTACATGAACGTTGTAAGAAGGGACTGGGCTTGGCAAAGCGTTTAAATAGCAGTTTGGCTTTCTTCTGTTATGATCTCTTGTCCATTATCGAACCTCGCCAAGTTTTTGAACTGGTATCCTTGTACCTTGACAAGTTTTCTGGGGTATGTCAATCGGTTTTGCATGATTGCAAACTCACATTTTTGCAAATCATTTGTGATCATGATCTTTTTGTGGAAATGCCTGGGAGAGACCCTTCTGATAGGAACTATCTCTCGTCTGTTTTGATCCAAGAGCTTTTTCTCACTTGGGATCATGATGATTTATCTTTGCGGGCAAAGGCAAGTTTTCAGATGCTGGTCTATACTGAGTATACTCAACTGTCCTTAGATTTCACCTTTGAATTAATCATGCGCTCTAGGAAGCATGAAAGTATATACAAGACACCAACTCAATATACTCAAATTTGCCTGGCTGCTAGAGTTTTAGTAGTCCTGTTGTGCAAGCATGAGTTTGATGCTCGATACCAAAAACCTGAAGATAAATTATATATTGCCCAGCTATATTTTCCACTTATCGGACAGATTCTAGATGAAATGCCAGTCTTTTACAATCTCAATGCTGTTGAAAAGCGTGAAGTCTTGGTTGCTATTCTACAAATTGTACGGAACCTTGATGATGCGTCACTTGTCAAGGCATGGCAGCAGAGCATCGCCAGAACTAGATTATTCTTCAAACTCATGGAGGAATGCCTTGTTTTATTTGAGCACAGAAAACCTGCTGATGGCATGCTTATGGGTTCTAGTTCTCGAAGTCCTGTTGGTGATGGCCCTGCTTCTCCCAAGTATTCTGATAGACTTTCTCCTGCAATCAACAACTATCTGTCCGAGGCATCCAGACAAGAAGTCAGACCTCAAGGTACACCTGAAAATGGTTACTCATGGCAGAGAGTAAATTCTCAATTAAGTTCTCCTAGCCAGCCATATTCCTTGAGAGAAGCTCTACTTCATGCACAATCTTCCAGGATTGGAGCTTCGGCTCAAGCACTAAGAGAATCTTTGCATCCAATATTGAGGCAAAAATTGGAACTATGGGAAGAAAACTTGAGTGCTTCTGTCAGTCTTCAGGTTTTGGAAATAACTGAGAAGTTTACCGTAATGGCAGCATCACATAGCATTGCTACTGACTACGGAAAATTTGATTGCGTCACAGCCATATTCATGAGCTTCTTCTCTCGGAATCAATCACTGACTTTCTGGAAATCATTGCTTCCTGTCTTCAACAGCGTCTTCAATCTTCATGGCGCAACTTTGATGTCAAGGGAAAATGACCGCTTCTTAAAGCAAGTCACTTTTCATCTTCTTCGACTTGCAGTGTTCCGAAATGACAATATCAGGAAAAGGGCTGTTAACGGGCTCCAGATACTCATGAGGACAGCAAGGTTGAGGGCGATGCTAATCATTACATTATCAGAGTTGATGTCTGATGTACAAGTGACTCAGATGAAGGCCGATGGAACACTAGAAGAGAGTGGTGAAGCTCGACGCCTCCGCAAATCACTGGAGGAAGTGGCAGATGCAGCTAAGAGCCCCAGTCTATTGAGAGAGTGTGGACTTCCTGAGAGTGCCTTATTAGAAATTCCTGAAAAAATGACTGAAAATAGATGGTCCTGGTCAGACGTGAAATATCTCTCTGACAGTCTTCTTCTTGCTCTTGATGCCAGCTTGGAACATGCACTCCTGGGCTCTATGATGACTATGGATAGATATGCAGCTGCAGAAAGCTTCTATAAACTTGCTATGGCATTTGCTCCTGTCCCAGATCTTCATATAATGTGGTTACTTCATTTATGTGATGCACATCAAGAAATGCAGTCGTGGGCAGAATCTGCTCAATGTGCTGTCGCTGTGGCTGGTATTGTAATGCAGGCTTTGGTGGCCAGAAATGATGGTGTTTGGAGCAAAGATCACATAACTGCTCTACGTAAAATTTGTCCAATGGTCAGTAGTGAGATCAGCTCTGAGGCTGCTGCAGCTGAGGTAGAGGGATATGGTGCATCAAAACTTACTGTTGACTCTGCTGTGAAGTACCTACAACTCGCAAATAAGCTCTTTTCTCAAGCTGAACTTTTTCATTTCTGTGCAAACATTCTGGAACTCGTTATTCCAGTATATAAAAGCAGGCGGGCATATGGACAGCTGAGCAAATGTCACACAATGCTTACCAATATATATGAATCAATCCTTGAGCAGGAATCGAGCCCAATTCCATTCACTGATGCAACATACTATAGGGTGGGGTTTTATGGCGATAGGTTTGGAAAATTGGACAGGAAGGAATATGTATACAGGGAGCCACGTGATGTAAGACTAGGTGACATAATGGAGAAGCTTAGCCATATCTATGAGTCTAGGATGGATGGGAATCACACCTTGCACATCATTCCGGATTCTAGGCAGGTAAAGGCAGATGAGTTGCAGCCTGGTGTCTGCTATCTGCAGATAACTGCGGTTGATCCAGTCATGGAAGACGAAGATTTGGGAAGCAGAAGGGAGAGAATCTTTTCTCTTTCGACTGGAAGTGTTCGTGCGCGAGTCTTTGACCGTTTTTTGTTTGATACACCTTTCACCAAAAATGGAAAAACTCAAGGTGGATTGGAAGACCAGTGGAAGAGGCGGACTGTTCTTCAGACTGAAGGTTCATTCCCAGCTCTCGTTAACAGGCTTGTAGTTACTAAATCCGAATCGCTTGAGTTCTCCCCTGTAGAAAATGCTATTGGAATGATTGAAACTCGGACTGCTGCTCTACGTAATGAACTTGAAGAACCTCGCAGTTCTGAGGGGGATCAACTCCCACGTCTCCAGAGCCTACAGAGAATTCTTCAAGGAAGTGTTGCAGTTCAGGTGAATAGTGGTGTTCTAAGTGTTTGCACTGCATTCCTTTCCGGTGAGCCAGCAACCAGGTTGCGGTCACAAGAATTGCAGCAACTCATTGCTGCGCTCCTTGAGTTTATGGCTGTATGCAAGCGTGCCATCCGTGTGCACTTCAGGTTGATTGGCGAGGAAGACCAAGAATTCCACACGCAGCTTGTGAATGGATTTCAATCTCTTACTGCTGAGTTATCTCATTATATCCCTGCCATCCTATCCGAGCTGTGA >Mapoly0021s0072 ATGGCGGATCTATCTACAACTGGACAACGGTTCAGGCGCATCGCGCATAGTGGTTCAATGAACGACATTGATCCTATGCTTCATGGCGATCTGGAACAGTGGCCACACATCAAAGAGCTCGTCCTTATCCACAAGGCAGATTGGGTTAAGGATGAAAGCAAATATGGTCATTATGAGAGTGTTCCACATCCTTCTTTCGAGCAACCAACTTTTGAAGGGCCCGATACGGACATCGAAACAGAGCACCGGCTAGCAAATGGACGACGTGGTCGAACTGCAGAAGTTTTAGATGACGATGATCCCAGCACTTCGGGCAGACTCTCTGTCGCGAGTGAATACGAAGTCTCACATGAAAAGAAGCTGCCAAAGCATTTTGGTCCGGCTCCTTTACCAGCCTACGACCCTGTGTTTAGCTGGGAAACAGAAAGGGCTACTATATATGGGCAGAGAGTACCTGTCCTACCAGCGGCCCTCTCTCATAGCGGGCTGAAATTGTCCGTTAAAGTTCTCTCACTTAACTTTCATGCTGGACTAGTCGAACCTATATATGGCACTGTTTGCTTATATCATCGAGAAAGGAGGGAGAAGCTTTCCGAAGACTTTTACTTTCAGTTCAGTCCTAACGACTTTCAGGAGCCAGGAGCACCCCCGTACAGGCGTGCCATATTTTCACTTGATTCCCCTACGGCTCCTGTCTGTCTCCTTATTCAGCTTGAGAAACATGCAACGGAAGAAGGCGGTGTTACCCCTTCCGTCTATTCTCGGAAAGAACCTGTTCATTTGACTGAGAGAGAGAAACAGAAACTTCAAGTATGGGCTAGAGTCATGCCTTACCGAGAACCCTTTGCTTGGGCAGCAGTTCCACTTTTTGACACGACAATGTCCGGAGTGGGTGGTTTTCCATCTCCAAGTAGTCCCCTTCCTCCCGGTATGCTAAGTACTAGCTTGCTTGAGGGTGTGGATTTGGACAGTGGCAGATCGGATAAACAACACGAGGGTGGTGGCCCTGTGTTAGTGGACATCCCAGGATTGAATCGGGTCAAAGAATGCTACAGCGAAGAGTCACTGCAGGATCCTAAGCGGAAAGTACACAAGCCTGTCAAAGCAATGATGCGTTTGGAAGTGGAGAGAATACTTCCAGAAGACAATGATGTGGATACCTTCTCAGAAAGCAGCAGCATCAGCAATGGATCAGGGGATGGAGACGGCCGCATTGGAGACACGTCATTGAGGAGTATCGGGAAGTCGGGAAGAGCCTTGTTTAATGGACGGCCGAAATGGAGTGCGGGTGATCGTAATGACAGTGGGAAACACAAGTTCAGCAGCTTTTCAAGCGCGAACAGTCCGGATCATCAAACGGCAGATTTTCGAGCACTGGAATTCCGGGCCCTTACAAAGAATGAGCCCTTTAATCAGCTTTTGCACAGTCTTTATGTGTACCCACTCGCCGTTAATATGAGCAAGAAACGCAATCTTTTTATCCGGGTGGAGCTGCGGAAGGATGATGTTGATATACGCAACCCTGCTCTGGAGGCAGTCTACGCCAGAGACGGTAGTAACCGTATTCAAAAGTTTGCTCATTCTCAAATAGCTGTAAATGCCCGTACAGCTCACTACCATGATGAGTTCAAGCTACGTCTTCCTGCGGTTCTCACTCCTCATCATCACCTAGTCTTCACCTTCTTTCATGTCGATCTCCAGATGAAGCTGGAGGCACCTAAGCCGGTAGTTATGGGATACTCTGTTCTTCCACTGTCGGCAGGACCCCAAGTTCTGAGATCTGACGGAAGCTTGCCCATAATGAAAGAGTTGCTTCCACACTATCTGCAAGATGGTGTAAAGGAGCGGATGGAACATCTTGAAGATGGAAAGAGCGTGTTCCGGTTACGCTTGCGTCTTTGTTCATCACTTTACCCAATAAATGAGCGTATTCGTGACTTCTTTACAGAGTATGATCGGCATATTCTCCGAACTAGCCCTCCTTGGGGTTCGGAACTTCTTGAGGCCATCAACAGCCTAAAGGTTGTAGACCCGACTGCAATGCTACAATTTTTGCAACCCATCCTGAACATGCTGCTTCGGATGATCGGGGATGGTGGCGAAACTTTGCAGGTTGCTTCATTTAGAGCAATGGTCAACATTTTGATACGGGTACAGCAGGAATCATCTGAAGGGGCAGACCGAAATCCCTATCTTGTTCAGTACGTGGATTATTCTTTTGATGATTTGGGTGGTCTTCAAGATCCGGTTTATCCTGGTCTGTGCAATGTCTGGAGAAGCTTGGCCAGAAGCAAGGCAAAAGGGTATAGGGTGGGACCAGTTTACGACGATGTGCTGTCGATGGCATGGGTGTTCCTGGAGCTAATTGTGAAGTCCATGGCTCTCGAACAGTCACGAGTTTTCTCTGATACTCTTCATTTAGGTGAAGATTTGCCTCCGATGCAGCTGAAGGAGGGGGTCTTCAGATGTATTTGGCAATTATATGACTGTCTCTTGACTGAAGTACATGAGCGTTGCAAGAAGGGTCTCACATTGGCCAAACGTCTCAACAGTAGTCTTGCTTTTTTCTGCTACGATCTCCTTTCAGTCATTGAACCCCGCCAAGTATTTGAGCTGGTTGCACTCTATTTTGACAAATTTACTGGAGTTTGTCAACAAGTACTGCATGAGTGTAAGCTCACGTTTCTAAGGATCATATGCGACCATGATTTGTTCGTGGAGATGCCTGGGCGGGATCCCTCAGAACGGAACTATTTGGCATCAGTCCTGATGCAGGAGCTGTTCCTTACTTGGGACCATGAAGACTTAACACAAAGAGCGAAGGCTGCGAGGATATTAGTTGTACTCATGTGCAAGCATGATTACGACGCTCGATATCAGAAACTGGAAGACAAGCTCTACATTGCTCAGCTCTACTTTCCTCTCATAGGCCTTATATTGGATGAGATGCCTGTGTTCTACAACCTAAGTTCAACGGAGAAGCGGGAGGTTTTAGTCTGTGTGATGCAAATCATTCGACATCTCGATGATGCGACCCTTGTGAAGGCCTGGCAGCATAGTGTTGCTCGAACACGACTTTTTTTCAAGCTCCTTGAAGAGTGCCTCGGTTTGTTCGAGCACAAAAGAGCCTCAGTTGATAACATGGGAATACCTGGGGGCATTCCTCCACCTGAAGAAGTTGAAGGACCCTATTCCCCACGATATTCCGAAAAATTGTCCCCGTCTATCCACGGGTACTTCACCGAAGCATCCCGGCCGGACGTTGGCAGACCGCAGGTCACACCAGATAGTGGATACTTGTGGAAGAAATTAAGCCCACAACTAATAAGCTCTCCAGGTCAACCGTATTCGTTGAGGGAGGCTTTGTCATCTCAAGCTCCATCTTCTCGAAGAGTAGGTTCAGACCGGGCATTGCGTGAAAGTCTGCATCCAATGCTCCGCCAAAAGCTGGAACTTTGGGAGGATAACTTAAGTGCAGCTGTAAGCCTGCAGGTGCTTGAAATCGTTGAGAAGTTTGTTGACGCAGCTGCAACCCATAGCATTGCCACTGATTATATAAAACTCGATTGTATTACTGCCCTCTTCACTGGGTTTTTGTCTCGCAGCCAACCGCTTCTATTCTGGAAGTCATTCCTTCCAGTTTTCAATAATCTATTTAGTCTCCATGGAGCAATTCTTATGGGTCGGGAAAATGACCGTTTTCTGAAGCAAGTAGCGTTTCATTTATTGCGCTTGGCCGTGTTCCGGAACGAGTCAATACGCAAACGAGCTGTTGTTGGCCTCCAGATTCTCGTTCGGAACTCTTTCTATCACTTTCAAACTACTGCGCGACTCCGTGTGATGTTGACCATCACTCTCTCAGAGCTTATGTCTGATGTACAAGTAACTCATCCATGTCCCGACGGAACTTCGGAGGAAAGTGGAGAAGCAAGGCGATTGCGGAAATCTTTACAAGACATTGCTTCCGAAACTAGTAGCGTGGAGCTGCTCAAAGAATGCACTCTGCCAGAGAACTGTTTGGTTGCAGTACCTGATGGTGCAAGCGAAAATCGGTGGCGGTGGAAAGAACTGCAAGATCTGTCAACTACATTGTTGCGTGCTCTCGATGCTGCCGTTGAGCACGCTCTCCTGGGTCCAATGACGGGCTTCGACAAGTATGCAACTGCAGAAAGCTACCACAGTTTGGCCTGGGCTTATTCTCATGTGCCAGATATCCACATCATGTGGCTCTTACATCTTTGTGATCAACATCAGCAAATGCATTCATGGGCAGAGGCTGCTCAATGTGCTGTGGCTGTGGCTGGTGTTATTATGGAGGCTTTAGTTGGAAGAGCTGATGCGGTGTGGGGAAAAGACCATGTGGAGTCGCTCCACAAAATATGTCCTATGCTAAGTAGCTCAGTAATAGGAGAGGCAGCCGCTGCCGAAGTAGAGGGATATGGAGCTTCAAAGCTGACTGTAGACTCAGCGGTAAAGTATCTTCAACTGGCAAATAGACTCTTTCAGCAGGCGGAGCTGTTCCATTTTTGTGCTGGAATTTTGGAGCTCATAATTCCAGTGTACAAAAGTCGACACGCTTATGGGCAGCTTGCAAAGTGCCACACTTCCCTTACCACTATCTATGATTCCATTGTCGAACAGGAGACGAGCCCTATTCCATTTACAGATGCCACTTATTATCGTGTGGGATTCTATGGGGAACGTTTTGGTAAACTAAATCGGAAGGAGTATGTGTACAGAGAGGCTAGAGATGTCCGCCTTGGAGATATAATGGAGAAACTAGGACATGTATACGAGTCTAGGCTAGGTGATGGGCACACCTTGCATATAATACCCGACTCGCGGCAGGTGAACGCAGATGAGCTTCAGCCAAGAGTTTGTTACCTGCAGATCACATCTGTCGACCGTGTGATGGAAGATGAGGATCTAGAGAGCAGGAGAGAAAGACAACAAACTGGTCACGCATCAGGAAGCGTCAGTGCGCGAGTTTTTGATCGATTTTTGTTTGACACCCCTTTCACTAAGAACGGTAGGAGTCAAGGAGGTTTAGAAGACCAGTGGAAGCGGAGAACTGTGGTCCAAACTGAAGGCCCTTTTCCTGCACTAGTAAATCGTCTCCTTGTGGTGAAGTCCGAGTCCAGAGAGTTTTCTCCCATTGAAAATGCTATAGGAATGATCGAAACCAGGACATCAGCGCTACAGAATGAACTCGAAGAGCCACGCAGTGCAGAAGGAGATCAACTGCCTCGGTTACAGAGTCTGCAAAGAATTCTGCAAGGCAGTGTTGCTGTTCAGGTCAATAGTGGGGTTCTTGGAGTCTGTACAGCCTTCTTGTCTGGTGAGCCAGCAACACGACTCCGTTCCCAAGAGCTGCAGCAACTTATTGCAGCATTGCTGGAGTTTATGGGTGTATGCAAACGTGCAATTCGTGTACATTCCCGCCTGATAGGAGAAGAAGACCAAGAGTTCCATTCTCAGCTAGTAAATGGTTTTCAGTCTCTTACAGCGGAGCTCTCTCACTACATACCGGCCATCTTGTCTGAACTTTGA >TCA.TCM_011918 ATGGATAGCAACGTTTCTGGCAATGGCAACGGGGGCGGGGGTTATCGCTTTCGTAGAATACCACGACACTTTCTCCCTCATCTCAAGCTGGATCCTTTGCTTGATGAAAATTTGGAGCAGTGGCCACATCTAAATGAACTCGTTCAGTGCTATAGAAGCGATTGGGTTAAAGATGATAACAAATATGGCCACTATGAAACTATCAGTCCTGTTTCCTTCCAGAATCAGATATTTGAAGGCCCGGATACTGATATTGAGACGGAAATGCAGCTTGCCAGTGCGAGGCAAATTAAAGCTGAAGATGCTACCGATGATGACGTCCCAAGTTCCTCAGGAAGGCAATTTACCAACGCTGATATTACAAAGCATTTTGGTCAGTCTCCCCTCCCAGCTTATGAACCAGCTTTTGACTGGGGAAATGAGAGGTCAATGATATTTGGCCAAAGGATTTCAGAAACCGCTACAACACAGTATGGCAGTGGATTGAAGATCTCAGTCAAAGTTCTGTCCCTTTCCTTTCAAGCTGGACTTGTTGAGCCATTCTATGGAACCATTTGCATATATAATAGGGAGAGAAGAGAAAAACTGTCGGAAGATTTCTATTTTTGTGAGCTACCAAGTGAAATGCAGGATGCTAAAGTGCCTTTAGAACATCATGGAATATTCTATTTAGATGCTCCATCAGCGTCAATCTGTTTGCTAATCCAGTTAGAGAAGCCTGCAACAGAAGAAGGCGGTGTAACCCCTTCAGTTTATTCACGTAAAGAACCGGTGCACTTGACTGAGAGAGAGAGGCAGAAGCTGCAGGTGTGGTCTCGTATAATGCCTTACAGTGAGTCCTTCGCCTGGGCTATTGTTCCATTATTTGATAACAGCATTGGTGCAGCTTCTGGTGGATCTGCTTCTCCTAGTAGCCCTCTTGCTCCCAGCATTTCTGGGTCGAGTTCTCATGAGGGTGTGTTTGAACCTATTGCAAAGGTTACATCAGATGGAAAGCTGGGTTATTCTAGTGGAAGTTCTGTTATTGTTGAAATATCTAATCTAAATAAAGTGAAAGAAAGCTATACTGAGGAGTCACTTCAGGATCCTAAACGAAAGGTCCATAAACCTGTCAAAGGTGTTTTGAAATTGGAAATTGAGAAGCACCAGACTGTTCATACTGAGCTGGAAAATGTATCAGAAAGTGGCAGTGTGACAAATGATTTCCTGGATCCAGCGGATCCCGTTGCTGATATGCTGTTTTCAAAGAGTCCTGGAAATGGTCTGGATGGACCTCAGAGTAGCAACTCCAAGTGGATTTCGAGTGATGGGAAAGATGTCTCCGGAAATGGATCTAACACTCAGGGAAATCCAGATTTCTGTGCTGATGATTTTCAGGCTTTTGACTTCCGTACAACAATGAGAAATGAGCCATTCTTGCAGCTCTTTCATTGTCTATATGTATATCCCTTAACTGTGAGTTTGAGTCGGAAAAGGAATCTATTCATACGAGTTGAGCTAAGAAAGGATGATGCAGATGCTCGTAGGCAGCCTTTAGAGGCAATGTATCCAAGGGAGCGTGGTTCATCACTCCAGAAATGTGCCCACACGCAAGTTGCTGTCGGTGCTAGGGTGGCCTGCTACCATGATGAGATTAAAGTTTCACTGCCTGCTGTCTGGACACCATCGCATCACCTTTTATTTACTTTCTTCCATGTCGATCTTCAAACTAAACTCGAAGCTCCAAAACCAGTAGTTATCGGATATGCATCACTTCCATTGTCCACCCATGCTCAATTGCGGTCTGAAATTTCTTTACCAATAATGAGAGAACTGGTTCCACATTATCTCCAGGATTCTGGCAAGGAGAGGTTGGATTATTTGGAAGATGGAAAAAGTATTTTCAAATTGCGCTTAAGACTATGTTCGTCTGTGTACCCAATTAATGAGCGCATCAGGGATTTTTTTCTTGAATATGATAGACACACTCTTCGAACAAGCCCACCTTGGGGTTCTGAACTTTTGGAGGCAATTAACAGCTTAAAGAATGTTGATTCCACTGCTTTGCTTCAGTTTCTTCACCCAATTCTGAATATGCTTCTCCATCTTATAGGGAATGGTGGAGAAACCCTTCAGGTTGCTGCATTCAGAGCCATGGTCAATATCCTAACCAGGGTGCAGCAAGAGTCAGTTGATGATGCTGAACGAAATCGCTCTCTAGTTAATTATGTAGATTATGCTTTTGATGACTTTGGTGGTCGTCAACCTCCAGTTTATCCGGGTTTGTCTACTGTGTGGGGTAGCTTGGCTCGTAGTAAGGCTAAGGGTTATCGTGTTGGACCAGTATATGATGATGTGCTGGCAATGGCTTGGTTTTTTCTTGAGCTAATTGTCAAGTCAATGGCATTGGAGCAAACACGTCTGTTCTATCATAGTCTTCCATTAGATGAAGATGTTCCACCAATGCAATTGAAAGAGGGTGTGTTCAGATGTATAATGCAGCTGTATGATTGCCTTCTAACTGAAGTTCATGAGCGTTGTAAGAAAGGGCTAAGCTTGGCGAAACGATTGAACAGCAGTTTGGCATTCTTTTGTTATGATCTTTTGTCTGTCATTGAGCCTCGCCAAGTTTTCGAATTGGTGTCCTTGTATCTGGACAAGTTTTCTGGGGTATGTCAATCAGTTCTGCATGATTGCAAGCTAATATTTTTGCAGATAATATGTGATCATGATCTTTTTGTGGAAATGCCTGGGAGAGACCCTTCAGATAGGAACTATCTGTCTTCTGTCTTGATTCAAGAAATTTTCCTTACTTGGGATCATGATGATTTATCTCAGCGTGCTAAGGCAGCTAGAATTTTGGTAGTTCTTTTATGTAAGCATGAGTTTGACGGTCGGTATCAAAAGCCTGAAGACAAGCTATATATTGCCCAACTATATTTTCCTCTTATTGGCCAGATTCTAGATGAAATGCCTGTATTTTACAACTTAAATGCTGCTGAAAAGCGTGAAGTTTTGATTATTATCTTGCAAATCGTGCGTAATCTGGATGAGGCATCAGTTGTCAAGGCTTGGCAGCAAAGCATTGCTCGAACTAGATTATTCTTCAAACTCATGGAGGAATGCCTGGTTCTTTTTGAGCACAGAAAGCCTGCTGATGGTATGCTTATAGGCAGCAGTTCTCGCAATCCTGTAGGTGATGGACCTACTTCACCAAAATACTCTGATAAGCTTTCCCCTGCAATTAACAATTATCTATCTGAGGCATCAAGACAAGATGTTAGACCGCAGGGAACACCTGACAATGGTTACTTGTGGCAGAGGGTGAATTCTCAGCTAAGCTCCCCAAGCCAGCCATATTCCTTGAGAGAAGCTCTGGCTCAGGCACAATCTTCTAGGATTGGAGCTTCAGCCCAAGCACTTAGAGAATCTTTGCACCCCATTTTGCGACAAAAGCTGGAGCTTTGGGAAGAAAACTTGAGTGCTGCTGTTAGTCTTCAGGTTTTGGAAATGTCTGAGAAATTTTCTGTGATGGCAGCATCCCATAGCATTGCTACAGATTATGGAAAACTTGATTGTTTATCATCTATAATTATGAGCTTCTTTTCCCGAAATCAGCCACTGGCTTTCTGGAAAGCTTTCTTACCTGTTTTCAACCATGTCTTTGATCTTCATGGGGCAACCCTAATGGCTAGGGACAATGATCGATTCTTAAAGCAAGTTGCTTTTCATCTTCTTCGGCTTGCAGTCTTCCGAAATGATAATATTAGGAAAAGAGCGGTTATTGGGCTTCAAATACTTGTGAAGAGTTCTTTCTACTTCATGCAGACTGCGAGGTTGAGGGTCATGCTGACTATTACATTATCCGAGCTAATGTCTGACATGCAGGTGACTCAGATGAAGTCTGATGGGACACTTGAAGAAAGCGGTGAAGCACGGCGGCTTCGAAAATCTTTGGAGGAAATGTCAGATGAGGTCAAGAGCTCTGGCCTATTGAATGAGTGTGGACTTCCTGAGAATTCTCTATTGGTGACTCCAGAAAATTTTGAAGAGAATCGATGGTCCTGGTCAGAAGTGAAATCTCTCTCTGGCAGTCTTCTTCTGGCCCTTGATGCTAGTCTGGAGCATGCACTGTTGGCCTCTGTGATGTCAATGGATAGATATGCAGCGGCAGAAAGCTTTTACAAGCTTGCAATGGCATTTGCCCCTGTCCCAGATCTTCACATAATGTGGTTGCTGCATTTGTGTGATGCACATCAAGAAATGCAGTCTTGGGCTGAAGCTGCACAGTGTGCTGTGGCTGTTGCTGGTGTTGTAATGCAGGCCCTTGTTGCTAGAAATGATGGTGTTTGGAGCAAGGATCATGTGACAGCTCTACGTAAAATTTGTCCTATGGTCAGCAGTGAAATAACATCTGAGGCATCAGCTGCTGAGGTTGAGGGATATGGTGCTTCCAAGCTCACTGTTGACTCTGCTGTTAAGTACCTACAGCTTGCAAATAAGCTTTTCTCTCAAGCTGAGCTCTATCATTTCTGTGCAAGCATTTTGGAACTTGTAATTCCAGTTTATAAGAGCAGAAGGGCATACGGACAGCTGGCTAAATGTCATACATTGCTCACAAATATCTACGAATCAATCCTTGAGCAGGAGTCAAGCCCTATTCCATTCACTGATGCTACTTATTATAGGGTTGGATTCTACGGGGAGAGATTTGGCAAGCTGGACCGGAAGGAATATGTTTACCGAGAACCTCGTGATGTACGCTTGGGTGACATAATGGAAAAACTTAGTCATATATATGAATCTAGGATGGATGGTAATCATACTTTGCACATTATCCCTGATTCAAGACAAGTGAAGGCAGAGGAGTTGCAGCCTGGAGTCTGTTACCTGCAAATAACGGCTGTTGATCCAGTCATGGAAGATGAAGATTTGGGAAGCAGAAGGGAGAGAATCTTTTCTCTTTCGACTGGAACTGTCCGTGCACGTGTCTTCGACCGCTTCTTGTTTGATACTCCATTCACAAAAAACGGCAAGACCCAAGGTGGATTGGAAGACCAATGGAAGAGGAGGACTGTTCTTCAGACTGAAGGCTCATTCCCTGCACTGGTCAATAGGCTCTTGGTCATAAAATCTGAATCACTTGAATTTTCCCCAGTAGAGAATGCAATTGGAATGATTGAAACTCGAACAGCTGCCTTACGAAATGAGCTTGAAGAGCCTCGTAGTTCTGAAGGAGATCAATTGCCACGTCTCCAGAGTCTGCAGAGAATTCTTCAAGGCAGTGTCGCAGTTCAAGTGAAATAG >AUR62034357 CCGGTTCAGCTCGACGAGGATGTGGAACAGTGGCCACATTTGCATGAACTTGTGCAATGCTACAAAGCTGATTGGATTAAAGATGAAAATAAGTATGGGCATTATGAGAGCATTGGTGCTACTAGTTTTCGAAATCAGATATATGAAGGGCCTGATACTGACATTGAAACAGAGATGCATCTAGCTGAGGCCAGACAAATTGAAAATGAAGATGCTGCTGATGAAGAATCACCAAGCACATCCGGAAGACCGTTTGGAGAGCATCTTGGTTTGTCGCCGTTGAGTGCATATGAACCAGCATTTGACTGGGAGAATGAGAGGTCTATGGTATTTGGTCAAAGGCTTCCAGAAACTCAAGCACAATATGGAAGTGGATTGAAGATCTCTGTCAAAGTTCAGTCCCTTATGTTTCAAGCTGGATTAGTTGAACCATTCTATGGAACTATTTGCTTGTATAACAAAGAGAAAAGAGAGAAGTTATCAGAGGACTTCATTTTCCAGGTGCTCCCTACAGAAATGGAAAATTCTGGTATTTCAAATGACTCTCGAGCAATATTCTACCTAGATGCTCCCTCAGCATCAGTTTGCTTGTTGATCCAGCTGGAGAAGCCTGCCACTGAAGAAGGAGGCATCACTTCGTCTGTCTACTCCCGAAAAGAACCAATACAGCTTAGTGAGAGAGAGAGGCAAAAATTGCAGGTTTGGTCTCGAGTAATGCCTTACAGGGAGTCATTTGCATGGGCTATGGTACCATTATTTGACAATACCATCGCTGGAACCTCTGGTGGAACTGCTTCTCCCAGTAGCCCTCTGGCACCGAGTGTATCTGGTTCTAGTTTCCATGAGGGTGTATCAGAGTCTACTACAAAAATCACATTAGATGGAAAGTTGGGTTATTTGAGTGGGAGTTCAATCATTGTTGAAATATCAAATTTGAATAAAGTCAAGGAGAGCTATACAGAGGATTCTCTGCAGGATCCTAAAAGAAAGATCCATAAGCCTGTTAGAGGTATGTTGAGACTGGAGATTGAGAAGCTACACGCTGGGCATCTCAACTTTGAAAATGGCTCAGAGAGTGGCAGTATGACTAATGAATCCTTTGATATGGGAGAGAGTATTCAAGATATGTCACAGGAACCAAGTAACAATGTGGAAAGGTCTCAGAGCACCAGATCAAAAAATTGTTTTGCAGATGGAAAAGAATCTGCTCGAAATGGTTTAAAGGCTTATGAGAACCATGATTCCCAATCGGAGGTATTCCATGCCTTTGACTTCCGTGCAACTACAAGGAATGAACCTTTCTTGCAACTTTTCCACTGTCTCTATGTGTATCCATTGACTGTCAGTTTGAGTCGAAAAAGGAATCTGTTTATACGAATAGAGCTTCGAAAAGATGACACAGATATTCGACGACAGCCTCTGGAGGCAACATACCCCAGGGAGCCTGGTGCATCACTAGAGAAGTGGGCTCATACACAAGTTGCAGTTGGTGCAAGGGTTGGTTGCTATCATGATGAAATCAAAGTCTCCTTGCCACCTATATGGACCCCACTGCATCACCTTTTGTTCACTTTCCTTCATGTTGACCTTCAAACTAAATTGGAAGCTCCGAAACCGGTGGTGATTGGCTATGCTGCACTCCCACTGTCTACATATGCTCAGTCAAGATCTGAAATTTCTCTGCCCATCATGAGAGAGCTTGTTCCACATTATCTTCAAGATGCGGGGAAGGAGAGGCTTGACTATTTGGAGGATGGGAAGAATGTCTTCAGATTGCGATTGAGGTTATGTTCCTCTTTGTATCCTACTAATGAACGCATAAGGGATTTCTTTCTTGAGTATGACAGGCACATCCTTCGGACAAGCCCTCCATGGGGATCAGAGCTTCTTGAGGTTGCTGCATTTAGAGCTATGGTTAATATCTTGACTCGGGTCCAGCAAGAATCGGTAGATGATGCAGAAAGAAATCGATTTCTTATTAGCTATGTTGATTATGCTTTTGATGACTTTGGTGGCCGCCAGTTACCAGTTTATTCTGGTCTTTCTACTGTGTGGGGAAGTTTAGCACGTAGTAAGGCAAAAGGTTATCGTGTGGGACCAGTATATGATGATGTCTTGGCAATGTCTTGGTTTTTTCTTGAGCTTATTGTGAAGTCGATGGCTTTGGAACAAATACGACTTTTGTATCATAGCCTTCCATCAGGTGAAGATGTCCCGCCAATGCAATTGAAAGAAGGAGTTTTTAGGTGCATTATACAGCTCTATGATTGTCTTATCACTGAAGTACATGAGCGTTGCAAGAAAGGGTTAAGCTTAGCAAAGCGTTTAAATAGTAGCTTGGCCTTCTTTTGCTATGACCTGTTATCTATTGTTGAGCCTCGGCAAGTTTTTGAGTTGGTATCTTTGTATTTGGACAAGTTTTCTGGGTTATGTCAACCTGTTCTTCATGACTGTAAGCTTACCTATTTACAGATCATATGTGATCATGATCTTTTTGTCGAAATGCCAGGAAGAGACCCTTCTGATAGGAACTATCTTGCGTCTGTGCTGATACAAGAGCTTTTCCTCACCTTAGATCATGATGACTTGTCACTAAAGGCTAAAGGAGCTAGAATCTTAGTGGTTCTCATGTGCAAACATGAATTTGATTCTCGTTACCAGAAGCCTGAAGATAAATTATACATCGCACAGCTTTATTTCCCGCTGATAAGCCAGATACTTGATGAAATGCCTGTTTTTTACAACCTCGGTGCTGCTGAAAAGCGTGAAATCTTGATTGTTGTTTTGCAAATTGTACGCAATTTGGATGATGCGTCATTGATTAAAGCCTGGCAGCAAAGTATTGCAAGAACCAGATTGTTTTTCAAAGTTATAGAGGAAAGCTTAATCCTTTTTGAGCATAAAAAACCAGCTGATGGTATGATAATTGGAAACAGTTCTCGTAGTATCGTGGGGGATGGAAATGCATCCCCTAAGTATTCAGATAGGTTGTCTCCAGCCATCAACAACTATCTGTCTGAGGCATCACGGCAAGAGCCTCATAGAACGCCAGAGAATTATTTGTGGCAGAAAGTAAACTCTCAGTTAAGTTCTCCAAGCCAACCCTATTCCTTGAGAGAAGCTCTAGCTCAAGCACAGTCTTCCAGGATAGGAACTTCTGCCCAAGCACTAAGGGAATCATTGCATCCTTTATTGAGACAGAAGCTGGTGGGTACTCTTGCATTGGAACTTTGGGAGGAGAATTTGTGTGCTGCTGTTAGTCTTCAAGTCCTAGAAATTATTGAGAAGTTTTCTAAAACAGCAGCAACACATGGAATTGCAACAGATTACGGGAAACTTGATTGCATTACATCCATATTCACGAGTTTCTTCTCAAGGAATCAGCCACTTGAATTCTGGAAAGCTCTTCTGCTGGTGTTTAACAGTATATTAAGTTCCCATGGATCAACATTAATGTCACGTGAGAATGATCGTTTTCTTAAACAAATTGCTTTCCATCTTCTTCGTCTTGCTGTCTATAGAAATGAAAACATCAGAAAAAGGGCAGTTGTTGGGCTTCAGATTCTTGTAAGGAGCTCTTTCTGTCACTTCATGCAAACTACAAGGCTTAGAGTCATGCTGACCATAACATTGTCAGAGCTGATGTCAGATGTACAAACTACTCTGATGAAGCCTGATGGAAGTCTTGAAGAGAGTGGTGAAGAGCAGCGTCTTCGTAAATCTTTGGAGGAAATGGCAGATGAAGTGAAAAGCTCCAGTTTGCTGAGGGATTGTGGTCTTCCTGAGTCTGCACTGATAGCTATTCCAGAAAGGTCTACAGAGAATAGGTGGTCTTGGTCAGAAGTTAAACATCTCTCTGACAATCTAATTCTGGCTCTTGATGCGAGCTTGGAACATGCACTTCTGGGCCCTGTGATGAACATTGACAGATATGCTGCTGCAGAAAGCTTTTACAAACTTGCTGTAGCATTTGCTCCTGTTCCAGATCTTCACATAATGTGGCTACTGCATCTATGTGATGCGCATCAGGAAATGCAATCCTGGGCGGAAGCAGCAGAGTGTGCAGTTGCTGTTGCAGGTGTTGTTATGCAGGCTCTAGTAAGTAGAAATGACGGCGTATGGAGCAAAGAGCATGTTGCTGCTCTCCGCAAAATATGTCCTATGGTCAACAATGAGATAAGTTCTGAGACAGCTGCTGCAGAGGTGGAGGGATATGGTGCTTCAAAGCTTACTGTTGATTCAGCTGTGAAATATTTGCAGCTTGCTAACAAACTTTTTTCTCAAGCTGAGCTCTATCACTTTTGTGCTAGCATTCTAGAATTGGTAATTCCAGTGTACAAAAGCAGAAGGGCATATGGGCAGCTAGCCAAATGTCACACAATGCTAACCAGTATTTATGAATCTATCCTTGAACAAGAAGCAAGCCCAATTCCCTTTGCCGATGCTACATATTATAGGGTAGGCTTTTATGGTGAGAAATTTGGAAAGCTGGATCAAAAAGAATATGTATACAGGGAGCCCCGTGATGTACGGCTTGGAGACATCATGGAAAAGCTTAGCCATACATATGAATCCAGGATGGATGGTAATCACAGACTTCATATTATTCAAGATTCTAGGCAAGTGAAGGCAGAGGAGTTGCAGCCTGGTGTCTGTTACTTGCAGATTACTGCTGTTGATCCTGTCATGGAAGATGAAGACTTGGGTAGTAGGAGAGAGAGGATATTTTCCCTATCCACTGGAAGTGTACGTGCTCGTGTTTTTGATCGATTTTTATTTGATACCCCCTTTACTAAAAACGGGAAGACTCAAGCTGGATTAGAGGATCAGTGGAAACGGCGTACAGTTCTTCAGACAGAAGGCTCCTTTCCTGCTCTTGTTAACAGGCTTTTGGTGATAAAATCTGAATCTATGGAGTTCTCTCCTGTGGAAAATGCAATTGGAATGATTGAAACTCGGACAGCTGCACTTCGAAATGAACTTGAAGAACCTCGAAGCTCTGAAGGGGACCAGTTACCACGTTTACAGAGCCTGCAGAGAATATTGCAAGGCAGTGTTGCAGTTCAAGTAAATAGTGGAGTGTTGAGTGTGTGTACTGCTTTTCTATCAGGTGAGCCTGCAACTAGGCTTCGTTCGCAGGAATTGCAGCAACTCATTGCCGCACTTCTTGAATTTATGGCTGTTTGTAAGAGGGCAATTAGAGTACACTTCAGGTTGATTGGAGAGGAAGACCAGGAGTTCCACACTCAGCTTGTAAATGGATTTCAATCGCTTACTGCTGAGTTATCTCACTACATTCCCGCCATTCTTTCAGAGCTCTAA >AUR62022352 ATGCTCGACGAGGATGTGGAACAGTGGCCGCATTTGCATGAACATGTGCAATGCTACAAAGCTGATTGGATTAAAGATGAAAATAAGTATGGGCATTATGAGAGCATTGGTGCTACTAGTTTTCGAAATCAGATATATGAAGGGCCTGATACTGACATTGAAACAGAGATGCATCTAGCTGAGGCCAGGCAAATTGAAAATGAAGATGCTGCTGATGAAGAATCACCAAGCACATCCGGAAGACCGTTTGGAGAGCATCTTGGTTTGTCGCCGTTGAGTGCATATGAACCAGCATTTGATTGGGAGAATGAGAGGTCTATGGTATTTGGTCAAAGACTTCCAGAAACTCAAGTACAATATGGAAGTGGATTGAAGATCTCTGTCAAAGTTCAGTCCCTTATGTTTCAAGCTGGATTAGTTGAACCATTCTATGGAACTATTTGCCTATATAACAAAGAGAAAAGAGAGAAGTTGTCAGAGGATTTCATTTTCCAGGTGCTCCCTACAGAAATGGAAAATTCTGGTATTTCAAATGACTCTCGAGCAATATTCTACCTAGATGCTCCCTCAGCATCAGTTTGCTTGTTGATCCAGCTGGAGAAGCCTGCCACTGAAGAAGGAGGCATCACTTCGTCTGTCTACTCCCGAAAAGAACCAATACAGCTTAGTGAGAGAGAGAGGCAAAGATTGCAGGTTTGGTCTCGAGTAATGCCTTACAGAGAGTCATTTGCGTGGGCTATGGTACCATTATTTGACAATACCATCGCTGGAACCTCTGGTGGAACTGCTTCTCCCAGTAGCCCTCTGGCACCGAGTGTATCTGGTTCTAGTTTCCACGAGGGTGAATCAGAGTCTACTACAAAAATCACATTAGATGGAAAGTTGGGTTATTTGAGTGGGAGTTCAATCATTGTTGAAATATCAAATTTGAATAAAGTCAAGGAGAGCTATACAGAGGATTCTCTGCAGGATCCTAAAAGAAAGATCCATAAGCCTGTTAGAGGTATGTTGAGACTGGAGATTGAGAAGCTACACGCTGGGCATCTCAACTTTGAAAATGGCTCAGAGAGTGGCAGTATGACTAATGAATCCTTTGATATGGGAGAGAGTATTCATGATATATCACAGGAACCAAGTAACAATGTGGAAAGGTTTCAGAGCACCAGATCAAAAAATTGTTTTGCAGATGGAAAAGAATCTGCTCGAAATGGTTTAAAGGCTTATGAGAACCATGATTCCCAATCGGAGTTCCATGCCTTTGACTTCCGTGCAACTACAAGGAATGAACCTTTCTTGCAACTTTTCCACTGTCTCTATGTGTATCCATTGACTGTCAGTTTGAGTCGAAAAAGGAATCTGTTCATACGAATAGAGCTTCGAAAAGATGACACAGATATTCGACGACAGCCTCTGGAGGCAACATACCCCAGGGAGCCTGGTGCATCACTAGAGAAGTGGGCTCATACACAAGTTGCAGTTGGTGCAAGGGTTGGTTGCTATCATGATGAAATCAAAGTCTCCTTGCCACCTATGTGGACCCCACTGCATCACCTTTTGTTCACTTTCCTTCATGTTGACCTTCAAACTAAATTGGAAGCTCCGAAACCGGTGGTGATTGGCTATGCTGCACTCCCACTGTCTACATATGCTCAGTCAAGATCTGAAATTTCACTGCCCATCATGAGAGAGCTTGTTCCACATTATCTTCAAGATGCGGGGAAGGAGAGGCTTGACTATTTGGAGGATGGGAAGAATGTCTTCAGATTGCGATTGAGGTTATGTTCCTCGTTGTATCCTACTAATGAACGCATAAGGGATTTCTTTCTTGAGTATGACAGGCACATCCTTCGGACAAGCCCTCCATGGGGATCAGAGCTTCTTGAGGCCATTAATAGTTTCAAGAATGTTGATTCCACTGCCTTGCTTCAATTTCTTCACCCAATACTAAATATGCTTCTCCATCTAATTGGAAATGGTGGTGAAACCCTTCAGGTTGCTGCATTTAGAGCTATGGTTAATATCTTGACTCGGGTCCAGCAAGAATCGGTAGATGATGCAGAAAGAAATCGATTTCTTATTAGCTATGTTGATTATGCTTTTGATGACTTTGGTGGCCGCAGTTACCAGTTTATTCTGGCAAAAGGTTATCGTGTGGGACCAGTATATGATGATGTCTTGGCAATGTCTTGGTTTTTTCTTGAGCTTATTGTGAAGTCGATGGCTTTGGAACAAATACGACTTTTGTATCATAGCCTTCCATCAGGTGAAGATGTCCCGCCAATGCAATTGAAAGAAGGAGTTTTTAGGTGCATTATACAGCTCTATGATTGTCTTATCACTGAAGTACATGAGCGTTGCAAGAAAGGGTTAAGCTTAGCAAAGCGTTTAAATAGTAGCTTGGCCTTCTTTTGTTATGACTTGTTGTCTATTGTTGAGCCTCGGCAAGTTTTCGAGTTGGTATCTTTGTATTTGGACAAGTTTTCTGGGTTATGTCAACCTGTTCTTCATGACTGTAAGCTTACCTATTTACAGATCATATGTGATCATGATCTTTTTGTCGAAATGCCAGGAAGAGACCCTTCTGATAGGAACTATCTTGCGTCTGTGCTGATACAAGAGCTTTTCCTCACCTTAGATCATGATGACTTGTCACTAAAGGCTAAAGGAGCTAGAATCTTAGTGGTTCTCATGTGCAAACATGAATTTGATTCTCGTTACCAGAAGCCTGAAGATAAATTATACATCGCACAGCTTTATTTCCCGCTGATAAGCCAGATACTTGATGAAATGCCTGTTTTTTACAACCTCGGTGCTGCTGAAAAGCGTGAAATCTTGATTGTTGTTTTGCAAATTGTACGCAATTTGGATGATGCATCATTGATTAAAGCCTGGCAGCAAAGTATTGCAAGAACCAGATTATTTTTCAAAGTTATAGAGGAAAGCTTAATCCTTTTTGAGCATAAAAAACCAGCTGATGGTATGATAATTGGTAACAGTTCTCGTAGTATCGTGGGGGATGGAAATGCATCCCCTAAGTATTCAGACAGGTTGTCTCCAGCCATCAACAACTATCTGTCTGAGGCATCACGGCAAGAGCCTCATAGAACGCCAGAGAATTATTTGTGGCAGAAAGTAAACTCTCAGTTAAGTTCTCCAAGCCAACCCTATTCCTTGAGAGAAGCTCTAGCTCAAGCACAGTCTTCCAGGATAGGAACTTCTGCCCAAGCACTAAGGGAATCATTGCATCCTTTATTGAGACAGAAGCTGGTGGGTACTCTTGCATTGGAATGGTTTTGTAAGGGTAATAATGTTGTTTCTCTTCAGGAACTTTGGGAGGAGAATTTGTGTGCTGCTGTTAGTCTTCAAGTCCTAGAAATTATTGAGAAGTTTTCTAAAACAGCTGCAACACATGGAATTGCAACTGATTATGGGAAACTTGATTGCATTACATCCATATTCACGAGTTTCTTCTCTAGGAATCAGCCACTTGAATTCTGGAAAGCTCTTCTGCTGGTGTTTAACAGTATATTAAGTTCCCATGGATCGACATTAATGTCACGTGAGAATGATCGTTTTCTTAAACAAATTGCTTTTCATCTTCTTCGTCTTGCTGTCTATAGAAATGAAAACATCAGAAAAAGGGCAGTTGTTGGGCTTCAGATTCTTGTAAGGAGCTCTTTCTGTCACTTCATGCAAACTACAAGGCTTAGAGTCATGCTGACCATAACATTGTCAGAGCTGATGTCAGATGTACAAACTACTCTGATGAAGCCTGATGGAAGTCTTGAAGAGAGTGGTGAAGAGCAGCGGCTTCGTAAATCTTTGGAGGAAATGGCAGATGAAGTGAAAAGCTCCAGTTTGCTGAGGGATTGTGGTCTTCCTGAGTCTGCACTGATAGCTATTCCAGAAAGGTCTACGGAGAATAGGTGGTCTTGGTCAGAAGTTAAACATCTCTCTGACAATCTAATTCTGGCTCTTGATGCGAGCTTGGAACACGCACTTCTGGTAAGATTTACTCTGACAACTGCTTATATCTGTGATGCTTGGACTCAACCCACCATCCCTTCTGTACCGGTGTCAACACGACACATCGTGCTGGGCCCTGTGATGAACATTGACAGATATGCTGCTGCAGAAAGCTTTTACAAACTTGCTGTAGCCTTTGCTCCTGTTCCAGATCTTCACATAATGTGGCTACTGCATCTATGTGATGCGCATCAGGAAATGCAATCCTGGGCGGAAGCAGCAGAGTGTGCAGTTGCTGTTGCAGGTGTTGTTATGCAGGCTCTAGTAAGTAGAAATGACGGCGTATGGAGCAAAGAGCATGTTGCTGCTCTCCGCAAAATATGTCCTATGGTCAACAATGAGATAAGTTCTGAGACAGCTGCTGCGGAGGTGGAGGGATATGGTGCTTCAAAGCTTACTGTTGATTCAGCTGTGAAATATTTGCAGCTTGCTAACAAACTTTTTTCTCAAGCTGAGCTCTATCACTTTTGTGCTAGCATTCTAGAATTGGTAATACCAGTGTACAAAAGCAGAAGGGCATATGGGCAGCTAGCCAAATGTCACACAATGCTAACCAGTATTTATGAATCTATCCTTGAACAAGAAGCAAGCCCAATTCCCTTTGCTGATGCTACATATTATAGGGTAGGCTTTTATGGTGAGAAATTTGGAAAGCTGGATCAAAAAGAATATGTATACAGGGAGCCCCGTGATGTACGGCTTGGAGACATCATGGAAAAGCTTAGCCATACATATGAATCCAGGATGGATGGTAATCACAGACTTCATATTATTCAAGATTCTAGGCAAGTGAAGGCGGAGGAGTTGCAGCCTGGTGTCTGTTACTTGCAGATTACTGCTGTTGATCCTGTCATGGAAGATGAAGACTTGGGTAGTAGGAGAGAGAGGATATTTTCCCTATCCACTGGAAGTGTACGTGCTCGTGTGTTTGATCGATTTTTATTTGATACCCCCTTTACTAAAAACGGGAAGACTCAAGCTGGATTAGAGGATCAGTGGAAACGGCGTACAGTTCTTCAAACAGAAGGCTCGTTTCCTGCTCTTGTTAACAGGCTTTTGGTGATAAAATCTGAATCTATGGAGTTCTCTCCTGTGGAAAATGCGATTGGAATGATTGAAACTCGGACAGCTGCACTTCGAAATGAACTTGAAGAACCTCGAAGCTCTGAAGGGGACCAGTTACCACGTTTACAGAGCCTGCAGAGAATATTGCAAGGCAGTGTGGCAGTTCAAGTAAATAGTGGAGTGTTGAGTGTGTGTACTGCTTTTCTATCAGGTGAGCCTGCAACTAGGCTTCGTTCGCAGGAACTGCAGCAACTCATTGCTGCACTTCTTGAATTTATGGCTGTTTGTAAGAGGGCAATTAGAGTACACTTCAGGTTGATTGGAGAGGAAGACCAGGAGTTCCACACTCAGCTCGTAAATGGATTTCAATCACTTACGGCCGAGTTATCTCACTACATTCCCGCCATTCTTTCAGAGCTCTAA >Cla005494.g ATGCATCTTCTACATCGCCGAGATTCTACTCCCGCGTCTATCAAATGGCACAACAAGTTTGAGGAGAATTTGGAGCAATGGCCACATCTCAATGAGCTCGTGCAGTGCTATTCCACAGACTGGGTAAAGGATGAAAATAAGTACGGTCACTATGAGACTATCGGGCCCGTGTCCTTTCAGAATCAGATATACGAAGGCCCCGATACTGACATTGAGACTGAAATGCGGCTTACTTATGCTAGGCGCACAAAGCCTGATGATACTACAGAGGATGATGTACCTAGTACCTCAGGAAGGCCAGAGTCTACAACATATGATCCATTGTTATCGAATGTTCCAAAGCAGATTGGTCCTTCTCCTCTTCCAGCTTACGAGCCAGCTTTTGATTGGGAAAATGAAAGGTCGATGATATTTGGCCAGAGGATACCAGAAACTCCTGTAACACAGGAGAGAAGAGAAAAATTGTCTGAGGATTTCCATTTTCGCATTGTACCGAAAGAAATGCAGGATCCTAAAATATCATTTGAACCGCGTGGAATTTTCTATTTGGAGGCTCCATCAGCATCAGTCTGTCTTTTTATTCAGTTAGAGAAACATGCCACAGAAGAAGGAGGGGTTACTGCTTCTGTATATTCACGTAAAGAACCAGTGCATTTGAATGAAAGAGAAAAGCAAAAATTGCAGGTCTGGTCTCAAATCATGCCTTACAGAGAATCCTTTGCCTGGGCCATTGTTTCATTATTTGACAACAGCACTGGTGCAGCATCTGCTGGTTCTGCTTCCCCAAGCAGTCCTCTTGCTCCCAGCATAACTGGCTCTAGTTCCCATGAAGGTGTTTTTGAGCCTAGCACAAAGGTTACTGTAGATGGTAAGCTGGGTTACTCTAGTGGAAGCTCTGTAGTTGTTGAAATATCCAACTTAAATAAGGTTAAGGAAGGCTACACGGAAGATGCACTTCAGGATCCCAAACACAAGGTTCATAAACCTGTAAAAGGTGTTCTTAGGCTTGAAATTGAGAAGCACCAGATTTCCCATGCTGACAATGAAAACATGTCGGAGAGTGGTAGTGTGATCAGTGACTCTGTTGATATGGTGGACCGTCTGGTTGATTCCACATTTAAGAAGCTCCCTAATAATGGTTCTGATAGCCATCATCTTAGTGGCAGCTCGAAGTTAAATTTTTCTATCGGGAAAGAAATTTCTGGAAATGGATCATTTTCTCATGAAAATGCTGATACAAATGCAGATGATTTCCACGCATTTGACTTCCGCGTTATGATGAGGAATGAGCCATTCTTGCAGCTCTTTCACTGTCTTTATGTTTACCCCCTGACTGTTAGTTTGAGCCGCAAGCGGAACTTGTTCATTCGTATAGAACTTAGAGAGGATGATAGTGACCCACGCAGACAGCCTCTGGAGGCTATGTATCCCGTGGAGCTGGGTGCACCTCTTCAGAAGTGGGCTCACACTCAAGTTGCTGTAGGTGCAAGAGTTGCTTGCTACCATGATGAGATTAAACTCTCCCTCCCAGCTACCTGGACGCCAAAGCATCACTTGTTGTTTACTTTCTTCAATGTTGATATGCAAGCAAAACTAGAAGCTCCCAAGCCAGTGCCAATTGGATTTGCATCACTCCCCTTATCAACACATGCTCAGTTACGGTCTGAAATTTCTTTACCAGTAATGAGAGAGCTTGTTCCACATTACCTCCAAGATACAAACAGGGAGAGGCTAGATTACTTGGAAGATGGGAAGAACATCTTCAAATTGCGCTTAAGATTGTGTTCCTCCCTGTATCCCATCAATGAACGAATCAGGGATTTTTTCCTGGAATATGATAGGCACACTCTTCGAACAAGCCCTCCTTGGGGTTCTGAACTTTTGGAGGCTATTAACAGTTTGAAGAATGTTGATTCCACTGCGTTACTCCAATTCCTTCATCCTATTTTGAATATGTTGCTCCATCTCATTGGCAATGGTGGAGAAACCCTCCAGGTTGCGGCTTTTAGAGCAATGGTTAATATTGTTACTAGGGTGCAACAGGAATCAGCCGAAGATGGTGAAAGAAATCACTTTCTTGTTAACTATGTTGATTATGCTTTTGATGACTTTGGAGGTCGCCAGCCACCCGTATACCCTGGTCTGTCCACTGTCTGGGGAAGCTTGGCTAGGAGCAAGGCCAAAGGCTATCGTGTTGGACCAGTTTATGATGACGTTTTGGCTATGGCCTGGTTTTTCCTTGAGCTAATTGTCAAATCAATGGCACTGGAGAAAACTCGGCTTTTCTATCATAGCCTTCCATTAGGTGAAGACATTCCTCCAATGCAATTGAAAGAAGGTGTATTTAGATGCATAATGCAGTTGTATGATTGCCTTCTTACTGAAGTACATGAACGTTGCAAGAAAGGATTAAGCTTGGCTAAACGTTTGAATAGCAGTTTAGCATTCTTTTGTTATGATCTTTTGTCCATCATCGAACCTCGCCAAGTATTTGATTTGGTATCCTTGTACCTGGACAAGTTTTCAGGTGTCTGCCAATCAGTTCTGCATGACTGCAAGCTTACGTTTTTGCAGATCATATGTGATCACGACCTCTTTGTGGAAATGCCTGGAAGAGACCCTTCTGATAGGAACTACCTTTCATCTGTATTAATACAAGAACTTTTTCTTACTTGGGATCATGATGATTTACCCCTGCGGGCAAAGGCAGCTAGAATTTTAGTTGTTCTCTTATGCAAGCATGAATTTGATGCTCGGTACCAAAAGCCTGAAGATAAGCTGTACATTGCTCAGCTGTATTTTCCACTTATCGGGCAGATTTTAGATGAAATGCCTGTCTTCTATAACCTAAATGCCACAGAGAAGCGTGAAGTTTTGATTGTGATTTTGCAAATTGTGCGCAACTTAGACGATACGTCACTTGTCAAGGCATGGCAGCAAAGCATTGCTCGAACCAGATTGTTTTTCAAGCTCATGGAGGAATGCCTTATTCTTTTTGAGCATAGAAAACCTGCTGATGGCATGCTTATGGGATCCAGTTCTCGAAGCCCTGCTGCTGTCGGTGATGGACCTGGTTCCCCAAAATACTCTGACAGACTTTCACCTGCAATTAACAACTACCTATCTGAGGCATCGAGACAAGAATTCAGACCTCAGGGAACTCCTGATAATGGTTATTTGTGGCAGAGGGTGAATTCTCAGTTGAGCTCCCCAAATCAGCCATATTCCTTGAGAGAAGCACTAGCTCAGGCACAATCATCTAGGATTGGTGCATCTGCCCAAGCACTAAGGGAGTCACTGCACCCGGTATTAAGACAAAAATTGGAACTTTGGGAAGAAAACTTAAGTGCAGCAGTAAGTCTTCAGGTTTTGGAAATAACAGAGAAGTTCTCCTTGATGGCGTCATCCCATAGCATTGCCACTGACTACGGGAAACTTGATTGCATCACCTCCATCTTCATGAGCTTCTTCTCTAAGAATCAACCTTTGGCATTCTACAAGGCCTTATTTCCTGTCTTTAACAGTGTCTTTGATCTTCATGGTGCAACTTTAATGGCAAGAGAAAATGACCGTTTCCTAAAGCAAGTAACATTCCATCTTCTTCGGCTTGCAGTTTTTCGAAATGATAGCATAAGGAAAAGGGCAGTTACTGGGCTTCAGATACTTGTGAGGAGTTCTTTCTGTCACTTTATGCAGACGGCTAGATTGAGGGTCATGCTCATAATAACTTTGTCAGAGTTGATGTCTGATGTGCAAGTAACTCAGATGAAGGCAAATGGGACACTTGAAGAGAGTGGTGAAGCACAGCGTCTACGAAAATCCTTAGAAGACATGGCAGATGAATCGAAGAGTTCTAATCTGTTAAATGAATGTGGACTTCCTGAGAATGCTCTTGTCATAATTCCAGAAGCTTCTGCTGACAATAGGTGGTCCTGGTCAGAGTTGAAATATCTTTCTGACAGTCTCCTTCTGGCTCTTGATGCTAGTTTAGAGCATGCTCTTTTAGCCTCTGTGATGTCGATGGATAGATATGCTGCTGCAGAAGGTTTCTACAAACTTGCCATGGCATTCGCCCCTGTGCCTGATCTTCATATTATGTGGTTATTGCATTTATGTGATGCGCATCAAGAGATGCAGTCATGGGCAGAGGCTGCGCAGTGTGCTGTAGCCGTTGCAGCTGTGGTCATGCAGGCTCTCGTCGCTCGAAATGATGGTGTCTGGAGCAGAGATCATGTGACAGCTCTACGCAGAATATGTCCTATGGTCAGCAGTGAGATCACCTCAGAGGCATCAGCAGCTGAGGTGGAGGGATACGGTGCCTCTAAACTCACGGTCGACTCTGCTGTGAAGTACCTACAGCTCGCAAACAAGCTTTTCTCCCAAGCTGAGTTGTATCATTTTTGTGCTAGTATTCTGGAACTTGTAATTCCAGTTTATAAAAGCAGGAGAGCATATGGGCAACTGGCAAAATGTCACACCTTATTGACAAATATTTACGAATCAATCCTTGAGCAGGAATCAAGCCCAATCCCGTTTACTGACGCAACATATTATAGAGTGGGGTTCTATGGTGAAAAATTTGGGAAGCTGGACAGGAAGGAATACGTATATCGTGAGCCCCGTGACGTACGGTTGGGTGACATAATGGAGAAACTCAGTCATGTATACGAGTCTAGGATGGATGGCAGTCACACACTGCATATTATTCCAGACTCCAGGCAAGTGAAAGCAGAGGAGTTGCAGCCGGGCGTTTGCTACCTACAGATAACGGCAGTTGATCCTGTCATTGAAGATGAAGATCTGGGAAGTAGAAGAGAGAGAATCATTTCTCTATCCACTGGGAGTGTCCGTGCTCGTGTCTTTGACCGTTTCTTATTTGATACCCCATTTACCAAAAATGGAAGGACTCAAGGTGGACTAGAAGACCAATGGAAGAGGAGGACTGTTCTACAGACTGAGGGTTCCTTCCCAGCATTGGTAAATCGACTCTTAGTAACTAAGTCCGAATCGCTCGAGTTTTCCCCTGTGGAAAATGCAATTGGAATGATTGAAACTAGAACTGCTGCTCTGCGGAATGAACTGGAAGAGCCTCGCAGTTCTGAGGGCGATCAACTTCCACGACTCCAGAGTCTTCAGAGAATACTCCAAGGCAGTGTTGCAGTTCAAGTTAACAGTGGAGTCTTGAGCGTGTGCACTGCATTCTTGTCCGGTGAGCCAGCTACAAGGTTGCGGTCACAAGAGTTGCAGCAACTCATTGCTGCACTTCTCGAATTCATGGCTGTATGTAAGCGTGCAATTCGAGTTCATTTTAGATTAATCGGAGAGGAAGACCAGGAGTTCCACACCCAACTAGTGAATGGATTCCAGTCTCTCACCGCCGAACTATCGCATTACATTCCCGCCATTCTGTCTGAACTGTAA >Cc03_g11030 ATGAATGTCTTCTCTCGTAATCAACCCCTGGCATTCTGGAAAGCTCTGTTCCCTATGTTCAACAGTGTCTTTGAACTCCATGGAGCAACACTAATGGCAAGGGAAAATGATCGATTCTTGAAGCAAGTTGCTTTTCATCTTCTTCGTCTTGTAGTTTTTCGGAATGATAGTATCAGGAAAAGAGCTGTTACTGGCCTACAAATACTTGTCCGGAGCTCTTTCTCCTACTTCACGCAAACAGCTAGGCTAAGGGTCATGGTAACTATTACTCTTTCTGAATTGATATCTGAAGTTCAAGTGTCTCAGATGAAATCTGATGGAACACTTGAAGAAAGTGGTGAAGCGCTCTTAGAATATCATAATTCACTTGTCTCCGTTCCTCAAAATTTATCAGAGAACCATTGGTCCTGGACTGAGGTCAAATATCTTGCTGACAGCCTTCTTTTGGCTTTTGATGCTAGCTTGGAACATGCGCTTCTGGCATCTATTATGACTGTGGATCGATATGCAGCAGCAGAGGGCTTTTACAAACTTGCATTGGCCTTTGCTCCTGCAGGCGTTCCAGATCTTTATATAATGTGGTTACTGCATTTGTGTGATGCATATCAGGAGATGCAGTCTTGGGCTGAAGCTGCAACAAAAATTCTGGGGTTGCAGAAAGGCAGAGGGGAGAAGGTAGAGGGAAGAAGGAGAAGAATGTTGGTTTTTGTCCGTTGCAATCCATTAAAAAATGGCTCCATTTGA >Cc03_g16320 ATGGAGAGTTCTGCATCCAATGGCCACCGCTTCCGAAGGATTCCCCGGCAATCCTATGCTGCCTCTTTGAAGTTAGACCCCCTTCTTGACGAAAACTTGGAACAGTGGCCACATTTAAATGAACTTGTTCAGTGCTATCGAACTGACTGGGTGAAAGATGATAACAAGTACGGGCACTATGAAAGTATCGGCCCCATTCAATTCCACAACCAAATATTCGAAGGACCCGATACAGATATTGAAACAGAAATGCATCTTGCTAATGCTAGGCAAAGTAAGACTGAAGATTCAGCTGATGAAGAACTTCCTAGTACGTCTGGGATTCAACCTTCAGGATCTAGTATCCCGGAGTCATCGAATTTGCTACTACTGAAGCATTTCGGTGAATCCCCCCTACCAGCTTATGAACCCGTTTTTGACTGGGAGAATGAGCGATCTATGATATTTGGTCAAAGAAATCCAGAAACACACTTGCCTCAATATGCCAGTGGACTAAAGATCGCTGTGAAAGTTCTATCATTATCATTTCAAGCTGGACTTGTTGAGCCGTTTTATGGCACCATTTCTTTATATAATAGGGAGAGAAGAGAAAAACTGTCAGAGGATTTCAGTTTTCAACTGTCACCTCCAGAAATGCAAGATGCCAGCAGTTCTTCTGAACAGCGCGGTATTTTCCATCTAGATGCTCCATCAGCATCAGTTTGTCTGCTGATTCAATTAGAGAAACCTGCAACAGAAGAAAACGGGGTGACTCCTTCTGTTTATTCACGCAAAGAACCAGTGCACTTGACTGAAAGAGAGAAACAGAAGCTGCAAGTGTGGTCCCGGATCATGCCTTACAGAGAGTCTTTTGCTTGGGCCATCATTCCACTCTTTGATAGCAATATTACTGCACCATCTGGGGGTTCTGCTTCACCAGGCAGCCCCTTGACTCCTAGCATGTCAGGTTCAGGTTCTCAAGATCACGTTATGGAGCCAATCGCAAAGATTACTTCGGAAGGGAAGCTTAACTATACAAGTGCCGTGGTGGTTGAAGTTTCCAATTTGAATAAAGTTAAAGAAGGCTATACTGAGGACTCACTCCAGGATCCAAAGCGGAAGGTTCATAAACCTGTCAAGGGTGTCTTAAGATTGGAAATTGAAAAGCTCCAAGCCAGCTCTGTTGATTGGGAAAACACTTTGGAAAGTGGGCATACCATCTATGGGTCCGTTGAACATGTGGACCGGTTGAATGATCCCAGTATAACTAGATGCCCCAGCAATGGTTCTTATGGACCTCACTATGCCAGCTCTAAATCAATATCCTTTCAGGGGAAAGAGATGGCTCGAAATGGATCAATTGCTCAAAGTAACTTGGAATTTGCTGCCGACGATTTCCAAGCTTTTGACTTCCGTACAACAACAAGAAATGAGCCTTTCTTGCAGCTCTTCCATTGTCTTTATGTGTACCCTTTGAATGTTAGCATGAGTCGGAAAAGGAATCTGTTTATACGGGTTGAGCTGAGAAAAGATGATGTTGATATTCGTAAACCACCATTGGAGGCAATGCATCCAAGGGAACCAGCTGCATCACTTCAGAAATGGGCTCATACTCAAGTTGCGGTTGCAGCTAGGGTTGCTTGCTACCATGATGAGATTAAAGTTTCCCTGCCAGCCATTTGGACACCACTGCATCACCTATTGTTCACATTCTTTCATGTTGACCTTCAAACGAAACTGGAAGCGCCAAAGCCTGTTGTAATTGGATATGCTTCAGTTCCATTATCTACTCATGCTCAGTTCAGGTCTGAGGTTTCTTTGCCAATAATGAGAGAGTTGGTTCCACACTACCTTCAGGATACTGTTAAGGAGCGACTGGATTACTTGGAGGATGGGAAAAATGTATTCAGGCTTCGCTTGCGACTATGTTCATCATTATACCCCATTAGTGAGCGAATTAGAGATTTTTTTCTTGAGTATGACAGACACACTCTTCGAACTAGTCCACCTTGGGGATCCGAGCTACTTGAGGCTATCAACAGTTTGAAGAATGTGGATTCTACTGCCTTGCTTCAGTTTCTCCATCCTATACTAAATATGCTCCTCCATCTTATAGGCAATGGTGGAGAAACTCTCCAGGTTGCTGCCTTCAGAGCTATGGTTAACATTTTGACGAGGGTGCAGCAAGAATCAGTAGATGAAGCCGAAAGAAATGTTTATCTAGTGAACTATGTTGATTTTGCCTTTGATGATTTTGGTGGTCGTCAGCCGCCAGTATACCCTGGTTTATCTACAGTCTGGGGAAGCCTGGCTCGCAGTAAGGCGAAAGGCTACCGTGTAGGGCCGGTTTATGATGATGTTTTGGCAATGGCTTGGTTTTTCCTTGAACTGATAGTGAAATCAATGGCATTGGAGCAGACGCGACTGTACTATCACAATCTTCCCTCAGGTGAGGATGTCCCACCAATGCAATTGAAAGAAGGTGTTTTCAGGTGTATAATGCAACTATATGACTGCCTTATTACGGAAGTTCATGAGCGTTGCAAGAAGGGTTTAGGGTTGGCCAAATATTTAAACAGCAGTTTGGCTTTCTTTTGTTACGACCTCTTGTCTATCATAGAGCCACGACAAGTTTTTGAATTGGTATCTTTGTACCTGGACAAATTTTCTGGGGTTTGTCAAGCTGTGCTGCATGACTGCAAGCTTACTTTTCTACAAATTATATGTGACCATGATCTTTTCGTGGAGATGCCTGGGCGAGATCCTTCGGATAGGAATTACCTTTCTTCTGTCCTAATACAAGAAATTTTCCTAACGTGGGACCATGATGATCTGTCCATGCGGGCAAAAGCAGCTAGAATTCTGGTGGTCCTACTTTGTAAGCATGAATTTGACGTGCGTTACCAAAAGACTGAAGATAAGCTCTACATTGCCCAGTTATACTTTCCTCTTGTTGGCCAGATCTTAGATGAAATGCCTGTCTTCTACAATTTGAGTGCAATAGAAAAGCGTGAAGTATTGATAATTATTTTGCAAATAATACGCAATTTGGATGATGCCTCGCTTGTGAAGGCATGGCAACAAAGCATTGCTCGGACTAGATTATTTTTCAAACTTTTGGAGGAGGGCCTAGTTCATTTTGAGCACAGAAGACCTGCTGATAGCATGTTAATCAGCAATAGTTCTCGCAGTCCCGGACAGGAAAAACCTGCATCTCCAAAATATTCTGAAAGACTTTCACCAGCAATTAATCACTATCTATCTGAGGCAGCACGACACGAAGTGAGACCTCAGGGAACACCTGAAAATGGGTACTTGTGGCAAAGAGTCAATTCCCAGCTTAGTTCACCCAGTCAGCCATATTCTTTGCGGGAAGCTCTTGCTCAGGCACAGTCTTCCAGGATTGGTGCCTCTACTCAAGCGCTGAGGGAATCTTTGCACCCAATCCTAAGACAAAAACTGGAACTTTGGGAAGAAAACCTTAGTGCAGCCGTCAGTCTTCAAGTTCTGGAAATAGCTGAGAAATTTTCAAGAACTGCTGCATCCCACAGCATCGCAACTGATTATGCGAAACTTGACTGCCTGACTACTATATTTATGAATGTCTTCTCACGTAATCAACCCCTGGAATTCTGGAAAGCTCTCTTCCCTGTGTTCAACAGTGTCTTTGAACTCCATGGAGCAACACTAATGGCAAGGGAAAATGATCGATTCTTGAAGCAAGTTGCTTTTCATCTTCTTCGTCTTGCAGTTTTTCGGAATGACAATATCAGGAAAAGAGCTGTTATTGGCCTACAAATACTTGTCCGGAGCTCTTTCTCCTACTTCACGCAAACAGCTAGGCTAAGGGTCATGCTAACTATTACTCTTTCTGAATTGATGTCTGAAGTTCAAGTGACTCAGATGAAATCTGATGGAACACTTGAAGAAAGTGGTGAAGCTCGCCGTCTTAGAATATCGTTGAGGGAAATGGCAGATGAATCTAAGAGTCCTAACTTGTTAAATGATTGTGGTCTTCCAGATAATTCACTTGTCTCTGTTCCTCAAAATTCATCAGAGAACCATTGGTCCTGGACTGAGGTCAAATATCTTGCTGACAGTCTTCTTTTGGCTCTTGATGCTAGCTTGGAACATGCGCTTCTGGCATCTGTTATGACTGTGGATCGATATGCAGCAGCAGAGGGCTTTTACAAACTTGCATTGGCCTTTGCTCCTGTTCCAGATCTTCATATAATGTGGTTACTGCATTTGTGTGACGCGCATCAGGAGATGCAGTCTTGGGCTGAAGCTGCACAGTGTGCTGTTGCGGTTGCTGGTGTAGTAATGCAGGCCCTTGTGAGCAGGAACGATGGTGTCTGGAGCAATGAACATGTCAACGCCTTGCGCAAAATATGCCCAATGGTCAGCAGTGAGATAACTTCTGAGGCCTCAGCAGCAGAGGTAGAAGGCTATGGTGCCTCGAAACTTACAGTTGACTCCGCGGTAAAATATGTACAGCTTGCAAACAAGCTTTTCTCACAAGCTGAGCTCTACCATTTCTGTGCAAGCATTTTAGAACTTGTGATTCCAGTGTACAAAAGTAGAAGGTCATATGGACAGCTAGCAAAATGCCATACCATGTTAACCAATATCTATGAATCCATCCTTGAGCAAGAATCTAGTCCTATACCATTCACAGATGCCACATACTATAGGGTGGGATTCTATGGTGAAAAATTTGGGAGGCTAGATAGAAAAGAGTATGTTTACAGAGAACCCCGTGATGTCCGGCTGGGTGATATAATGGAGAAACTTAGTCATATATACGAGTCAAGAATGGGTGGAACCACGTTGCATGTCATTCCGGATTCTCGACAAGTTAAAGCTGATGAGTTGGAGCCTAGTGTTTGCTACCTTCAGATTACTGCTGTTGATCCGGTCATGGAAGATGAGGATCTCGGAAGCAGAAGGGAAAGAATATTTTCTCTTTCTACGGGAAGCATATGTGCCCGTGTCTTTGACCGTTTTTTGTTTGACACTCCTTTTACTAAAAATGGAAAGACCCAAGGTGGATTGGAAGATCAGTGGAAGCGCCGTACTGTTTTGCAGACTGAGGGCTCCTTCCCTGCCTTAGTTAATAGGCTTGTGGTTACTAAGTCAGAGTCACTGGAGTTTTCCCCAGTTGAGAATGCAATAGGAATGATTGAAACTCGAACTGCTGCATTACGTAATGAACTTGAAGAACCTCGCAGCTCTGAAGGCGATCAACTTCCAAGGCTTCAGAGTTTACAAAGGATACTTCAAGGCTCTGTAGCTGTTCAAGTGAACAGCGGAGTTCTGAGTGTATGTACAGCTTTCCTCTCTGGTGAGCCTGCAACAAGGCTGCGCTCACAGGAATTACAGCAACTAATTGCTGCCCTCCTGGAATTTATGGCTGTCTGCAAGCGAGCTATTCGGGTGCATTTTAGATTGATTGGAGAGGAAGACCAGGACTTCCACACGCAGCTTGTCAATGGGTTTCAATCACTTACTGCAGAATTGTCTCACTATATCCCTGCAATTCTTTCGGAACTCTGA >Gorai.008G189300 ATGGATGGCAACGTTGCTACCAATGGCAACGGGGGCGGTGGGTATCGCTTTCGGAGAATTCCTCGACATTCGCTCGCTCATCTCAAGCTGGATCCATTGCTTGATGACAATTTGGAGCAGTGGCCACATCTAACCGAACTCATTCAGTGCTACAAAAGCGATTGGATTAAAGATGATAACAAATATGGCCACTACGAAAGTATCAGTCCCGATTCATTCCAGAATCAGATATTTGAAGGTCCTGATACTGATATTGAGACTGAAATGCAGCTTGCCAGTGCTAGACAAATTAAGGCTGAAGATGCTAACGATGATGACTTGCCAAGTTCCTCAGGAAGGCAATTTCCCAACTCTAATGTTACCAAGCATTTTGGTCAGTCTCCTCTCCCAGCTTATGAACCTGCTTTTGACTGGGGAAATGAAAGGTCAATGATATTTGGCCAAAGGATCCCAGAAACCCCTACCACACACTATGGCAGTGGGTTGAAGATCTCTGTCAAAGTTCTGTCGCTTTCCTTTCAAGCTGGAATTGTTGAGCCATTCTATGGAACCATGTGCATATATAATCGGGAGAGAAGAGAAAAATTATCTGAAGATTTTTATTTTTCTGTTCTTCCAAGTGAAATGCAGGATGCTAAAGTGCCATTAGAACCTAGTGGGATATTCTATTTAGATGCTCCATCAGCATCAATCTGTTTGCTAATCCAGTTAGAGAAGCCTGCAACAGAAGAAGGCGGTGTAACCCCTTCAGTTTATTCACGTAAAGAACCGGTGCACTTGACTGAGAGAGAGAGGCAGAAGCTGCAGGTGTGGTCTCGTCTAATGCCTTACAGAGAGTCTTTCGCCTGGGCCATTGTTCCATTATTTGACAACAGCATCGCTGCAGCTTCTGGTGGATCTGCTTCTCCCAGCAGCCCTCTTGCTCCCAGCATGTCTGGTTCAAGTTCTCACGAGGGTGTATTTGAGCCCATTGCTAAGGTCACATCAGATGGGAAACTGGGTTGCGCAAGTGGTAGTTCTGTTATTGTTGAAATATCTAATCTAAAAAAAGTGAAGGAAAGCTATACCGAAGAGTCACTTCAGGATCCTAAACGAAAAGTACATAAACCTGTAAAAGGTGTTCTGAAATTGGAAATTGAGAAACACCAGACTGCTCTTACTGAGCTGGATAATATATCAGAAGGTGGCAGTGCGACAAATGATTCCCTGGATCCCGGGGAAGCAGTTGCTGATTTAATGTTTTCAAGGAGTCCTGGAAATGGTCTGGATGGACCTCAGACTAGCAACTCCAAGTGGATCGCAATTGATGGGAAAGAGGTTTCTGGAAATGGATCTAACAGTCATGGAAATCTAGATTTATGTGCAGATGATTTCCAAGCTTTTGACTTCCGCACAACAATGAGAAATGAGCCATTCTTGCAGCTTTTTCATTGCCTATATGTGTATCCATTAACTGTGAATTTGAGTCGGAAAAGGAATCTATTCATACAAGTTGAGCTAAGAAAGGATGATGCTGATGCTCGGAGGCAGCCCTTAGAGGCAATCCATCCAAGAGATCGTGGTTCATCACTCCTGAAATATGCTCACACACAAGTTGCTGTTGGTGCTAGGGTTGCCTGCTATCACGATGAGATTAAAGTTTCACTTCCTGCTGTCTGGACACCATCACATCACCTGTTATTTACTTTTTTCCATGTTGATCTTCAAACTAAACTTGAAGCTCCAAAACCAGTAGTTATAGGATATGCAGCACTTCCATTATCGACACATGCCCAATTGCGATCTGAAATTTCTTTACCGATAATAAGGGAATTGGTTCCACATTATCTGCTGGATTCTGGCAAGGAGAGGTTGGATTATTTGGAAGATGGAAAAAATGTTTTCAAATTGCGGTTAAGACTTTGTTCATCTCTATACCCGATTAATGAGCGCATCAGAGATTTTTTTCTTGAGTATGATAGACACACTCTTCGAACAAGCCCACCTTGGGGTTCTGAACTTTTGGAGGCAATTAACAGCTTAAAGAATGTTGATTCCACTGCTTTGCTTCAGTTTCTTCACCCGATTCTAAATATGCTTCTCCATCTTATAGGGAATGGTGGAGAAACCCTTCAGGTTGCTGCATTCAGAGCCATGGTTAATATCCTGACCAGGGTGCAGCAAGAGTCAGTTGATGATTCTGAACGAAATCGCTCTCTAGTTAACTATGTAGATTATGCTTTCGATGACTTTGGTGGTCGTCAACCCCCAGTTTATCCGGGCTTGTCTACTGTGTGGGGTAGCTTGGCTCGTAGTAAGGCTAAGGGTTATCGTGTTGGACCAGTGTATGACGATGTGCTGGCAATGGCTTGGTTTTTTCTTGAGCTAATTGTTAAGTCAATGGCATTGGAGCAAACACGTCTGTTCTATCATAGCCTTCCATTAGATGAAGATGTTCCCCCGATGCAGTTGAAAGAGGGTGTGTTCAGATGTATAATCCAACTGTATGATTGCCTTCTAACTGAAGTTCATGAGCGTTGTAAGAAAGGGCTAAGCTTGGCGAAACGATTGAACAGCAGTCTGGCATTCTTTTGTTATGATCTTTTATCCATTATTGAGCCTCGCCAAGTTTTTGAATTGGTGTCCTTGTATCTGGACAAGTTTTCTGGGGTATGTCAATCAGTTCTGCATGATTGCAAGCTAATTTTTCTGCAGATAATATGTGATCATGATCTTTTTGTGGAAATGCCTGGGAGAGACCCCTCAGACAGGAACTATCTTTCATCTGTCTTGATTCAAGAGCTTTTCCTCACTTGGGATCACGATGATTTATCTCAGCGTGCTAAGGCAGCTAGAATTTTGGTGGTTGTTTTATGTAAGCATGAGTTTGATGCTCGGTACCAAAAACCTGAAGACAAGCTGTATATTGCTCAACTATATTTTCCCCTCATTGGCCAGATTCTAGATGAAATGCCCGTATTTTACAACTTAAATGCTGCCGAAAAGCGTGAAGTTTTGATTGTTATCTTGCAAATCGTGCGGAATCTGGATGATGCATCAGCTGTTAAGGCTTGGCAGCAAAGCATTGCTCGAACTAGATTATTTTTCAAACTCTTGGAGGAATGCCTGGTTCATTTTGAGCACCGAAAGCCTGCTGATGGAATGCTTATAGGAAGCAGTTCTCGCAATCCTGTGGGTGATGCACCTACATCACCAAAGTATTCTGATAAGCTTTCTCCTGCAATCAACAATTATTTATCTGAAGCATCAAGACAAGAAGTTCGACCTCAGGGAACTCCTGAAAATGGTTACTTGTGGCAGAGGGTGAATTCTCAGCTGAGCTCCCCTAGCCAGCCATATTCCTTGAGAGAAGCTCTGGCTCAGGCCCAATCTTCTAGGATTGGAGCTTCAGCCCAAGCACTTAGAGAATCTTTGCATCCAATTTTGCGACAAAAACTGGAGCTTTGGGAAGAAAACTTGAGTGCTGCTGTTAGTCTTCAGGTTTTAGAAATATCTGAGAAATTTTCTGCAATGGCAGCATCCCATAGCATTGCTACTGATTATGGAAAACTTGATTGTTTATCATCTATAATTATGAGCTTCTTTTCCCGAAATCAGCCACTGGTTTTCTGGAAAGCTTTTCTGCCTGTCTTCAACAATGTATTTGATCTTCATGGGGCAACACTAATGGCTAGGGAGAATGATCGTTTCTTAAAACAAGTTGCCTTTCATCTTCTTCGACTTGCAGTCTTTCGAAATGATAATATTAGGAAAAGAGCTGTTATTGGGCTTCAGATACTCGTGAGGAGTTCATTCTACTTCATGCAGACTGCAAGGTTGAGGGTAATGCTGACTATCACCTTGTCCGAGCTAATGTCTGACATGCAGGTGACTCAGATGAAGTCTGATGGGACACTTGAGGAAAGTGGTGAAGCACGAAGGCTTCGAAAATCTTTAGAGGAAATGGCAGATGAAGTCAAGAGCTCTGGCCTTTTGAAGGAATGTGGACTTCCTGAGGATGCTCTATTGGTAACTCCAGAAAGTTTTAAAGAGAACAGATGGTCCTGGTCAGACGTAAAATCTCTCTCTGGCAGCCTTCTTCTGGCCCTTGATGCTAGTCTGGAGCATGCACTGTTGGGCTCTGTAATGTCCATGGATAGATATGCAGCAGCAGAAAGCTTTTACAAGCTTGCAATGGCATTTGCCCCTGTCCCAGATCTTCACATAATGTGGTTGCTGCATTTGTGTGATGCACATCAAGAAATGCAGTCTTGGGCTGAAGCTGCACAGTGTGCTGTGGCTGTTGCCGGTGTTGTAATGCAGGCTCTTGTTGCTAGAAACGATGGTGTTTGGAGCAAGGATCATGTCACAGCCTTACGTAAAATTTGTCCTATGGTCAGCAGTGAAATCACATCCGAGGCATCAGCAGCTGAGGTTGAGGGATACGGTGCTTCGAAGCTCACTGTTGATTCTGCTGTTAAGTACCTACAACTTGCAAATAAACTTTTCTCTCAAGCTGAACTCTATCATTTCTGTGCAAGCATTTTGGAACTCGTTATTCCAGTTTATAAGAGCAGAAGAGCATATGGACAACTGGCTAAATGTCATACATTGCTCACAAACATCTATGAATCAATCCTTGAGCAGGAGTCAAGCCCTATCCCTTTCACTGATGCTACTTACTATAGGGTTGGGTTTTATGGTGAGAGATTTGGTAAGCTGGACCGGAAAGAATATGTTTACCGAGAACCTCGTGATGTGCGCTTGGGTGATATAATGGAAAAACTTAGTCATATATATGAATCTAGGATGGATGGTAATCATACATTGCACATTATTCCTGATTCCAGACAGGTGAAGGCAGAGGAGTTGCAGCCTGGAGTCTGTTACCTGCAGATAACAGCTGTTGATCCAGTAATGGAAGATGAAGATTTGGGAAGCAGAAGGGAGAGAATCTTTTCTCTTTCTACTGGAACTGTCCGTGCACGTGTTTTTGACCGCTTCTTATTTGACACTCCATTCACGAAAAATGGCAAGACCCAAGGTGGATTGGAAGACCAATGGAAAAGGAGGACTGTTCTTCAGACTGAGGGCTCATTCCCTGCACTTGTCAATAGGCTCTTGGTGATAAAATCTGAATCACTTGAATTTTCTCCGGTTGAGAATGCGATTGGAATGATTGAAACTCGAACAGCAGCCCTACGAAATGAGTTGGAAGAGCCTCGTAGTTCCGAAGGAGACCAACTGCCTCGTCTTCAGAGCCTGCAAAGAATTCTTCAAGGCAGTGTTGCAGTTCAAGTGAATAGTGGCGTTCTGAGTGTGTGCACAGCCTTCTTGTCTGGTGAACCTGCCACAAGGTTGCGTTCTCAGGAGCTACAGCAACTTATTGCTGCACTCCTTGAATTTATGGCTGTTTGCAAGCGGGCAATTCGTGTACACTTCAGACTAATAGGAGAAGAAGACCAAGATTTCCACACACAACTAGTGAATGGATTTCAATCTCTCACAGCAGAGCTATCTCATTACATCCCTGCAATTCTATCAGAGCTCTGA >C.cajan_36319.g ATGCTTCATCTCCGCCACCGCCGCGACTCCACGCCGGCCACCACGCGCTGGCGCAACACGTTCGAGGAGAATCTGGAGCAGTGGCCGCACCTCAACGAACTGGTCCATTGCTACACCACGGATTGGGTCAAAGATGAGAACAAGTACGGACACTACGACACCGTCGGAACGCCGTCGTTTCATAACCAGATATATGAGGGCCCCGATACTGACATTGAAACTGAAATGCGGCTTGCCGGGGCAAGGAGAACAAAGGGAGACGATGAGGATGACATTCCTAGTACTTCGGGAAGGCAGTTTACCGAAGGTGCAGATGGTGACTTGCTGCATTCGGATGTTCAGAAGCATATTGGTCAATCTCCTCTTCCTGCTTATGAGCCTGCGTTTGATTGGGAAAATGAGAGGGCGTTGATATTTGGACAAAGGATACCAGAAACTCCTCTATCACATGGAATGAAGATCTCTGTAAAAGTTCAGTCTTTACAATTTCAAGCAGGATTGGTTGAGCCCTTTTATGGTACAATTTGCTTATACAATAGGGAGAGAAGAGAAAAGTTATCGGAAGACTTTTACTTTCATGTCTTACCAACTGAAACGCAGGATGCCAAAATTCAATCTGAACCTCGTGCAGTCTTTTACCTAGATGTGCCATCTGCTTCAGTTTGTTTGTTAATCCAGTTGGAGAAGCATGCTACTGAAGAAGGCGGTGTTACTGCTTCTGTTTATTCACGTAAAGATCCAGTGCACCTGACTGAGAGAGAGAAGCAAAAACTGCAGGTGTGGTCTAAAGTCATGCCTTACAAAGAGTCCTTCGCATGGACCATGGTATCATTATTTGATAGCAGTATTGGTGCAGCTTCAGTAGGGCCTGCTTCCCCAAGCAGCCCTCTTGCTCCAAGTGTATCTGGTTCGAGTTCTCATGAAGGTGTTTTTGAGACTAGTGCAAAGATCTCTTTAGATGGAAAGATGAGTTACTCTAATGGAAATTCTGTGGTAGTTGAGGTTTCAAACTTAAATAAAGTCAAAGAAAGCTATACTGAGGAATCACTTCAGGATCCTAAACGTAAGGTGCACAAACCTGTCAAAGGTGTTTTGAGGCTGGAAATTGAAAAGCACCAGATTTCCCAAGCGGATTTGGAAAACATGTCAGAAAGTGGTAGTATTACTAATGATTCTGTTGACCCTGGGGATCGGATTGCAGATTCACTGTCTGGTAAGTATCCTAGTAATGGCTGTGATGATCCTCAGGGTAGCATCCTAAGGGTGGTATCTCCAGTTTCAGGAAATGGAACAACTCAACATGGAATTTCAGATTTTAATGCCGATGATTTCCATGCTTTTGACTTCCGCACTACAACAAGAAACGAGCCTTTTTTGCAACTTTTTCACTGCCTGTATGTGTATCCGTTGACTGTAAGTTTGGGTAGGAAAAGGAATTTGTTTATACGGGTTGAACTCAGGGAGGATGATGGTGATATTCGTAGGCAGCCATTGGAGGCAATATATCCTAGAGATCCAGGTCTAGATGCATCATTTCAGAAGTGGGGTCACACCCAAGTTGCTGCTGGGGCTAGGGTTGCTTGCTACCACGATGAAATTAAACTTTCCCTTCCTGCTACGTGGACGCCAAATCACCACCTTTTATTTACTTTATTTCATGTTGATCTGCAAACAAAATTGGAAGCTCCTAAGCCAGTGGTTATTGGATATACAGCACTTCCTTTATCATCCCATGCTCAGCTGCGGTCGGAAATAAATCTTCCAATTATGAGAGAATTGGTTCCTCATTATCTCCAGGATGCAGGACGGGAGAGATTGGATTATTTGGAAGATGGGAAAAGTGTCTTCAGATTGCGTTTAAGGCTATGTTCTTCTTTATACCCTATCAATGAACGCATTAGAGATTTCTTTCTTGAATATGATCGGCACACTCTTCGAACAAGTCCGCCATGGGGTTCTGAACTTCTGGAGGCCATTAATAGTTTGAAGAATGTTGATTCCACTGCTTTACTTCAGTTTCTTCACCCAATTCTTAACATGCTACTTCATCTTATTGGCAATGGTGGAGAAACACTACAGGTTGCTGCGTTTCGGGCCATGGTTAATATTGTAACCAGGGTGCAGCAGGAGTCAGTTGATGATGCTGAAAGAAATCATTTTCTAGTTAACTATGTTGATTGTGCTTTTGATGATTTTGGTGGTCGTCAACCACCTGTATATCCTGGGCTGTCCACTGTTTGGGGAAGCTTGGCACGGAGTAAGGCCAAAGGGTATCGTGTTGGACCTGTGTATGATGATGTTTTGGCTATGGCATGGTTTTTTTTGGAGCTAATTGTTAAATCAATGGCATTGGAGAAGACTCGCCTCTTCTATCACAGCCTTCCAATAGGTGAAGATATCCCCCCAATGCAGTTGAAGGATGGTGTATTCAGATGTATAATGCAGTTGTATGATTGCCTACTTACTGAGGTGCATGAGCGCTGTAAGAAGGGTTTAAGCTTGGCGAAACGCTTGAACAGTAGTTTGGCCTTCTTTTGTTATGATCTTCTATCCATTATTGAGCCACGGCAAGTTTTTGAGTTGGTATCATTATATCTTGACAAGTTCTCTGGTGTATGTCAATCGGTTCTTCATGAATGCAAACTTACCTTTTTACAAATAATATGTGATCACGATCTATTTGTGGAAATGCCTGGAAGGGACCCTTCAGATAGGAACTACCTTTCTTCAGTATTAATACAAGAACTCTTTATTACTTGGGATCATGAAGATTTGTCTCTTCGAGCAAAGGCAGCAAGAATTTTGGTAGTGCTCTTGTGCAAACATGAGTTTGATGTGAGATACCAGAAGCCTGAAGATAAGCTGTATATAGCACAGCTATATTTCCCACTTGTTGGACAGATATTAGACGAAATGCCTGTTTTCTACAACCTCAATTCTGTTGAAAAGCGTGAAGTTTCAATTGTAATTTTGCAAATAGTTCGAAACCTTGATGATGCATCACTTGTCAATGCATGGCAACAAAGCATTGCCCGGACTAGATTGTTTTTCAAGCTAATGGAGGAATGCTTGCTTCTATTTGAGCACAAAAAACCTGCTGATGGCATGTTACTTGGATCCAGTTCTCGCAACCCAGTAGGGGAGGCACCCACTTCCCCTAAGTACTCTGACAAGCTTTCTCCTGCAATCAACAACTATCTGTCTGAGGCCTCAAGGCAGGATGTCAGGCCTCAGGGAACACCAGATAATGGGTATTTATGGCAGAGAGTAAATTCTCAGTTAAGCTCTCCTAGCCAGCCGTATTCCTTGAGAGAGGCTCTAGCTCAAGCACAGTCTTCTAGGATTGGAGCTTCTGCTCAAGCATTGCGAGAATCTTTACATCCACTTTTGAGGCAGAAATTGGAACTTTGGGAGGAAAATTTGAGTGCCTCTGTCAGTCTTCAAGTTTTGGAGGTGACTGAGAAATTCTCCATGATGGCTTCATCCCATAGCATTGCCACTGATTATGGAAAACTTGATTGCATAACTACTGTATTCATGAGCTTTTTATCGAGAAATCAGCCATTGACTTTTTGGAAAGCATTTTTTCCTGTATTTAACAGTGTATTTGATTTACACGGGGCAACTTTGATGGCAAGGGAAAATGATCGTTTTCTAAAGCAAGTGACTTTCCATCTCCTTCGACTTGCAGTTTTCCGTAATGAAAACGTAAGGAAAAGGGCAGTTGTTGGGCTCCAAATACTTGTGAGGAGTTCATTTCATTACTTTATGCAGACAGCTAGACTGAGAGTCATGTTGATTATCACATTATCAGAGCTAATGTCTGATGTCCAAGTGACTCAGATGAGATCTGATGGAAGCCTAGAAGAAAGTGGTGAGGCACGGAGACTTAGGAAGTCTTTAGATGAAATGAAGGATGAAAGTAAAAATGCTTACCTGTTGAAGGAGTGTGGATTGCCTGAGAATGCTCTTGTAACCATACCAGAAAAAATGACAGAAAATAGATGGTCCTGGTCTGAGGTGAAATATCTCTCTGACAGTCTTCTTTTGGCCCTTGATGGTAGCTTGGAGCATGCGCTACTGGCCCCCATGATGACTATGGATAGGTATGCTGCTGCTGAAAGCTTCTATAAACTGGCCATGGCATTTGCCCCAGTCCCTGATCTTCACATAATGTGGTTGCTTCATCTATGTGATGCACATCAGGAAATGCAGTCATGGGCAGAAGCTGCTCAGTGTGCTGTTGCAGTTGCTGGAGTTGTAATGCAGGCCCTTGTTTCAAGAAATGATGGTGTTTGGAGCAAAGACCATGTTGCTGCTTTACGTAAGATATGTCCTATGGTCAGCAATGAGATCACGTCTGAAGCATCTGCTGCCGAGGTTGAGGGATATGGTGCTTCAAAACTAACTGTTGACTCTGCTGTGAAATACCTGCAGCTTGCTAATAAGCTCTTCTCACAAGCTGAGCTTTTCCATTTCTGTGCAAGCATTCTGGAACTTGTAATCCCAGTTTACAAGAGCAGGAGGGCTTATGGACAGCTAGCTAAATGTCACACTTTACTGACCAATATCTATGAATCAATTCTTGAACAGGAATCTAGTCCAATTCCTTTCACTGATGCAACGTACTACAGGGTTGGATTTTATGGTGATAGATTTGGGAAACTTGATAAAAAGGAGTATGTATATCGTGAGCCACGTGATGTACGTCTAGGTGACATAATGGAAAAGCTTAGTCACATATACGAGTCTAGAATGGATGGTAATCACACTTTGCATATTATTCCAGATTCTAGACAAGTGAAGGCAGAGGAGTTACAGCCTGGTGTCTGTTACCTTCAGATTACCGCTGTTGATCCTGTCATGGAAGATGAGGATTTAGGAAGTAGGAGGGAAAGAATTTTCTCTCTTTCTACTGGAAGTGTTCGGGCCCGCACTGAGGGTTCTTTTCCAGCTTTAGTAAATAGGTTATTAGTCATCAAATCCGAGTCTCTTGAATTCTCTCCTGTAGAAAATGCTATCGGAATGATTGAAACACGAACAGCTGCATTAAGAAATGAGCTTGAAGAGCCTCGAAGTTCTGAGGGGGATCAACTTCCAAGACTCCAGAGTCTACAAAGAATCCTCCAAGGCAGTGTTGCAGTACAAGTGAATAGTGGAGTCTTGAGTGTTTGCACAGCCTTCTTGTCTGGGGAGCCTGCGACAAGGTTGCGATCACAAGAACTTCAGCAACTCATAGCAGCCCTTCTTGAGTTCATGGCTGTTTGCAAACGTGCCATCCGCGTACATTTCAGATTGATTGGTGAGGAAGATCAGGATTTCCATACTCAACTTGTAAATGGATTCCAGTCCCTAACAGCTGAGTTATCACATTACATTCCTGCCATTCTCTCAGAGCTATGA >C.cajan_36329.g AAAAGGAATTTGTTTATACGGGTTGAACTCAGGGAGGATGATGGTGATATTCGTAGGCAGCCATTGGAGGCAATATATCCTAGAGATCCAGGTCTAGATGCATCATTTCAGAAGTGGGGTCACACCCAAGTTGCTGCTGGGGCTAGGGTTGCTTGCTACCACGATGAAATTAAACTTTCCCTTCCTGCTACGTGGACGCCAAATCACCACCTTTTATTTACTTTATTTCATGTTGATCTGCAAACAAAATTGGAAGCTCCTAAGCCAGTAAGTTCATTTATGTGTTCCACTGAATTCATTGTTTTTTCATTCCTGCCTTTATTGCTTGTGTCTGTACATATGGATTGTTTTGAATTGATTATGCTTTTTAATTTTTGA >C.cajan_36331.g AAAAGGAATTTGTTTATACGGGTTGAACTCAGGGAGGATGATGGTGATATTCGTAGGCAGCCATTGGAGGCAATATATCCTAGAGATCCAGGTCTAGATGCATCATTTCAGAAGTGGGGTCACACCCAAGTTGCTGCTGGGGCTAGGGTTGCTTGCTACCACGATGAAATTAAACTTTCCCTTCCTGCTACGTCGACGCCAAATAAGGTCCACATCCATAACTTAAAAGGTAGCTTAATCAACAAAAATTACAAGGAATTAATATAA >C.cajan_39504.g AAAAGGAATTTGTTTATACGGGTTGAACTCAGGGAGGATGATGGTGATATTCGTAGGCAGCCATTAGAGGCAATATATCCTAGAGATCCAAGTCTAGATGCATCATTTCAGAAGTGGGGTCACACCCAAGTTGCTGCTGGGGCTAGGGTTGCTTGCTACCACGATGAAATTAAACTTTCCCTTCCTGCTACATGGATGCCAAATCACCACCTTCTATTTACTTTATTTCATGTTGATCTGCAAACAAAATTGGAAGCTCCTAAGCCAGTAAGTTCATTTATGTGTTCCACTGAATTCATTATTTTTTCATTCCTGCCTTTATTGCTTGTGTCTGTACATATGGATTGTTTTGAATTGATTATGCTTTTTAATTTTTGA >Achn206301 ATGATTGGGTGGTGGATGGCGGTGGATGTTGTAATGGATTTGTTCCCACCCATGCAATTTTCAAATGACAGAGGTGAAGGGTTTGAGAGATCTGGGGGTGATGTAGGGTTAGAGTTCCAAAGAATTGACAACGGGGATGGTTTTGGGAAATTAAGGGCCATGGAAAACTTGTCATCCTATGGGAATCGTTTTCGGCGATTACCGCGTCAGTCCTTTGCTGCTAATCTGAACTTAGACCCTCTGTTTGATGAAAACTTGGAGCAGTGGCCACATCTGAACGAACTTGTTCAATGTTACAGAACTGACTGGGTAAAGGACGAAAACAAATATGGACACTATGATAGCATTGGTCCCATTTCATTTCAGAATCAGATATTTGAGGGGCCTGATACTGATATTGAAACAGAAATGCATCTTGCCAATGCCAGGCAGACTAAGATTGATGATGCCACTGATGATGAAATGCCTAGTACCTCGGGGAGGCAGTTTACAGAGGCTACCTTCTCTGACTCAGCGTGTTCAAAAGTCTCGAAGCATCTGGGTGAATCTCCTCTCCCTGCTTATGAACCTGTTTTTGATTGGGAAAACGAAAGGTCGATGATATTCGGGCAGAGGATTCCAGAAACTCATATGGCACAGTATGGCAGTGGATTGAAGATCTCTGTGAAAGTCTTATCGTTATCTTTTCAAGCAGGACTAGTTGAGCCATTTTATGGTGCAATTTGTTTATACAATAGGGAGAGAAGAGAGAAATTGTCAGAGGATTTCATCTTCCGTATGTTACCAGCCGAGATGCAGGATGCTAGAGGCTCTTGTGAATCTCGTGGCATTTTCTATTTGGATGCTCCATCAGCATCAGTTTGTCTTCTAATTCAGTTAGAGAAGGCTGCAACTGAAGAAGGCGGAGTTGCTCCTTCTGTCTATTCACGTAAAGAGCCCGTTCACCTGACAGAGAGAGAAAAGCAGAAACTTCAAGTGTGGTCTCGAATCATGCCTTATAGAGAGTCATTTGCCTGGGCCATTGTTCCACTATTCGACAACAGCATTGGTACTGCTTCAGGTGGATCAGCTTCTCCCAGTAGTCCTCTGGCTCCTAGCATCTCTGGGTCGAGTTCTCAAGAGGGTGTTTCAAAATCAAGTGCAAAGATCACATTGGATGGGAAGCCAGGATACTCGAATGGAAGCTCTGTCGTTGTTGAAATATCAAACTTGAACAAAGTCAAAGAAGGCTATACAGAAGACTCACTCCAGGATCCTAAACGCAAGGTCCACAAACCAGTGAAAGGTGTCTTAAGATTGGAAATTGAAAAGCTGCAAGCTGGCCCTGTTGACCTTGAAAATATTTCGGAAAGTGGCAGTGTGACCAATGATTTTGTTGACAATGGAGACCGATTAGCTGATTCCCCATTTACAAAATGCCCCAGTAATGGTTCTGATGGGTCTCGTACAGGTGATTCGAAGTGGAACTCCCTTGATGGGAAAGAAATTCAACGAAATAGATCAATTGCCCAAGGAAATTCAGATATCAATTCTGATGATGAACCAGGTGTGTTGCTTCAAAAATGGGCTCAGACACAAGTTGCTGTCGGGGCTAGGGTCGCTTGCTACCATGATGAAATTAAAGTTTCTCTCCCTGCTATTTGGACACCATCGCATCACCTTTTATTCACATTCTATCACATTGACCTTCAAACAAAATTGGAAGCTCCAGAGCCAGTAAGTCCTCTTGTGTTGGTATTTAATAATACCTGGGATGCCATCTTATTCTTTTGTGTTCCAGTTCCAGTTCTAGATATCCTAATACGCATAAGCTAA >Achn206321 ATGCAGTTGAAAGAAGGTGTTTTCAGATGTATTATGCAATTATATGATTGCCTTCTGACCGAAGTGCATGACCGTTGCAAGAAGGGATTGAGCTTGGCGAAACGTTTGAATAGCAGTTTGGCATTCTTTTGCTACGATCTTTTGTCTGTTGTTGAGCCTCGCCAAGTGTTTGAATTGGTGTCCTTGTACTTCGATAAGTTCTCTGGGGTATGCCAACCAGTTCTGCATGAATGCAAGCTTATATTTCTGCAGATCATATGCGACCATGATCTGTTTGTGGAAATGCCTGGACGAGATCCGTCAGATAGGAACTACCTTTCTTCTGTCTTAATACAAGAGCTTTTCCTTACATGGGATCATGATGACTTGTCTCAGCGAGCAAAAGCAGCTAGAATTTTGGTCTTTCTTCTTTGCAAGCATGAGTTTGACGCTCGATATCAAAAGCCTGAAGATAAGCTCTATATAGCCCAGTTATATTTTCCACTTGTTGGCCAGATTCTAGATGAAATGCCTGTCTTCTACAACCTAAATGCCAATGAAAAGCGTGAAGTTTTAATTGTAATTTTGCAAATTGTTCGCAATCTAGATGATGCATCGCTTGTGAAGGCTTGGCAGCAAAGCATTGCTCGAACCAGATTGTTTTTCAAGCTCTTGGAGGAATGCCTAATTCTATACGAGCACAGAAAACCAGCTGATAGCATGCTTGTGGGCAGTAGTTCTCGCAGCCCAGTTGGGGATGTACCTTCGTCCCCAAAGTACTCAGATAGACTTTCTCCTGCAATTAACCACTATCTGACTGAGGCTTCGCGGCAAGAAGTCAGAGAACTTTGGGAAGAAAATTTAAGTGCTGCTGTCAGTCTTCAGGTTTTGGAAATAACTGAGAAATTTTCCACGACTGGATCATCGCATAGCATTGCTACTGATTATGGAAAACTTGACTGCATCACAACCATATTTACGAGCTTCTTCTCACGAAGTCAGCCTTTGGCTTTTTGGAAAGCTTTGTTTGCTGTGTTCAACAGTGTGTTCAACCTTCATGGCGCAACACTACTGGCAAGGGAAAATGACCGCTTCTTAAAACAAATTGCTTTCCATCTTCTCCGGCTTGCAGTTTTCAGAAATTATAATATTAGGAAAAGGGCAGTTATTGGGCTACAAATACTTGTTCGGACAGCAAGGTTAAAGGTCATGCTGATTATTACATTGTCAGAGTTGTTGTCTGATGTGCAAGTGACTCAGATGAAGTCTGATGGGACACTTGAAGAAAGTGGTGAAGCACGGCGCCTCCGTAGATCATTGGAGGAAATGGCAGATGAATCTCAGAGCCATAAGCTGTTAAGTGAGTGTGGACTTCCTGAAAATGCACTTACTGAAGTATCAGAAACATCAGCAGAGAACCAGTGGTCATGGTCAGAGGTGAAATATCTTTCTGACAGTCTCCTTCTGGCTCTTGATGCTAGCCTGGAACATGCACTTCTGACACCAGTGATGAACATGGATAGATATGCAGCTGCAGAGAGCTTCTATAAACTTGCAATGGCATTTGCGCCTGTCCCAGATCTACACATAATGTGGCTATTGCATCTATGTGATGCACATCAGGAGATGCAGTCTTGGGCTGAAGCTGCACAGTGTGCCGTTGCTGTTGCTGGTGTCGTCATGCAGGCCCTTGTGAGCAGAAACGATGGCGTCTGGAGCAGGGATCACGTAACTGCTTTACGTAAAATATGCCCCATGGTCAGTAATGAGATAACATCTGAAGCCTCGGCAGCTGAGGTGGAAGGATATGGTGCTTCCAAGCTCACTGTCGACTCTGCCGTTAAATACCTCCAGCTTGCTAATAAGCTTTTCTCCCAAGCTGAACTTTACCATTTTTGTGCAAGTATTTTGGAGCTTGTAATTCCAGTTTATAAGAGCAGGAGAGCATATGAACAGCTAGCCAAATGCCACACAATGCTAACGAATATCTATGAATCAATCCTAGAACAGGAATCAAGCCCAATACCATTCACTGATGCCACATATTATAGGGTGGGATTCTATGGTGAAAGATTTGGGAAACTAGATAGAAAGGAATATGTATATCGTGAGCCTCGTGATGTAAGGTTAGGGGACATAATGGAGAAACTTAGTCATATATACGAGTCGAGGATGGATGCCAATCACACGCTGCATATAATTCCAGATTCGAGACAAGTCAAAGCAGATGAGTTGCAGCCTGGGGTTTGCTACCTGCAAATAACTGCAGTTGATCCAGTCATGGAAGATGAAGATCTAGGAAGCAGAAGGGAGAGAATATTCTCTCTTTCCACGGGAAGTGTCCGTGCACGTGTCTTTGACCGCTTTTTGTTTGATACGCCCTTTACCAAAAATGGCAAGACACAAGGTGGATTAGAAGATCAATGGAAGCGGCGGACAGTTCTGCAGACTGAGGGGTCTTTCCCTGCCCTGGTGAATCGTCTCTTTGTAATTAAATCAGAATCTCTTGAGTTCTCTCCTGTAGAAAATGCAATTGGAATGATTGAAACTCGGACAGCTGCATTACGAAATGAGCTTGAAGAACCTCGCAGTTCCGAAGGTGACCAACTCCCACGCCTCCAGAGTTTACAAAGAATACTTCAAGGATCTGTTGCGGTTCAAGTCAACAGCGGAGTCTTGAGTGTGTGCACGGCTTTCCTGTCGGGTGAGCCAGCGACAAGGCTACGTTCACAGGAGCTGCAGCAACTCATAGCTGCACTTCTTGAATTCATGGCAGTCTGCAAGCGCGCAATAAGGGTGCACTTTAGACTGATTGGGGAGGAAGACCAGGAATTCCACACACAGCTTGTCAATGGATTTCAGTCACTCACTGCAGAGCTCTCTCACTACATCCCCGCCATTCTTTCTGAGCTCTGA >ZJU.LOC107417911 ATGCTTCACCTACGGCCTCGCCGGGATTCTACTCCGGTTACTAGTAAATGGCACAACAAGTTTGAGGAAAATTTGGAGCAGTGGCCGCATCTGAAGGAGCTGGTACAATGCTATACAGCTGACTGGGTGAAGGATGAGAACAAGTATGGACATTATGAGGCTGTTGGTCCGGTTTCCTTTCAGAACCAGATTTACGAAGGCCCTGATACTGATATTGAGACTGAAATGTGTCTTGCTAGTGCAAGGCGAACAAAGGCTGAAGATACCACTGATGATGATGTCCCAAGTACATCAGGAAGACAATTTGCAGAGGCTACTGCCTCTGATTCATCACACTCAAATAATTTGAAGCATTTTGGTCAATCTCCCCTCCCAGCTTATGAACCGGCATTTGACTGGGAAAACGAAAGGGCAGTAATATTTGGTCAAAGGATTCCAGAGACTCCTATATCCCATGGATTGAAGATCTCTGTAAAAGTTCTGTCCCTATCATTTCAAGCAGGATTGGTTGAACCGTTTTATGGTACAATTTGCTTATACAATAGAGAGAGACGAGAAAAATTGTCCGAAGATTTCTATTTTCGTGTCATACCATCTGAAATGCAGGATGCAAATGTTTCTTTTGAATCTCGTGGAGTATTTCATTTAGATGCTCCATCGGCATCAGTTTGTCTGCTAATCCAGTTAGAGAAGCATGCCACTGAACAAGGCGGGGTTACTCCTTCCGTTTATTCTCGTAAAGAACCAGTGCACTTGACTGAGAGAGAGAAGCAAAAACTGCAGGTGTGGTCTCAAATAATGCCTTACAAAGAGTCCTTCGCGTGGGCTATTGTTTCATTATTTGATAACAGCATTGGTGCAGCTTCTGGTGGGTCTGCTTCCCCTAGCAGTCCTCTTGCTCCTAGTGTTTCTGGATCGAGTTCTCATGAGGGTGTATTTGAGCCTAGTGCAAAGGTCACGTTAGATGGGAAGCTGGGATATTCAACTGGAAGTTCAATTGTAGTTGAGATATCAAATTTGAACAAAGTTAAAGAAAGCTATACCGAGGACTCACTTTTGGATCCCAAACGGAAAATTCATAAACCTGTGAAAGGCGTTTTGAGACTGGAGATTGAGAAGCACCAGATTGACCATGCAGAGTTGGAAAATATATCAGAAAGTGGTAGTATGACTAATGATTCAGTTGATCCAGGAGATCGCATTACTGATCCTTCATTTGGAAAGCTCCCCAGTAATGGTTCAGATGTGCCACAAGGTAGCAACTCTAAATGGAATTCTCTCGATGCCAAAGAAATGTCTGGGAATGGATCAAATGTACATGGAAATTCAGATTTCGGTGCTGATGATTTTCAAGCTTTTGACTTCCGCACTACAACAAGAAATGAGCCTTTCTCGCAGCTTTTTCATTTCCTCTATGTTTATCCCTTGACTGTTAGTTTAAGTCGGAAGAAAAATTTGTTTGTTCGGGTTGAGCTTAGGGAGGATGATGCTGATATCCGTAGACAGCCGTTAGAGGTACTGTATCCAAGGGAGCCAGGAAGCTCACTTCAGAAGTGGGCTCATACGCAAGTGGCTGTTCAGGCTAGGCTGGCCTGCTACCATGATGAGATTAAACTCTCCCTCCCTGCTACTTGGGTGCCAACGCATCATCTTTTATTCACTTTCTTTGATGTTGAGCTTCAGACAAAATTGGAAGCACCAAAGCCAGTAGTAATTGGATATGCATCGCTGCCATTATCCACACATAATCAGTTGCGATCTGAGATTTCTTTACCGATTATGAAGGAGTTAGTTCCACATTATCTACAGGATACGTCCAGGGAGAGGCTTGATTTTTTGGAAGATGGAAAGAATGTCTTTAGATTGCGCTTGAGACTTTGCTCATCTTTATACCCCATTAATGAGCGCATTAGAGATTTTTTTCTTGAATATGATAGGCATACTCTTCGCACAAGCCCACCATGGGGTTCTGAACTTCTGGAGGCTATCAACAGTTTGAAGAATGTTGATTCCACTGCTTTGCTTCAGTTTCTTCATCCAATCCTGAGTATGCTTCTCCACCTAATAGGCAATGGTGGAGAAACCCTCCAGGTGGCAGCTTTCAGAGCGATGGTTAATATTGTTACCAGGGTGCAGCAGGAGTCGGTTGATGATGCTGAACGAAATCATTTTCTAGTTAACTATGTTGACTATGCTTTTGATGACTTTGGGGGTCGTCAACCACCAGTTTACCCTGGTTTGTCCACCGTTTGGGGAAGTTTGGCGAGAAGCAAGGCTAAAGGCTATCGTGTTGGACCAGTGTATGATGATGTATTGGCCATGGCCTGGTTTTTCCTTGAGCTTATTGTCAAGTCAATGGCATTAGAGAAGACTCGTCTTTTCTATCATAGTCTTCCATTAGGCGAGGATATCCCACCTATGCAACTCAAAGAAGGTGTGTTCAGATGTATTATGCAGTTGTATGATTGCCTGCTGACAGAAGTGCATGACCGTTGTAAGAAGGGTTTAAGCTTGGCAAAGCGTTTGAACAGCAGTTTGGCTTTCTTTTGTTATGATCTTCTGTCAATTATCGAACCTCGCCAAGTTTTTGAACTGGTGTCATTGTACCTGGACAAGTTTTCTGGAGTATGTCAATCTGTTCTACATGACTGCAAGCTGACATTTTTACAGATTATATGTGATCATGATCTTTTTGTTGAAATGCCTGGGAGAGACCCTTCAGATAGGAACTACCTCTCTTCTGTCTTAATTCAAGAGCTTTTCCTTACTTGGGATCATGATGATTTATCTCTTCGAGCAAAGGCAGCAAGAATACTGGTAGTTCTTTTGTACAAGCATGAGTTTGATGCTCGATACCAAAAGCCTGAAGATAAACTCTATATTGCACAGCTGTATTTTCCACTTATTGGCCAGATTCTAGATGAAATGCCGGTCTTTTACAACCTCAATGCTGTTGAGAAGCGTGAAGTTTTGATTGTTATTTTGCAAATTGTCCGGAATCTTGATGATGCATCACTTGTGAAGGCGTGGCAATTGAGCATAGCTCGTACTAGATTATTTTTCAAACTCATGGAGGAATGCCTAGTTCTTTTTGAGCACAGGAAACCTGCTGATGGCATGCTTATGGGCTGCAGTTCTCGCAGTCCTGTTGGGGATGGACCTGCTTCCCCTAAGTACTCTGATAGACTTTCTCCTGCAATAAACAATTATCTGTCTGAGGCGTCAAGACAAGAAGTTCGTCCTCAGGGAACACCTGAAAATGGTTATTTGTGGCAGAGAGTAAATTCTCAGTTAAGCTCCCCTAGTCAGCCATATTCGTTGAGAGAAGCTCTGGCTCAGGCACAGTCTTCAAGGATTGGAGCTTCTGCTCAAGCACTTAGAGAATCTTTACACCCGATTTTGCGGCAAAAACTGGAGCTCTGGGAAGAAAACTTAAGTGCTTCAGTCAGTCTTCAGGTTTTGGAAATAACTGAGAAATTTTCCACGATGGCAGCATCCAAAAGTATTGCTACTGACTATGGAAAACTTGATTGCGTCACAGCCATATTTACGAGCTTCTTCTCCCGAAATCAACCATTGACTTTCTGGAAAGCTTTGTTTCCTGTCTTCAACAGTGTTTTTAATCTTCATGGTGTGACTTTGATGGCAAGGGAGAATGATCGTTTTTTAAAGCAAGTCACTTTCCATCTTCTTCGACTTGCAGTTTTTCGGAATGACAGCATTAGAAAAAGAGCTGTCATTGGGCTGCAGATACTTGTTAGGAGTTCTTTCTACTACTTTATGCAGACAGCAAGGTTGAGAGTCATGCTGATTATTACATTGTCAGAACTGATGTCTGATGTACAAGTGACTCAGATGAAGTCGGATGGATCACTAGAAGAGAGTGGGGAGGCACGGCGTCTTAGAAAATCTTTGGAGGAAATGGCAGATGAAAGTAAGAGCCCCAATCTGTTGAGGGAGTGTGGACTTCCAGAGAATGCACTATTGGCAATTCCAGAAAAAATGACAGAGAACAGGTGGTCATGGTCTGAGGTGAAATATCTCTCTGACAGTCTTCTCCTTGCTCTTGATGCTAGCTTGGAACATGCACTTTTGGGCTCTTTGACGACTATGGATAGATATGCAGCTGCAGAAGGCTTCCATAAACTTGCGATGGCATTTGCCCCTGTTCCGGATCTTCACATAATGTGGTTACTACATTTATGTGATGCACACCAGGAAATGCAGTCTTGGGCTGAAGCAGCCCAGTGTGCAGTGGCTGTGGCTGGGGTTGTAATGCAGGCCCTTGTGGCAAGAAATGATGGTGTTTGGAGCAAAGATCATATAACTGCTTTACGTAAAATCTGCCCCATGGTAAGCAGTGAGATAACCTCTGAGGCATCCGCAGCTGAGGTAGAGGGATATGGTGCTTCGAAACTCACAGTTGACTCTGCTGTGAAATACCTGCAACTTGCAAATAAGCTTTTCTCTCAAGCTGAACTGTTTCATTTCTGTGCAAGCATTCTGGAGCTTGTTATTCCAGTTTATAAAAGTAGAAGGGCATATGGTCAACTTGCCAAGTGCCATACACTACTTACTAATATATATGAGTCAATTCTTGAGCAGGAATCAAGCCCAATTCCATTCACTGATGCCACCTACTATAGGGTGGGATTTTATGGTGATCGGTTTGGAAAGTTGGACAGGAAGGAATATGTATACAGAGAACCCCGTGATGTACGGCTAGGTGACATAATGGAGAAGCTTAGTCATATCTATGAATCTAGGATGGATGGTAACCACACTCTGCATATTATTCCAGATTCTAGGCAAGTAAAGGCCGATGAATTGCAGCCTGGAGTGTGCTACCTCCAGATAACTGCTGTTGATGCAGTCATGGAGGATGAAGATTTGGGAAGCAGAAGGGAGAGAATCTTTTCTCTTTCTACTGGAAGTGTACGTGCACGTGTCTTTGACCGTTTCTTGTTCGATACCCCGTTTACGAAAAATGGCAAAACTCAAGGTGGATTGGAAGACCAGTGGAAGAGACGGACTGTTCTTCAGACTGAAGGCTCATTCCCTGCGCTTGTTAATAGGCTCTTGGTTATTAAATCTGAATCACTAGAGTTTTCGCCTGTAGAAAATGCTATTGGAATGATTGAGACTCGAACAGCTGCTCTACGAAATGAGCTTGAAGAACCTCGCAGTTCTGACGGGGATCAACTCCCACGCCTACAGAGTCTACAGAGAATTCTTCAAGGCAGTGTTGCAGTTCAGGTCAACAGTGGAGTATTGAGCGTGTGCACTGCATTCTTGTCCGGTGAGCCTGCAACAAGGTTGCGGTCACAAGAACTGCAGCAACTCATCGCTGCACTCCTCGAATTCATGGCGGTATGCAAGCGTGCAATCCGGGTACACTTTAGACTAATAGGTGAGGAGGACCAGGAATTCCACACACAGCTTGTGAATGGGTTTCAATCATTAACCGCAGAGCTGTCTCATTATATCCCTGCGATTTTATCAGAGCTGTGA >Tp7g14850 ATGGAGAACAACAACCTTGGCCTTCGCTTTCGCAAGATTCCTCGCCAGCCTGTTGCTCTCCCTAAGCTCGATCCTTTGCTTGATGAAAATCTGGAACAGTGGCCGCATTTGAACCAATTGGTTCAATGCTACGGAACGGAATGGGTCAAGGATGTTAATAAATATGGACACTATGAGAATACTCGACCTGATACTTTCCAAAGTCAGATTTTTGAAGGACCTGACACAGATACTGAGACTGAAATCCGTCTTGCTAGCGCTAGGAGTGCAACATTGGAAGACGATGAAGCCAGCATTTCTGGGAGGCCGTTTTCTGATTCTGCATCCCCCAAGCACTTTGGGCAGCCTCCCCTCCCTGCTTATGAACCAGCTTTTGACTGGGAAAATGAAAGATCTATGATAGTTGGCCAGAGAACTCCAGAATCTCCTGCAGCAAGCTATTCCAGTGGATTGAAGATCTCTGTCAGAGTTTTGTCTCTAGCTTTTCAGTCTGGCTTAGTTGAACCATTTTTTGGCTCGATTTCATTGTACAATCAAGAGAGGAAAGAGAAACTCTCTGAGGAATTTTATTTCCGTATTTTGCCAACGGAAATGCAGGATGCTAAACTTTCATCTGAAAATCGTGGAGTGTTTTATCTAGATGCTCCATCTGCATCGGTTTGCCTGCTGATTCAACTAGAAAAAACAGCAACAGAGGAGGGAGGCGTTACATCATCTGTCTATTCCCGTAAAGAACCTGTGCACTTAACTGAAAGGGAAAAGCAAAAGTTGCAGGTCTGGTCCCGCATTATGCCTTACCGAGAATCTTTTGCCTGGGCAGTTGTTCCACTTTTTGATAATAATATCACCACAAACACTGGTGAATCTGCTTCCCCTAGCAGTCCTCTTGCTCCCAGTATGACTACGTCAAGTTCTCATGATGGTGTTTTTGAACCCATGGCAAAGATCACATCAGATGGAAAGCAAGGTCATTCAGGTGGAAGTTCTGTTGTAGTTGAAATATCTAATTTCAACAAAGTTAAGGAGAGCTACTCTGAGGAGTCAATTCAGGACCCTAAACGGAAGGTTCATAAACCTGTTAAAGGGGTTCTAAGATTGGAAATTGAGAAACATCGGAATGGACATGGCGACTTTGAAGATCTATCTGAGAATGGAAGTATCATAAATGATTCTCTTGATCCGACTGACCGCCTCGGTGACCTGACACTTATGAAGTGTCCCAGTTCTGGTTCTGGTGGACCCCACAGTAGCGGTTCCAAGTGGAATACAGAGGACGCAAAGGATGTTTCAAGAAACCTAACAAGCTCAAGTGGGAATCTTGACAATTGTAATTATGCTTTTGATTTCTGCTCTACAACAAGAAACGAGCCTTTTCTACATCTCTTCCATTGCCTTTATGTGTATCCTGTAGCTGTTACTTTGAGTCGGAAAAGGAATCCCTTTATCCGAGTAGAATTGAGAAAGGATGATGCAGATGTCCGAAAACAACCGCTTGAGGCAATATATCCAAGAGAGCCTGGTGTGTCACTCCAGAAGTGGGCTCATACGCAAGTTGCTGTTGGAGCTAGAGCTGCTAGTTACCATGATGAAATTAAGGTGTCTCTTCCTGCCACATGGACGCCATCACATCATCTGCTATTCACTTTTTTTCATGTTGATCTCCAGACAAAACTTGAAGCTCCAAGACCAGTAGTTGTTGGATATGCATCACTTCCGTTATCTACCTATATCCACTCACGGTCTGATATTTCTCTACCAGTAATGAGAGAACTGGTTCCCCACTATCTTCAGGAAACCACCAAGGAGAGGTTGGATTATTTGGAAGATGGGAAGAATATTTTTAAGTTGCGACTGAGACTTTGTTCATCGCTTTTTCCCACCAATGAACGTGTCAGGGATTTCTGTCTAGAGTATGATAGACATACTCTCCGAACAAGCCCTCCCTGGGGTTCAGAACTGTTGCAGGCAATTAACAGTTTGAAGCACGTTGACTCCACTGCCCTGCTTCAGTTTCTTTACCCAATTCTTAACATGCTCCTTCATCTTATTGGCAATGGTGGAGAAACTCTTCAGGTCGCAGCATTCAGAGCCATGGTGGATATTTTAACTCGGGTGCAGCAGGTGTCATTTGATGATGCTGACCGAAATCGTTTTCTGGTCACCTATGTTGATTATTCTTTTGATGATTTTGGAGGCAATCAACCACCGGTTTATCCTGGATTATCAAATGTATGGGGAAGTTTAGCTAGAAGCAAGGCTAAAGGTTACCGGGTTGGACCTGTATATGACGATGTTTTATCAATGGCGTGGTTTTTCCTTGAGTTAATTGTTAAATCAATGGCATTGGAGCAGGCACGTCTTTTTCATCACAATCTACCTTCAGGCGAGGATGTTCCACCCATGCAGCTCAAAGAAAGCGTTTTTCGATGTATCATGCAATTGTTTGATTGTCTCTTAACTGAAGTACATGAACGTTGTAAAAAGGGTTTAAGCTTGGCGAAACGTCTGAACAGCAGTTTGGCCTTCTTCTGTTATGATCTTTTATATATCATTGAACCCTGCCAGGTCTATGAACTGGTATCGTTATACATGGACAAGTTTTCTGGTGTTTGTCAATCTGTCCTACACGAGTGCAAGCTCACATTTTTGCAAATTATCTCCGATCATGATCTCTTTGTAGAAATGCCTGGCAGAGACCCATCAGACAGGAACTATTTATCATCCATCTTAATACAGGAGTTATTTCTCTCCCTGGATCATGATGAGCTCCCTCTGCGGGCAAAGGGTGCAAGAATTTTAGTGATCCTCTTATGCAAGCATGAATTTGATGCTCGGTACCAGAAAGCCGAAGATAAGCTGTATATTGCACAATTATATTTTCCTTTTGTCGGGCAGATTTTAGATGAAATGCCTGTTTTCTATAACCTAAATGCTACTGAAAAGCGTGAGGTTTTAATTGGTGTGTTGCAAATTGTTCGAAATCTGGATGACACATCACTTGTCAAGGCATGGCAGCAGAGCATTGCTCGTACAAGATTCACAAGAAAGCTGATAGCATCCTCGGGGGGGAACAATTCTCGGGGGCCTGTTTGTGAAGGAGGTGGATCACCAAAGTACTCCGAGCGACTTTCGCCTGCTATCAACAATTATCTGTCAGAGGCTTCCCGCCAAGAAGTCAGGCTAGAAGGAACACCTGATAATGGGTACCTGTGGCAGAGAGTTAATTCTCAGTTGGCCTCCCCTAGCCAACCTTATTCTCTAAGAGAAGCTTTAGCTCAAGCACAATCTTCGCGGATTGGAGCTTCAGCCCAGGCATTAAGAGAATCGCTGCACCCTATTTTGAGGCAAAAACTGGAACTTTGGGAAGAGAATGTAAGTGCCACTGTTAGCCTCCAGGTTTTGGAGATCACTGAAAAATTTTCGTCAATGGCAGCCTCTCACAACATTGCTACGGACTACGGAAAATTGGACTGCATTACTACAATATTGACGAGTTTCTTCTCCCGAAACCAGTCATTAGCCTTCTGGAAAGCCTTCTTTCCAATTTTCAACAGAATCTTTGATCTTCATGGGGCCACACTGATGGCCAGGGAAAATGATCGCTTCTTAAAACAGATAGCATTCCATCTTCTCCGGCTTGCTGTTTACCGAAATGACAGCGTCAGGAAAAGAGCCGTTATTGGTCTTCAAATATTAGTCAAGAGCTCGCTATATTTTATGCAGACTGCTAGGCTAAGGGCTTTGCTGACCATTACACTGTCAGAACTCATGTCCGATGTCCAGGTAACTCATATGAAAACAGATAATACATTGGAAGAGAGTGGAGAGGCAAGGCGGCTTCAACAGTCATTAAGCGAAATGGCTGATGAAGCGAAGAGTGTCACTTTGTTGAGGGAGTGTGGTCTTCCTGATGATACTCTGTTGATAGTTCCCGAGAAATTTACAGAAAACCGCTGGTCTTGGGCTGAAGTTAAACATCTTTCTGACAGCCTTGTTCTTGCTCTTGATGCGAGCCTTGGGCATGCCCTTTTGGGATCTGTGATGGCTATGGATCGATACGCTGCAGCAGAGAGCTTCTACAAACTTGGAATGGCGTTTGCTCCTGTTCCAGATCTTCACATAATGTGGTTGCTGCATCTATGTGATGCCCACCAGGAAATGCAGTCCTGGGCTGAAGCTGCCGAGTGTGCTGTGGCGGTTGCAGGTGTGATTATGCAGGCCTTGGTGGCTAGAAATGATGGTGTGTGGAGCAAGGATCATGTGTCTTCCTTGCGTAAAATTTGTCCCATGGTAAGTGGTGAATTTACGACAGAGGCATCTGCAGCTGAAGTCGAGGGTTATGGTGCTTCAAAGCTAACAGTTGACTCTGCCGTCAAGTATCTACAGCTTGCAAATAAGCTTTTTTCTCAAGCTGAGCTTTACCATTTTTGTGCAAGCATTTTGGAACTTGTTATTCCAGTTTACAAAAGCAGGAAGGCTTATGGGCAGTTGGCTAAGTGTCACACGCTACTTACGAATATATACGAGTCCATCCTTGACCAAGAATCAAACCCGATCCCGTTTATTGATGCCACGTATTACCGGGTGGGATTCTATGGGGAAAAGTTTGGGAAGTTGGACAGGAAAGAATATGTATACCGTGAACCACGAGATGTGCGGCTAGGGGATATAATGGAAAAGCTGAGCCATATATATGAATCAAGGATGGACAGCAACCATATTCTGCACATTATTCCAGATTCGAGACAAGTGAAGGCAGAAGAATTGCAGGCCGGAGTGTGCTACCTGCAAATTACGGCTGTTGATGCAGTCATGGAAGATGAGGATCTTGGGAGCAGAAGAGAGAGGATATTTTCTCTTTCAACTGGAAGTGTTCGAGCACGAGTCTTTGATCGGTTCTTGTTTGATACACCGTTTACAAAAAACGGTAAGACACAAGGTGGATTAGAAGATCAATGGAAGAGACGAACAGTGCTGCAGACGGAGGGCTCGTTCCCCGCACTTGTGAATAGGCTGTTGGTTACCAAATCTGAATCCCTTGAATTCTCGCCAGTGGAGAATGCGATCGGAATGATTGAAACCCGAACAACTGCTTTGAGAAACGAGCTAGAGGAGCCTCGGAGCTCGGACGGGGATCACCTACCACGGCTTCAGAGTCTGCAGAGGATTCTTCAAGGAAGTGTTGCAGTGCAGGTTAACAGTGGGGTCTTGAGCGTGTGCACAGCTTTCTTATCAGGTGAGCCTGCGACTAGACTGCGTTCACAGGAACTGCAGCAACTTATCGCGGCACTACTTGAATTCATGGCAGTTTGCAAGCGAGCCATAAGGGTTCACTTCAGGTTAATCGGAGAAGAAGACCAAGAGTTCCATACTCAGCTGGTCAATGGATTTCAGTCTCTTACCGCAGAACTCTCCCATTACATCCCTGCTATCTTGTCCGAACTTTAG >Ca_15757.g ATGCTTCAGCTTCGCCACCGTCGAGATTCTACTCCGGCCACCACTAGGTGGCGTAACAAGTTTGATGAGAATCTGGAGCAGTGGCCGCATCTCAATGAGCTTGTTCATTGCTACACTACGGATTGGGTTAAGGATGAGAACAAATACGGTCACTATGAAAGTATTGGAACGCCGTCGTTTCATAACCAGATATATGAAGGCCCCGACACTGACATTGAAACCGAAATGCGGCTTGCTGGTGCAAGACGAACGAAGGGTGAAGACATTAGTGAAGATGACATCCCTAGTACTTCAGGAAGGCAGTTTATGGAAGCTGCAGATGGTGAACATTCGGATGTTCCAAAGCATTTTGGTCACTCTCCTCTTCCTGCTTATGAGCCAGCGTTTGATTGGGAAAATGAGAGGTCATTGATATTTGGACAAAGGATACCGGAAACTCCTATATCACATGGAATGAAGATATCTGTGAAGGTTCAGTCTTTACAATTTCAAGCAGGATTGGCTGAGCCCTTTTATGGTACAATTTGCTTATACAATAGGGAGAGAAGAGAGAAATTATCGGAAGACTTTTACTTTCATGTCTTACCGACTGAAATGCAGGGTGCCAAAATTACCTGTGAACCTCGTGCAATTTTTTACTTAGACGTGCCTTCTGCTTCAGTTTGTTTGTTAATCCAGTTGGAGAAGCATGCTACCGAAGAAGGCGGAGTTACTCCTTCTGTTTATTCACGTAAAGATCCAGTGCATTTGACTGAGAGAGAGAAGCAAAAATTGCAGGTGTGGTCTCAAATCATGCCTTACAAAGAATCCTTCTCATGGGCCATTGTGTCATTATTTGATGGCAGTATTGGTGCAGCTTCGGCAGGGCCTGCTTCCCCAAGCAGCCCTCTTGCTCCAAGTGTATCTGGTTCAAGTACACATGAAGGTGTTTTTGAGACTAGTACAAAAGTCTCTTTAGATGGAAAGATGAGTTACTCAAATGGAAATTCTGTTGTGGTTGAGGTTTCAAACCTAAATAAAGTCAAAGAAAGTTATACTGAGGAATCACTTCAGGATCCCAAACGTAAAGTGCATAAACCTGTCAAAGGAGTTTTGAGACTGGAAATTGAAAAGCACCAGATTTCTCAAGCTGATTTGGAAACTATGTCAGAATGCGGCAGTGCAACCAATGATTCTGTTGATCCCGGGGATCGCATTGCAGATTCCATGTCTGGAAAGTATCCTAGTAATGGTTGTGATGATCCTCAGGGTAGTATCTCCAAGTGGAATTTCAGTGATGCGAAAGAAATTTTGGGCAATGGAACAAATCAACATGGAAACTCGGATTTTAATGCTGATGATTTCCATGCTTTTGACTTCCGCACTACAACGAGAAACGAGCCGTTTTTGCAACTTTTTCACTGCCTGTATGTGTATCCATTGACCGTAAGTTTGGGTAGGAAAAGGAATTTGTTTATACGGGTTGAACTCAGAGAGGATGATGGTGATATTCGCAGACAGCCATTGGAGGCAATTTATCCTAGAGATCCAGGTCTAGAGACATCATATCAGAAGTGGGGTCACACTCAAGTTGCAGTTGGGGCTAGGGTTGCTAGCTACCATGATGAAATTAAACTTTCCCTTCCTGCCATGTGGACACCAATGCACCACCTTCTATTTACTTTATTTCATGTTGATCTGCAAACAAAATTGGAAGCTCCAAAGCCAGTGGTCATTGGATATGCAGCTCTTCCTTTATCGTCACATGCTCAGCTGCGGTCGGAAATAAATCTTCCGATTTTGAGAGAGTTGGTCCCACATTATCTCCAGGATGCAGGACGGGCTATTAATAGTTTGAAGAATGTTGACTCTACTGCCTTACTTCAGTTTCTTCATCCAATTCTTAACATGTTGCTTCATCTTATTGGCAATGGTGGAGAAACACTCCAGGTTGCGGCTTTCCGGGCTATGGTTAATATTGTAACTAGGGTGCAGCAGGAGTCAGTTGATGATGCTGAAAGAAATCATTTTCTTGTCAACTATGTCGATTGTGCTTTTGATGATTTTGGGGGTCGTCAACCACCAGTATATCCTGGATTATCCACTGTATGGGGAAGTTTGGCACGAAGTAAGGCTAAAGGGTATCGGGTTGGACCTGTGTATGATGATGTTTTGGCAATGGCATGGTTTTTTCTGGAGTTAATTGTTAAATCAATGGCATTGGAGAAGACTCGCCTCTTCTATCATAGCCTTCCCATAGGTGAAGATATCCCACCAATGCAGTTGAAGGATGGGGTGTTCAGATGCATAATGCAGTTGTATGATTGCCTTCTCACCGAGGTGCATGAGCGCTGCAAGAAGGGTTTAAGCTTGGCAAAGCGCTTGAACAGTAGTTTGGCCTTCTTTTGTTATGATCTTCTATCAATTATTGAGCCACGACAAGTTTTTGAGTTGGTATCATTATATCTCGATAAGTTCTCTGGTGTATGTCAATCAGTTCTTCATGAGTGCAAACTTACCTTTCTACAAATAATCTGTGACCATGATCTTTTTGTTGAAATGCCTGGGAGAGATCCTTCAGATAGGAACTACCTTTCGTCTGTATTGATACAAGAACTCTTTGTTACTTGGGATCATGAAGATTTATCTCTACGGGCAAAGGCAGCAAGAATCTTGGTAGTGCTCTTGTGCAAGCACGAGTTTGATGTGAGATACCAAAAGCCTGAAGATAAGTTGTATATTGCTCAGCTATATTTGCCAGTTATTGGACAGATATTAGATGAGATGCCTGTTTTTTACAACCTGAATTCTGTTGAGAAGCGTGAAGTTTCCATTGTAATTCTGGAAATAGTTCGAAACCTTGATGATGCATCACTGGTCAAGGCATGCCAGCAAAGCATTGCCCGGACTAGATTGTTTTTCAAGCTCATGGAGGAGTGCTTACTTCTATTTGAGCACAAAAAACCCGCTGATGGCATGTTACTTGGCTCTAGTTCTCGCAACCCCATAGGGGAGGCACCTGCTTCCCCCAAATACTCTGAGAGACTTTCTCCTGCAATCAACAACTATCTATCTGAGGCCTCAAGGCAGGAAGTCAGGCCTCAGGGAACACCTGATAATGGATATTTATGGCAGAGAGTAAATTCCCAGTTAAGCTCTCCTAGCCAGCCATATTCCTTGAGAGAAGCTCTTGCCCAAGCACAGTCTTCTAGAATTGGAGCTTCTGCTCAAGCACTTCGTGAATCTTTGCATCCACTTTTGAGGCAAAAATTGGAACTTTGGGAAGAAAATTTGAGCGCTTCTGTCAGTCTTCAGGTCTTGGAAGTGACTGAAAAATTTTCCACCATGGCAGCAAAGCATAGCATTGCTACTGATTATGGAAAACTTGATTGCATCACAGCTGTATTCATGAGCTTTCTGTCTAGAAATCAACCGTTGTCGTTTTGGAAAGCATTTTTTCCGGTATTTAACAGTGTGTTTGATTTACATGGGGCAACTCTGATGGCAAGAGAAAATGATCGTTTTCTAAAGCAAGTCACTTTCCAGCTTCTACGGCTTGCAGTTTTCAGAAATGAAAACATTAGGAAAAGGGCAGTTGTTGGGCTTCAAATACTTGTGAGGTGTTCATTTCATTACTTTACGCAGACAGCAAGGTTAAGAGTCATGTTGATCATCACTTTATCAGAGCTAATGTCTGATGTTCAAGTGACTCAAATGAGATCTGATGGAAGCCTAGAAGAGAGTGGTGAAGCACGGAGACTTAGAAAATCTTTAGAGGAAATGAAGGATGAAACTAAAAGTTCTTTCCTGTTGGAGGAGTGTGGACTACTTGAGAGTGCTCTTGTAGCTATACCAGAAAAAAAGGCAGAGCATAAGTGGTCCTGGTCAGAGGTGAAATATCTCTCTGACAGTCTTCTTTTGGCCCTTGATGGTAGTTTGGAACACGCACTATTGTCGCCTGTGATGACTATGGATAGATATGCTGCTGCTGAAAGCTTCTATAAACTGGCAATGGCATTTGCCCCAGTCCCTGATCTTCACATAATGTGGTTACTTCATCTATGTGATGCACATCAGGAAATGCAGTCATGGGCTGAAGCTGCTCAATGTGCTGTCGCTGTTGCTGGTGTTGTAATGCAGGCCCTTGTTGCTAGGAAAGATGGTGTTTGGAACAAAGACCATGTTGCTTCTTTACGTAAGATTTGTCCTATGGTTAGCAATGAGATAACTTCTGAAGCATCCGCTGCAGAGGTAGAGGGATATGGTGCTTCAAAATTAACAGTTGACTCTGCTGTGAAATACCTGCAGCTAGCTAATAAGCTTTTTTCACAAGCTGAGCTTTTTCATTTCTGTGCAAGCATTCTGGAACTTGTAATCCCAGTTTACAAGAGCAGAAGGGCTTATGGACAGCTTGCTAAATGTCACACTCTACTTACCAATATCTATGAATCAATACTTGAACAGGAATCTAGTCCGATTCCTTTTACTGATGCAACATACTACAGGGTTGGATTTTATGGTGATAGATTTGGAAAACTTGACAAAAAGGAGTATATATATCGTGAACCTCGTGATGTACGTCTAGGGGACATCATGGAAAAACTTAGTCACATATATGAGTCCAGAATGGATGGTAATCACACTTTGCATATTATTCCAGATTCTCGACAAGTGAAGGCTGAAGAGTTACAGCCTGGTGTCTGCTACCTTCAGATCACCGCTGTTGATGCAGTCATGGAAGATGAGGATTTAGGAAGTAGAAGGGAGAGAATTTTCTCCCTTTCGACTGGAAGTGTTCGTGCTCGTGTGTTTGACAGATTTTTGTTTGATACCCCATTTACAAAAAATGGCAAGACTCAAGGTGGGTTGGAAGATCAATGGAAGAGACGCACTGTTCTTCAGACTGAGGGTTCATTTCCAGCTTTAGTAAATAGGCTACTGGTAATCAAATCTGAGTCCCTTGAATTTTCACCTGTGGAAAATGCCATTGGAATGATTGAAACACGAACAGCTGCATTAAGAAATGAGCTTGAAGAGCCTCGAAGTTCTGAAGGGGATCAACTTCCACGGCTCCAGAGTCTGCAAAGAATCCTCCAAGGCAGTGTTGCAGTACAAGTAAACAGTGGAGTTTTGAGTGTTTGCACAGCCTTCTTGTCTGGCGAGCCTGCTACAAGATTGCGGTCACAGGAACTACAACAACTTATAGCTGCCCTTCTTGAGTTCATGGCTGTTTGCAAACGAGCCATCCGGGTACATTTCAGATTGATTGGTGAGGAAGATCAGGATTTCCATACACAACTTGTAAATGGATTTCAGTCTCTAACTGCAGAGTTATCGCATTATATTCCCGCCATCCTCTCCGAGCTATGA >Peaxi162Scf01205g00167 ATGTTCAGGAATTATCTTTCATCTATCTTAATTCAAGAGATTTTCCTTACATGGGATCATGATGACTTATCAATGAGGGCAAAAGCTGCAAGAATCCTGGTGGTCCTCATGTGTAAGCACGAGTTCGATATTCGATACCAAAAGCAAGAGGATAAATTATATATTGCTCAATTGTATTTTCCCCTCGTTGGCCAGATACTGGATGAGATGCCTGTCTTCTACAATCTGAGTACAATTGAAAAGCGTGAAGTCCTGATTATCTTTCTGCAAATAGTGCGCAACTTGGACGATGCCTCACTTGTTAAAGCTTGGCAGCAGAGCATTGCCCGTACCAGATTATTTTTCAAACTCTTGGAGGAGTGCTTGATGCATTTTGAGCATAGGAAACCTGCTGATGGCATGCTTGTTGGTAGTAGTTCTCGTAGTGTGATAGGGGATGCACCTGCATCCCCAAAATATTCTGACAGACTTTCACCCGCAATAAATCACTATATGTCTGAGGCAGCACGGCAAGAAGTCAGAGGAACTCCGGATAATGGTTATTTGTGGCAGAGGGTCAACTCCCAATTAAGCTCGCCTAGTCAGCCATATTCTTTGAGAGAAGCGCTGGCTCAAGCCCAATCCTCCAGAATTGGAGCTTCAGCACTAGCATTAAGGGAATCTTTGCACCCAATCTTAAGGCAAAAGCTGGAACTTTGGGAAGAGAACCTGAGTGCTGCTGTTAGTCTTCAAGTTTTAGAAGTTTCTGAGAAATTTTCACGGACTGCTGCAACTCATAGCATTGCGACTGATTATGGAAAACTTGACTGTATCACATCCATATTTATGAATGTGTTCTCGCGTAATCAACCGCTCTCCTTCTGGAAAGCTCTCTTTCCTGTCTTCAACAGTGTCTTTGAACTTCATGGAGCTACGCTTATGGCAAGAGAAAATGATCGCTTCTTAAAGCAAATTGCTTTCCATCTTCTTCGGCTTGCAGTTTTTCGGAATGACAATATCAGGAAAAGGGCTGTCATTGGGCTGCAGATACTTATTCGGACAGCAAGATTAAGAGCCATGCTAACCATTACATTGTCAGAGTTAATGTCTGAAGTTCAAGTAACACAAATGAGACCTGATGGAACACTAGAAGAAAGTGGGGAAGCGCGTCGTCTTCGGAATTCTTTAGAGGAAATGGCAGATGAAGCTAAGAGTTCTTCCTTATTAGTGGAGTCTGGCCTCCCAGAAAATACACTGGTTGCTGTTCCAGAAGGATCGGCAGAAAACCGCTGGTCCTGGTCTGATGTGAAACTTCTTTCTGACAGTCTTCTTATGGCTCTTGATGCCAGCCTGGAACATGCTCTTCTGGGCTCTGTTATGAATGTCGATAGGTATGCAGCTGCAGAGAGCTTTTATAAACTAGCGATGGCATTTGCTCCTGTACCAGATCTTCACATAATGTGGTTACTGCATCTATGTGATGCTCATCAGGAAATGCAGTCTTGGGCTGAAGCTGCTCAATGTGCTGTTGCTGTTGCTGGTGTAGTGATGCAGGCCCTTGTGAGTAGGAACGATGGTGTTTGGAGCAAGGATCATGTGAGTGCACTACGCAAAATATGCCCCATGGTCAGCTGTGAGATCAGTTCTGAGACCGCAGCAGCTGAGGTGGAGGGATATGGTGCTTCGAAACTCACAGTTGACTCAGCTGTGAAGTATTTACAGCTTGCAAATAAGCTTTTCTCTCAGGCTGAATTGTTCCATTTCTGTGCAAGCATTCTGGAACTTGTAATTCCAGTATATAAAAGCAGAAAGGCATATGGACAGCTCGCAAAATGCCACACAATGCTTACTAATATCTATGAATCCATCCTTGAGCAAGAGTCAAGCCCAATACCTTTCACAGATGCCACATATTATAGAGTAGGATTTTACGGTGAGAAGTTTGGGAAGCTGGACAGGAAAGAATATGTTTATAGAGAGCCTCGTGATGTACGATTAGGTGACATAATGGAGAAATTGAGCCATATCTACGAGTCGAGAATGGATGGGACTACATTACATGTAATTCCTGATTCTAGACAAGTTAAAGCAGATGAGTTGCAGCCTGGAGTCTGCTACCTGCAAATAACTGCAGTTGATCCAGTGATGGAGGATGAAGATTTAGGTAGCAGAAGGGAAAGAATATTCTCTCTCTCTACGGGAAGTGTCCGTGCTCGAGTCTTTGATCGGTTTTTGTTTGATACCCCTTTCACTAAAAATGGAAAGACCCAAGGAGGCTTGGAAGACCAATGGAAGCGGCGAACGGTTCTGCAAACTGAGGGATCTTTCCCTGCGCTAGTGAATCGGCTGCTGGTTACCAAATCGGAATCACTTGAATTCTCCCCTGTTGAGAACGCAATTGGAATGATTGAAACCAGGACAGCTGCGTTAAGGAATGAACTTGAAGAGCCTCGAAGCTCAGAAGGGGATCAACTTCCCCGTTTGCAGAGTTTACAGAGGATTCTTCAAGGCTCAGTTGCAGTTCAAGTTAACAGTGGAGTCCTCAGCGTTTGCACAGCTTTCCTTTCTGGTGAGCCTGCAACTAGGTTGCGTTCGCAGGAGCTGCAACAACTTATTGCTGCTCTTCTTGAATTTATGGCTGTTTGCAAACGCGCTATTCGAGTACACTTTAGGTTGATCGGGGAAGAAGATCAGGATTTTCATACTCAGCTTGTAAATGGATTCCAGTCTCTTACTGCAGAACTATCACATTATATTCCTGCAATTCTTTCAGAGCTTTAG >Peaxi162Scf01205g00192 CTGGATGAAAATTTGGAGCAGTGGCCACATTTAAACGAACTTGTGCAATGCTATAGAACCGACTGGGTAAAAGATGAGAACAAGTATGGTCACTACGAAAGCATTAGCCCAGCTTCATTTCAGAGTCAGATATATGAGGGCCCTGATACTGATATTGAAACAGAGATGCATCTTGCAAATGCTAGACGACCTAAGATTGAGGATTCAATTGATGGTGAATTGCCGAGCACATCTGGTACACAACTCCCAGAAGCTAATTTCTCCGACTCAAATGTCAAAGTCCCAAAGCATATTGGTGAATCCCCCCTACCGACTTATGAACCAGTTTTTGATTGGGAAAATGAGAGGTCATTAATATTTGGGCAAAGGATTCCAGAAGCTCATATGTCCCAGTATACGAGTGGTCTGAAGATTGCCGTGAAAGTCCTATCATTGTCATTTCAAGCTGGACTTGTTGAGCCGTTTTATGGCACAATTTGTTTATATAATAGGGAGCGAAGAGAAAAACTTTCAGAGGATTTTATCTTTCATATATTGCCTACCGAAATGCAAGAAGGAAGCCGTTCCCCTGAAAGGCGTTGTATTTTTCATCTAGATGCTCCATCAGCATCAATTTGTCTGCTAATCCAGCTAGAAAAGCCTGCTACCGAAGAAGGTGGAGTGTCTCCTTCTGTTTATTCACGAAAGGATCCAGTTCATCTGACAGAGAGAGAGAAACAGAAACTGCAAGTATGGTCGCGGATTATGCCTTATAGGGAGTCCTTTGCCTGGGCCATCATTCCACTCTTTGATAGTAACATTACTTCTGTGGTTGGCTCTGCTTCTCCTAGCAGTCCTCTTGCTCCAAGCGTTTCAGCTTCAAGTTCTCAAGAGGGTATCACTGAGCCAGTTTCAAAAGTTACAGCGGATGGAAAGCTTGGTTATTCGAATGGAAACTCCATAGTGGTTGAGGTGTCTAACTTAAATAAAGTCAAAGAAGGATACACTGAGGAATCGCTCCAGGATCCTAAACGAAAGGTTCATAAACCAGTAAAAGGTGTCCTGAAATTGGAAATCGAAAAGCTGCCAGCTAGTTCTTCTGAAGTCGAGACTTTGGAGACTGGAAGTCTGATCTATGATTCTCTTGATCATGGGGACCATTTGACTGATTCTACTTCTATGAAGTGCCCTGCTAATGGCTCCTTTTCTAAGTCTAAATCCTTTGAGATGAAAGATCTTGTTCGGAATGGTTCAATTGCTCATGAAAATGTTGAAAGTACTGCTGACGATTTTGAAGCTTTTGACTTCCGCACGACGACAAGGAATGAACCTTTCTTGCAGCTGTTTCACTGCTTATATGTCTACCCCTTGACCGTTAGTATGAGTCGAAAAAGGAACATGTTTATACGTGTTGAACTGCGAAAGGATGATGCAGATATTCGAAAACCACCTCTAGAGGCTATGCATCCAACGGAACAAGGTCTACCACTTCAGAAATGGTCTCACACACAAGTTGCTGTTGGGGCAAGGGTTGCCAGCTACCATGACGAGATTAAAGTTTCTTTACCTGCTATTTGGACGCCATTGCATCACCTTTTGTTTACTTTCTATCACGTTGATCTTCAAACAAAACTTGAAGCCCCAAAGCCGGTGGTAATTGGATATGCTTCACTTTCATTATCAACACATGCACAGTTCAGATCTGAGGTTTCGTTGCCAATCATGAAGGAATTGGTCCCTCATTATCTTCAAGATAGTGGCAAGGAGAGGCTGGATTACTTGGAAGATGGCAAGAATATCTTCAAGCTGCGTTTACGTCTATGTTCATCACTGTATCCTGTTAGTGAGCGCATTAGGGATTTTTTCCTAGAGTATGATAGACATACTCTTCGGACAAGTCCCCCTTGGGGTTCTGAGCTACTTGAGGCAATCAATAGTTTGAAGAATGTTGATTCCACTGCTTTGCTTCAGTTTCTTTATCCAATCTTAAACATGCTTCTCCATCTTATTGGCAATGGGGGAGAAACTCTTCAGGTTGCTGCCTTTAGAGCTATGGTTAATATTTTAACAAGGGTGCAGCAAGAGTCGGTTGATGAAGCTGAGAGAAATGCTTTTCTAGTAAACTTTGTGGATTATGCTTTTGATGATTTTGGGGGTCGTCAGCCACCAGTCTATCCTGGTTTGTCCACAGTGTGGGGAAGTTTGGCTCGCAGTAAGGCCAAAGGGTACCGCGTTGGTCCAGTCTATGATGATGTCCTGGCAATGGCTTGGTTTTTTCTTGAGCTTATTGTCAAGTCGATGGCGCTGGAGCAGGCTCGATCCTTCTATCACAATCTTCCTTCTGGTGAAGATGTTCCTCCAATGCAATTGAAAGAAGGTGTTTTTAGATGTGTTGTTCAACTCTATGATTGCCTTTTGACGGAAGTTCATGAACGCTGCAAGAAAGGTCTAAGCTTGGCCAAGCATTTAAACAGTAGTCTGGCTTTCTTTTGTTACGATCTTTTATCCATCATTGAGCCTCGTCAAGTTTTTGAACTGGTATCCTTGTACCTTGATAAATTCTCTGGAGTGTGTCAAACAGTGCTACATGATTGCAAACTTACCTTTTTACAAATTATATGTGATCACGATCTTTTTGTTGAAATGCCTGGGCGAGATCCTTCTGAT >HBR2459G054 ATGGATAATAACACTGGTAACAATGGGGGGCAGCGTTTTCATAGAATATCTCGCCAATCTCTTGCTCGTCTCAAGTTGGACCCGTTGCTTGATGAAAATCTGGATCAGTGGCCTCATCTTAATGAACTTGTTCAATGCTATAGAACTGATTGGGTAAAGGATGAAAATAAGTATGGTCACTATGAAAGCATCGCTCCAGTATCTTTTCAAAACCAGATTTTTGAAGGGCCTGATACCGATATTGAGACAGAAATGCAGCTTGCGAATTCAAGACGAACTAAAGCTGAAGATACAGCTGATGATGACATTCCGAGCACCTCTGGAAGGCAATTTACAGAGGCCACTTCTGACTTGTCACTTTCACATGTTTCAAAGCATTTTGGTCATTCCCCTCTCCCTGCTTATGAACCAGCTTTTGACTGGGAAAATGAGAGGTCGATGATATTTGGCCAAAGGATTCAAGAAACTCCAATGGCGCCATATGGCAGTGGTTTCAGGGGATTGAAGATCTCTGTAAAAGTTCTTTCCCTTTCTTTTCAAGCAGGACTAGTTGAGCCATTTTATGGTACCATTTGCATATATAATAAGGAGAGAAGAGAAAAGTTATCGGAGGATTTTTATTTTTCTGTGCTGCCAACAGACACACAAGATGCAAAAATTTCATATGAACCTCATGGAATTTTCTATCTAGATGCTCCATCTGCATCAATTTGTCTGCTGATCCAGCTAGAGAAGCCTGCTACAGAAGAAGGCGGGGTTACTCCTTCGGTTTATTCACGTAAAGAACCTGTCCACTTGAGTGAGAGAGAGAAGCAGAAATTGCAGGTGTGGTCTCGAATTATGCCTTATAGACAGTCATTTGCCTGGGCGATTGTTCCATTATTTGATAACAGTGTTGGTGGAACTTCTGGAGGGCCTGCTTCCCCAAGCAGCCCACTTGCCCCAAGTGTATCTGGATCAAGTTCCCATGATGGTGTGTTTGAGCCCGTAGCAAACATCACACTGGATGGGAAATTGGGTTATTCAAGTGGAAGCTCGGTTGTTGTTGAAATATCAAACTTAAATAAAGTTAAAGAAAGTTATACTGAGGACTCTCTTCAGGATCCTAAACGCAAGGTTCACAAACCAGTCAGAGGTGTTCTCAGACTAGAAATTGAGAAGCACCAGACAGGCCATTCTGACTTGGAAAACCTATCCGAAAGTGGTAGCATGACCAATGAGTCCGTTGATCCAGGAGACCGAATTACTGATTCCACTCTTACAAAATGCCCTAGCAATGGCTCTGACCATCCTCAAACTAGCAGCTCCAAGTGGAATATCTATGATGGGAAAGAAATTTCTGGAAATAGTTCTAGTGGCCATGGAAACCCTGAGATGAATGCTGATGATTTCCAAGCATTTGACTTCCGTACAACAATGCGAAATGAGCCTTTCTTGCAGCTTTTTCATTGCTTGTATGTTTATCCTTTAAATGTTACTTTGAGTCGGAAGAGGAATTTGTTCATGCGAGTGGAACTAAGGAAGGATGATGCAGACGTTCGTAGACAGCCTTTGGAGGCAATGTATCCTAGGGAACCAGGAGCATCACTCCAAAAGTGGGCTCACACACAGGTTGCTGTTGGGGCTAGAGTGGCTTGCTTCCATGATGAGATTAAACTTTCCCTTTCTGCCATCTGGACACCGTTGCATCATCTCTTGTTCACTTTCTTCCATATTGATCTTCAAACAAAGTTGGAAGCTCCAAAGCCCGTGGTAATCGGATATGCAGCGCTTCCATTATCTACACATGCTCAGTTGAGATCTGAAATTTCCTTACCAATCATGAGAGAGCTGGTTCCACATTATCTCCAGGATATTGGCAAGGAGAGGCTGGATTATTTGGAAGATGGGAAGAATGTCTTTAGATTGCGCATGAAACTTTGTTCATCATTGTACCCTATAAATGAGCGCATTAGAGATTTTTTCCTTGAATATGATAGGCACACTCTTCGAACAAGTCCGCCTTGGGGTTCAGAACTCCTGGAGGCCATTAACAGTTTGAAGAATGTTGATTCCACTGCCTTGCTTCAGTTTCTTCACCCAATTTTAAACATGCTTCTCCATCTTATAGGCAGTGGTGGAGAAACTCTACAGGTTGCAGCCTTCAGAGCTATGGTCAATATCTTAACTAGGGTGCAGCAGGAATCAGTTGATGATGCTGAACGAAATCGTTTTCTTGTTAACTACGTTGATTATGCTTTTGACGACTTTGGAGGTCGTCAACCTCCAGTTTATCCTGGTTTGTCCACTGTGTGGGGAAGCTTGGCTCGTAGTAAGGCCAAAGGCTACCGAGTTGGGCCAGTATATGATGATGTTTTGGCAATGGCTTGGTTTTTTCTTGAGCTAATTGTGAAGTCAATGGCATTGGAGCAAACTCGCCTTTTCTATCATAGTCTTCCGCTAGGTGAAGATGTTCCACCAATGCAATTAAAAGAAGGTGTTTTCAGATGCATAATGCAATTGTATGATTGCCTTCTAACAGAAGTGCATGAGCGTTGTAAGAAGGGTTCAAGTTTGGCAAAACGCTTGAATAGTAGTTTGGCCTTCTTTTGTTATGATCTTTTGTCTATCATTGAACCTCGGCAAGTTTTTGAATTGGTGTCCTTGTACTTAGACAAGTTTTCTGGGGTATGTCAATCGGTTCTCCACGAATGTAAGCTAACCTTTCTTCAAATTGTGTGTGATCATGATCTTTTTGTGGAAATGCCTGGGAGAGACCCTTCAGATAGAAACTACCTTTCATCTGTTTTAATACAAGAGCTTTTCCTTACTTGGGATCATGATGATCTATCTCAGCGATCAAAGGCAGCAAGAATGTTAGTAGTTATCTTATGCAAGCATGAGTTTGATGCTCGTTACCAAAAGCCTGAAGATAAATTATATATTGCACAGCTATATTTTCCTCTTATTGGCCAGATCCTAGATGAGATGCCTGTCTTCTATAATCTGAATGCCGTTGAAAAGCGCGAAGTTTTAATTGTTATTCTGCAAATTGTGCGCAATCTGGATGAGACATCACTTGTCAAGGCATGGCAGCAAAGCATTGCACGAACTAGATTGTTCTTCAAACTTATGGAGGAATGCCTTGTTCTTTTTGAGCACAGAAAACCTGCAGATGGCATGCTCATGGGCTCTAGTTCTCGCAGCCCAGTCACAGATGGACCTTCTTCCCCCAAGTACTCTGATAGGCTTTCTCCTGCAATAAACAACTATCTGTCTGAGGCATCACGGCAAGAAGTTAGGACTCAGGGAACACCTGATAATGGATATTTGTGGCAGAGAGTGAATTCCCAGTTAAGCTCCCCTAGCCAGCCATATTCCTTGAGAGAAGCTCTTGCTCAGGCACAATCTTCAAGAATTGGAGCTTCAGCCCAAGCACTTAGAGAATCTTTGCATCCTATATTGAGACAAAAGCTGGAGCTTTGGGAAGAAAACCTGAGTGCAGCTGTGAGTCTTCAGGTGCTGGAGATAACTGAAAAATTTTCCATGATGGCAGCATCCCATAGCATTGCTACTGATTATGGAAAACTTGACTGCATTACAGCCATGTTTATGAGTTTCTTTTCTCGAAATCAGCCACTGGCTTTCTGGAAAGCTCTTTTTCCTGTCTTCTACAGTGTATTTGATCATCATGGGGCAACACTAATGGCAAGGGAAAATGATCGCTTTCTAAAGCAGGTTGCTTTCCATCTTCTACGGCTTGCTGTTTTCAGAAATGAAAGCATCAGGAAAAGAGCTGTTATTGGGCTCCAGATACTAGTGAGGAGCTCTTTCTTTATGCAAACAGCAAGATTGCGGGTCATGCTGACTATCACGTTGTCAGAGCTGATGTCTGATGTGCAAGTGACTCAGATGAAATCTGATGGAACACTGGAAGAGAGTGGTGAAGCAAGACGCCTTCGCAGGTCTTTGGAGGAAATGGCAGATGAATATAAGAGCACCAACTTATTAAGGGAATGTGGACTGCCTGAAAATGCATTGGTGGCAATTTTGGAAAGGTCTGCAGAAAATCGATGGTCCTGGTCGGAGGTGAAATATCTCTCTGACAATCTAATCCTGGCCCTTGATGCTAGCCTGGAACATGCACTTCTGGCTTCTGTGATGACTATCGATAGATATGCGGCTGCAGAGAGCTACTATAAACTTGCTATGGCATTTGCACCTGTTCCTGACCTTCACATAATGTGGTTGTTGCATTTATGTGATGCTCATCAGGAAATGCAGTCCTGGGCAGAAGCTGCACAGTGTGCTGTGGCTGTTGCCGGTGTTGTAATGCAGGCCCTTGTGGCTAGAAATGACGGTGTCTGGAGCAAAGATCATGTAACTGCTCTACGTAAAATTTGCCCAATGGTCAGCAGTGAGATCTCGTCTGAGGCATCTGCAGCAGAGGTGGAGGGATATGGTGCATCTAAGCTGACTGTTGACTCTGCTGTAAAATATCTACAGCTTGCAAATAAGCTTTTCTCTCAAGCTGAGCTCTTTCATTTCTGTGCAAGCATTCTGGAACTTGTAATTCCAGTTTATAAAAGCAGGAGGGCATATGGGCAGTTGGCTAAATGTCATACATTGCTCACTAATATCTATGAATCAATTCTTGAGCAGGAATCAAGCCCAATTCCATTCACTGATGCCACATACTATAGGGTGGGATTTTATGGTGAAAGATTTGGGAAGCTGGACAAGAAAGAATATGTATACCGAGAACCCCGAGATGTACGTCTAGGTGACATAATGGAGAAATTAAGTCATATATATGAATCTAGGATGGATGGGAATCACACTTTGCATATTATCCCTGATTCTAGACAGGTTAAGGCAGATGAATTGCAGCCTGGAGTCTGCTACTTGCAGATAACTGCTGTTGATCCAGTGATGGAAGATGAAGATTTAGGAAGTCGAAGGGAAAGAATTTTCTCTCTTTCCACTGGAAGCGTCCGTGCACGAGTCTTTGACCGGTTCTTGTTTGACACCCCATTTACAAAAAATGGTAAGACCCAAGGTGGCTTGGAAGACCAATGGAAGAGGCGGACTGTTCTTGAGACTGAAGGTTCTTTCCCTGCCCTTGTGAATAGGCTTTTGGTAATCAAATCTGAATCTATTGAGTTCTCCCCAGTAGAGAATGCAATTGGGATGATTGAAACTCGGACAGCTGCCTTGAGAAACGAGCTTGAGGAGCCTCGTAGTTCTGAAGGGGATCAACTCCCTCGCCTCCAGAGTTTGCAGAGAATTCTTCAGGGCAGTGTTGCAGTTCAAGTCAATAGCGGAGTTTTGAGTGTCTGCACAGCCTTCTTATCTGGCGAGCCTGCTACAAGGTTACGTTCACAAGAGCTGCAACAACTCATAGCTGCACTCCTAGAATTCATGGCTGTTTGTAAACGTGCCATACGTGTGCATTTTAGATTGATTGGTGAGGAAGACCAAGATTTCCACACTCAACTTGTGAATGGATTTCAGTCTCTTACAGCGGAATTATCCCATTACATCCCTGCAATTCTTTCAGAGCTCTGA >Potri.011G024000 ATGGATAATAGTAATAGTAACGGCAGCAGCGGGGGGCAGCGGTTCCGGAAAATACCTCGGCATTCTCAGTCCCTTTCTCATCTCAAGTTGGACCCGCTGGTAGATGAAAATTTGGAGCAGTGGCCACATCTTAATGAACTTGTTCAATGTTATAGAACTGATTGGGTGAAGGATGAAAACAAGTATGGTCATTATGAAAGTATCTCTCCAGTATCTTTTCAAAACCAGATTTTTGAAGGTCCGGATACTGATCTCGAGACAGAAATGCATCTTGCCAATTCAAGACGAAACAAGGCTGAAGAGACCACCGATGATGACATCCCAAGTACTTCAGGAAGGCAATTTGTGGAGGCCGCCTTCCCCGACTCATCAAATTCTGTTGTTTCAAAGCATTTTGGTGAATCTCCTCTCCCTGCATATGAACCAGCTTTTGATTGGGATAATGAGAGGTCGATGATATTTGGCCAAAGGATTCCTGAAACTCCATTGCCACATGGATTGAAGATCTCTGTGAAAGTACTGTCCCTATCATTTCAAGCAGGATTAGCTGAGCCATTTTATGGTACAATTTGCATATATAATAAGGAGAGAAGAGAAAAGTTGTCCGAGGATTTTTATTTTTCTGTGGTGCCAACAGACACACAAGATGCAAAAATTTCTCATGATCCTCGTGGAATTTTCTATTTAGATGCTCCTTCATCATCAATATGTTTGCTAATCCAACTAGAGAAGCCTGCCACAGAAGAAGGCGGGGTCACTGCCTCTGTTTATTCACGTAAAGAACCTGTGCACTTGAGCGAGAGAGAGAAGCAGAAACTGCAGGTCTGGTCTCGTATTATGCCTTACAAAGAATCCTTTGCCTGGACTATTGTTCCATTATTTGATAACAGTATTGCTGCGACTTCCGGGGGGGCTGCTTCTCCAAGCAGCCCTCTTGCTCCAAGTGTATCTGGCTCAAGCTCCCATGACGGTGTTTTCGAGCCTGTTGCAAAGATCACTCTGGATGGGAAGTTGGGTTATTCAAGTGGAAGCTCTGTTGTGGTTGAAATATCAAATTTAAATAAAGTTAAGGAAAGCTACACTGAGGACTCACTTCAGGATCCTAAACGCAAAGTTCATAAACCTGTCAAGGGTGTTCTCCGACTAGAAATTGAAAAGCATCAGACAGCCCATGCTGAGTTGGAAAATTTATCAGAAACTGGCAGTATAACCAATGATTCCATTGATCTGGGGGATCGTGTTGCTGATTCTGCATTTACAAAATCCCCTAGCAATGGCTTTGATGATCCTCAAACTAGTGGTTCGAAGTGGAATATCTTTGATGGGAAAGAAACATCTGGAAATATATCAAATGCTCGTGAAAATCCTGATTTCACTGCTGATGATTTTCAAGCTTTTGATTTCCGCACGACCACGAGGAACGAGCCTTTCTTGCAGCTTTTCCATTGCCTGTATGTTTACCCATTAACTGTCAGTTTGAGTCGGAAGAGGAATTTGTTCATTCGGGTTGAACTAAGGAAGGATGACGTGGATGTTCGTAGACAGCCTTTAGAGGCAATGCATCCCAGGGAGCCAGGAACATCGCTCCAAAAGTGGGCTCACACACAAGTAGCTGCTGGGACTAGAGTGGCTTGCTATCATGATGAAATCAAACTTTCTCTGCCAGCGATTTGGACACCATCCCATCACCTCTTGTTCACTTTCTTCCATGTTGATCTTCAAACCAAACTGGAAGCTCCAAAACCAGTGGTTATCGGATATGCAGTGCTTCCATTATCCACACATGCACAGTTGAGATCTGAAATTTCTTTGCCAATAATGAGAGAGCTGGTTCCACATTATCTCCAGGAAATGGGAAAGGAGAGGCTGGATTATTTGGAAGATGGAAAAAATGTCTTCAGATTGCGCTTGAGACTATGCTCATCTCTGTATCCCATTAATGAGCGCATTAGAGATTTTTTTATTGAATATGATAGGCACACTCTTCGTACTAGTCCACCTTGGGGATCTGAACTTCTTGAGGCCATTAATAGTCTGAAGAACGTTGATTCCACTGCTTTGCTTCAGTTTCTCCACCCAATTTTGAATATGCTTCTCCATCTTATTGGCAGTGGTGGAGAAACTCTCCAGGTTGCAGCCTTCAGGGCCATGGTTAATATCCTAACTAGGGTGCAGCAAGAGTCAGTTGATGATACTGAACGGAATCGTTTTCTGGTTAACTATGTTGATTATGCTTTTGATGACTTTGGTGGTCGTCAACCACCTGTTTATCCTGGTTTGTCCACTGTGTGGGGGAGTCTGGCTCGTAGCAAGGCTAAAGGCTATCGTGTTGGACCAGTATATGATGATGTATTGGCAATGGCATGGTTTTTCCTTGAGCTTATTGTCAAGTCAATGGCATTGGAGCAAGCTCGTCTTTTCTATCATAGTCTTCCATTGGGTGAAGATGTTCCACCGATGCAATTGAAAGAAGGTGTGTTCAGATGCATCATGCAGTTATATGATTGCCTTCTTACAGAGGTGCATGAGCGTTGTAAGAAGGGTTTAAGCTTGGCAAAACGTTTGAATAGCAGTTTGGCCTTCTTCTGCTATGATCTTTTGTCAATCATTGAACCTCGTCAAGTTTTTGAATTGGTGTCCTTGTACCTGGACAAGTTTTCTGGGGTATGCCAATCAGTTCTTCATGACTGCAAGCTTACCTTTTTGCAAATCATATGTGATCATGATCTTTTTGTGGAGATGCCGGGGAGGGACCCTTCAGATAGAAACTACCTTGCATCTGTTTTAATACAAGAGCTTTTCCTTACTTGGGATCATGACGAGCTATCTCAACGGTCAAAGGCAGCCAGAATCTTAGTAGTACTGCTTTGCAAGCATGAATTTGATGCTCGATACCAAAAGCCTGAAGATAAACTATATATCGCACAGCTATATTTTCCACTTGTTGGCCAGATCCTGGATGAGATGCCTGTCTTCTACAACCTGAATGCTGTTGAAAAGCGTGAAGTTTTAATTGTTATTTTGCAAATCATGCGCAATTTGGATGATACATCGCTTGTCAAGGCGTGGCAGCAAAGCATTGCTCGGACTAGATTATTTTTCAAACTCATGGAGGAATGCCTTGTTCTTTTTGAGCACAGAAAACCTGCTGATGGCATTCTTATGGGATCTAGTTCTCGCAGTCCTGTTGGGGATGGACCTGCTTCTCCCAAGTACTCCGATAGGCTCTCTCCAGCAATCAACAATTATCTGTCTGAGGCATCACGGCAAGAAGTCAGGCCTCAGGGTAAAACTGATAATGGATATTTGTGGCAGAGAGTGAATTCCCAATTAAGCTCCCCCAGCCAGCCATATTCCTTGAGAGAAGCACTTGCTCAGGCACAATCTTCCAGGATTGGAGCTTCAGCCCAAGCACTTAGAGAATCCTTGCATCCAATATTGAGACAAAAACTGGAGCTTTGGGAAGAAAACTTGAGTGCTGCTGTGAGTCTTCAGGTTCTGGAAATAACTGAGAAGTTTTCTATGATGGCAGCTTCCCATAGCATTGCTACTGATTATGGGAAACTTGATTGCCTCACAGCCATATTTACGAGCTTCTTCTCTCGAAATCAACCATTGTCTTTCTGGAAAGCTCTATTTCCTGTCTTTAACAATGTGTTTGATCTTCATGGGGCAACATTAATGGCCAGGGAGAACGATCGTTTCTTAAAGCAGGTTGCTTTCCATCTTCTTCGGCTTGCAGTTTTTAGAAACGAAAGTGTCAAGAAAAGAGCTGTTATTGGCCTCCAGATTCTTGTCAGGAGCGCTTTCTATTACTTCATGCAAACAGCAAGGTTGAGGGTCATGCTGACTATCACACTGTCAGAGCTGATGTCTGATGTGCAAGTGACTCAGATGAAGTCTGATGGAATGCTAGAGGAGAGTGGTGAAGCAAAGCGTCTTCGCAAGTCTTTGGAGGAGGTGGCAGATGAATTGAAGACTCCTGACCTACTACGGGAATGTGGAGTTCCTGAAAGTGCTCTGGTGGCAGTTCCAAAAAAGTTGGCAGACAATAGGTGGTCCTGGAGTGAGGTGAAATATCTCTCAGACTGCCTTATCCTGGCCCTTGATGCTAGCCTTGAACATGCACTCTTGGGTTCTGTAATGACTGTGGATAGATATGCGGCTGCAGAGAGCTTCTATAAACTAGCAATGGCATTTGCTCCTGTTCCTGATCTTCACATAATGTGGTTACTGCATTTATGCGATGCGCATCAGGAAATGCAGTCTTGGGCTGAAGCTGCACAGTGTGCTGTGGCTGTTGCTGGTGTTGTAATGCAGGCTCTTGTGGCTAGGAATGATGGTGTGTGGAGCAAAGATCACGTGATCTCTCTACGTAAAATTTGCCCAATGGTCAGCAGTGAGATCACTGCTGAGGCATCTGCAGCTGAGGTAGAGGGGTATGGTTCTTCAAAGCTCACAGTGGACTCTGCTGTAAAATATCTACAGCTTGCTAATAGGCTTTTCTCTCAAGCTGAGCTTTTTCATTTCTGTGCAAACATTCTGGAGCTTGTAATACCAGTTCATAAAAGTAGGAGGGCATATGGGCAGCTGGCTAAATGTCACACCATGCTTACTGATATCTATGAATCAATTCTGGAGCAGGAATCAAGCCCAATTCCGTTCACTGATGCCACATACTATAGGGTGGGATTCTATGGTGAAAGGTTTGGGAAACTAGATAGGAAGGAATATGTATACCGAGAGCCCCGTGATGTACGGCTAGGTGACATAATGGAGAAACTTAGTCATATTTATGAGTCTAGGATGGACGACAATCACACTTTGCATATTATTCCAGATTCTAGGCAAGTAAAGGCTGACGAGCTGCAGCCCGGAGTCTGCTACCTGCAGATAACTGCTGTTGATCCGGTCATGGAAGATGAAGATTTAGGAAGCAGAAGGGAAAGGATCTTTTCTCTTTCCACTGGAACTGTCCGGGCACGTGTCTTTGACCGCTTCTTGTTTGACACTCCATTTACAAAAAATGGTAAAACCCAAGGTGGATTGGAAGACCAATGGAAGAGGAGGACAGTTCTTCAGACTGAAGGCTCATTCCCTGCTCTGGTGAACAGGCTTTTGGTAATGAAATCTGAATCTCTTGAGTTCTCACCAGTCGAGAATGCAATTGGAATGATTGAAACTCGAACAGCTGCCTTACGAAACGAGCTTGAGGAGCCCCGCAGCTCTGAAGGCGATCAGCTTCCACGTCTCCAAAGTTTGCAGAGAATTCTCCAAGGCAGTGTTGCCGTTCAAGTAAACAGCGGCGTTTTGAGTGTCTGCACGGCCTTCCTGTCGGGTGAGCCTGCTACAAGGTTGCGTTCTCAAGAACTGCAGCAACTCATTGCTGCCTTGCTTGAATTCATGGCTGTTTGCAAGCGCGCCATTCGTGTACATTTTAGATTGATTGGAGAGGAAGATCAAGATTTCCACACGCAGCTTGTGAACGGATTTCAATCGCTCACTGCAGAGTTATCTCATTACATCCCAGCCATTCTTGCAGAACTATGA >Araip.59YT6 ATGCTCCATCTCCGGCAACGGCGGGATTCTACTCCGGCCACCACCAGGTGGCAAAACAAGTTCGAGGAGAATTTGGAGCAGTGGCCGCACCTCAATGAGCTTGTTCACTGCTACACCACTGACTGGGTCAAGGATGAAAACAAGTACGGCCACTACGAGAGCGTTGGAACGCCTTTGTTTCACAACCAGATATATGAAGGCCCTGACACTGATATTGAGACAGAAATGCGCCTTGCTGGGGCGAGACGAACAAAGGGTGAAGACATTAGTGAGGATGACGTCCCTAGTACTTCAGGAAGGCAGTTTATGGAGGCTGCAGAGGGTGACGTGCCCCATTCGGATGTCCCAAAGCATGTTGGTCAATCTCCTCTTCCTGCTTATGAACCCGCATTTGATTGGGAAAATGAGAGGTCGTTGATATTTGGACAAAGGATACCTGAAACTCCTATATCACATGGAATGAAGATCTCTGTAAAAGTTCAGTCTTTGCAATTTCATGCCGGATTAGTTGAGCCCTTTTATGGTACAATTTGCTTGTACAATAGGGAGAGAAGAGAAAAGTTATCAGAAGACTTTTACTTTTCTGTCTTACCAACTGAAATGCAGAATGCTAAAATTACATATGAACCACGTGCAGTATTTTATTTAGATGCACCATCTGCTTCAGTTTGCTTGTTGATCCAGTTGGAAAAGCATGCTACAGAAGAAGGCGGGGTTACTCATTCTGTTTATTCGCGGAAAGATCCAGTGCACTTGACTGAGAGAGAGAAGCAAAAACTTCAGGTGTGGTCTCAAATCATGCCATACAAAGAGTCCTTTGCGTGGGCCATGGTATCATTATTTGATAGCAGCACAGGTGCAGCTTCAGTGGGGCCTGCTTCCCCAAGCAGCCCTCTTGCTCCGAGTGTATCTGGTTCAAGTTCTCATGAAGGTGTTTTTGAGACTAGTGCGAAGATCTCCTTAGACGGGAAGCTGAGTTACTCAAATGGAAATTCTGTTGTAGTTGAGGTTTCGAACTTAAATAAAGTTAAGGAGTGCTATACTGAGGAATCACTTCAGGATCCCAAACGCAAAGTGCATAAACCTGTCAAAGGTGTTCTGAAGCTAGAAATTGAAAAGCACCAGATTTCCCAGTCTGATTTGGAGAATGTGTCAGAAAATGGCAGTACAACCAATGATTCTGTTGACCCAGGTGATCGTATTGCAGAATCATCTGGAAAGTATCCTGTTAATGTTGGTGATGATCCTCAGGGTAGTATCTCCAAGTGGAATTTCCATGATGGGAAAGACATTTCAGCAAATGGAGCAAATCAACATGGAAGCGCAGATTTTAATGCTGATGATTTCCATGCTTTTGACTTCCGCACTACAACAAGAAACGAGCCGTTTTTGCAACTTTTTCACTGTCTGTATGTGTATCCATTGACTGTAAGTTTGAGTAGGAAGAGGAATTTATTCATACGGGTTGAACTGCGGGAGGATGACGGTGATGTTCGTAGGCAGCCATTGGAGGCAATGTATCCAAGAGATCCAGGTCTTGATGCCTCATTTCAGAAGTGGGCCCACACCCAAGTTGCTGTTGGGGCTAGAGCTGCTTGCTATCATGATGAAATCAAACTTTCCCTTCCTGCCATGTGGACACCAACGCACCACCTTCTGTTTACTTTTTTTCATGTTGATATGCAAACAAAACTTGAAGCTCCGAAGCCAGTAGTGATTGGATATGCAGCACTTCCTTTATCGTCACATGCTCAGCTGCGATCAGAAATAACTCTTCCAATCATGAAAGAGTTGGTTCCTCACTATCTCCAGGATATGGGACGGGAAAGATTGGACTATTTGGAAGATGGTAAACATGTTTTTCGACTGCGTTTACGGCTATGTTCTTCTTTATACCCTATCAATGAACGCATCAGAGACTTTTTTCTTGAATATGATCGACACACTCTTCGAACAAGTCCACCTTGGGGTTCTGAACTTCTGGAGGCTATTAATAGTTTGAAGAATGTTGATTCCACTGCTTTACTTCAGTTTCTTCACCCAATCCTTAACATGCTGCTTCATCTTATTGGCAATGGGGGAGAAACACTCCAGGTTGCAGCTTTCCGTGCAATGGTTAACATTGTTACCAGGTATACCATTTATCTTTTGAAAGTTCTACTAGTCAACTATGTTGATTATGCTTTTGATGACTTTGGTGGTCGTCAACCACCAGTATACCCTGGTTTGTCCACTGTTTGGGGAAGCTTGGCTCGAAGTAAGGCTAAAGGCTACCGTGTTGGACCTGTGTATGATGATGTTTTGGCAATGGCATGGTTTTTTCTGGAGCTAATTGTTAAATCAATGGCATTGGAGAAGACTCGCCTCTTTTATCATAGTATTCCAATAGGAGAAGATATACCACCAATGCAGCTGAAGGATGGTGTGTTTAGATGTATAATGCAGTTGTATGATTGCCTTCTTACTGAGGTGCATGAACGTTGTAAGAAGGGTTTAAGTTTGGCAAAGCGCTTGAACAGTAGTTTGGCCTTTTTCTGTTATGATCTTCTATCCATTGTTGAGCCTCGTCAAGTTTTCGAGTTGGTATCATTATATCTCGATAAGTTCTCTGGCGTATGCCAATCAGTTCTTCATGAGTGCAAACTTACCTTTCTGCAAATCATTTGTGATCATGATCTATTTGTGGAAATGCCTGGGAGAGACCCTTCAGATAGGAACTACCTTTCTTCTGTATTAATACAAGAACTCTTTCTTACATGGGATCATGAAGATTTGTCTTTACGGGCAAAGGCAGCAAGAATCCTGGTAGTGCTGTTGTGCAAGCATGAGTTTGATGTGAGGTACCAGAAGCCTGAAGATAAGTTGTATATCGCTCAGCTATATTTCCCTCTAATTGGACAGATTTTAGATGAAATGCCTGTTTTCTACAACCTGAATTCTGTTGAGAAGCGTGAAGTGGCAATTGTGATTTTACAAATAGTTAGAAACCTTGATGATGGATCACTTGTGAAGGCATGGCAGCAAAGCATTGCCCGGACAAGATTGTTTTTCAAGCTCATGGAGGAATGCTTATTGCTATTTGAGCACAAAAAACCTGCTGATGGAATGCTACTTGGCTCCAGTTCTCGCAACCCTGTAGGGGAGGCACCTGCTTCCCCAAAATACTCTGATAGACTCTCTCCTGCAATTAACAGCTATTTGTCTGAGGCCTCTAGACAGGAAGTAAGGCCTCAGGGAACACCCGATAATGGCTATTTATGGCAGAGAGTGAATTCCCAGTTAAGTTCCCCCAGCCAGCCGTATTCTTTAAGAGAAGCACTAGCTCAAGCACAGTCTTCTAGGATTGGAGCTTCTGCTCAAGCACTCAGAGAATCTTTACATCCACTTTTGAGACAGAAATTGGAACTTTGGGAGGAAAATTTGAGTGCTTCCGTCAGCCTTCAGGTTTTGGAAATGACTGAAAAATTCTCCATGATGGCAGCCTCTCACAGCATTGCTACTGATTATGGAAAACTGGATTGCATCACTGCTGTATTCATGAGCTTTTTATCTAGAAATCAGCCACTGACATTTTGGAAAGCATTTTTTCCTATATTTAATTGTGTTTTTGATTTACACGGGGCAACTCTGATGGCGAGGGAAAATGATCGTTTTCTAAAGCAAGTCACTTTCCATCTTCTTCGGCTTGCAGTCTTCCGAAATGAGAACATCAGGAAAAGGGCAGTCGTTGGGCTTCAAATACTTGTGAGGACAGCAAGGTTGAGAGTCATGTTGATTATCACATTATCAGAGCTAATGTCTGATGTGCAAGTTACTCAGATGAGATCTGATGGAAGCCTAGAAGAAAGTGGTGAAGCACGGCGACTTAGAAAGTCATTGGATGAAGTGAAGGATGAGACTAAAAGTGCTTCCCTATTATATGAGTGTGGATTACCTGAGACTACTCTTCTAACCATACCAGATAAAATGACAGAGAATAGGTGGTCCTGGTCAGAGGTGACATATCTGTCCAACAGTCTTCTTTTGGCCCTTGATGCTAGTTTGGAGCATGCACTATTGGCCCCTGTGATGAGTATGGATAGGTATGCTGCTGCAGAAAGCTTCTATAAACTGGCAATGGCGTTTGCTCCAGTCCCTGATCTTCACATTATGTGGTTGCTTCATCTCTGTGATGCGCACCAGGAAATGCAGTCATGGGCTGAAGCTGCTCAGTGTGCAGTAGCTGTCGCTGGTGTTGTTATGCAGGCCCTTGTTGCCAGAAATGATGGTGTTTGGAGCAAAGACCATGTTGCTGCTTTGCGAAAGATTTGCCCTATGGTCAGCAGTGAAATCTCCTCAGAAGCCTCTGCAGCAGAGGTAGAGGGATATGGTGCTTCTAAACTGACAGTTGACTCTGCTGTAAAGTATCTTCAGCTTGCTAATAAGCTCTTCTTACAAGCTGAACTTTTCCATTTCTGTGCAAGCATTCTGGAACTTGTGATCCCAGTTTATAAAAGCAGGAGGGCATACGGACAGCTGGCTAAATGTCACACACTGCTTACCAATATCTATGAGTCAATAGTTGGACAGGAATCTAGTCCAATTCCATTTACTGATGCAACATACTACAGGGTTGGGTTTTACGGTGACAGATTTGGGAAACTCGACAAAAAAGAGTATGTATATCGCGAGCCTCGTGATATACGTCTAGGTGACATCATGGAAAAACTTAGTCACATATATGAGTCTAGGATGGATGGTAATCACACTTTACATATTATACCGGACTCTAGACAAGTAAAGTCAGAGGAGTTACAACCTGGTGTCTGCTACCTTCAGATTACTGCGGTTGATCCGGTCATGGAAGATGAGGATTTAGGAAGCAGAAGAGAGAGAATTTTCTCCCTTTCTACTGGGAGTGTGCGAGCTCGAGTCTTTGACCGGTTTTTGTTTGATACCCCCTTCACAAAAAATGGCAAGACTCAAGGTGGGTTGGAAGACCAGTGGAAGAGACGCACTGTACTTCAGACTGAGGGTTCATTTCCAGCTTTAGTAAATAGGCTTTTGGTAACTAAATCCGAGTCACTTGAATTCTCTCCTGTAGAGAATGCAATTGGAATGATTGAAACACGAACAGCTGCATTAAGAAATGAACTTGAAGAGCCTCGTAGTTCGGAGGGTGATCAACTTCCCAGACTACAGTCTCTACAGAGAATCCTGCAAGGCAGCGTCGCAGTACAAGTCAATAGCGGAGTCTTGAGTGTCTGTACTGCCTTTTTGTCTGGGGAACCTGCAACGAGGTTGCGATCACAGGAACTGCAGCAGCTTATAGCTGCACTTCTTGAGTTCATGGCTGTTTGTAAGCGCGCCATCCGAGTGCATTTCAGATTGATTGGCGAGGAAGATCAGGATTTCCACACACAACTTGTAAATGGATTCCAGTCTCTGACCGCGGAGTTATCACATTATATTCCAGCCATTCTTTCCGAACTCTAG >RCO.g.30024.000059 ATGGAGAATAGTGGCAGTAGCAGTGGGGGGCAGCGTTTCCGTAGAATACCTCGTCAGTCACTTGCTAGTCTCAAGCTGGACCCCTTGCTTGATGAAAATCTGGATCAGTGGCCTCATCTTAATGAACTTGTTCAATGCTATAGAACAGATTGGGTAAAGGATGAAACCAAGTATGGTCACTTCGAAAGCATTGCATCAGTATCTTTCCAAAACCAGATTTTTGAAGGGCCTGATACTGATATTGAGACTGAAATGCAACTTGCCAATTCAAGACAAGCTAAGGCTGAAGATATTACTTTTGATGACATCCCAAGCACTTCTGGAAGGCAATTTGTAGATGACTTGTCACAGCCACATGTTTCGAAGCATTTTGGTCATTCTCCTCTCCCTGCATATGAACCAGCTTTCGACTGGGAAAATGAGAGGTCAATGATATTTGGTCAGAGAATCCCAGAAACTGCAATGGCGCCGTTTGGCAGGGGATTGAAGATTTCTGTGAAAGTGCTGTCGCTTTCATTTCAAGCAGGACTTGTTGAGCCATTCTATGGTACTATTTGCATATATAATAAGGAGAGAAGAGAAAAGCTATCAGAAGACTTTTATTTTTCTGTGGTGCCAACAGACACGCAAGATGCGAGAATTTCGCATGAACCTCATGTAATTTTCTATTTAGATGCCCCGTCAGCGTCAATTTGCCTTCTGATTCAGCTAGAGAAGCCTGCTACAGAAGAAGGCGGAGTTACTCCCTCTGTTTATTCACGTAAAGAACCTGTACATTTGAGTGAGAGAGAGAAGCAGAAATTGCAGGTCTGGTCTCGGATTATGCCTTACAGACAGTCGTTTGCCTGGGCTATAGTTCCATTATTTGATAACAGTGTTGGTGCAACTTCTGGAGGACCTACCTCACCAAGCAGCCCACTTGCTCCAAGTGTATCTGGCTCCAGTTCTCACGAGGGTGTATTTGAGCCTATAACAAATATTACACTGGACGGGAAGTTGAGTTATTCAAGTGGAAGCTCAGTTGTTGTTGAAATATCAACCTTAAATAAAGTTAAAGAAAGCTATACAGAGGACTCTCTTCAGGATCCTAAACGCAAGGTTCATAAACCTGTCAAAGGTGTTCTTAGACTAGAAATTGAGAAACACCAAACAGGCCATTCGGATTTGGAAAACTTGTCGGAAAGTGGCAGCATGACAAATGAGTCCGTTGACCCAGGTGACAGGGTCAATGATTCCACATTTACAAAATCCCCTAGCAATGGCTCCAACTGGCCTCAGACTAGCAGCTCCAAGCAAAATATCTTTGACGGGAGAGAAAGTACTGGAAATAGTCCAAGTGCTCATGGAAATCCTGAGCTGAGTGCTGATGATTTCCAAGCTTTCGACTTCCGTACAACAATGCGGAATGAGCCTTTCTTGCAGCTGTTTCATTGGTTATATATTTATCCTTTAACTGTTACTTTGAGTCGGAAGAGGAATTTGTTCATACGAGTGGAACTAAGAAAGGATGACTCAGATGTTCGTAGACAACCTTTGGAGGCAATGTACCCAAGGGAGCCAGGAGCATCGCTCCAAAAGTGGGCTCACACACAGGTTGCTGTTGGGGCTAGAGTGGCATGCTACCATGATGAGATTAAACTATCCCTTTCTGCTGTCTGGACACCTTTTCATCATCTCTTGTTCACTTTCTTCCACGTTGATCTTCAAACAAAATTGGAAGCTCCAAAGCCAGTGGTAATTGGATATGCAGCACTTCCATTATCAACATATGATCAGTTGAGATCTGAAATTTCTCTTCCAATCATGAGAGAGCTGGTTCCACATTATCTCCAGGATACTGGCAAGGAGAGGCTGGATTATCTGGAGGATGGAAAAAATATTTTTAGATTGCGCTTGAGACTTTGTTCGTCCATGTATCCTACTAATGAGCGCATTAGAGATTTTTTTCTTGAATATGATAGGCACACTCTTCGAACTAGCCCTCCTTGGGGCTCAGAACTTCTGGAGGCAATTAACAGTTTGAAGAATGTTGATTCCACTGCCTTGCTTCAGTTTCTTCACCCTATTCTGAATATGCTTCTCCATCTTATTGGCAGTGGTGGAGAGACTCTACAGGTTGCAGCCTTCAGAGCTATGGTCAATATCTTAACTAGGGTCCAGCAGGAATCAGTTGATGATGCTGAGAGAAATCGTTTTCTTGTTAACTATGTTGATTATGCTTTTGACGACTTTGGTGGTCGTCAACCTCCAGTTTATCCTGGTCTATCTACTGTGTGGGGAAGCTTGGCTCGTAGTAAGGCTAAAGGCTACCGTGTTGGGCCAGTTTATGATGATGTTTTGGCAATGGCTTGGTTTTTTCTAGAGCTAATTGTCAAGTCAATGGCATTGGAACAAACTCGTCTTTTCTATCATAGTCTTCCGCTAGGTGAGGACGTACCACCAATGCAATTAAAAGACGGCGTTTTCAGATGCATAATGCAATTGTATGATTGCCTTCTAACTGAGGTGCACGAGCGTTGTAAGAAGGGCTCAAGCTTGGCAAAACGCTTGAATAGCAGTTTGGCCTTCTTCTGTTATGATCTATTGTCAATCATTGAACCTCGCCAAGTCTTTGAGTTGGTTTCCTTGTACATGGACAAGTTTTCTGGAGTATGTCAATCAGTTTTGCATGACTGCAAGCTAACCTTTCTGCAAATTGTATGTGATCATGATCTTTTTGTGGAAATGCCTGGGAGAGATCCTTCAGATAGAAACTATCTTTCATCCGTTTTAATACAAGAGCTTTTCATTACTTGGGACCATGATGATCTATCCCAACGATCAAAGGCAGCTAGGACTTTAGTAGTTCTCCTATGCAAGCATGAGTTTGATGCTCGTTACCAAAAGCCTGAAGATAAATTATACATCGCCCAGCTATATTTTCCTCTTATCGGCCAGATTCTGGATGAGATGCCTGTGTTCTATAACCTGAATGCTGTTGAAAAGCGTGAAGTCTTAATTGTTATTTTGCAAATCGTGCGCAATCTGGATGATACATCACTTGTGAAAGCGTGGCAACAAAGCATTGCTCGTACTAGATTGTTCTTCAAACTTATGGAGGAGTGCCTTGTTCTTTTTGAGCACAAGAAACCTGCTGATGGCATGCTCATGGGTTCTAGTTCTCGCAGCCCTGTCATAGATGCACCTTCTTCCCCCAAGTACTCTGATAGGCTTTCTCCTGCAATCAATAACTATCTGTCTGAGGCATCACGACAAGAAGTCAGAACTCAGGGAACACCTGATAATGGATATCTGTGGCAAAGAGTAAACTCCCAATTAAGCTCCCCTAGCCAGCCATATTCTCTGAGAGAAGCTCTCGCTCAGGCACAATCTTCAAGAATTGGAGCTTCATCCCAAGCACTTAGAGAATCCTTGCATCCAATATTGAGACAAAAACTTGAGCTTTGGGAAGAAAACTTGAGTGCTGCTGTGAGTCTTCAGGTGCTGGAAATAACTCAGAAGTTTTCTATGATGGCAGCATCCCACAGCATTGCTACCGACTATGGAAAACTAGATTGCATTACAGCCATATTTATGAGCTTCTTCTCTCGAAATCAAGCACTGGCTTTCTGGAAAGCTCTGCTTCCTGTTTTCTGCAGTGTCTTTGATCTTCATGGGGCAACATTAATGGCAAGGGAGAATGATCGCTTTCTAAAGCAGGTTGCTTTTCATCTTCTCCGGCTTGCTGTCTTTAGAAATGAAAGCATCAGGAGAAGAGCTGTTGTTGGACTCAAGATACTTGTGAGGAGCTCTTTCTATTATTTTATGCAGACAGCAAGGTTGCGGGCCATGCTGACTATCACACTGTCAGAGTTGATGTCTGATGTGCAAGTGACTCAAATGAAATCAGATGGAACACTAGAAGAGAGTGGTGAAGCACGGCGCCTGCGCAAGTCTTTGGAGGAAATGGCAGATGAGTATAAGAGTACTAGCCTATTGAAGGAATGCGGACTACCTGAAGATGCACTAGTGGCAATTTTGGATAGTTCAGCAGAGAATCGGTGGTCTTGGTCAGATGTGAAATATCTCTCTGACAATCTAATCCTGGCCCTTGATGCTAGTCTGGAACATGCACTTCTGGCTTCTGCGATGACAATTGATAGATATGCAACTGCAGAGAGTTACTATAAACTTGCCATGGCATTTGCACCTGTTCCCGATCTTCACATAATGTGGTTATTGCATTTGTGTGATGCCCATCAAGAAATGCAGTCCTGGGCTGAAGCTGCTCAGTGTGCTGTAGCTGTTGCTGGTGTTGTAATGCAGGCACTTGTGGCTAGAAAAGATGGTGTTTGGAGCAAAGATCATGTGACTGCTCTACGTAAAATTTGCCCAATGGTCAGCAGTGAGATCTCGTCTGAGGCATCAGCAGCAGAAGTGGAGGGTTATGGTGCTTCAAAGCTCACTGTGGATTCAGCTGTAAAATATCTACAGCTTGCAAATAAGCTTTTTTCTCAAGCTGAGCTCTTTCATTTCTGTGCAAGCATTCTGGAACTCGTGATTCCAGTTTATAAAAGCAGAAGAGCATATGGACAGTTGGCTAAATGTCATACTTTGCTAACTAATATCTACGAATCAATTCTTGAGCAGGAATCAAGCCCAATCCCGTTCACTGATGCCACATACTATAGGGTGGGATTCTACGGTGAAAAATTTGGGAAGCTGGACAGAAAAGAATATGTATACCGAGAACCCCGTGATGTACGGCTAGGTGACATAATGGAGAAACTAAGCCATATTTATGAGTCTCGGATGGATGGCAATCACACTTTGCACATTATCCCTGATTCGAGACAAGTGAAGGCAGATGAATTGCAGCCTGGAGTCTGCTACCTGCAGATAACTGCTGTTGATCCGGTAATGGAAGATGAAGATTTAGGAAGTAGACGGGAAAGGATTTTTTCTCTTTCTACTGGAAGTGTCCGTGCACGAGTCTTTGACCGTTTCTTATTTGACACCCCCTTCACAAAAAATGGCAAAACCCAAGGAGGTCTGGAAGACCAATGGAAGAGGCGGACTGTTCTTCAGACAGAAGGTTCTTTTCCTGCTCTTGTTAATAGGCTTTTGGTAATTAAATCGGAATCTCTCGAGTTCTCCCCAGTGGAGAATGCAATTGGAATGATTGAAACTAGGACAGCTGCCTTAAGAAATGAGCTTGAGGAGCCTCGTAGTTCTGAAGGGGATCAACTCCCACGCCTCCAGAGTTTGCAGAGAATTCTTCAGGGCAGCGTGGCAGTTCAAGTAAACAGTGGTGTTCTAAGCGTTTGCACGGCCTTCCTGTCTGGCGAGCCTGCTACAAGATTACGTTCACAGGAACTGCAACAACTCATTGCTGCACTCTTAGAATTCATGGCTGTTTGCAAGCGTGCTATCCGGGTGCACTTCAGATTGATTGGAGAGGAAGACCAGGATTTTCACACTCAACTTGTAAATGGATTTCAGTCTCTTACAGCTGAATTATCTCATTACATCCCTGCAATTCTTTCGGAGCTCTGA >Ciclev10010893m.g ATGGACGGCAGCAGTGGTGGTAGCGGAGGTCATCGCTTTCGAAGAATCCCTCGACAGTCTTTAGCTCATCTCAAATTGGACCCATTGATTGATGAGAATTTGGAGCAGTGGCCGCATTTGAATGAACTGGTGCAATGCTATAGAGCTGATTGGGTGAAGGATGAGAACAAGTATGGTCACTATGAAAGCGTTAGTCCGCCTTCTTTCCAAAATCAGATTTTTGAAGGCCCTGACACTGATATTGAGACAGAGACACGACTTGCTAATGCAAGGCGAGGCAAGGGCGAAGATGCCACAGATGATGACGCACCAAGTACCTCTGGAAGGCAATACACAGATGCTACTGATGTTTCAAAGCATTTTGGTATATCTTCCCTTCCTGCTTACGAACCAGCTTTTGATTGGGAAAATGAGAGATCATTAACATTTGGTCAGAGACTTTCAGAAACCCCAATGTCACATGGGTTAAAGATCTCTGTGAAGGTTTTGTCTCTATCATTTCAAGCTGGACTAGTTGAGCCATTTTATGGCACAATTTGCTTATATAATAGGGAGAGAAGAGAAAAATTATCCGAAGATTTCTATTTCCGAGTGCTACCGGCTGAAATGCAGGATGCAAAAATATCTTATGAACCTCGCGGCATATTTTATTTAGATGCCCCATCAGCATCTGTTTGTCTTCTTATCCAGTTAGAGAGGCCTGCCACAGAAGAAAGTGGAGTCACCCCTTCCGTTTATTCACGCAAAGAACCTGTACACTTGACAGAGAGAGAGAAGCAGAAACTGCAGGTGTGGTCTCGAATTATGCCTTATAGAGAGTCCTTCGCCTGGGCTATTGTTCCGCTATTTGACAACAGCATTGGTGCAGTTTCTGGTGGGTCTGCTTCCCCTAGCAGTCCTCTTGCTCCCAGCGTCTCTGGGTCAAGTTCTCACGAGGGTGTGTTTGAGCCCATTTCAAAGATCACATTGGATGGGAAGTTGGGATATTCGGGTGGAAGTTCTGTCATAGTTGAAATATCTAACTTAAATAAAGTAAAGGAATGCTACACTGAGGAGTCGCTTCAGGATCCTAAACGCAAGGTTCATAAACCAGTGAAGGGTGTTTTAAGACTGGATATAGAGAAGCACCAGACTGCTCATGCCGATTTGGAGAATATATCAGAAAGTGGCAGTGTGACTAATGACTCAATTGATCCAGGGGACCGTGCTACTGATTTGACATTTTCTAAGTGCCCCAGTAATGGTTCTGATGTGCCTCAGACCAGCAACTCTAAGTGGAGTTACGGTGATGGGAAAGAAATTTCTGGAAACGGATCAAATGCTCCAGATTTTAGTGCTGATGATTTTCAAGCTTTTGACTTCCGCACCACAACAAGAAACGAGCCTTTCTTGCAACTTTTTCATTGTCTATATGTATATCCCTCAAGTGTAAGTTTGAGTCGGAAGAGGAATTTGTTTATCCGAGTTGAACTACGGAAGGATGATGCTGATGTTCGTAGACAGCCTTTAGAGGCAATTCATCCAAGGGAGCCAGGTGTTTCACTCCAGAAGTGGGCTCACACACAAGTTGCTGTTGGGGCTAGGATGGCCTACTACCATGATGAGATTAAAGTTTCACTCCCAGCTGTCTGGACACCTATGCATCACCTCTTATTCACTTTTTTCCATGTTGATCTACAAACGAAACTGGAAGCTCCAAAACCAGTAGTTATCGGATATGCGGCACTTCCACTGTCTACACATGCTCAGCTGCGATCTGAAATTTCTTTACCAATAATTAAGGAACTGGTTCCGCATTATCTCCAAGAGACAGGAAAGGAGAGGCTTGACTATTTGGAAGATGGAAAGAATGCTTTTAAGTTGCGCCTAAGACTTTGTTCTTCCTTGTATCCAATTAATGAGCGCATTAGGGATTTCTTTCTTGAATATGACAGACACACTCTTCGAACAAGCCCACCTTGGGGTTCTGAACTGCTGGAGGCTATCAATAGTTTGAAGAATGTTGATTCCACTGCTTTGCTTCAGTTTCTTCACCCTGTACTGAATATGCTTCTCCATCTTATAGGCAATGGTGGAGAAACACTTCAGGTTGCAGCCTTCAGAGCCATGGTCAATATCTTAACCCGGGTGCAGCAGGAGTCAGTTGATGATGCTGAGCGAAATCGATTTCTTGTCAACTATGTTGATTATGCTTTTGATGACTTTGGCGGTCGTCAACCACCTGTTTATCCTGGTTTGTCTACTGTATGGGGTAGCTTGGCTCGCAGTAAGGCTAAGGGTTATCGTGTTGGACCTGTATATGATGACGTTCTGGCAATGGCTTGGTTTTTCCTTGAGCTAATTGTGAAGTCAATGGCATTGGAGCAGACACGGCTTTTCTTTCATGGTCTTCCATTAGGTGAAGACATTCCTCCCATGCAGTTAAGAGACGGTGTGTTCAGATGTGTAATGCAGTTGTATGACTGTCTTCTAACTGAGGTGCATGAGCGTTGTAAGAAGGGGTTAAGTTTGGCAAAACGCTTAAACAGCAGTTTGGGCTTCTTCTGTTATGATCTTTTGTCCATCATTGAACCTCGGCAAGTTTTTGAACTGGTTTCATTGTATCTGGACAAGTTTTCCGGGGTATGTCAGTCAGTTCTCCATGATTGCAAGCTTATATTCTTGCAGATTGTATGTGATCATGATCTTTATGTAGAAATGCCAGGGAGGGACCCTTCAGATAGGAACTATCTTTCATCTGTGTTAATACAAGAAGTTTTCCTTACTTGGGATCATGATGATTTATCTCAGAGAGCAAAGGCAGCCAGAATCCTAGTAGTCCTTCTGTGCAAGCATGAGTTTGATGCTCGGTACCAAAAGCCTGAGGATAAGCTATATATCGCTCAGCTATATTTCCCCCTTATTGGCCAGATCCTGGATGAAATGCCTGTATTTTACAATCTAAATGCTGTAGAAAAGCGTGAAGTTTTAATTGTTGTAATGGAAATTGTGCGGAATCTAGATGATGCTTCACTGGTCAAGGCATGGCAGCAAAGCATTGCTCGGACAAGATTGTTTTTCAAACTCATGGAAGAATGCCTCATTCTTTTTGAGCACAGAAAACCTGCTGATGGAATGCTGTTAGGTGCTAGTTCTCGCAGCCCTGTTGGTGAGGGGCCTTCTTCTCCCAAGTATTCAGATAGACTCTCTCCTTCAATAAACAATTACTTGTCTGAGGCATCTAGACAAGAAGTCAGACCTCAGGGGACTCCTGAAAATGGTTATTTGTGGCAGAGGGTGAATTCCCAGTTAAGCTCTCCAAGCCAGCCATATTCCTTGAGAGAAGCTTTGGCGCAGGCACAATCTTCTAGGATTGGAGCTTCGGCTCAGGCACTTAGAGAATCCTTGCACCCAATGTTGAGACAGAAATTGGAACTCTGGGAAGAAAATTTGAGTGCTGCTGTCAGTCTTCAGGTTTTAGAAATAACTGAGAAATTCTGCATGATGGCAGCATCCCATAGCATTGCTACTGATTATGGGAAACTTGATTGCATTACAGCCATAATTATGAGTTTCTTCTCCCGAAACCAGCCAGTAGCTTTCTGGAAAGCATTTTTTCCCGTCTTCAATCGCATTTGTGATCTTCATGGAGCAACACTAATGGCTAGGGAGAATGATCGCTTCCTAAAGCAAGTTGCCTTTCATCTCCTTCGGCTTGCAGTTTTCCGAAATGTTAGCATCAGGAAAAGGGCTGTTATCGGGCTCCAGATACTTGTGAGGAGCTCTTTCTACTTTATGCAGACTGCAAGGCTGAGGGTTATGCTGACTATCACACTGTCAGAGCTAATGTCCGATGTGCAAGTGACTCAAATGAAATCTGATGGAACACTAGAAGAAAGCGGGGAAGCGCGACGCCTTCGAAAATCTTTGGAGGAAATGGCAGATGAAGCTAGGAGTCCCAGCCAATTTAGGGAGTGTGGACTTCCTGAGGATGCTTTGTTGGCCATTCCAGAAAAATTTACAGAGAATCGGTGGTCCTGGTCTGAAGTGAAACATCTATCTGTCAGTCTTCTGTTGGCCCTCGATGCCAGCCTGGAACATTCACTTTTGGGTTCCGCCATGACTATGGATAGATATGCAGCTGCAGAAAGCTTCTATAAACTTGCAATGGCATTTGCCCCTGTCCCGGATCTTCATATAATGTGGTTGCTACATCTATGTGATGCGCATCAAGAAATGCAGTCATGGGCTGAAGCTGCTCAGTGTGCTGTAGCTGTTGCTGGTGTTGTCATGCAGGCCCTTGTGGCTAGAAATGACGGTGTTTGGAGCAAAGATCATGTTGCTGCTCTTCGTAAAATTTGTCCCATAGTTAGCAATGAGATCACTGCTGAGGCGTCAGCGGCTGAGGTGGAGGGTTATGGTGCTTCAAAGCTCACGGTTGACTCAGCTGTGAAGTACCTACAGCTAGCAAATAAACTTTTCTCTCAAGCTGAACTCTACCATTTCTGTGCAAGCATTCTAGAACTTGTGATCCCAGTTTATAAGAGCAGGAGAGCATATGGGCAACTGGCTAAATGTCATACTTTACTCACTAATATATACGAATCAATCCTTGAGCAGGAAGCAAGTCCAATTCCATTTACTGATGCCACATACTACAGGGTGGGATTTTATGGTGAAAAATTTGGAAAGCTGGACAGAAAGGAATATGTGTACCGTGAACCACGTGATGTACGCCTAGGTGACATAATGGAGAAACTTAGTCATATATACGAGTCTAGGATGGATGGCAATCACACTTTGCACATTATTCCAGATTCCAGGCAAGTGAAGGCAGAAGAATTGCAGCCTGGAGTCTGCTATCTACAAATCACTGCTGTTGATCCAGTCATGGAGGATGAAGATTTGGGGAGCAGAAGGGAAAGAATCTTCTCTCTTTCCACTGGAAGTGTTCGTGCCCGTGTCTTTGACAGATTTTTGTTTGATACCCCATTCACAAAAAATGGGAAGACCCAAGGCGGTTTGGAAGACCAATGGAAGAGGCGGACTGTTCTTCAGACCGAAGGTTCTTTCCCAGCACTGGTGAATAGGCTCTTGGTAACCAAGTCTGAGTCCCTCGAGTTCTCACCCGTTGAGAATGCAATTGGAATGATTGAAACCCGAACTGCAGCACTACGAAATGAGCTTGAAGAACCTCGCAGTTCTGAAGGTGATCAACTCCCACGTCTCCAGAGTCTGCAGAGAATCCTTCAAGGCAGTGTTGCAGTTCAAGTGAACAGCGGGGTGTTGAGTGTCTGCACAGCCTTCCTGTCGGGTGAGCCAGCCACAAGATTGCGTTCACAAGAATTGCAGCAACTCATAGCTGCACTCCTCGAATTTATGGCTGTTTGCAAGCGAGCCATAAGAGTACACTTCCGATTGATTGGGGAGGAAGACCAGGAGTTCCACACGCAGCTTGTTAATGGATTTCAATCACTAACAGCAGAATTGTCTCATTACATCCCCGCCATTCTCTCAGAGCTGTAA >Bv7_162790_awaf ATGGAGAATTCATCAGCATATGGGCATCGATTTCGTAGAATACCACGACATGTATGGGCTGCTAATACCAAAGTAGACCCACTTCTTGACGAGGATGTGGAACAGTGGCCTCATCTGCATGAACTTGTCCAATGCTACAGAGCGGATTGGGTGAAAGATGATAATAAGTATGGGCATTATGAGAGCATTGGTCCAACTACATTTCAAAATCAGACATATGAAGGGCCTGACACTGACATTGAAACAGAAATGCATCTTGCTGAGGCCCGACAAATTGAAAATGAAGATGCTGTTGATGAAGAATTACCAAGCACATCTGGGAGACCGTTTGGAGAGCATCTTGGTTTGTCTCCCTTGCCTGCTTATGAACCTGCATTTGACTGGGAGAGTGAGAGGTCTATGGTATTTGGTCAAAGACTTCCAGAAACTCAAGTACAATATGGAAGTGGATTGAAGATCTCTGTTAAAGTCCAGTCCCTTTTGTTTCAAGTTGGAGTAGTTGAACCATTTTATGGTACTATATGCTTATATAACAAAGAGAAAAGAGACAAGTTGTCGGAGGACTTCATTTTTCGGGTGCTTCCTACAGATTTGGAAAAGACTGGGACTTCAAATGAATCGCGAGCTATATTCTACTTAGATGCTCCCTCAGCATCAGTTTGCTTGCTGATCCAGTTGGAGAAGCCTGCTACTGAAGAAGGAGGGATCACTTCATCTGTCTATTCTCGGAAAGAACCAAATCAGCTGAGTGAGAGAGAGAGGCAAAAGTTGCAAGTTTGGTCTCGAATTATGCCTTACCGGGAGGCATTTGCTTGGGCTATGGTACCATTATTTGACAACAGCATTGCTGGAACCTCTGGTGGAACTGCTTCTCCGAGCAGCCCTCTGGCACCAAGTGTCTCTAGTTCTAGTTTTCATGAGGGTGTATCAGAGTCTACTACGAAGATCACCTTAGACGGAAAGCTGGGTTATTTGAGTGGGAGCTCAATTGTTGTTGAAATATCAAATTTGAATAAAGTCAAGGAGAGCTATACAGAGGATTCTCTGCAGGACCCTAAAAGAAAGGTCCATAAGCCTGTTAGAGGTATGCTGAAATTGGAGATTGAGAAGCTCCACGCTGGGCATCTTGATTTCGAAAATATTTCAGAAAGTGGCAGTATGACAAATGATTCTTTTGATATGGGGGAAGGTATTGTTGATGCATCACAGGTTCCAAGTAATGATTTGAACAGGTCTCAGGGCACCAAATCAAAACAATGCTTTGTTGATGCAAAAGACCCTGCTCGAAATGGGTTAAAGGGCCACGAGATCCAGGATTCCCAGACAGATGAATTCCATGCCTTTGACTTTCGTGCAACTACGAGGAATGAGCCTTTCTTGCAGCTTTTCCACTTTCTTTATGTGTATCCATTGACTGTTACTTTGAGTCGAAAAAGGAACCTGTTCATACGAATAGAACTTCGGAAGGATGATGCAGATATCCGGAGACAGCCTCTCGAGGCAACTTACCCTAGGGAGCCCGGTGCATCGCTAGAAAAGTGGGCTCATACACAAGTTGCTGTTGGCGCAAGGGTGGGTTGTTATCATGACGAAATTAAAGTCTCTTTGCCACCTATGTGGACTCCATTGCATCATCTTCTATTTACCTTCTTCCATGTTGACCTTCAAACTAAATTGGAAGCTCCAAAACCGGTGGTGATTGGCTATGCTGCACTTCCATTGTCTACATATGCTCAGTCTAGATCTGAAATTTCACTGCCCATCATGAGAGATCTTGTTCCACATTATCTTCAAGATGCTGGGAAGGAGAGGCTTGACTATCTTGAGGATGGAAAGAATGTCTTTAGATTGCGGCTGAGATTATGTTCTTCCTTGTATCCTACTAATGAACGCATTAGGGATTTCTTTCTTGAGTATGATAGGCACATTCTACGAACTAGTCCTCCTTGGGGATCTGAGCTTCTTGAGGCCATTAACAGTTTGAAGAATGTTGATTCCACTGTTCTGCTTCAGTTTCTTCACCCAATATTAAATATGCTTCTCCATCTTATTGGGAATGGTGGTGAAACCCTTCAGGTTGCTGCCTTTAGAGCTATGGTTAATATCTTGACTCGGGTACAGCAAGAATCAGTAGATGACGCAGAAAGAAATCGGTTTCTTATAAGCTATGTTGATTATGCTTTTGATGACTTTGGTGGCCGTCAATTACCAGTCTATTCAGGTCTTTCTACTGTGTGGGGAAGCTTAGCTCGTAGTAAGGCAAAAGGTTATCGCGTGGGACCAGTATATGATGATGTCTTGGCAATGTCTTGGTTTTTCCTTGAGCTTATTGTGAAGTCGATGGCTTTGGAACAAATAAGGCTATTCTATCATAGCCTTCCCACAGGTGAGGATGTTCCACCAATGCAATTGAAAGAAGGTGTTTTCAGGTGCGTTACGCAGCTGTATGATTGCCTTATCACTGAAGTACACGAGCGCTGCAAAAAAGGGTTGAGCTTAGCCAAACGTTTAAATAGTAGCTTGGCTTTCTTCTGCTATGACCTATTGTCTATTATTGAGCCTCGTCAAGTTTTTGAGTTGGCGTCCTTGTATCTGGATAAGTTTTCTGGTTTATGCCAATCTGTTCTTCATGACTGTAAGCTTACCTATTTACAGATTATATGTGATCATGATCTTTTTGTGGAAATGCCAGGACGAGATCCTTCTGATAGGAATTATCTTGCATCAATGCTGATACAGGAGCTTTTCCTCACATTAGATCACGACGATCTATCACTGAAGACTAAGGGGGCTAGAATCTTGGTGGTTCTCATGTGCAAACATGAATTTGATTCTCGTTACCAAAAGCCTGAAGATAAACTATATATCGCACAGCTATATTTTCCACTGATTAGCCAGATACTTGACGAAATGCCTGTATTTTACAACCTCGGTGCTGCTGAAAAGCGTGAAATCTTGATTGTTGTGTTGCAAATTGTACGCAATCTGGATGATGCATCGCTTATCAAAGCCTGGCAGCAAAGCATTGCAAGAACCAGATTGTTTTTCAAAGTACTAGAGGAATGCTTAATCCTTTTTGAGCATAAAAAACCATCAGATGGTATGCTTATTGGAAATAGTTCTCGTAGTATTGTGGGGGAGGGAACTGCATCTCCAAAATACTCAGACAGGCTCTCTCCAGCCATCAACAATTATCTCTCTGAGGCATCTCGACAAGAGCCTCATAGAACACCAGAGAATTATTTATGGCAAAGAGTGAACTCTCAGTTAAGCTCTCCAAGCCAACCCTATTCGTTGAGAGAAGCATTAGCTCAAGCACAGTCCTCCAGGATAGGAACTTCTGCGCAAGCACTAAGGGAATCATTGCATCCAATCCTGAGACAGAAGCTGGAACTTTGGGAGGAGAATTTGTGTGCCTCTGTCAGTCTTCAAGTTCTAGAAATTATTGAGAAATTTTCGACAACTGCTGCAGCACATGGAATCGCAACAGATTATGGGAAACTTGATTGCATTACTTCCATATTTACAAGCTTCTTCTCAAGGAACCAGCCACTTACGTTCTGGAGAGCTCTTCTGCTGGTGTTTAACAGTATGTTGAGCTCTCATGGATCAACACTAATGTCACGTGAAAATGATCGCTTTCTTAAGCAAATTGCTTTCCATCTTCTTCGCCTTGCTGTCTATAGAAACGAAAACATCCGTAGAATGGCTGTAGTTGGGCTTCAGATTCTCGTACGGAGTTCTTTCTGTCACTTCATGCAGACAACAAGGCTTAGAGTCATGCTAACCATTACATTGTCAGAGTTGATGTCAGATGTACAAGCTACGCTAATGAAGCCTGATGGAAGTCTTGAAGAGAGTGGTGAAGAGCAGAGACTTCGTAAGTCATTGGAAGAAATGGCAGATGAAGCAAAAAGCGCTAGTTTGCTGAGGGAATGTGGTCTCCCTGAGAGTGCACTAGTAGCTATTCCAGAAAAGTCCTCTGAGAATAGGTGGTCTTGGTCAGAAGTTAGATATCTCTCTGACAATCTTATTCTGGCTCTCGATGCAAGCCTGGAACACGCTCTTTTGGGTCCTGTGATGAACATTGATAGGTATGCGGCAGCAGAAAGCTTTTACAAACTTGCAGTAGCATTCGCTCCCGTTCCAGATCTTCATATAATGTGGTTACTACATCTCTGTGATGCGCATCAGGAAATGCAATCCTGGGCTGAAGCAGCACAATGCGCAGTCGCTGTTGCTGGTGTTGTTATGCAGGCTCTGGTTAGTAGAAATGATGGTGTATGGAGCAAAGAACATGTTGCTGCTCTGCGCAAAATATGTCCTATGGTCAACAGTGAGATCAATTCTGAGGCCTCTGCTGCTGAGGTGGAGGGATATGGTGCTTCGAAGCTAACTGTTGATTCTGCTGTGAAATACCTTCAGCTTGCCAACAAGCTTTTTTCTCAAGCTGAGCTCTATCACTTCTGTGCTAGTATTCTAGAATTGGTGATTCCTGTGTACAAAAGCAGAAGGGCATATGGACAGCTAGCCAAATGCCACACAATGCTGACTAGTATATATGAATCAATCCTTGAACAAGAAGCAAGCCCAATTCCTTTTGCTGATGCTACATATTACAGGGTAGGCTTTTATGGTGAGAAATTCGGAAAGCTGGATAAAAAAGAATATGTTTACAGAGAGCCTCGTGATGTACGGCTTGGTGATATCATGGAAAAGCTTAGTCATATATATGAATCCAGGATGGATGGTAATCACAGGCTTCATATTATACAAGATTCTAGACAAGTAAAGGCTGATGAGTTGCAGCCCGGCGTGTGTTACTTACAGATTACTGCTGTTGATCCGGTGATGGAAGATGAAGACCTGGGAAGTAGGAGGGAGAGGATCTTTTCCCTTTCCACTGGAAGTGTCCGTGCTCGTGTTTTCGACCGATTTCTGTTTGATACCCCCTTTACTAAAAATGGGAAGACTCAAGGTGGACTAGAGGACCAGTGGAAACGACGAACAGTTCTTCAAACAGAAGGCTCATTTCCTGCTCTTGTTAACAGGCTTTTGGTGATAAAATCTGAATCTATGGAGTTCTCACCTGTGGAAAATGCGATTGGAATGATTGAAACTCGGACAGCTGCACTTCGAAATGAGCTTGAAGAACCTCGAAGCTCTGAAGGGGACCAGTTGCCACGCCTACAGAGCCTGCAGAGAATACTGCAAGGCAGTGTTGCAGTTCAAGTGAATAGTGGAGTGTTGAGCGTGTGTACTGCATTTCTCTCAGGTGAGCCTGCAACTAGGCTTCGTTCACAGGAACTACAGCAACTCATTGCCGCACTCCTTGAATTCATGGCTGTATGTAAGAGGGCAATTAGAGTACATTTTAGGCTGATTGGAGAAGAAGATCAGGAGTTTCACACACAGCTTGTAAATGGGTTTCAATCACTTACAGCAGAGTTATCTCACTATATTCCTGCTATTCTCTCAGAGCTTTAA >MDO.mRNA.g.1219.3 ATGCAGCCTCAGGGTACTCCAGAAAATGGTTATTCGTGGCAGAGAGTAAATTCTCAGTTAAGCTCCCCTAGCCAGCCGTATTCCTTGAGAGAAGCACTAGCTCAGGCACAATCTTCTAGAATTGGAGCTTCTTCTCAAGCGTTAAGAGAATCTTTGCATCCAATATTGAGACAAAAATTGCACGAGCCTCATTTACATCGTGCAATAAAAATCTATCTTGCCTTTGAACTTGTCCGTCATCTCTTTGCTTTTTTGAGGTTTTTGGAAATAACTGAGAAGTTCTCCATAATGGCAGCATCCCACAGCATCGCCACTGACTATGGAAAATTTGACTGCGTCACAGCCATATTTATGAGCTTCTTCTCTCGAAATCAACCTTTGTCTTTCTGGAGATCATTGCTTCCTGTCTTCAACGGTGTCTTTAATCTTCATGGTGTAACTTTGATGGCTAGGGAAAATGACCGCTTTTTAAAGCAAAGTTCTTTCTATTACTTTATGCAAACAGCAAGGTTGAGGGTCATGCTGATCATCACATTGTCTGAGTTGATGTCTGAAGTACAAGTGACTCAGATGAAGGCTGATGGAACACTAGAAGAGAGTGGTGAAGCACGGCGTCTTCGAAAGTCACTTGAGGAAGTGGCAGATGAAGCTAAGAGCCTGAGTCTATTGAGAGAGTGTGGAGTTCCTGACGGTGCTCTGTTAGAAATTCCAGAAAAAATGACAGAAAATAGATGGTCCTGGTCAGAAGTGAAATTTCTCGCTGACAGTCTCTTCTTTGCTCTTGATGCCAGCTTGGAACATGCACTCCTGGAAATGCAGTCTTGGGCTGAAGCTGCTCAGTGTGCTGTTGCTGTGGCCGGTATTGTAATGCAGTTGGATAGAAAGGAATATGTATACAGGGAGCCCCGCGATGTAAGGCTAGGTGACATAATGGAGAAACTTAGTCACGTATACGAATCTAGGATGGATGGCAATCACACCTTACACATTATTCCAGATTCTAGGCATGTGAAGGCGGATGAATTGCAGCCTGGAGTCTGCTACCTGCAGATAACAGCTGTTGATCCGGTCATGGAAGACGAGGATTTGGGAAGTAGACGGGAGAGAATCTTTTCGCTTTCAACTGGAAGTGTTCGTGCACGAGTCTTTGATCGTTTCTTGTTTGATACCCCATTTACGAAGAATGGAAAGACTCAGGGTGGGTTGGAGGACCAGTGGAAGAGGCGGACCGTTCTTCAAACTGAAGGTTCATTCCCAGCTCTTGTGAATAGGCTATTAGTTACCAAATCCGAATCGCTTGAGTTCTCCCCAGTAGAAAATGCCATTGGAATGATTGAAACTCGGACAGCTGCTTTACGAAATGAACTTGAAGAGCCTCGCAGTTCTGAAGGGGATCAACTTCCACGTCTCCAGAGCCTACAAAGAATTCTTCAAGGCAGTGTTGCCGTCCAGGTCAACAGTGGGGTACTGAGCGTGTGCACTGGCATTCCTATCAGGCGAGCCTGCAACAAGATTGCGGTCCCAGGAACTGCAGCAACTGATTGCTGCACTCTCTATGGCCGTATGCAAGCGTGCAATCCCGTGTGCACTTCAGATTGA >MDO.mRNA.g.1219.4 ATGGTCAAATTGAACCATTTTGAGGAGAATTTGGAGCAGTGGCCACATCTGAAGGAGCTGGTGCAGTGCTACACAACAGACTGGGTGAAGGACGACAACAAGTATGGTCACTACGAGAGTATTGGACTGCCCTCATTCCAGAACCAGATTTATGAGGGCCCTGACACTGACATTGAAACTGAAATGCATCTTGCAAGTGCAAGGCAAACCAAGGTGGAAGATACTACTGATGATGACGTCCCCAGTACCTCGGGACGACAATTCTCAGAAGCTACTGTATCGGATTCAGTACAGTCCAATGATCCAAAGGGGAGAAGAGAAAAATTGTCAGAGGACTTTTATTTTCGACATGCACCAACTGAAAAGCAGGATATTTCTTTTGAACCTCGCGGAATCTTCTATTTAGATGCTCCATCATCATCAGTTTGTCTGCTAATCCAGTTAGAGAAGCATGCCACAGAAGAAGGCGGGGTTACACCTTCAGTTTATTCGCGCAAAGAACCAGTACACTTGACTGAGAAAGAAAAGCAAAAACTGCAGGTGTGGTCTCAAATAATGCCTTACAGAGAGTCCTTCGCCTGGGCTATTGTTTCATTATTTGATAACAGCATTGGTGCAGCTTCTGGTGGGTCTGCTTCCCCAAGCAGTCCTCTTGCTCATAGTATATCTGGTACAAGTTCTCATGATGGTGTGTTTGAGCCTAGTGCAAAGGTCACATTAGATGGGAAGCTAGGATATCCAAGTCGAAGCTCTGTTGTTGTCGAAATATCGAACTTAAATAAAGTTAAAGAATGCTATACTGAGGACTCACTTCAGGATCCCAAACGTAAGATTCATAAACCTGTGAAAGGTGTTATGAGGCTGGAAATCGAGAAGCACCAGAATGACCATGATGACATGGAAAATATATCAGAAAGTGGTAGTGTGACTAATGATTCTATTGATGACCGCATTACCGATTCCACATTTGGGAAGCTCCCAAGTAATGGTTTGGATGGTCCTCAGGGTAGCAGCTCTAAGTGGAATTCTTCCGACACCAAAGAAAGATCTGGAAATGGATCAAATGCTCATGGAAATTCAATTCCCAGTGTTGACGATTTTCAAGCTTTTGACTTCCGTACGACGACAAGAAATCAGCCTTTCTTGCAGCTTTTTCATTGGCTTTATGTATATCCTATGACTGTTAGTTTGAGTCGGAAGAGGAATTTGTTCATAAGGGTTGAGCTTCGGGAGGATGATAATGATATTCGTAGACAGCCTCTGGAGGCAATGTATCCAAGGGAACCAGGTGCATCACTCCAGAAGTGGGTTCACACACAAGTGACTGTTGGTGCTAGGGTGGCCTGCTACCATGATGAAATCAAACTCTCCCTACCTGCTACCTGGACACCGACACATCATCTTTTATTTACTTTTTTTCATGTAGATCTTCAAACAAAATTGGAAGCTCCAAAACCTGTAGTAATTGGATACGCGGCACTTCCGTTATCTACTCATGCTCAGTGTAGGTCTGAAATTTCTTTGCCAATTATGAGAGAGCTGGTTCCACATTATCTCCAGGATATGGGCAGAGAGAGGTTGGATTATTTGGAAGATGGAAAGAATATCTTTCGATTGCGCTTAAGACTTTGTTCGTCGCTGTATCCTATCAATGAGCGGATAAGAGATTTTTTTCTTGAATACGATAGGCACACTCTTCGAACAAGTGCACCTTGGGGTTCTGAGCTTTTGGAGGCTATTAACAGTTTGAAGAATGTTGATTCCATTGCTTTGCTTCAGTTTCTACATCCAATTTTGAATATGCTTCTGCATCTAATAGGAAATGGTGGAGAAACCCTCCAGGTTGCAGCTTTCAGAGCCATGGTCAATATTGTCACCCGGCTGTCCTGTGATTATGGTGTTGATAATATCACAGAGCACAACCATGACATGCTTAAATTTAGACATGCTAAAGGATATCGTGTTGGACCTGTGTATGATGATGTTTTGGCAATGGCTTGGTTTTTCCTTGAGCTAATTGTCAAGTCAATGGCGTTAGAGAAGATGCGTCTTTTCTATCATAATCTTCCTTTAGGTGAAGATATTCCGCCTATGCAGTTGAAAGAAGGTGTATTCAGATGTATAATGCAGTTATATGATTGCCTACTAACAGAAGTGCATGAACGTTGTAAGAAGGGATTAAGCTTAGCAAAGCGTTTAAACAGCAGTTTGGCTTTCTTTTGTTATGACCTCTTGTCCATCATTGAACCTCGCCAAGTTTTTGAATTGGTGTCTTTGTACCTGGACAAGTTTTCCGGGGTTTGTCAATTGGTTCTTCATGATTGCAAGCTCACATTTCTACAAATTATATGCGATCACGACCTTTTTGTGGAAATGCCTGGGAGAGACCCTTTGACAGAGCTATTTCTTACATGGGATCATGACGATTTGTCTCTGCGGGCAAAGGCAGCTAGAATTTTAGTAGTCCTTTTGTGCAAACATGAGTTTGATGCACGATACCAAAAGCCAGAAGATAAACTATATATAGCCCAGCTCTATTTTCCACTTATCGGACAGATTCTTGATGAAATGCCTGTATTTTACAACCTCAATGCTGTTGAAAAGCGTGAAGTTTTGGTCGCAATTTTGCAAATTGTACGGAACCTTGATGATTCATCACTTGTCAAGGCGTGGCAGCTGAGCATTGCCAGAACTAGATTGTTTTTCAAACTCATGGAGGAATGCCTTGTTCTATTTGAGCACAGAAAACCTGCTGATAGCACGCTTATGGGATCTAGTTCTCGCAGTCCTGTTGGTGGCGATGCCCCTGCTTCCCCTAAGTATTCTGATAGACTTTCCCCTGCGATCAACAAACTATCTGTCTGA >MDO.mRNA.g.5023.17 ATGTGGGTTTATTTTGAGGAGAATTTGGAGCAGTGGCCACATCTGAAGGAGTTGGTGCAGTGCTATACAACTGACTGGGTGAAGGATGACAACAAGTATGGTCACTACGAGAGTGTTGGACCGCCCTCATTCCAGAACCAGATTTATGAGGGTCCTGACACTGACATTGAAACCGAGATGCATCTTGCAAGTGCAAGGCGAACCAAGGTGGAAGATACTACTGATGATGATGTCCCCAGTACCTCGGGAAGACAATTCACAGAGGCTACTGTATCTGATTCAGTACAGTCCAATGATCCAAAGCATTTTGGTCAATCTCCCCTTCCTGCCTATGAACCAGCATTTGATTGGGAAAATGAAAGGTCAATGATATTCGGACAAAGGATTCCAGAAACTCCAATATCTCATGGATTGAAGATCTCAGTGAAGGTTCTTTCCCTATCATTTCAAGCGGGATTAGCTGAGCCATTTATGGTACAATGTGCTTATACAATAGGGAGAGAGAAAAAATTGTCAGAGGACTTTTATTTTCGTCATGCACCAACTGAAAGGCAGGATATTTCTTTTGAACCTCGCGGAATCTTCTATTTAGATGCTCCATCATCATCAGTTTGTCTGCTAATCCAGTTAGAGAAGCATGCCACAGAAGAAGGCGGGTTACACACCTTCAGTTTATTCACGCAAAGAACCACATTGGTGCAAGCTTCTGGTGGGTCTGCTTCCCCAAGCAGTCCTCTTGCTCCTAGTATATCTGGTACAAGTTCTCATGATGGTGTGTTTGAGCCTAGTGCAAAGGTCACATTAGATGGGAAGCTAGGTTATTCAAGTCGAAGCTCTGATCCCAAACGCAAGATTCATAAACCTGTGAAAGGTGTTTTGAGGCTGGAAATCGAGAAGCACCAGAATGACACTGTTGACTTGGAAAATGTATCAGAAAGTGGTAGTGTTACCAATGATTCTATTGATGACCGCATTACCGATTCCACATTTGGGAAGCTCCCAAGTAATGGTTTGGATGGTCCTCAGGGTAGCAGCTCTAAGTGGAATTCTTCTGACACCAAAGAAATATCTGGAAATGGACCAAATGCTTCAATTCCTAGTACTGATGATTTTCAAGCTTTCGACTTCCGTACGACAACAAGAAATGAGCCTTTCTTGCAGCTTTTTCATTGCCTATATGTATATCCCATGACTGTTAGTTTGAGTCGGAAGAGGAATTTGTTCATAAGAGTTGAACTGCGGGAGGATGATAATGATATTCGTAGACAGCCTTTGGAGGCAATGTATCCAAGGGAACCAGGTGCATCACTACAGAAGTGGGCTCAAACACAAGTGACTGTTGGGGCTAGGGTGGCCTGCTACCATGATGAGATCAAACTCTCCCTCCCTGCTACCTGGACACCAACACATCATCTTTTATTTACTTTCTTTCATGTAGATCTTCAAACAAAATTGGAAGCTCCAAAGCCTGTAGTAATTGGATACGCGGCACTTCCATTATCCACGCATGCTCAGGTGCGCTCTGAAATTTCTTTGCCAATTATGAGAGAGCTGGTTCCACATTATCTCCAGGATATGGGCAGAGAGAGGTTGGATTATTTGGAAGATGGAAAGAATATCTTTCGATTGCGCTTAAGACTATGTTCGTCGCTGTATCCTATCAATGAGCGCATAAGAGATTTTTTTCTTGAATACGATAGGCACACTCTTCGAAAAGTTGCAGCTTTCAGAGCCATGGTTAATATCGTCACCGGTGTGTTGTCCTGTGTTTATGGTGTTGTAAGGGTGCAGCAAGAGTCGGTTGATGATGCTGAGAGAAATCATTTCCTAGTTAATTATGTTGATTACGCTTTTGATGACTTTGGGGGTCGTCAACCACCAGTTTATCCTGGTTTGTCAACTGTTTGGGGGAGTTTGGCTCGTAGTAAGGCTAAAGGATATCGTGTTGGACCTGTGTATGATGATGTTTTGGCAATGGCCTGGTTTTTCCTTGAGCTAATTGTCAAGTCAATGGCATTGGAGAAGATGCGTCTTTTCTATCATAATATTCCTTTAGGTGAAGATATTCCGCCTATGCAATTGAAAGAAGGTGTATTCAGATGTATAATGCAGTTGTATGATTGCCTACTAACTGAAGTGTCCTTGTACCTGGACAAGTTTTCTGGGGTTTGCCAACTGGTTCTGCATGATTGCAAGCTCACATTTCTACAAATTATATGCGATCACGACCTTTTTGTGGAAATGCCTGGGAGAGACCCTTCTGATAGGAATTACCTTTCGTCTGTTTTAATACAAGAGCTATTTCTTACGTGGGATCATGACGATTTGTCTCTGCGAGCAAAGGCAGCTAGAATTTTGGTAGTCCTTTTGTGCAAGCATGAGTTTGATGCACGATACCAAAAGCCTGAAGATAAACTATATATAGCCCAGCTCTATTTTCCACTTATTGGACAGATTCTTGATGAAATGCCTGTATTTTACAACCTCAATTCTGTTGAAAAGCGTGAAGTTTTGGTCGCAATTTTGCAAATTGTACGGAACCTTGATGATTCATCACTTGTCAAGGCGTGGCAGCAGAGCATCGCTAGAACTAGATTGTTTTTCAAACTCATGGAGGAATGCCTTGTTCTATTTGAGCACAGAAAACCTGCTGATGGCATGCTTATTGGATCTAGTTCTCGCAGTCCTGTTGTTGGCGATGCCCCTGCGTCCCCCAAGTATTCTGATAGACTATCCCCTGCGATCAACAACTATCTGTCTGAAGCATCTAGACAAGAAGTCAGGTTCTTTCTACTACTTTATGCAAACAGCAAGGTTGAGGTCATGCTGATCATCACATTGTCAGAGTTGATGTCTGATGTACAAGTGACTCAGATGAAGGCCGATGGAACACTAGAAGAGAGTGGTGAAGCACGGCGTCTTCGAAAGTCGCTTGAGGAAGTGGCAGATGAAGCTAAGAGCCCCAGTCTATTGAGAGAGTGTGGAATTCCTGACGGTGCTCTGTTAGAAATTCCAGAAAAAATGACAGAAAATAGATGGTCCTGGTCAGAAGTGAAATTTCTCGCTGACAGTCTTCTTCTTGCTCTTGATGCCAGCTTGGAACATGCACTCCTGGGCTCTTTGATGACTATGGATAGATATGCTGCTGCCGAAAGCTTCTATAGACTTGCTATGGCATTTTGCCCCTGTCCCAGATCTTCACATAATGTGGTTACTGCATCTATGTGA >MDO.mRNA.g.5023.19 ATGGAGAAACTTAGTCACGTATACGAATCTAGGATGGATGGCAATCATACGTTACACATTATTCCAGATTCTAGGCAGGTCAAGGCGGATGAATTGCAGCCTGGAGTCTGCTACCTGCAAATAACTGCTGTTGATCCAGTCATGGAAGATGAAGATTTGGGAAGCAGAAGGGAGAGAATCTTTTCTCTTTCCACTGGAAGTGTTCGTGCACGAACTCAAGGTGGATTGGAAGACCAGTGGAAGCGACGGACCGTTCTTCAGACTGAAGGTTCATTCCCAGCTCTTGTGAACAGGCTTTTAGTTACCAAATCCGAATCGCTTGAGTTCTCGCCAGTAGAAAATGCCATTGGAATGATTGAAACTCGGACAGCTGCTTTACGAAATGAACTTGAAGAGCCTCGCAGTTCTGAAGGGGATCAACTTCCACGTCTCCAGAGCCTCCAGAGAATTCTTCAAGCAGTGTTGCCGTTCAGGTGGAATTCGTTCTCAACCTATGTTTCTCTAAACCCAATAACATCTGCTGCTGACTCCATGACTCAATTTCGTCAACAGTGGGTACTGAGTGTGTGCACTGCATTCCTGTCGGGTGAGCCTGCAACAAGGTTGCGGTCCCAGGAACTGCAGCAACTCATTGCTGCACTCCTTGAATTCATGGCCGTATGCAAGCGTGCCATCCGTGTGCACTTCAGATTGATCGGCGAGGAAGATCAGGAGTTCCACACTCAGCTTGTGAATGGATTTCAATCTCTGACGGCCGAGTTGTCCCATTACATCCCTGCCATTCTGTCAGAGCTGTGA >Bo1g054880 ATGGAGAACAACAACAACCTTAGCCTTCGCTTCCGCAAGATTCCTCGGCAGCCTCTTTCTCTCCCCAAGCTCGAACCTTTGCTTGATGGGAATCTGGAACAGTGGCCGCACTTGAACCAATTGGTTCAGTGCTACGGAACGGAGTGGATTAAGGATGCTAATAAATACGGACACTACGAGACTACTCGGCCTGATACTTTCCAAACTCAGATTTTCGAAGGTCCCGACACTGATACTGAGACTGAGTTCCGTCTTGCTAGTGCTAGGAGTGCTACATTGGATGAGGATGTAGCCAGCGTTTCTGGGACGCCCTTTACTGATTCTGGATCCCCCAAGCATTTTGGGCTACCTCCACTCCCTGCGTATGAACCGGCTTTTGACTGGGAAAATGAAAGATCTATGATATTTGGTCAGAGAACTCCTGAGTCTCCTGCAGCTAGCTATTCCAGTGGTTTGAAGATTTCTGTCAGAGTTTTATCTCTAGCTTTTCAGTCTGGCTTAGTTGAACCATTTTATGGCTCCATTTCATTATACAATCAAGAGAGGAAGGAGAAACTCTCTGAGGATTTTTATTTCCATATTTCGCCAACCGAAATGCAGGATGCCAAACCTTCATCTGAAAACCGTGGAGTGTTTTATCTAGATGCCCCATCAGCATCAGTTTGCTTGCTGATTCAGTTAGAAAAGACAGCAACGGAGGAGGGAGGCGTTACAACATCTGTCTATTCCCGTAAAGAACCTGTGCACTTAACTGAAAGGGAAAAGCAAAAGTTACAGGTCTGGTCCCGCATTATGCCTTACCGAGAGTCTTTTGCCTGGGCAGTTGTTCCGCTTTTTGATAATAATATCACCACAAACACTGGCGAATCTGCTTCCCCTAGCAGTCCTCTTACTCCCAGTATGACTGCCGCAAGTTCCCATGATGGTGTTTTTGAACCCATGGCAAAGATCACATCAGATGGGAAGCAAGGTTCTTCAGGTGGAAGTTCTGTCGTTGTTGAAATATCTAATTTAAACAAAGTTAAGGAGAACTACTCTGAGGAGTCGATTCAGGACCCTAAACGGAAGGTTCATAAACCTGTTAAAGGAGTTCTAAGACTGGAAATTGAGAAACATAGGAATGGACATGGAGACGTTGAAGATCTATCTGAGAATGGGAGTATCAGAAATGAATCTCTTGATCTGACTGACCGCCTCGGTGACCTGACGCTTATGAAGTGTCCTAGTGCTGGTTCCGGTGGACCCCATAACAGTGGTTCCAAGTGGAGTACAGAGGATGTTTCAAAAAACCTAACGAGCTCAAGTGGGAATGTTGACAATTGTTACTATGCTTTTGATTTCTGCTCTACGACAAGAAACGAGCCTTTTCTACATCTCTTCCATTGCCTTTATGTGTATCCCGTAGCTGTTACACTGAGTCGGAAGAGGAATCCCTTTATCCGGGTAGAATTGAGAAAGGATGATACAGATGTCCGAAAACAACCACTGGAGGCAATATATCCAAGAGAGCCTGGTGTGTCACTCCAGAAGTGGGCTCACACACAAGTTGCTGTTGGAGCTAGAGCTGCTAGTTACCATGATGAAATTAAGGTGTCTCTCCCTGCCACCTGGACGCCATCACATCATCTGCTATTCACTTTCTTTCATGTTGATCTCCAGACAAAGCTTGAAGCTCCAAGACCAGTAGTTATTGGATATGCATCACTTCCATTGTCTACATATATCCACTCACGGTCTGATATTTCTCTTCCGGTTATGAGAGAACTGGTTCCTCATTATCTTCAAGAGACCACCAAGGAGAGATTAGATTATTTGGAAGATGGCAAGAGTATTTTTAAGTTGAGACTGAGACTTTGTTCATCGCTTTATCCCACCAACGAACGTGTCAGGGATTTCTGTCTAGAATATGATAGACATACCCTCCGAACAAGCCCTCCCTGGGGTTCAGAACTGTTGCAGGCAATTAACAGTTTGAAGCACGTTGACTCCACTGCCCTGCTTCAGTTTCTCTACCCAATTCTTAACATGCTCCTTCATCTTATTGGCAATGGTGGAGAAACTCTTCAGGTCGCAGCATTCAGAGCCATGGTGGATATTTTAACTCGGGTGCAGCAGGTGTCGTTTGATGATGCTGACCGAAATCGTTTTCTGGTCACCTATGTTGATTATTCTTTTGATGATTTTGGAGGCAATCAACCACCGGTTTATCCGGGATTATCAACTGTGTGGGGAAGTTTAGCTAGAAGCAAGGCTAAAGGTTACCGGGTTGGACCTGTATATGACGATGTTTTATCAATGGCGTGGTTTTTCCTCGAGTTAATTGTTAAATCAATGGCATTGGAGCAGGCACGTCTTTTTGATCACAATCTACCTTCAGGCGAGGATGTTCCACCCATGCAGCTCAAAGAAAGTGTCTTTCGATGTATCATGCAATTGTTTGATTGTCTTTTAACTGAAGTTCATGAACGTTGTAAAAAGGGTCTAAGCTTGGCAAAACGTCTGAACAGCAGTTTGGCCTTCTTCTGCTATGATCTCTTATATATCATTGAGCCCTGCCAGGTCTATGAATTGGTATCGTTGTACATGGACAAGTTTTCTGGTGTTTGTCAATCTATCCTACACGAGTGCAAGCTCACATTTTTGCAAATTATCTCCGATCATGATCTCTTTGTAGAAATGCCTGGCAGAGACCCATCGGACAGGAACTATTTATCATCCATCTTAATACAGGAGCTATTTCTCTCCCTGGACCATGATGAGCTGCCTCTGCGGGCAAAGGGTGCAAGAATTTTAGTGATCCTCTTATGCAAGCATGAATTTGATGCTCGGTACCAGAAAGCCGAAGATAAGCTGTATATTGCACAGCTATATTTTCCTTTTGTGGGGCAGATTTTAGACGAAATGCCTGTTTTCTATAACCTAAATGCTACTGAAAAGCGTGAGGTTTTAATCGGTGTGTTGCAAATCGTTCGAAATCTGGATGACACATCACTTGTCAAGGCATGGCAGCAGAGCATTGCTCGTACAAGATTGTATTTCAAACTCATGGAAGAATGTCTTATACTATTTGAGCACAAGAAAGCTGCTGATAGCATCCTCGGGGGCAACAACTCTCGTGGGCCTGTTAGTGAAGGAACTGGATCACCAAAGTACTCCGAGCGACTTTCTCCTGCTATCAACAATTATTTGTCAGAGGCATCCCGTCAAGAAGTCAGGCTAGAGGGAACACCTGATAATGGGTACCTGTGGCAGAGAGTAAATTCTCAGTTAGCCTCCCCTAGCCAACCTTATTCCCTAAGAGAAGCTTTAGCTCAAGCACAATCTTCGCGGATTGGAGCTTCAGCCCAGGCATTAAGAGAATCGCTGCACCCTATTTTAAGGCAAAAACTGGAACTCTGGGAAGAGAATGTAAGTGCTACTGTTAGCCTCCAGGTTTTGGAGATCACTGAGAAATTTTCATCAATGGCAGCCTCTCACAACATTGCTACGGACTATGGCAAATTGGACTGCATTACTACAATATTGACAAGTTTCTTCTCCCGAAACCAGTCACTAGCCTTCTGGAAAGCCTTCTTTCCTATTTTCAACAGAATCTTTGATCTTCACGGGGCTACACTGATGGCAAGGGAAAATGATCGCTTCTTAAAACAGATAGCCTTCCATCTTCTCCGGCTTGCCGTTTACCGAAATGACAGTGTCAGGAAAAGAGCCGTTATTGGTCTTCAAATACTAGTCAAGAGCTCGCTATATTTTATGCAGACTGCTAGGCTGAGGGCTTTGCTGACCATTACACTGTCAGAACTCATGTCGGATGTCCAAGTTACTCATATGAAAACGGATAATACATTGGAAGAGAGTGGAGAGGCAAGGCGGCTTCAACTGTCATTAAGCGAAATGGCTGATGAAGCTAAGAGTGTCACTCTGTTGAGGGAATGTGGTCTTCCTGATGATACTCTGTTGGTAATTCCCGGGAAGTTTACAGAAAACCGCTGGTCTTGGGCTCAAGTGAAACAACTTTCTGACAGCCTTGTTCTTGCTCTTGATGCGAGCCTTGGGCACGCTCTTTTGGGATCTGTGATGGCTATGGATCGATATGCTGCAGCAGAGAGCTTTTACAAACTTGGAATGGCATTTGCTCCTGTTCCAGATCTTCACATAATGTGGTTGTTGCACCTATGTGATGCTCACCAGGAAATGCAGTCCTGGGCTGAAGCTGCACAGTGTGCTGTGGCGGTTGCAGGTGTGATTATGCAGGCCTTGGTGGCTAGAAATGATGGTGTCTGGAGCAAGGATCATGTCTCTGCCTTGCGTAAAATTTGCCCCATGGTAAGTGGCGAGTTCACGACAGAGGCATCTGCAGCTGAAGTAGAGGGTTACGGTGCTTCAAAGCTAACAGTTGACTCTGCCGTCAAGTATCTACAGCTTGCAAATAAGCTTTTCTCTCAAGCTGAGCTCTACCATTTCTGTGCAAGCATTTTGGAGCTTGTTATACCAGTTTACAAGAGCAGGAAGGCTTATGGGCAGTTGGCTAAGTGTCACACGCTGCTTACTAACATATACGAGTCCATTCTTGACCAAGAATCAAACCCCATCCCATTTATCGACGCCACGTATTACCGGGTGGGATTCTACGGAGAAAAGTTTGGGAAGCTGGACAGGAAAGAGTATGTATACCGTGAACCGCGAGATGTGCGGCTTGGAGATATAATGGAGAAGCTGAGCCATATATACGAATCAAGGATGGACAGCAACCATATTCTGCACATCATTCCAGATTCGAGACAAGTGAAGGCAGAAGAGTTGCAGGCCGGAGCGTGCTACCTGCAAATCACTGCGGTTGATGCAGTCATGGAAGATGAGGATCTTGGGAGCAGAAGAGAGAGGATATTTTCTCTTTCGACTGGTAGTGTTCGAGCACGAGTCTTTGACCGGTTCTTGTTTGATACACCGTTTACAAAGAACGGTAAGACGCAAGGTGGGTTAGAAGATCAGTGGAAGAGAAGAACAGTGCTGCAGACGGAAGGATCGTTCCCTGCTCTCGTGAATAGACTGTTGGTTACCAAATCCGAATCCCTTGAATTCTCGCCGGTGGAGAATGCAATTGGAATGATTGAAACCAGAACAACCGCTCTTAGAAACGAGCTAGAGGAGCCTCGTAGCTCGGACGGGGATCACTTACCACGGCTTCAGAGTCTGCAGAGGATTCTTCAAGGAAGTGTTGCAGTGCAGGTCAACAGTGGAGTCTTGAGTGTTTGCACAGCCTTCTTATCAGGTGAGCCTGCAACGAGATTGCGTTCGCAAGAGCTGCAGCAACTCATCGCGGCACTTCTTGAATTCATGGCGGTTTGCAAGCGAGCCATAAGGGTTCACTTCAGATTAATCGGAGAAGAAGACCAAGAGTTCCATACTCAGCTCGTCAATGGATTTCAGTCTCTTACCGCAGAGCTCTCCCATTACATTCCTGCTATCTTGTCCGAACTTTAG >Cpa.g.sc34.42 ATGACAGCTACAGCTATAATCTGTGATCATGATCTTTTTGTTGAAATGCCTGGGAGAGACCCTTCGGATAGGAACTACCTTTCATCTGTCTTAATACAAGAACTTTTTCTCACATGGGATCATGATGATCTATCTCAGCGATCAAAGGCAGCAAGAATTTTGGTCATCCTCTTGTGCAAGCATGAGTTTGATGCTCGATACCAGAAGCTTGAGGATAAGTTGTATATAACACAGCTATATTTTCCACTTATTGGCCAGATCCTCGATGAAATGCCTGTCTTTTACAACCTAAATGCTGTTGAAAAGCGTGAAGTGTTAATTGTCATATTGCAAATTGTGCGCAATCTAGATGATTCTTCACTTGTCAAAGCATGGCAACAAAGCATTGCTCGAACTAGATTATTCTTCAAGCTCATGGAGGAAAGTTTGATGCTTTTTGAGCACCGAAAACCTGCTGATGGCATGCTTATGGGAAGCAGTTCTCGGAGCCCTGTTGGAGAGGGGCCTGCTTCCCCCAAGTACTCTGATAGACTTTCTCCTGCAATCAATAATTATCTTTCTGAGGCCTCTCGACAAGAAGTCAGGCCTCAGGGAACACCTGATAATGGTTATTTATGGCAGAGAGTGAATTCCCAGTTGAGTTCCCCCACTCAACCATATTCCCTTAGAGAAGCTCTGGCCCAGGCACAATCTTCTCGGATTGGAGCTTCTGCTCAAGCACTGAGAGAATCTTTGCACCCAATATTGAGACAAAAACTGGAACTATGGGAAGAAAATTTGAGTGCTGCTGTCAGTCTTCAGGTTTTGGAAATAGCTGAGAAATTTGCTATGATGGCTGCATCCCATAGCATTGCTACTGATTATGGAAAACTTGACTGCATCACAGTCATAATTATGAGTTTCTTTTCACGAAATCAGCCTCTAGCTTTTTGGAAGGCTTTCTTTCCTGTGTTCAACCATGTTTTTGATCTTCATGGGGCAACTCTAATGGCCAGGGAGAATGACCGCTTCTTAAAGCAAGTTGCTTTCCATCTTCTTCGACTGGCTGTTTTCCGAAATGATAGTATCAGAAAAAAGAGCTGTTATAGGGCTTCAGATACTCGTCAGGAGCTAATGTCGGACATCCAAGTGACACAGATGAAATCCGATGGAACACTAGAAGAGAGTGGTGAGGCTCGGCGGCTTCGAAAATCTTTGGAGGAAATGGCAGATGAAGCTAAGAGTCCCAACCTATTGAGGGAATGTGGACTTCCTGAGAGTGCTCTTTCAGCGATTCCAGATGGATTTACAGAAAACAAATGGTCATGGTCAGAAGTAAAATGTCTTTCGGACAGTCTTCTTCTGGCCCTTGATGCTAGCCTGGAGCATGCCCTTCTGGGCTCTATGATGAGTATGGATAGATATGCTGCTGCAGAGAGCTTCTACAAACTTGCTTTGGCATTTGCTCCAGTCCCAGATCTTCACATAATGTGGTTGCTGCATTTATGTGATGCACATCAGGAAATGCAATCTTGGGCTGAAGCTGCACAGTGTGCTGTAGCTGTTGCTGGTGTTGTAATGCAGGCCCTTGTAGCAAGAAATGATGGTGTCTGGAGCAAGGATCACGTTGCTGCTTTACGTAAAATTTGTCCAATGGTCAACAGTGAGATCACATCAGAAGCATCCGCCGCTGAGGTGGAGGGATATGGTGCTTCAAAGCTAACAGTTGATTCTGCCGTGAAATACCTACAACTGGCTAATAAGCTTTTTTCTCTAGCTGAACTCTACCATTTCTGTGCAAGCATTTTGGAACTTGTAATTCCTGTTTACAAAAGCACGCGAGCATATGGACAATTGGCCAAATGCCATACTCAACTTACTAATATCTACGAGTCAATTCTCGACCAGGAGTCAAGCCCAATCCCATTTACGGATGCCACATACTATAGGGTGGGTTTCTATGGTGAAAAATTTGGAAAACTAGATAGACAAGAATATGTATATCGTGAACCACGGGATGTACGACTAGGTGATATAATGGAGAAACTTAGTCACATATACGAGTCTAGGATGGATGGCAGTCACACTTTGCACATTATTCCAGATTCTCGACAAGTGAAGGCAGAAGAACTGCAACCTGGAGTTTGTTATCTGCAAATTACTGCTGTTGATCCCGTCATGGAAGATGAAGATTTGGGGAGCAGAAGGGAAAGAATCTTTTCTCTCTCCACTGGAAGTGTCCGTGCACGTGTCTTTGATCGTTTTCTGTTTGATACCCCATTTACCAAAAATGGTAAGACGCAAGGTGGATTGGAAGACCAATGGAAGCGGCGAACTGTTCTTCAGACTGAGGGCTCTTTTCCTGCCCTTGTGAATAGGCTTTTGGTAACTAAATCTGAATCTCTTGAGTTTTCCCCAGTAGAAAATGCAATCGGAATGATTGAAACCCGCACAGCTGCACTACGAAATGAACTTGAAGAGCCTCGCAGTTCTGAAGGGGATCAACTTCCCCGTCTACAAAGTCTACAGAGAATTCTTCAAGGCAGTGTTGCTGTTCAAGTAAATAGTGGAGTCCTTAGTGTCTGCACAGCCTTCCTTTCGGGTGAACCTGCTACAAGGCTGCGTTCTCAAGAACTACAGCAACTAATTGCTGCTCTCCTCGAATTCATGGCTGTTTGTAAGCGTGCAATCAGAGTTCACTTTAGATTAATCGGAGAAGAAGATCAGGATTTCCACACACAGCTTGTCAATGGGTTTCAATCCCTCACGGCAGAATTGTCCCATTATATTCCCGCTATTCTATCAGAGCTTTAA >LOC_Os03g21080 ATGGACAAGTTTGCAGGAGTTTGCCAGTCAATTCTCCATGATTGCAAATTGACATTCCTTCAGATAATATGTGACCATGATCTTTTTGTTGAGATGCCTGGTCGTGACCCCTCTGATAGAAATTATCTCTCGTCAGTACTTATTCAAGAGATTTTTCTCACCCTTGACCATGATGATCTATCTCAGCGAGCGAAAGCAGCCCGTATTTTGGTTGTTCTAATATGCAAGCATGAATTTGATGCACGATATCAAAAAAGTGAAGACAAGCTGTATATTGCTCAGCTGTATTTTTCTCTTATAGGACAGATTCTAGATGAGATGCCTGTATTCTATAATCTAAATGCTGTTGAAAAGCGTGAGGTGCTGGTAGTCATTTTGCAAATCATAAGGAACTTGGACGACATGACTCTGATCAAAGCATGGCAACAGAGCATTGCTAGAACCAGATTGTTCTTCAAGCTACTTGAAGAATGCATTACCCATTTTGAGCACAACAAAACAGGAGACAGCTTGTTACTAGGCTCAAGTTCACGGAGCCCTGATGCTGAGCGCCCTGCATCTCCAAAGTACTCCGATCGATTATCCCCATCAGTTAATGCATATTTGTCTGAGGCATCACGCCATGAAATAAGGCCTCAGGGAACACCAGAAAATGGATACATGTGGAACAGGGTTAGTCCTCAACTGAGCTCTCCTAACCAGCCCTATTCATTGAGAGAAGCACTTGCTCAAGCGCAGTCTTCAAGGATTGGATCAACCGCGAGGGCACTGAGAGAATCTCTACATCCAGTGCTGAGACAAAAGTTGGAACTGTGGGAAGAAAATCTCAGTACTGCTGTGAGCCTGGAAGTGTTGGGAATAATTGATAAGTTTTCAGTCGCTGCAGCTTCTCGTAGCATCACTACTGATTACGCAAAGCTAGATTGTGTAACATCTGTATTAATGGGTCTTTTATCAAGGAGCCAGCCCTTAGCTTTTTGGAAAGCTTTCCTTCCTGTGGTGTATAATATATTTAACCTCCATGGCGCAACACTGATGGCAAGGGAGAATGATCGCTTCTTGAAGCAAATTGCTTTTCATCTTTTGCGCCTTGCTGTTTTCCGGAATGATTCTATTAGAAAAAGGGCTGTTGTTGGGTTGCAGATTCTTGTTAGGAACTCGTTTAATTATTTTAAGAACACCACAAGGTTGAGGGTGATGTTGACAATCACTTTGTCAGAACTTATGTCTGATGTGCAAGTAACTCAGATGAAATCTGATGGCTCTCTTGAGGAAAGTGGTGAAACTCGGTGCCTTAGGAAATCACTAGAGGAAATGGCTGATGTACGAAGTAAGGATCTCTTGAAAGATTGTGGCCTCCCTGTTAATGCACTGGAGGCAGCGCCTGAAGGGTCGACTGATAATAGGTGGTCTTGGGTAGAAGTTAAACATCTATCCAAATGTCTAGTCCAGGCCCTTGATGCTGGTCTTGAACATGCCCTCTTGGGCTCTGAAATGACTCTGGACAGGTACGCTGCTGCTGAGGGTTTCTATAAGCTAGCAATGGCCTACGCGCCTGTGCCAGATCTTCATATAATGTGGTTACTGCATCTATGTGATGCACATCAGGAGATGCAATCATGGGCTGAAGCTGCACAATGTGCAGTTGCTGTAGCTGGTGTTATCATGCAGGCACTTGTTGGAAGGAATGATGCGGTGTGGAGTAAGGAGCATGTTGCTTCCCTATGTAAGATTTGCCCTATTGTGAACACTGATGTTAGCTCAGAAGCATCTGCAGCAGAAGTTGAGGGATATGGTGCATCCAAGCTTACTGTGGATTCAGCTGTCAAGTATCTTCAGCTGGCAAACAAACTTTTTGCACAAGCCGAACTCTATCACTTTTGTGCTAGTATTCAGGAACTCATCATTCCTGTGTATAAAAGCAGAAGGGCATATGGGCATCTGGCTAAGTGTCATACATCACTCAAGGATATCTATGAGTCAATTCTTGAACAGGAGGCTAGTCCTATACCATTCATTGATGCTACCTACTACCGGGTAGGGTTTTATGGGGAGCGGTTTGGCAAACTCAACAAAAAGGAGTATGTGTTCAGAGAGCCAAGAGATGTTCGTCTTGGTGACATAATGGAGAAGCTTAGTCATATCTATGAGGCTAAAATGGATGGCAATCACACCTTACACATCATTCCGGATTCGAGACAAGTCAACGCTGATGAGTTGCAACCTGGTGTCTGCTATCTGCAGATAACTGCTGTTGATCCTGTAATGGAGGATGAGGACCTAGGGAGTAGAAGGGAAAGGATTTTCTCTTTATCTACTGGTACTGTCCGGGCCCGTGTGTTCGACCGTTTTCTTTTTGATACACCATTCACAAAGAATGGAAAAACACAAGGTGGCCTTGAAGATCAGTGGAAGAGGCGCACAGTACTCCAGACAGAGGGTTCCTTTCCTGCTTTGGTGAATCGTCTGTTAGTGATCAAATCAGAATCTCTAGAGTTTTCTCCTGTTGAGAATGCGATTGGAATGATCGAGACAAGGACAGCTGCCTTGCGAAATGAACTAGAAGAACCACGCAGTTCGGAAGGTGACCAACTCCCAAGACTCCAAAGCCTGCAGAGGATACTCCAAGGAAGTGTGGCTGTTCAGGTAAATAGTGGTGTATTAAGTGTGTGCACTGCATTCTTATCTGGTGAGCCCGCAACTAGGCTCCGATCTCAAGAACTGCAGCAGCTCATCGCTGCATTGCTGGAATTCATGGCCGTCTGCAAGCGCGCAATCCGTGTGCATTTTAGATTGATAGGGGAAGAAGACCAGGAATTCCACACTCAACTAGTCAATGGCTTTCAGTCGCTCACAGCTGAGCTTTCACACTATATTCCTGCAATTCTTTCAGAGCTATAA >Medtr8g056900 ATGCTTCATCTCCGTCACCGTCGTGATTCTACTCCGGCCACTACAAAATGGCGGAACAAGTTTGATGAGAATTTGGAGCAATGGCCGCATCTGAATGAGCTTGTACATTGTTACACTACGGATTGGGTTAAGGATGAGAACAAATACGGTCATTATGAGAGTATTGGAACGCCGTCGTTTTCTAATCAGATTTATGAGGGGCCTGATACTGACATTGAAACTGAAATGCGGCTTGCTGGTGCGAGAAGAACGAAGGGTGAAGACATTAGCGAAGATGACATCCCTAGTACTTCGGGAAGGCAGTTTATGGAAGCTGCAGATGGTGAACATTCAGATGTTCCAAAGCATTTTGGTCAATCTCCCCTTCCTGCTTATGAGCCGGCATTTGATTGGGAAAATGAGAGGTCATTGATATTTGGGCAAAGAATACCGGAAACTCCTATAACACATGGAATGAAGATTTCCGTAAAGGTTCAATCTTTACAATTTCAGGCAGGATTGTCTGAGCCCTTTTACGGTACAATTTGCTTATACAATAGGGAGAGAAGAGAGAAATTATCGGAAGACTTTTACTTTCATATCTCACCAACCGAAATGCAAGATGCCAAAATTACCTGTGAACCCCGCGCAATTTTTTACTTAGATGCGCCATCTGCTTCAGTTTGTTTGTTAATTCAGTTGGAGAAGCATGCTACTGAAGAAGGCGGAGTCACTCCTTCTGTTTATTCTCGTAAAGATTCGGTGCATTTGACTGAGAGAGAGAAGCAAAAATTGCAGGTGTGGTCTCAAATCATGCCTTACAAAGAGTCATTCGCATGGGCCATTGTGTCGCTATTTGATGGCAGTATTGGTGCAGCTTCGGTAGGGCCTGCTTCCCCAAGCAGCCCTCTTGCTTCAAGTGTATTTGGTTTAAGTTCGCATGAAGGTGTTTTTGAGATTAATACAAAAGTCTCGTTAGATGGAAAGCTGAGTTACTCAAATGGAAATTTTGTTGTAGTTGAGGTTTCAAACTTAAATAAAGTCAAAGAAAGCTATACTGAGGAATCACTTCAGGATCCCAAGCGGAAAGTGCATAAACCTGTCAAAGGAGTTCTGAGACTGGAAATTGAAAAGCACCAGATTTCTCAAGCTGATTTGGAAAACATATCAGAATGTGGCAGTGCAACCAATGATTCTGTTGATCCCGGGGATCGCATCGCTGATTCCATGTCTGGAAAGTATCCTAGTAATGGTTGTGATGATCCTCAGGGTAGTATCTCCAGGTGGAACATCAGTGATGCAAAAGAAGTTTTTGGCAATGGAGCAAATCATCATGGAAACTCGGATTTTAATGCTGATGATTTCCATGCTTTTGACTTCCGCACAACAACAAGAAACGAGCCTTTTTTGCAACTTTTTCACTGTCTCTATGTGTATCCGTTGACTGTAAGTTTGGGTAGGAAAAGAAATTTGTTTATACGGGTTGAACTCAGAGAGGACGATGGTGATATTCGCAGACAGCCATTGGAGGCAATTTATCCTAGAGATCCAGGTGTTGAGACATCATTTCAGAAATGGGGTCACACCCAAGTTGCTGTTGGGGCTAGGGTTGCTTGCTACCATGACGAAATTAAACTTTCCCTTCCTGCCATGTGGACACCAATGCACCACCTTCTTTTTACTTTATTTCACGTTGATCTGCAAACGAAATTGGAAGCACCAAAGCCAGTGGTAATTGGATATGCAGCACTTCCTTTATCGTCACATGCTCAGTTGCGTTCGGAAATCAATCTCCCGATTTTGAGAGAGTTGGTCCCGCATTATCTCCAGGATGCAGGACGGGAGAGATTGGATTATTTGGAAGATGGGAAAAATGTCTTCAGACTGCGTTTACGGTTATGTTCTTCTTTATACCCTATCAATGAACGTATTAGAGACTTTTTTCTCGAATATGATCGACACACTCTTCGAACAAGTCCACCTTGGGGTTCTGAACTGCTAGAGGCTATTAATAGTTTGAAGAACGTTGATTCTACTGCTTTACTTCAGTTTCTTCACCCAATTCTTAACATGCTGCTTCATCTTATTGGCAATGGTGGAGAAACACTCCAGGTTGCAGCTTTCCGGGCTATGGTTAATATTGTAACTAGGGTGCAGCAGGAGTCGGTTGACGATGCTGAAAGAAATCATTTTCTAGTCAACTATGTTGATTGTGCTTTCGATGACTTTGGGGGTCGTCAACCACCAGTATATCCTGGGTTATCTACTGTTTGGGGAAGTCTGGCACGAAGTAAGGCTAAAGGGTATCGTGTTGGACCAGTGTATGATGATGTTTTGGCAATGGCATGGTTTTTTCTGGAGTTGATTGTTAAATCAATGGCATTGGAGAAGACTCGCCTCTTCTATCATAGCCTTCCAATAGGTGAAGATATCCCACCGATGCAGTTGAAGGACGGTGTATTCAGATGCATAATGCAGTTGTATGATTGCCTTCTCACTGAGGTGCACGAGCGCTGCAAGAAGGGTTTAAGCTTGGCAAAGCGCTTGAACAGTAGTCTGGCCTTCTTTTGTTATGACCTTCTATCAATTATTGAGCCACGACAAGTTTTTGAGTTGGTATCATTATATCTCGATAAGTTCTCTGGTGTATGTCAATCAGTTCTTCACGAGTGCAAACTTACCTTTCTTCAAATAATCTGTGACCATGATCTTTTTGTTGAAATGCCTGGGAGAGACCCTTCAGATAGGAACTATCTTTCCTCTGTCTTGATACAAGAACTCTTTGTTACTTGGGATCATGAAGATTTGTCTCTACGGGCAAAGGCAGCAAGAATATTGGTAGTGCTCTTGTGCAAACATGAGTTTGATGTGAGATACCAAAAGCCTGAAGATAAGTTGTATATTGCTCAGCTATATTTGCCGGTTATTGGACAGATATTAGATGAGATGCCTGTTTTCTACAACCTGAATTCTGTTGAGAAGCGTGAAGTTTCCATTGTAATTCTAGAAATAGTTCGAAATCTTGATGATGCATCACTGGTGAAGGCATGGCAGCAAAACGTTGCCCGGACTAGATTGTTTTTCAAGCTCATGGAGGAATGCTTACTGCTATTTGAGCACAAAAAACCTTCTGATGGCATGTTACTTGGCTCTAGTTCTCGCAATCCCGTAGGGGAGACACCTGCTTCCCCCAAATACTCTGAGAGACTTTCTCCCGCAATCAACAATTATCTATCTGAGGCCTCAAGGCAAGAAGTCAGGCCTCAGGGAACACCTGATAATGGATATTTATGGCAGAGAGTAAATTCCCAGTTAAGCTCTCCTAGCCAGCCATATTCCTTGAGAGAAGCTCTTGCCCAAGCACAGTCATCTAGGATTGGAGCTTCTGCTCAAGCACTTCGAGAATCTTTGCACCCACTTTTGAGGCAAAAATTGGAGCTATGGGAAGAAAATTTGAGCGCTTCTGTCAGTCTTCAGGTCTTGGAAGTGACTAAAAAGTTTTCAGTGATGGCAGCATCACAGAGCATTGCTACTGATGTTGGAAAACTTGATTGCATCACGGCTGTATTCATGAGCTTTCTATCTAGAAATCAGCCATTGTCTTTTTGGAAAGCATTTTTTCCTGTATTTAACAGTGTGTTTGATTTACATGGGGCAACTCTAATGGCAAGAGAAAATGATCGTTTTCTAAAGCAAGTCACTTTCCATCTCCTCCGGCTTGCAGTTTTCAGAAACGACAACATCAGGAAAAGGGCAGTTGTTGGGCTTCAAATACTTGTGAGGTGTTCATTTCATCACTTTACACAGACAGCAAGGTTAAGAGTCATGTTGATCATCACTTTATCGGAGTTAATGTCTGATGTGCAAGTGACTCAAATGAGATCTGATGGTAGCCTAGAAGAGAGTGGTGAAGCACGGAGACTTAGAAAATCCTTAGAGGAAATGAAAGATGAAACTAAAAGTTCTTTCCTATTGGAGGAGTGTGGGTTACTTGAGAATGCTCTTGTAGCCATACCAGAAAAAAAGGCAGAGAATAGATGGTCCTGGTCAGAGGTGAAATATCTCTCTGACAGTCTTCTCTTAGCCCTGGATGGTAGCTTGGAACATGCACTATTGGCCCCTGTAATGACTATGGATAGATATGCGGCAGCTGAGAGCTTCTATAAACTGGCAATGGCATTTGCTCCAGTCCCTGATCTTCACATAATGTGGTTACTTCATCTATGTGATGCACATCAGGAAATGCAGTCATGGGCTGAAGCCGCTCAATGCGCCGTTGCCGTTGCTGGTGTTGTAATGCAGGCCCTTGTTGCCAGAAAGGATGGTGTTTGGAACAGAGACCATGTTGCTGCTCTACGTAAGATTTGTCCTATGGTTAGCAGTGAGATCACGTGTGAAGCATCTGCTGCAGAGGTAGAGGGATATGGTGCATCAAAACTGACAGTTGACTCTGCTGTGAAATACTTGCAGCTTGCTAATAAGCTTTTTTCACAAGCTGAGCTATTTCATTTCTGTGCAAGCATTCTGGAACTCGTAATCCCAGTTAACAAGAGCAGACGGGCTTATGGACAGCTGGCTAAATGTCATACTTTACTTACTAATATCTACGAATCAATACTTGAACAGGAATCTAGTCCGATTCCTTTCACTGATGCAACATACTATAGGGTTGGATTTTATGGTGATAGATTTGGAAAACTTGACAAAAAGGAGTATATATATCGTGAACCTCGTGATGTACGTCTTGGGGACATAATGGAAAAACTTAGTCACATATATGAGTCCAGAATGGATGGTGATCACACTTTGCATATTATTCCAGATTCTAGACAAGTGAAGGCAGAAGAGTTGCAGCCTGGTGTCTGCTACCTTCAGATTACTGCTGTTGATGCAGTCATGGAAGATGAGGATTTAGGAAGTAGAAGAGAGAGAATTTTCTCTCTTTCTACTGGAAGTGTTCGTGCCCGTGTGTTTGACCGATTTTTGTTTGATACCCCATTTACAAAAAATGGCAAGAATCAAGGTGGACTGGAAGATCAATGGAAGCGACGCACTGTTCTTCAGACTGAGGGTTCATTTCCAGCTTTAGTAAATAGGCTATTGGTAATCAAATCCGAGTCTCTTGAATTTTCACCTGTAAAAAATGCCATTGGAATGATTGAAACACGAACAGCTGCATTAAGAAATGAGCTTGAAGAGCCTCGAAGTTCTGAAGGGGATCAACTTCCAAGACTTCAAAGTCTACAAAGAATCCTCCAAGGCAGCGTTGCAGTACAAGTAAATAGTGGAGTTTTGAGTGTTTGCACAGCCTTCTTGTCTGGAGAGCCAGCTACAAGATTGCGGTCACAGGAACTTCAGCAACTGATAGCCGCCCTTCTTGAATTCATGGCCGTTTGCAAACGAGCCATCCGGGTACATTTCAGATTAATAGGTGAGGAAGATCAGGATTTCCATACCCAACTTGTAAATGGATTTCAGTCTCTAACAGCAGAGTTATCACATTACATTCCTGCCATTCTCTCAGAGCTATGA >AT4G16340 ATGGAGAACAACAATCTTGGTCTTCGATTTCGTAAGCTACCTCGTCAGCCTCTTGCTCTCCCTAAGCTCGATCCTTTGCTTGATGAGAATCTGGAACAATGGCCACATTTGAATCAATTGGTTCAATGTTATGGCACTGAATGGGTTAAAGATGTTAACAAATACGGTCACTATGAAAATATTCGACCTGATTCTTTCCAGACTCAGATTTTTGAAGGACCTGATACTGATACTGAGACTGAGATTCGTCTTGCTAGTGCCAGGAGTGCAACTATTGAGGAGGATGTTGCCAGTATTTCCGGGAGGCCGTTTTCTGATCCTGGATCCTCTAAGCATTTTGGGCAACCTCCTTTACCTGCTTATGAACCAGCTTTTGACTGGGAAAATGAAAGAGCTATGATTTTTGGTCAGAGAACTCCTGAATCTCCTGCAGCTAGCTATTCCAGTGGATTGAAGATCTCTGTCAGAGTTTTGTCTCTAGCTTTTCAGTCTGGCTTAGTTGAACCATTTTTTGGCTCGATTGCATTGTACAATCAAGAGAGGAAGGAGAAACTCTCTGAGGATTTTTATTTCCAGATTCAGCCGACGGAAATGCAGGATGCTAAACTTTCATCTGAAAATCGTGGAGTATTTTATCTAGATGCCCCATCAGCATCAGTTTGCCTGCTTATTCAATTAGAAAAAACAGCAACTGAGGAAGGAGGCGTTACATCATCTGTCTATTCCCGTAAAGAGCCTGTGCACTTAACTGAGAGGGAAAAGCAAAAGTTGCAGGTCTGGTCTCGCATTATGCCTTACCGAGAGTCTTTTGCTTGGGCAGTTGTTCCGCTTTTTGATAATAATCTCACCACAAACACTGGTGAATCTGCTTCCCCTAGCAGTCCTCTTGCTCCTAGTATGACTGCGTCAAGTTCCCATGATGGTGTTTATGAACCAATTGCAAAGATCACATCAGATGGAAAGCAAGGTTATTCAGGTGGAAGTTCTGTCGTAGTTGAAATATCTAATTTAAATAAAGTTAAAGAGAGCTACTCTGAAGAGTCCATTCAGGACCCCAAACGGAAGGTTCACAAACCTGTTAAAGGGGTTCTAAGACTGGAAATTGAGAAACATCGGAATGGACATGGAGACTTTGAAGATCTATCTGAGAATGGAAGTATCATAAATGACTCCCTTGATCCAACTGACCGCCTCAGTGACCTGACTCTTATGAAGTGTCCCAGTTCTAGTTCTGGTGGACCCCGTAATGGCTGTTCAAAGTGGAATTCAGAGGATGCAAAGGATGTTTCGAGAAATCTAACAAGTTCATGTGGGACTCCTGACTTAAATTGTTATCATGCTTTTGATTTTTGCTCTACGACAAGAAACGAGCCTTTTCTACATCTCTTCCATTGCCTTTATGTGTATCCTGTAGCTGTTACTTTAAGTCGGAAGAGGAATCCCTTTATCCGTGTAGAATTGAGAAAGGATGACACAGATATCCGAAAACAACCACTCGAGGCAATATATCCAAGAGAACCTGGTGTTTCACTCCAGAAATGGGTTCATACACAGGTCGCTGTTGGTGCTAGGGCCGCTAGCTACCATGATGAAATTAAGGTCTCTCTTCCTGCCACATGGACGCCATCACATCATCTGTTATTCACTTTTTTTCATGTTGATCTCCAGACAAAGCTTGAAGCTCCAAGACCAGTAGTTGTTGGATATGCATCACTTCCATTATCTACATATATCCACTCACGGTCTGATATTTCTCTACCAGTAATGAGAGAACTTGTTCCCCACTATCTTCAGGAAAGCACCAAGGAGAGGTTGGATTATTTGGAAGATGGCAAAAATATTTTTAAGTTGCGACTGAGACTTTGTTCATCTCTTTATCCCACCAACGAACGTGTCAGGGATTTCTGTCTAGAGTATGATAGACATACCCTCCAGACAAGGCCTCCCTGGGGTTCAGAACTGTTGCAGGCAATAAACAGTTTGAAGCACGTTGATTCTACTGCCTTGCTTCAGTTTCTTTACCCAATTCTTAACATGCTCCTTCATCTTATTGGCAATGGTGGAGAAACCCTTCAGGTTGCAGCATTCAGAGCCATGGTGGATATTTTAACTCGGGTGCAGCAGGTGTCGTTTGATGATGCTGACCGAAATCGATTTCTGGTCACCTATGTTGATTATTCTTTTGATGATTTTGGAGGCAATCAACCACCGGTTTATCCTGGATTAGCAACTGTGTGGGGAAGTTTAGCTAGAAGCAAGGCCAAAGGTTACCGGGTTGGACCTGTATATGACGATGTATTATCAATGGCGTGGTTTTTCCTCGAGTTGATTGTTAAATCAATGGCATTGGAGCAAGCACGTCTTTATGATCACAATCTACCTACAGGCGAGGATGTTCCACCCATGCAGCTCAAAGAAAGTGTTTTCCGATGTATCATGCAATTGTTTGATTGTCTTTTAACTGAAGTACATGAACGTTGTAAAAAGGGCTTAAGCTTGGCGAAACGTCTGAACAGCAGTTTGGCCTTCTTCTGTTATGATCTTTTATATATCATTGAGCCCTGCCAGGTCTATGAACTGGTATCGTTATACATGGACAAGTTTTCTGGTGTTTGTCAATCTGTTCTACACGAATGCAAGCTCACGTTTTTGCAAATTATCTCCGACCATGATCTTTTTGTAGAAATGCCTGGTAGAGACCCATCAGACAGGAACTATTTATCATCCATATTAATACAGGAGTTATTTCTCTCACTGGATCATGATGAGCTGCCTCTGCGGGCGAAGGGAGCAAGAATTTTAGTGATCCTTTTATGCAAGCATGAATTTGATGCGCGGTACCAGAAAGCTGAAGATAAGCTGTATATTGCACAACTGTATTTTCCTTTTGTCGGGCAGATTTTAGATGAAATGCCTGTTTTTTATAACCTAAATGCTACTGAAAAGCGTGAGGTTTTAATTGGTGTGCTGCAAATTGTTCGTAATCTGGATGACACATCACTTGTCAAAGCATGGCAGCAGAGCATCGCTCGTACTCGATTATATTTCAAACTCATGGAAGAATGCCTCATACTTTTCGAGCACAAGAAGGCTGCTGACAGCATCCTCGGGGGCAACAATTCTCGTGGTCCTGTTAGTGAAGGAGCTGGATCACCAAAGTACTCCGAGCGACTTTCTCCTGCTATCAACAATTATCTGTCAGAGGCTTCTCGCCAAGAAGTCAGGCTAGAGGGAACACCTGATAATGGGTACCTGTGGCAGAGAGTTAATTCTCAGTTGGCCTCCCCTAGCCAACCTTATTCTCTAAGAGAAGCTTTAGCTCAAGCACAATCTTCCCGGATTGGAGCTTCAGCCCAGGCACTAAGAGAATCGCTGCACCCAATTTTGAGGCAAAAACTGGAACTTTGGGAGGAGAATGTAAGTGCCACTGTTAGCCTCCAGGTTTTGGAGATCACTGAAAATTTTTCATCAATGGCAGCCTCTCACAATATTGCGACCGACTATGGCAAATTGGACTGCATTACTACAATACTGACGAGTTTCTTCTCCCGAAACCAGTCATTAGCTTTCTGGAAAGCCTTCTTTCCAATTTTCAACAGAATCTTTGATCTTCATGGGGCTACACTGATGGCCAGGGAAAATGATCGCTTCTTAAAACAGATAGCCTTCCATCTTCTCCGGCTTGCTGTTTACCGCAATGACAGTGTCAGGAAAAGGGCTGTTATTGGTCTTCAAATACTAGTTAAGAGCTCGCTATACTTTATGCAGACTGCTAGGCTGAGGGCTTTGCTGACGATTACACTGTCAGAACTCATGTCGGATGTCCAAGTGACTCATATGAAGTCAGATAATACATTAGAAGAGAGTGGAGAAGCACGGCGACTTCAACAGTCATTAAGCGAAATGGCTGATGAAGCTAAGAGTGTCAATTTGTTGAGGGAGTGTGGTCTTCCTGATGATACACTGTTGATTATTCCCGAGAAATTTACAGAGAACCGCTGGTCATGGGCTGAAGTCAAACATCTTTCTGACAGCCTTGTTCTTGCTCTTGATGCCAGCCTCGGGCATGCCCTTTTGGGATCTGTGATGGCTATGGATCGATATGCTGCTGCAGAGAGCTTCTACAAACTTGGAATGGCGTTTGCTCCTGTTCCGGATCTTCACATAATGTGGTTATTGCATCTATGTGATGCCCACCAGGAAATGCAGTCTTGGGCAGAAGCTGCACAGTGTGCTGTGGCGGTTGCAGGTGTGATAATGCAGGCCTTGGTGGCTAGGAATGATGGTGTGTGGAGCAAGGATCATGTGTCTGCCTTGCGTAAGATTTGCCCGATGGTAAGTGGCGAGTTTACAACAGAGGCATCTGCAGCTGAAGTCGAGGGTTATGGTGCTTCAAAGCTAACAGTTGACTCCGCCGTCAAGTATTTACAGCTTGCTAATAAGCTTTTCTCTCAAGCTGAGCTCTACCATTTTTGTGCAAGCATTTTAGAACTTGTTATTCCAGTTTACAAGAGCAGGAAGGCTTATGGGCAGTTGGCTAAGTGTCACACTTTACTTACTAATATATACGAGTCCATTCTTGACCAAGAATCAAACCCAATCCCATTTATTGATGCTACATATTACCGGGTGGGATTTTATGGGGAAAAGTTTGGGAAGTTGGACAGGAAAGAATATGTATACCGAGAACCACGAGATGTGCGGCTAGGGGATATAATGGAAAAACTGAGCCATATATATGAGTCAAGAATGGACAGCAACCATATTCTGCACATTATACCAGATTCGAGGCAAGTGAAGGCAGAAGACTTGCAGGCAGGAGTGTGCTATCTGCAAATTACTGCTGTTGATGCAGTGATGGAAGATGAGGATCTTGGGAGCAGAAGAGAGAGAATATTTTCTCTTTCAACTGGAAGTGTTCGAGCACGAGTGTTTGATCGTTTCTTATTTGACACACCATTTACGAAAAATGGTAAAACCCAAGGTGGATTAGAAGATCAATGGAAGAGAAGAACAGTGCTGCAGACTGAGGGTTCATTCCCTGCCCTTGTGAATAGGCTGTTGGTTACCAAGTCTGAATCCCTTGAATTCTCGCCAGTGGAGAATGCGATTGGAATGATTGAAACGCGGACAACCGCTCTGAGAAATGAGCTAGAGGAGCCTCGTAGCTCGGATGGGGATCACCTACCACGGCTTCAAAGTCTGCAGAGGATTCTCCAAGGAAGTGTTGCAGTGCAGGTGAACAGTGGGGTGTTGAGCGTGTGCACAGCTTTCTTATCAGGAGAGCCTGCAACGAGATTGCGTTCACAGGAACTGCAGCAACTAATCGCGGCACTGCTTGAATTCATGGCGGTTTGTAAGCGAGCCATTAGGGTTCACTTTAGATTAATCGGAGAAGAAGATCAGGAATTCCATACTCAGCTTGTCAATGGATTTCAGTCTCTCACCGCAGAACTCTCCCATTACATCCCTGCTATCTTATCCGAACTTTAG >COL.COLO4_11259 ATGGAGACTAACGTCTCTAGCAATGGCAACGGCGGGGGCAGTTATCGCTTTCGGAGAATTTCACGGCACTCACTGGCTCATCTCAAGCTGGATCCTCTGCTTGACGAAAACTTGGAGCAGTGGCCACATCTAAATGAACTCGTTCAATGCTATAGAAGTGATTGGGTTAAAGATGATAACAAATATGGCCACTACGAACCTATCAGTCCTGTTTCCTTTCAAAATCAGATATTTGAAGGGCCAGATACTGATATTGAGACTGAAATGCAGCTTTCCAGTGCGAGGCAAATCAAAGCTGAAGATGCTACAGATGATGATGTCCCAAGTTCCTCAGGAAGGCAATTCACTAACTCTGATATCACAAAGCATTTTGGCCAATCTCCACTTCCAGCTTATGAACCAGCTTTTGACTGGGGAAATGAGAGGTCAATGATTTTTGGCCAAAGGATTCCAGAAACCCCTACAACACAGCATGGCAGTGGATTGAAGATCTCCGTCAAAGTTCTGTCCCTTTCCTTTCAAGCTGGACTTGTTGAGCCATTCTATGGAACCATTTGCATATATAATAGGGAGAGAAGAGAAAAATTGTCAGAAGATTTCTATTTTTCTGTACTGCCAAGTGAAATGCAGGATGCTAAAGAGCCTTCAGAACCTCGTGGAATATTCTATTTAGATGCTCCATCAGCATCTATCTGTTTGCTAATCCAGTTAGAGAAGCCAGCAACAGAAGAAGGAGGTGTAACCCCTTCAGTTTATTCACGTAAAGACCCGGTGCACCTGTCTGAGAGAGAGAGGCAGAAGCTGCAGGTGTGGTCTCGTATAATGCCTTACAGAGAGTCCTTTGCCTGGGCAATTGTTCCATTATTTGATAACAGCATCGGTGCAGCTTCTGGTGGGTCGGCTTCTCCTAGTAGCCCTCTTGCTCCCAGCATGTCTGGGTCGAGTTCACATGAGGGAGTCTTTGAGCCTATTGCAAAGATCACATCAGATGGAAAGCTGGGATATTCAAGTGGGAGTTCTGTTATTGTTGAAATATCTAATCTAAATAAAGTTAAAGAAAGCTATACCGAGGAATCACTTCAGGATCCTAAACGAAAGGTTCATAAGCCCGTCAAAGGTGTTTTAAAATTGGAAATTGAGAAGCATCAGACTGTCCAGACTGAGTTAGAAACTTTATCAGAAAGTGGCAGTGTGACAAACGATTCCCTGGATCCCAGGGATCCTATGTCTGATATGATGTTTCCAAAGAGTCCTGGCAATGGTCTCGATGGATCTCAGAGTAGCAACTCCAAATGGATTTCAGGTGATGGGAAAGATGTCTCTGGAAATGGTTCTAACAATCGGGGAAATCAAGATTTTTGTGCTGATGATTTCCAGGCTTTTGACTTCCGTACAACAATGAGAAACGAGCCATTCTCCCAGCTTTTTCATTGTCTATATGTATATCCCTTAACTGTGAGCTTGAGTCGGAAAAGGAATCTATTCGTACGAGTTGAGCTAAGAAAGGATGATGCTGAGGCTCGTAGGCAGCCTTTAGAGGTACTGTATCCGAGGGAGCGTGGTTCATCACTGCAGAAATATTCTCACACACAAGTTGCTGTTGGTGCTAGGGTGGCCTGCTACCATGATGAGATTAAAGTTTCACTTCCTGCTGTCTGGACACCGTTGCATCACCTTTTATTTACTTTCTACCATGTTGATCTTCAAACAAAACTTGAAGCTCCAAAACCAGTAGTTATCGGATATGCATCACTTCCATTGTCCACACATGCTCAATTACGATCTGAAATTTCTTTACCAATAATGAAAGAACTGCTTCCACACTATCTCCAGGATTCTGGCAAGGAGAGGTTGGATTATGTGGAAGACGGAAAAAGCATTTTCAAATTGCGGTTAAGACTCTGTTCGTCTCTTTACCCAATTAATGAGCGCATCAGGGATTTCTTTCTTGAATATGATAGACACACTCTTCGAACAAGCCCGCCTTGGGGTTCTGAACTCTTGGAGGCAATTAACAGCTTAAAGAATGTTGATTCTACTGCTTTGCTTCAGTTTCTTCACCCAATTTTGAATATGCTTCTCCATCTTATAGGGAATGGCGGAGAAACCCTTCAGGTTGCTGCATTCAGAGCCATGGTTAATATTCTAACCAGGGTGCAGCAAGAGTCAGTTGATGATGCTGAACGCAATCGTTATCTAGTTAACTATGTAGACTACGTTTTTGATGACTTTGGTGGTCGTCAACCCCCAGTTTATCCGGGATTGTCTACTGTGTGGGGTAGCTTGGCTCGTAGTAAGGCGAAGGGTTATCGTGTTGGACCAGTATATGATGATGTTTTGGCAATGGCTTGGTTTTTTCTCGAACTTATTGTCAAGTCAATGGCGCTGGAACAAACACGTCTTTTCTATCATAGTCTTCCATTAGATGAAGATGTTCCGCCGATGCAGTTGAAGGAAGGTGTGTTCAGATGTATATTGCAGTTGTATGATTGCCTTCTAACTGAAGTCCATGAACGTTGTAAGAAAGGGCTAAGCTTGGCGAAACGACTGAACAGCAGTTTGGCATTTTTTTGTTACGATCTTTTGTCTATCATTGAGCCTCGCCAAGTTTTTGAATTGGTGTCCTTGTACCTGGACAAGTTTTCTGGGGTATGTCAATCAGTTCTGCATGATTGTAAGCTAATCTTTCTGCAGATAATATGTGATCATGATCTTTTCGTGGAAATGCCTGGGAGAGACCCTTCAGATAGGAACTATCTGTCATCTGTTTTGATTCAAGAGCTTTTCCTTACTTTGGATCATGATGATTTATCTCAGCGTGCTAAGGCAGCTAGAACTTTGGTAGTTCTTTTATGTAAGCATGAGTTTGATGCTCGGTATCAAAAGCCTGAAGACAAGCTGTATATTGCCCAGCTATATTTTCCACTTATTGGCCAGATTCTTGATGAAATGCCTGTATTTTACAACTTAAATGCTGCTGAAAAGCGTGAAGTTTTGATTATTATCTTGCAAATCATTCGGAATCTGGATGATGCATCAATTGTCAAGGCTTGGCAGCAAAGTGTTGCTCGAACTAGATTATTTTTTAAACTCATGGAGGAATGCTTGGTTCTTTTTGAGGTTCATGATGCGGTTAAGCATAGAAAGCCTGCTGATGGTATGCTTATAGGCAGCAGTTCTCGCAATCCTGTGGGTGATGGACCTACTTCACCAAAATACTCTGAGAAGCTTTCTCCTGCAATCAACAATTATCTATCTGAGGCATCAAGACAAGAAGTTAGGCCTCACGGTACACCTGATAATGGCTACTTGTGGCAGAGGGTGAATTCTCAGCTAAGCTCCCCAAGCCAACCATATTCCTTGAGAGAAGCTCTAGCTCAGGCACAATCTTCTCGGATTGGAGCTTCGGCCCAGGCACTCAGAGAATCTTTGCACCCAATTTTGCGACAAAAACTGGAGCTTTGGGAAGAAAACTTGAGTGCTGCTGTTAGTCTTCAGGTTTTGGAAATATCTGAAAAATTTTCTGTGATGGCAGCATCCCATAGCATTGCTACCGATTATGGAAAACTTGATTGTTTATCATCTATAATTATGAGCTTCTTTTCCAGAAATCAGCCCCTGGCTTTTTGGAAAGCATTCTTACCCGTCTTCAACCATGTCTTTGATCTTCATGGGGCAACACTAATGGCAAGGGAGAATGACCGTTTCTTAAAACAAGTTGCTTTTCACCTTCTTAGGCTTGCAGTATTTCGAAATGATAATATTAGGAAAAGAGCTGTTGTTGGACTTCAAATTCTCGTGAGGAGTTCATTCTACTTCATGCAGACTGCAAGGTTGAGGGTAATGCTGACCATCACGTTGTCCGAGCTAATGTCTGACATGCAGGTGACTCAGATGAAGTCTGATGGGACACTTGAAGAAAGTGGTGAAGCACGGCGTCTTCGAAACTCTTTGGAAGAAATGGCTGATGAGGTCAAGAGCTCTGACCTTTTGAAGGAGTGTGGACTTCCTGAAAATTCTCTGTCGGTGACTCCTGAAAATTTTGAAGCAAACCTATGGTCCTGGTCAGAAGTGAAATCTCTTTCTTCCAGTCTTCTTCTGGCCCTTGATGCTAGTCTAGAACATGCGCTATTGGAAGATGGTGAGCAGAGGGAAAGAAATGCCAGTGGGGGTGGCTTGCAATCTGTACAAAGAAATGCTTATGTATTATCGCGTCAATATTTACTGCTTCAAGCTTCGCAGGCCTCTGTAATGTCCATGGATAGATATGCTGCAGCAGAAAGCTTTTACAAGCTTGCGATGGCATTTGCCCCCGTCCCAGATCTTCACATAATGTGGTTACTGCATTTGTGTGATGCACATCAAGAAATGCAGTCTTGGGCTGAAGCTGCGCAGTGTGCTGTGGCTGTTGCTGGTGTTGTAATGCAGGCCCTTGTTGCTAGAAACGACGGTGTTTGGAGCAAGGATCATGTGACAGCTTTACGTAAAATTTGTCCTATGGTCAGCAGTGAAATTACATCTGAGGCATCAGCTGCTGAGGTTGAGGGATATGGTGCTTCGAAGCTCACAGTCGACTCTGCTGTTAAGTACCTACAACTGGCAAATAAGCTTTTCTCTCAAGCCGAACTCTATCATTTCTGTGCAAGCATTTTGGAACTTGTAATTCCAGTTTACAAGAGCAGAAGGGCGTACGGGCAGTTGGCTAAATGTCATACATTGCTCACAAATATCTATGAATCAATCCTTGAGCAGGAGTCAAGCCCTATTCCATTCACTGATGCTACTTATTATAGGGTTGGTTTCTATGGTGAGAAATTTGGTAAGCTTGACCGTAAGGAATATGTTTATCGAGAACCACGTGATGTTCGCTTGGGTGACATAATGGAAAAACTTAGTCATATATACGAATCAAGGATGGATGGTAATCATACTTTGCACATTATTCCTGATTCAAGACAGGTGAAGGCAGATGAGTTGCAGCCTGGGGTCTGTTACCTTCAAATTACAGCTGTTGATCCAGTCATGGAAGATGAAGATTTGGGAAGCAGAAGGGAGAGAATCTTTTCTCTCTCGACTGGAACTGTCCGTGCACGTGTCTTCGACCGCTTCTTATTTGATACTCCATTCACAAAAAATGGCAAGACCCAAGGTGGATTGGAGGACCAATGGAAGAGGAGAACTGTTCTTCAGACTGAGGGCTCATTCCCTGCACTGGTCAATAGGCTCTTGGTGATAAAATGCGAATCCCTTGAATTTTCCCCAGTAGAAAATGCAATCGGAATGATTGAAACTCGTACAGCTGCCCTACGTAATGAGCTTGAAGAGCCTCGTAGTTCTGAAGGAGATCAACTGCCACGTCTCCAGAGTCTTCAGAGAATTCTTCAAGGCAGTGTTGCAGTTCAAGTCAATAGTGGTGTTTTGAGTGTTTGCACGGCTTTCTTGTCTGGTGAACCTGCCACAAGGTTGCGTTCTCAGGAATTACAGCAACTAATTGCTGCACTCCTTGAATTTATGGCTGTTTGCAAGCGTGCAATACGGGTACACTTCAGATTGATTGGAGAAGAAGACCAGGATTTCCATACTCAACTAGTGAATGGATTTCAGTCTCTCACGGCAGAGTTATCTCATTACATTCCTGCAATTCTCTCAGAGCTCTGA >Vradi0367s00020 ATGCTCCACCTCCGGCAACGCCGCGACGCCACGCCGGCCACCACAAGGTGGCGCAACACGTTTGAGGAGAATCTGGAGCAGTGGCCGCACCTCAACGAACTAGTCCATTGTTATACCACGGATTGGGTCAAGGATGAGAACAAGTACGGACACTATGACTCCGTTGGAACGCCGTCGTTTCATAACCAGATATATGAAGGCCCTGACACTGACATTGAGACCGAAATGCGGCTTGCTGGGGCAAGGCGAACGAAGGGTGATGATATTAGTGAAGATGATGCACCAAGTACATCGGGAAGGCAGTTTCCGGAAGGTGCGGATGGTGACTTGCTTCATGCAGATGTTCCAAAGGTTGTTGATGGTTTAGTTCCTTGTTTTTATTCTGTTGGAGATTCTGTTCTACATATTGGTCAATCTCCCCTTCCTGCTTATGAACCAGCATTTGATTGGGAAAATGAGAGGGCATTGATATTTGGACAAAGGATACCGGAAACTCCTATATCGCATGGAATGAAGATATCTGTAAAAGTTCAGTCTTTACAATTTCAAGCAGGATTGGTTGAGCCCTTTTATGGTACAATTTGCTTATACAATAGGGAGAGAAGAGAAAAGTTGTCGGAAGACTTTTACTTTCACGTCTTACCAACAGAAATGCAGGATGCCAAAATTACATATGAACCTCGTGCAGTCTTTTACTTAGATGCACCATCTGCTTCAGTTTGTTTGTTAATCCAGTTAGAGAAGCATGCTACTGAAGATGGCGGGGTTACTGCTTCTGTTTATTCACGTAAAGATCCAGTGCACTTGACTGAGAGAGAGAAGCAAAAACTGCAGGTGTGGTCTAAAATCATGCCTTACAAAGAGTCCTTCGCATGGACCATTGTATCATTATTTGATAGCAGTATTGGTGCAGCTTCAGTAGGGCCTGCTTCCCCGAGCAGCCCTCTTGCTCCAAGTGTATCTGGTTCAAGTTCTCATGAAGGTGTTTTTGAGACTAGTGCAAAAATGTCATTAGATGGAAAGCTGAGTTACTCTAATGGAAATTCTGTGGTAGTTGAGGTTTCAACCTTAAATAAAGTAAAAGAATGCTATACGGAGGAATCACTTCAGGATCCTAAACGTAAGGTGCACAAACCGGTCAAAGGTGTTTTGAGGCTGGAAATTGAGAAACACCAGATTTCCCATGCTGATTTGGAGAATGTGTCAGAAAGTGGAAGTATAACCAATGATTCTGTTGACCCAGGGGATCGTGTTGCAGATTCACTATCTGGAAAGTATACTAGTAATGGCTGTGATGATCCTCAGGGTAGCATCCCCAGGGTAGTATCTCCAGCTTCCGGAAATGGAGCTACTCATCATGGAAATTCAGATTTTAATGCTGAAGATTTCCATGCATTTGACTTCCGCACTACAACAAGAAACGAGCCTTTTTTGCAACTTTTTCACTGCCTATATGTGTATCCGTTGACACTAAGTTTGGGTAGGAAAAGGAATTTGTTTATACGGGTTGAACTCAGGGAGGATGATGGTGATATCCGTAGGCAGCCATTGGAGGCAATATATCCTAGAGATCCAGGTGTGGATGCATCTCTTCAGAAGTGGAGTCACACCCAAATTGCTGTTGGAGCTAGGGTTGCTTGCTACCATGATGAAATTAAACTTTCCCTCCCTGCTATGTGGACACCAACGCACCACCTTCTATTTACTTTATTTCATGTTGATCTGCAAACGAAATTAGAGTCTCCGAAGCCAGTAGTAATTGGATATGCAGCACTTCCTTTATCTTCCCATGCCCAGCTGCGGTCTGAAATAAATCTTCCAATTATGAGAGAATTGGTTCCTCACTATCTACAGGATTCAGGACGGGAGAGATTGGATTATTTGGAAGATGGGAAAAGTGTGTTCAGATTGCGTTTACGATTATGTTCTTCGTTATACCCTATCAATGAACGTATTAGAGATTTCTTTCTTGAATATGATCGGCACACTCTTCGAACAAGTCCACCATGGGGTTCTGAACTTCTGGAGGCTATTAATAGTTTGAAGAATGTTGATTCCACTGCTTTACTTCAGTTTCTTCACCCAATTCTTAACATGCTACTCCATCTTATTGGCAATGGCGGAGAAACACTCCAGGTTGCTGCATTTCGGGCCATGGTTAATATTGTAACCAGGGTGCAGCAGGAGTCGGTTGATGATGCCGAAAGAAATCATTTTCTAGTCAACTATGTTGACTGTGCTTTTGATGATTTTGGTGGTCGGCAACCACCTGTATATCCCGGACTATCCACTGTTTGGGGAAGCTTGGCACGAAGTAAGTCCCTTGTGGAAGAGGTGGAGATCAAACCATATGAGGAGGACGTGGTGGCCAAAGGTTATCGTGTTGGACCTGTGTATGATGATGTTTTGGCTATGGCTTGGTTTTTTCTGGAGTTAATTGTTAAATCAATGGCATTGGAGAAGACTCGCCTGTTCTATCACAGCCTTCCAATAGGGGGAGCCGGGGAAACAAACTTGGGTTTAAGGACTAGATCTTTCAATCCTGGCTCCAAAAGCTGTGAAGATATCCCACCAATGCAGTTGAAGGATGGTGTATTCAGATGTATAATGCAGTTGTATGATTGCCTTCTCACTGAAGTGCATGAGCGCTGTAAGAAGGGTTTAAGCTTGGCAAAACGCTTGAATAGTAGTTTGGCTTTCTTTTGTTATGATCTTCTATCCATCATTGAGCCACGACAGGTTTTTGAGCTGTCTGTGTTGCCATACACTGTTGATCCTGAACTTAAGCTAAATTACTTGATCAACTATAATGATCAGCTTGCAGACATTCTAACCAAGTGTTTAAGAGGGCCTAAAATTCAGGTATCATTATATCTTGACAAGTTTTCTGGTGTTTGTCAATCAGTTCTTCATGAATGCAAACTTACCTTTTTACAAATAATATGTGATCAAGATCTTTTTGTGGAAATGCCTGGAAGGGACCCTTCAGATAGGAACTACCTTTCTTCTGTATTAATACAAGAACTCTTTGTTACTTGGGATCATGAAGATGTGTCTTTACGAGCAAAGGCGGCAAGAATCTTGGTAGTGCTCTTGTGCAAACATGAGTTTGATGTGAGATACCAGAAGCCTGAGGATAAGTTGTATATTGCTCAACTATATTTTCCACTTGTCGGACAGATATTAGATGAAATGCCAGTTTTCTACAACCTCAATGCTGTTGAAAAGAGGGAAGTTTCTATTGTAATTTTGCAAATAGTTCGAAACCTTGACGATGCATCCCTTGTCAAGGCATGGCAGCAAAGCATTGCCCGGACTAGATTGTTTTTCAAGCTCATGGAGGAATGCTTGCTTCTATTTGAGCACAAAAAACCTGCTGATGGCATGTTACTTGGCTCCAGTTCTCGCAATCCGGTAGGTGAGGCACCTGCTTCCCCTAAGTACTCTGACAGACTTTCTCCTGCAATCAACAACTATCTGTCCGAGGCCTCACGGCAGGAAGTCAGGCCTCAGGGAACACCAGATAATGGGTACTTATGGCAGAGAGTTAATTCCCAGTTAAGCTCCCCTAGCCAGCCATATTCTTTGAGAGAGGCTCTAGCTCAAGCACAGTCTTCTAGGATTGGAGCTTCTGCCCAAGCACTTCGAGAATCTTTACATCCACTTTTGAGACAGAAATTGGAACTTTGGGAGGAAAATTTGAGTGCCTCAGTCAGTCTTCAGGTCTTGGAGGTGACTGAGAAATTTTCCATGATGGCTGAATCCCACAGCATTGCAACTGATTATGGAAAACTTGATTGCATAACAGTCGTGTTCATGAGCTTTTTATCTAGAAATCAGCCTTTGACATTTTGGAAAGCATTTTTTCCTGTATTTAACAGTGTTTTTGATTTACACGGGGCAACTTTGATGGCAAGGGAAAATGATCGTTTTTTAAAACAAGTCACTTTCCATCTCCTCCGGCTTGCAGTTTTCCGAAACGAAAATATTAGGCAAAGGGCAGTTGTGGGCCTTCAGATACTTGTGAGGAGTTCATTTCATTACTTTATGCAGACAGCAAGATTGAGAGTCATGTTGATTATCACATTGTCTGAGCTAATGTCTGATGTGCAAGTTACTCAGATGAGATCTGATGGGAGCCTAGAGGAAAGTGGCGAAGCACGGCGACTTAGGAGGTCTTTAGATGAAATGAAGGATGAAACTAAAAGTTCCTACCTGTTGAAGGAGTGTGGATTATCTGAGAATGCTCTTGTGGCTGTTCCAGAAAAAATAACAGAGAATAGATGGTCCTGGTCTGAGGTGAAATATCTCTCTGATAGCCTTCTTTTGGCCCTTGATGGCAGCTTGGAGCATGCGCTATTGGCCCCCATGATGACTATGGATAGATATGCTGCTGCTGAAAGCTTCTATAAACTGGCCATGGCATTTGCCCCTGTCCCTGATCTTCACATAATGTGGTTGCTTCATCTATGTGATGCACATCAGGAAATGCAATCTTGGGCAGAAGCTGCTCAGTGTGCTGTTGCTGTTGCTGGTGTTGTAATGCAGGCCCTTGTTGCCAGAAACGATGGTGTGTGGAGCAAAGACCACGTTGCTGCTTTACGGAAGATTTGTCCTATGGTCAGCAATGAGATCACCTCTGAAGCATCTGCCGCTGAAGTTGAGGGATATGGTGCTTCAAAACTAACCGTTGACTCTGCCGTGAAATACTTGCAGCTTGCTAATAAGCTCTTCTCACAAGCTGAGCTTTTTCATTTCTGTGCAAGCATTCTTGAACTTGTCATCCCAGTTTACAAAAGTAGGAGGGCTTATGGACAGCTGGCTAAATGTCACACGTTACTTACCAATATTTATGAATCAATTCTTGAACAGGAATCTAGTCCAATTCCTTTTACAGATGCAACATACTACAGGGTTGGATTTTATGGTGATAGGTTTGGGAAACTTGATAAAAAGGAGTATGTCTATCGTGAGCCTCGTGATGTACGTCTAGGTGACATAATGGAAAAACTTAGTCACATATACGAGTCTAGAATGGATGGTAATCACACTTTGCATATTATTCCAGATTCTAGACAAGTGAAGGCAGAGGAGTTACAGCCTGGTGTCTGTTACCTTCAGATTACTGCTGTTGATCCAGTCATGGAAGATGAAGATTTGGGAAGTAGGAGGGAAAGAATTTTCTCACTCTCTACTGGAAGTGTTCGAGCCCGGGTATTTGACCGATTCTTGTTTGACACCCCATTTACCAAAAATGGCAAGACTCAAGGTGGATTGGAAGATCAATGGAAGAGACGCACTGTTCTTCAGACCGAGGGTTCCTTTCCAGCGTTAGTAAATAGACTATTGGTAATCAAATCCGAGTCCCTTGAATTCTCTCCAGTAGAAAATGCAATCGGAATGATTGAAACACGAACAGCTGCATTGAGAAATGAGCTTGAAGAGCCTCGAAGCTCCGAGGGTGATCAACTTCCAAGACTTCAGAGTCTACAAAGAATTCTCCAAGGCAGTGTTGCAGTACAAGTGAATAGTGGCGTCTTGAGTGTCTGCACAGCCTTCTTGTCTGGGGAGCCTGCAACAAGGTTGCGGTCACAGGAACTGCAACAACTAATAGCAGCCCTTCTTGAGTTCATGGCTGTTTGTAAACGTGCCATTCGCGTACACTTCAGATTGATTGGCGAGGAAGATCAGGATTTCCATACACAGCTTGTTAATGGTTTCCAGTCACTGACAGCAGAGTTATCACATTACATTCCTGCCATTCTCTCAGAGCTATGA >UGI.Scf00867.19374 ATGATGGATACTTTAGCGAATGGTGGGCTTCGATTCCGGAGAATTCCTCGCCGTTCGCCTTCTAATTGCGATCGTTTGGACGCAGTGTTGGATGAAACCTTGGAGCAATGGCCCCATTTGAATGAGCTTGTGCAGAGCTATGGAGCTGACTGGGTTAAAGATGAAAACAAATACGGACGTTATGAAAGTATTGGCCCATTTTCTTTTAACAATCAGATATTTGAGGGGCCGGATACTGATTATGAGAAAGAGATGGAGCTTTCTAACAATGGCAGAGTTAAGGCCCAAGGACCAGTGGATGAACAGGATGCAAGTACATCTGGAAGCCATTTTTCAGAATCAGATTTCCCTGATACACCCAACTCTGGCATTCTAAAGCATTCCCATATTGGCGAGTCTCCGCTGTTGGCGTATGAGCCTGTTTTTGATTGGTTTAATGAGAGATCAACAATATTTGGTCAAAGAACCCCATCGAATATTATTTTTCAGTATACCAGAGCACTCACCGTGAAGTGTATGAATCTCCCTGTAGAGTCTTTTCATGGATCCATGTGCTTGTACAATAGAGAAAGAAGAGAAAAACTTTCTGAGGATTTCTTTTTCCACATGTCACCGGATGAAACCCGTAATGCTACCAGTTCTGCTGAACCTCGTGGGATTTTCTGTGTTGATGTTCCATCGGCATCAGTTTGTCTTCTTATTCAGTTAGAAAAGCCTGCTGCAGAAGAAGGTGGTGTGACATCGTCAGTGTATTCACGCAAAGAACCAGTTAATCTTAGTGAGAGGGAGAAACAAAAACTGCAAATCTGGTCCCGTGTCATGCCATACAGGGAATCCTTTGCCTGGGCTATAGTCCCTCTTTTTGAGGGCGGTTCTTCATCTGTCTGTGGTGGGTCTTCTCCGCCAGGTAGTCCAATTATTACAAGTATAGCAGGTTCTATTGCTCAAGAGGTTGGCAATATTTCACTAGATGGTGGTCATTCTAGTGGTAACTCTGTCAGAGTTGAAATTTCCAATCTTAGCAAAGTTAAAGAATGCTATACTGAGGAGTCACTCATGGATCCCAAGCGAAAGATTCATAAGCCAGTGAAAGGTACTTTGGTGCTGGAGATTGAGAAGCTTCAAACTGGAGCTGCTGAGAAATATGTAGAAGGTGATGGTATAAATGGTAGCTTGGATGGTCTTGGAAGGCGTGGTGTTGGCATGGATTCGCAATCCCATATGATGAAGCTGGAGCGAAATGGTTCTATAGCTCACGGACTTACAAATGCCTCTCCCAATGATTTTCAGGCATTTGACTTCAGGATTACTTCAAGGAATGAACCATTCTTGCAGATTTTCCATTGCCTTTATGTGTATCCCTTGAGTGTGAGCTTGAGTAGGAAAAGAAATTTGTTCATCAGGGTTGAGTTGCGAGAGGATGATGCAGATCTCCGCAAGCCCCCATTAGAGGTAATGCATCCAAGGGAACCTGGATCTACGGTTAAAAAATGGGCTCATACTCAAGTTGCCGTTGGAGCTAAGATGCCCTGTTTCCATGATGAAATCAAAGTTTCATTGCCCACTATTTGGTCTCCGACCCATCATCTCTTGTTCACTTTCTTCCATGTTGACCTTCAAATGAAAGTTGAAGCTCCAAAGCCTGTAATTCTGGGATATGCTTCACTTCCTTTGTCTACCTACATGCAGTCAAAATCAGAGATCTCATTGCCACTAATGAGAGAGCTAGCTCCACAGTATCTGCAGGACAGCGGGAAGGAGAGAGTGGAATACTTGGAGGATGGAAAAAGCATATTTCGACTCCGACTGCGCCTGTGTTCATCACTGTACCCATTGAGTGAACGAATACGTGACTTTTTCCTTGAGTATGACAGGCACATTCTCAGGACAAGCCCACCTTGGGGATCTGAGCTTCTTGAGGCAATCAACAGTCTGAAAAACGCTGATTCAGTGGCTCTGCTTCAGTTTCTTCATCCAGTGTTGAACATGCTTCTCCATCTTATCAGCAATGGTGGGGAGACATTACAGGTGGCAGCATTCAGAGCGATGGTCAATATCTTAGCTCGGGTACAGCATGAATCGGTGGATGATGGTGAAAGAAATGTATTTTTAGTGAACTACATTGACTATGCATTCGATAACTTTGGGAGCCGACAACAACCTGTGTATCCGGGCTTGTCTACAGTTTGGGGGAGTTTGGCCCGCAGCAAGGCCAAGGGTTACCGTGTTGGCCCAGTTTATGATGACGTCTTGTCAATGGCTTGGTTTTTTCTTGAGCTTATTGTCAAGTCCATGACGCTAGAGCAGACTCGATTATTCTACCACAGTCTTCCTGTGGGGGAGGATATACCACCGATGCAGTTGAAAGAAGGTGTTTTTCGATGTATAATGCAACTATATGATTGCTTGTTAACTGAAGTTCATGAGCGCTGCAAAAAAGGTCTAGGGTTAGCGAAACATCTTAATAGTAGTTTGGCTTTCTTCTGTTATGACCTCCTGTCGACAGTAGAGCCCCGGCAAGTCTTTGAACTGGTATCTTTGTACCTCGACAAGTTTTCTGGTGTTTGCCAGTCTGCACTACACGATTGCAAGCTTACTTTCTTGCAGATTTTATGCGATCATGATCTTTTTGTTGAAATGCCTGGAAGAGATCCTTCAGATAGGAATTACATTGCATCTATTCTAATGCAAGAGATTTTCCTAACGTGGGATCATGAGGATCTATCAATGCGTGTAAAGATTCTAGATGAGATGCCTGTTTTCTACAATTTAAGCGCAAGTGAGAAGCGTGAGGTGCTCATTGCTGTTTTGCAAGTCATGCGCAATTTGGATGATGCGTCTCTTATGAAAGCATGGCAGCAAAGTATTGCTCGTACCAGACTATTTTTTAAACTCTTGGAGGAATGCCTCGTTCATTTTGAGCATAGAAAACCTGATGATGGCATGCTTATGGGGGGGAGTATGCGGAGTCCGGTTGGAGATAAGCCTTTTTCATCAAAATATTCTGATCGTCTTTCTCCTGCAATCAATCACTATTTTGCAGAGGCAGCACGGCAAGAAGTTGGCGAACTTTGGGAGGAAAACCTGAGTGCTGCTGTCAGTCTCCAGGTTTTGGAAATTATTAAAAAGTTTTCAGGAGCTGTGGCATCCCGCACCATTACTACTGATTATGGGAAGCTTGATTGCATCACAGCTGTATTGATGATAGTTTTCTCACACAATCAACCGTTGATTTTTTGGAAAGCTTTCTTCCCAGTTTTCAATGGCATTCTTGCACTTCATGGGGCAACGCTTATGGCCAGAGAAAATGATCGGTTTCTAAAACAAATAGCATTCCATCTTCTTCGTCTAGCAGCTTTTCGAAATGAGAATTACAGGAAACGTGCTGTTATTGGACTTCAGCTGCTCATTCGGAGCTCGTTCTCGTACTTCACTCACACAGCTAGATTGCGGGTTCTGTTGACCATTACATTATCAGAATTGATGTCTGAAGTTCAAGTCACACATATGAAACCTGACGGCTCACTTGAGGAAAGTGGTGAAGCACAACGCCTTCGCAAGTCTTTGGAAGGAATAGCAGATGAACGTCAGAGCTACAGCACGCTCAAAGAGTGTGGCCTTCCTGAAAATGCTCTTACTTCTACTGGAAAGCAATCTCCAGAAAACTGCTGGTCCTGGTCTGCAGTTGGAATGCTCTCTGAAACTCTTCTTTTGGCGCTTGATGCCAGCCTGGAACATGCTCTTTTGTCCCCAGTCATGATGTCGGACAGATATGCTGCTGCCGAGAGCTTTTACAAGCTTGCGATGGCATTCGCCCCCGTCCCGGATCTTCATATCATGTGGCTATTACATTTGTGCGATGCACATCAGGAGATGCAGTCATGGGCTGAAGCAGCACAGTGCGCAGTTGCTGTTGCTGGCGTAGTTATGCAGCCTCCACACAGCAATACATCTTTAAATGAGAGGCATAAAAGCATTCTTACAGAGAATACAACAGGGCATGAACAACTTTTTTTTCGAAATGCAAAAGAAAGTATGCAAGCCTGGGATGATGGGTTTCTTAGCAGCTTCTCCTTCATTGTTTTCACTCCTCTTTTACTGGAAATGCATTCCCCATCTACCCTTCATGCATCTGATTCATTCATGATGAAGCATATGATTGTTGGTGAAGTGAAATGCCTTTTTCATGTGTTGTTTCAGGCTCTAGTCAATAGAAATGATGGAGTGTGGAACCTTGATCATGTCTCTGCCCTGCGCAAGATATGCCCAACTGTCAGCAATGAGATCACATGCGAAGCATCTGTGGCAGAAGTTGAAGGATATGGAGCTTCAAAACTGACAGTAGACTCAGCTGTCAAGTACCTCCAGCTCGCTTCTAAGCTCTTTGCTCAGGCTGAGCTCCACCATTTCTGTGCCAGCATTCTGGAGCTTGTTATTCCTATGCATAAGAGCAGGAGAGCATATGGGCAGCTCGCAAAATGCCACACAACATTGACGAACATATACGAGTCGATTCTCGAGCAGGAATCGATTCCGTTTGTTGATGCTACATACTACAGAGTTGGATTCTATGGCCGGAAGTTTGGGAAGCTTGACAGGATGGAGTATGTGTACAGGGAGCCTCGTGATGTACGGCTGGGCGACATAATGGAGAAGCTCAGCCACATCTACGAGTCCAGAATGGATGGCACCACACTGCATATAATACCGGATTCGAGACAGGTGAACGCCGATGAGCTGCAGCCGGAAGTTTGCTACCTTCAGATAACTGCAGTTGATCCGGTGATGGAGGAGGAGGATCTGGGGAGCAGAAGGGAGAGGATATTCTCACTTTCGACAGGGAGCATTCGTGCCCGAGTTTTCGACAGGTTTCTTTTCGACACGCCGTTCACCAAGACCGGAAAAACTCAGGGCGGGCTAGAAGATCAGTGGAAGCGGAGGACGGTGTTGAGAACAGAGGGCTCCTTCCCCGCCTTGGTAAACAGGCTCCGTGTGACCAAATCCGAGTCGCTTGAGTTTTCTCCGGTGGAGAACGCCATCGGAATGATCGAAACCCGGACAGCAGCACTGCGAAATGAACTCGAGGAACCCCGAAGCTCCGATGGCGATCAGCTCCCCCGCCTCCAGAGCCTCCAGAGGATCCTCCAAGGCTCTGTTGCAGTTCAAGTTAACAGCGGCGTCCTCAGCGTCTGCACGGCATTCCTCTCTGGTGAGCCTGCGACCCGGCTGCGGTCTCAGGAACTACAACAGCTGATCGCCGCCCTGCTCGAGTTCATGGCCGTCTGTAAACGCGCCATCCGCGTGCATTTTCGACTCATCGGAGAAGAAGATCAGGAGTTCCATACCCAGCTTGTGAATGGGTTTCAGTCTCTAACCGCAGAATTGTCTCACTACATTCCCGCCATTCTTTCTGAGCTCTGA >Migut.H02557 ATGGATAATTCGTTGGCCAGTGGGCTTCGTTTTCGAAGGATTCCACGCCAGTCCTTTGCTAATTGCTTTCAGATGGACCCGCTGCTTGACGAAAACTTGGAGCAGTGGCCACATTTAAATGAGCTAGTTCAGAGCTATGGGGCTGACTGGGTTAGAGATGAACACAAGTATGGCCACTATGAAAGCACTGGCCCCGTCACATTTCACAATCAGATATTCGAGGGGCCGGATACTGATATGGAAACGGAAATGGAGTTGGCTAATGCGAGAAGAACTAAGCTACGAGATTCAACTGAAGAAGAAATGGCAAGTACATCTGGGAGTCATTTTTCAGGACCAAATTATTATGATTCATCAACTGCAGAGATTTTGAAGCTCCGTCATCTTGGACAATCTCCCCTGCCGGCATATGAACCTGTTTTTGACTGGGACAATGAGAGATCAACAATATTTGGCCAACGAATCCCCGCTACTAACATATTTCAGTATACCAGTGGGCTGAGGATTGCCGTGAAAGTGCTATCTTTGTCATTTCAAGCTGGGTTTGTCGAGCCATTTTATGGCACAATTTGTCTATATAATAGGGAGAGAAGGGAAAAACTTTCAGAGGATTTCAATTTTCACATGTTACCAGCTGATGTGCAAGAGACAAGCAATTCTGTTGAGGCTCGTGGAATTTTCCGTGTAGATGTACCATCAGCATCAGTTTGTTTGCTTATCCAGTTGGAAAAGCCTGCCACTGAGGAAGGTGGAGTGACTTCATCTGTTTATTCACGTAAAGAACCAGTTCATCTTACTGAGAGGGAGAAACAAAAACTACAAGTTTGGTCCCGAATCATGCCTTACAGGGAGCCCTTTGCCTGGGCAATCATCCCACTTTTCGATAGTGGTGTTACTTCTTCGTCTGGTGGGTCTAGTTCTCCCAGCAGTCCACTCATTACTAGTATTTCAGGTTCGATTCAAGAGGGTGCTGCTGAACCAGTTGCAAAGATCACATTGGATGGGAAGCTCGGATATTCTGGTGGAAACTCCGTTGTAGTTGAAGTGTCAAATCTGAGCAAAGTCAAAGAAGGCTATACTGAGGAGTCACTCCTGGATCCTAAGCGAAAGGTTCATAAACCAGTTAAAGGTATCTTAAGACTGGAGATTGAAAAGCTCCAATCTGGCCAAGTTGATTCTGAAAAATCTTTTGAAACCAGAAGTATAAACAGTGATTTGGCTGGTCATCACAATGCGTCTGATACCACCTTCACAAAATCTCCCAGTTACAGAACTGATGGAAGGCAGAATGCTGATTTGGATTCACATTCCTCTGAAAAGATAGAGCTGGAGCGGAACGGATCAATAACTCACGGTTTGACAGATCGCGTCAGTAATGATTTCCAGGCTTTTGACTTTCGGATAACTTCGAGGAATGAGCCTTTCTTGCAGCTTTTTCATTGTCTTTATGTGTATCCTTTGAGTGTAAGCATGAGTAGAAAAAGAAATTTGTTTATACGAGTTGAGCTGAGAAAGGATGATGGAGATATCCGCAGACCACCACTGGAGGCAATGCATCCGAGGGAACCAGACTCCACATTTCAGAAATGGACACATACTCAAGTTGCTGTTGGATCTAGAGTTGCCTGCTACCATGATGAAATTAAGGTTTCGCTGCCTGCCATTTGGACCCCGATGCATCACCTTTTGTTCACTTTCTTTCATGTTGACCTTCAAACGAAAATTGAAGCTCCAAAGCCCGTGGTTGTAGGATATGCATCACTTCCTTTATCCACTCATGCGCAGTTGAAATCAGATATTTCACTGCCCCTGATGAGAGAGTTGGTTCCACATTATCTACAAGATAGCAGGGAGAGGGTAGAGTACTTGGAGGATGGAAAAAATGTATTTAGGCTCCGGCTACGTTTATGTTCATCAGTGTACGCAATAAGTGAGCGTATCAGAGACTTTTTCCTTGAGTACGACAGGCACATTCTCCGAACAAGTCCACCTTGGGGATCTGAGCTTCTTGAGGCAATCAACAGTCTGAAGAATGTTGATTCAACAGCTTTGCTCCAGTTTCTTCAGCCAATCTTAAACATGCTTCTCCACCTCATTGGCAATGGTGGAGAGACTCTACAGGTTGCAGCCTTCAGAGCAATGGTTAATATCTTAACACGGGTGCAGCAAGAGTCCGTAGATGATGGTGAAAGAAATCTTTTCCTTGTAAACTACGTTGACTTTGCTTTCGATGATTTTGGGGGTCGTCAACCACCTGTCTACCCTGGTTTATCCACAGTGTGGGGAAGTTTGGCCCGCAGCAAGGCCAAAGGTTACCGTGTTGGTCCAGTTTATGATGATGTACTGGCTATGGCTTGGTTTTTTCTTGAACTTATTGTCAAATCAATAGCATTAGAGCAGACTCGGTTGTTCTATCACAATCTTCCATCAGGGGAAGATGTTCCTCCAATGCAGTTGAAAGAAGGTGTCTTTAGATGTATAATGCAATTGTACGATTGCCTTCTAACGGAAGTTCACGAGCGCTGTAAAAAAGGTCTAGGCTTGGCCAAGTATCTAAATAGTAGCTTGGCTTTCTTTTGTTACGATCTTTTGTCTACTATAGAGCCTCGCCAAGTTTTTGAACTGGTGTCTCTGTACCTTGATAAGTTCTCTGGTGTATGTCAATCGGTGCTGCATGATTGCAAGCTTACATTCTTGCAGATTTTATGTGATCATGATCTTTTTGTAGAAATGCCTGGAAGAGACCCTTCGGATAGAAATTACCTTTCATCTATTCTTATACAAGAGATTTTCCTCACTTGGGACCACGAGGATTTATCCATGCGGGCAAAGGCAGCTAGAATGTTGGTGGTTCTATTGTGCAAGCATGAGTTTGACATCCGCTACCAAAAGCTGGAAGATAAACTTTATATAGCTCAATTATATTTTCCCCTTGTGGGCCAGATGCTAGATGAAATGCCTGTCTTCTACAATCTGGGTTCAAGTGAAAAGCGTGAGGTCCTGATTACTATTTTGCAAATTATACGCAATCTGGATGATACCTCTCTTATCAAAGCTTGGCAGCAAAGCATTGCTCGTACCAGATTATTTTTCAAACTATTGGAGGAATGCCTAATTCATTTTGAGCACAGAAAACCTGACGATAGCATGCTTATGGGCAGTAGTTCTCGCAGTCCTTTAGGAGATAAGCCCTTTCCATCAAAGTATTCCGATAGGCTTTCTCCTGCGATTAATCACTATCTTTTGGAGGCTGCACGCCAAGAAGTTGGACCTCAGGGTACACCAGAGAATGGGTATTTGTGGCAAAGAGTCAACTCTCAACTAAGCTCTCCTAGTCAACCGTATTCCTTGAGGGAAGCTCTTGCTCAGGCCCAATCTTCAAGAATTGGAGCTTCAACCTTAGCATTAAGAGAATCGTTGCACCCAATCTTGAGGCAAAAGTTGGAACTTTGGGAAGAAAACCTTAGTGCTGCTGTCAGTCTTCAAGTTTTGGAAATAATTGAGAAATTTTCAGGGGCTGTTGCATCCCACACCATTGCTACAGATTATGGAAAACTTGATTGCATTACCTCCATATTTATGATAGTCTTTTCGCACAACCAACCTCTGGCCTTTTGGAAAGCTCTCTTTCCTGTGTTCAATAGTGTGTTTGAGCTTCATGGAGCGACACTAATGGCGAGGGAAAATGACCGTTTTCTTAAGCAAATTGCTTTCCATCTTCTTAGACTTGCAGTTTTCCGAAATGTCAATGTTAGGAAGAGAGCCGTTATTGGGCTTCAGATACTTGTTCGGAGTTCTTTCTCGTACTTTATGCAGACATCAAGACTGCGGGTTGTCCTAACTATTACACTGTCAGAGTTGATGTCTGAAGTGCAAGTTACACATATGAAATCTGATGGAACTCTAGAAGAAAGTGGTGAAGCATGTCGTCTTCGAAAATCTTTGGAGGAAATGGCAGATGAATCTGAGAGCCTTAATATATTTGAAGAGTTTGGTCTTCCAGAAAAACCTCTTGTTGCCAGTAATGAACAATCACCAGAGCACTGTTGTACCTGGTCAGAAGTTAAAGTCCTCTCTGATAGTCTTCTTTTGGCTCTTGATGCCAGCCTGGAACACGCACTTCTGGCCTCTGTCATGACGCTGGACAGATACTCTGCGGCGGAGAGCTTTTACAAACTTGCGATGGCATTTGCTCCAGTTCCGGATCTTCACATAATGTGGTTATTGCATCTATGTGATGCACATCAGGAGATGCAGTCTTGGGCTGAAGCAGCACAGTGTGCTGTTGCTGTTGCTGGCGTAGTGATGCAGGCTCTTGTTTTTAGGAATGACGGAGTATGGAGCTCTGATCACGTGTGTGCGCTGCGCAAAATCTGCCCCATGGTCAGTGGCGAGATCAGTTCTGAGGCTTCAGCAGCTGAGGTTGAAGGATATGGTGCTTCAAAACTTACGGTTGACTCGGCAGTCAAGTACTTGCAACTTGCAAATAAGCTTTTCTCTCAAGCTGAGCTCCACCATTTCTGTGCCAGTATCCTAGAACTTGTTATTCCTGTGTATAAGAGCAGAAGGGCGTACGGGCAGCTGGCCAAGTGCCACACGATGCTGACTAATATATACGAGTCAATTCTTGAGCAGGAATCCAGTCCCATACCTTTTGCAGATGCAACATACTATAGGGTGGGATTCTATGGTGAAAAATTTGGGAAGCTGAACAGGAAGGAGTATGTATATAGAGAGGCTCGGGATGTAAGGTTGGGTGATATAATGGAGAAGCTAAGTCATATATATGAGTCGAGATTGGATGGTACAACTTTGCACGTAATACCAGACTCGAGACAGGTGAAAGCCGATGAACTGCAGGCAGAAGCGTGCTACCTGCAGATAACTGCAGTTGATCCAGTTATGGAAGACGAGGACTTGGGAAGCAGAAGAGAGAGAATATTCTCACTTTCTACTGGGAGTGTTCGCGCTCGGGTTTTTGACCGATTTTTGTTTGATACACCTTTCACAAAAAATGGGAAGACTCAAGGTGGATTGGAAGACCAATGGAAGCGCCGTTCGGTGCTGCAGACAGAGGGTTCTTTCCCTGCTTTGGTAAATCGTCTGGAGGTAATGAAATCAGAATCACTAGAGTTCTCTCCAGTTGAGAATGCAATTGGGATGATTGAAACTAGGACAGCTGCTCTTAGAAATGAACTTGAAGAACCTCGCAGCTCCGAAGGTGATCAACTTCCTCGTCTCCAGAGCCTGCAGAGGATACTTCAAGGCTCTGTCGCTGTTCAGGTGAACAGTGGAGTACTGAGTGTTTGTACGGCATTTCTTTCTGGTGAACCAGCAACAAGGCTGCGTTCGCAAGAGCTTCAACAACTGATTGCAGCACTCCTTGAGTTCATGGCCGTTTGCAAGCGTGCTATACGTGTCCACTTTCGATTAATTGGAGATGAAGATCAGGAATTTCACACCCAGCTCGTCAACGGCTTTCAATCACTAACTGCAGAATTGTCCCATTACATCCCTGCCATTCTTTCTGAACTTTGA >AL7G38710 ATGGAGAACAACAATCTTGGTCTTCGATTTCGTAAGATACCTCGTCAGCCTGTTGCTCTCCCTAAGCTCGATCCTTTGCTTGATGAGAATCTGGAACAATGGCCGCATTTGAATCAATTGGTTCAATGCTATGGCACTGAATGGGTTAAAGATGTTAATAAATATGGTCACTATGAAAATATTCGACCTGATACTTTCCAGACTCAGATTTTTGAAGGACCTGATACTGATACCGAGACTGAAATCCGTCTTGCTAGTGCTAGGAGTGCAACTATTGAGGAGGATGTAGCTAGTATATCCGGGAGGCCGTTTTCTGATTCTGGATCCTCTAAGCACTTTGGGCAACCTCCTTTACCTGCTTATGAACCAGCTTTTGACTGGGAAAATGAAAGAGCTATGATATTTGGCCAGAGAACTCCTGAATCCCCTGCAGCAAGCTATTCCAGTGGATTGAAGATCTCCGTCAGAGTTTTGTCTCTAGCTTTTCAGTCTGGCTTAGTTGAACCATTTTTTGGCTCGATTGCATTGTACAATCAAGAGAGGAAGGAGAAACTCTCTGAGGATTTTTATTTCCATATTTTGCCGACGGAAATGCAGGATGCTAAAAATTCATCTGAAAATCGTGGAGTATTTTATCTAGATGCCCCATCAGCATCAGTTTGCCTGCTTATTCAATTAGAAAAAACAGCAACAGAGGAGGGAGGCGTTACAACATCTGTCTATTCCCGTAAAGAGCCTGTGCACTTAACTGAGAGGGAAAAGCAAAAGTTGCAGGTCTGGTCTCGCATTATGCCTTACCGAGAGTCTTTTGCTTGGGCAGTTGTTCCGCTTTTTGATAATAATGTCACCACAAACACTGGTGAATCTGCTTCCCCTAGCAGTCCCCTTGCTCCTAGTATGACCGCGTCAAGTTCCCATGATGGTGTTTATGAACCCATTGCAAAGATCACATCAGATGGAAAGCAAGGTTATTCAGGTGGAAGTTCTGTCGTAGTTGAAATATCTAATTTAAACAAAGTTAAAGAGAGCTACTCTGAAGAGTTAATTCAGGACCCCAAACGGAAGGTTCACAAACCTGTTAAAGGGGTTCTAAGACTGGAAATTGAGAAACATCGGAATGGACATGGAGACTTTGAAGATCTATCTGAGAATGGAAGTATCATAAATGACTCCCTTGATCCGACTGACCGCCTCAGTGACCTGACACTTATGAAGTGTCCCAGTTCTGGTTCTGGTGGACCACGTAATGGCTGTTCGAAGTGGAATTCAGAGGATGCAAAGGATGTTTCAAGAAACCTAACAAGTTCAAGTGGGACTCCTGACTTAAATTGTTATCATGCTTTTGATTTCTGCTCTACGACAAGAAACGAGCCTTTTCTACATCTCTTCCATTGCCTTTATGTGTATCCTGTAGCTGTTACTTTAAGTCGGAAGAGGAATCCCTTTATCCGTGTAGAATTGAGAAAGGATGACACTGATGTCCGAAAACAACCACTCGAGGCAATATATCCAAGAGAGCCTGGTGTTTCACTCCAGAAGTGGGTTCATACACAGGTTGCTGTTGGTGCTAGGGCTGCTAGCTACCATGATGAAATTAAGGTCTCTCTTCCTGCCACATGGACGCCATCACATCATCTGTTATTCACTTTTTTTCATGTTGATCTCCAGACAAAGCTTGAAGCTCCAAGACCAGTAGTTGTTGGATATGCATCACTTCCATTATCTACCTATATCCACTCACGGTCTGATATTTCTCTACCAGTAATGAGAGAACTGGTTCCCCACTATCTTCAGGAAACCACCAAGGAGAGGTTGGATTATTTGGAAGATGGCAAGAATATTTTTAAGTTGCGACTGAGACTTTGTTCATCTCTTTATCCCACCAATGAACGTGTCAGGGATTTCTGTCTAGAGTATGATAGACATACCCTCCGGACAAGCCCTCCCTGGGGTTCAGAACTGTTGCAGGCAATAAACAGTTTGAAGCACGTTGATTCTACTGCCTTGCTTCAGTTTCTTTACCCAATTCTTAATATGCTCCTTCATCTTATTGGCAATGGTGGAGAAACTCTTCAGGTTGCAGCATTCAGAGCCATGGTGGATATTTTAACTCGGGTGCAGCAGGTGTCGTTTGATGATGCTGACCGAAATCGATTTCTGGTCACCTATGTTGATTATTCTTTTGATGATTTTGGAGGCAATCAACCACCAGTTTATCCTGGATTAGCAACTGTATGGGGAAGTTTAGCTAGAAGCAAGGCCAAAGGTTACCGGGTTGGACCTGTATATGACGATGTATTATCGATGGCGTGGTTTTTCCTCGAGTTGATTGTTAAATCGATGGCATTGGAGCAGGCACGTCTTTATGATCACAATCTACCTTCAGGCGAGGATGTTCCACCCATGCAGCTCAAAGAAAGTGTTTTCCGATGTATCATGCAATTGTTTGATTGTCTTTTAACTGAAGTTCATGAACGTTGTAAAAAGGGCCTAAGCTTGGCGAAACGTCTGAACAGCAGTTTGGCCTTCTTCTGTTATGATCTTTTATATATAATTGAGCCCTGCCAGGTTTATGAACTGGTATCATTATACATGGACAAGTTTTCTGGTGTTTGTCAATCTGTTCTACACGAATGCAAGCTCACGTTTTTGCAAATTATCTCCGACCATGATCTTTTTGTAGAAATGCCTGGTAGAGACCCATCAGACAGGAACTATTTATCATCCATATTAATACAGGAGTTATTTCTTTCCCTGGATCATGATGAGCTGCCTCTGCGGGCGAAGGGAGCAAGAATTTTAGTGATCCTCTTATGCAAGCATGAATTTGATGCACGGTACCAGAAAGCTGAAGATAAGCTGTATATTGCACAACTATATTTTCCATTTGTTGGGCAGATTTTAGATGAAATGCCCGTCTTTTATAACCTAAATGCTACTGAAAAGCGTGAGGTTTTAATTGGCGTGCTGCAAATTGTTCGTAATCTGGATGACACATCACTTGTCAAGGCATGGCAGCAGAGCATCGCTCGTACTAGATTGTATTTCAAACTCATGGAAGAATGCCTCATACTTTTCGAGCACAAGAAGGCTGCTGACAGCATCCTCGGGGGCAACAATTCTCGTGGTCCTGTTAGTGAAGGAGCTGGATCACCAAAGTACTCCGAGCGACTTTCTCCTGCTATCAACAATTATCTGTCAGAGGCTTCTCGCCAAGAAGTCAGGCTAGAGGGAACACCTGACAATGGGTACCTGTGGCAGAGAGTTAATTCTCAGTTGGCCTCCCCTAGCCAACCATATTCTCTAAGAGAAGCTTTAGCTCAAGCACAATCTTCGCGGATTGGAGCTTCAGCTCAGGCACTAAGAGAATCGCTGCACCCTATTTTGAGGCAAAAACTGGAACTTTGGGAAGAGAATGTAAGTGCCACTGTTAGCCTCCAGGTTTTGGAGATCACTGAAATTTTTTCATCAATGGTAGCCTCTCACAATATTGCAACGGACTATGGAAAATTGGACTGCATTACTACAATATTGACGAGTTTCTTCTCCCGGAACCAGTCATTAGCCTTCTGGAAAGCCTTCTTTCCAATTTTCAACAGAATCTTTGATCTTCATGGGGCTACACTGATGGCCAGGGAAAACGATCGCTTCTTAAAACAGATAGCCTTCCATCTTCTCCGGCTTGCTGTTTACCGCAATGACAGTGTCAGGAAAAGGGCTGTCATTGGTCTTCAAATACTAGTTAAGAGCTCGCTATACTTTATGCAGACTGCTAGGCTGAGGGCTTTGCTGACCATTACACTGTCAGAACTCATGTCGGATGTCCAAGTGACTCATATGAAAACAGATAATACATTAGAAGAGAGTGGAGAAGCACGTCGGCTTCAACAGTCATTAAGCGAAATGGCTGATGAAGCTAAGAGTGTCGATTTGTTGAGGGAGTGTGGTCTTCCTGATGATACACTGTTGATAATTCCCGAGAAATTTACAGAGAATCGCTGGTCATGGGCTGAAGTCAAACATCTTTCTGATAGCCTTGTTCTTGCTCTTGATGCCAGCCTCGGGCATGCCCTTTTGGGATCTGTGATGGCTATGGATCGATATGCTGCAGCAGAGAGCTTCTACAAACTTGGAATGGCATTTGCTCCTGTTCCGGATCTTCACATAATGTGGTTGCTGCATCTATGTGATGCCCACCAGGAAATGCAGTCTTGGGCTGAAGCTGCACAGTGTGCTGTGGCGGTTGCAGGTGTGATAATGCAGGCCTTGGTGGCTAGAAATGATGGTGTGTGGAGCAAGGATCATGTGTCTGCCTTGCGTAAGATTTGCCCGATGGTAAGTGGCGAGTTTACAACAGAGGCATCTGCAGCTGAAGTCGAGGGTTATGGTGCTTCAAAGCTAACAGTTGACTCCGCCGTCAAGTACCTACAGCTTGCTAATAAGCTTTTCTCTCAAGCTGAGCTCTACCATTTTTGTGCAAGCATTTTGGAACTTGTTATTCCAGTTTACAAGAGCAGGAAGGCTTATGGGCAGTTGGCTAAGTGTCACACTTTACTTACTAATATATATGAGTCCATTCTTGACCAAGAATCAAACCCAATCCCATTTATTGATGCTACATATTACCGGGTGGGATTTTACGGGGAAAAGTTTGGGAAGTTGGACAGAAAAGAATATGTATACCGTGAACCACGAGATGTGCGGCTAGGGGATATAATGGAAAAGCTGAGCCATATCTATGAATCAAGAATGGACAGCAACCATATTCTGCACATTATACCAGATTCGAGACAAGTGAAAGCAGAAGAATTGCAGGCAGGAGTGTGCTACCTGCAAATTACAGCTGTTGATGCAGTGATGGAAGATGAGGATCTTGGGAGCAGAAGAGAGAGAATATTTTCTCTTTCGACTGGAAGTGTTCGAGCACGAGTGTTTGATCGCTTCTTGTTTGACACACCATTTACAAAAAATGGTAAGACCCAAGGTGGATTAGAAGATCAATGGAAGAGAAGAACAGTGCTGCAGACTGAGGGTTCATTCCCTGCGCTTGTGAATAGGCTGTTGGTTACCAAGTCTGAATCCCTTGAATTCTCGCCAGTGGAGAATGCGATTGGAATGATTGAAACGCGGACAACTGCTCTGAGAAATGAGCTAGAGGAGCCTCGTAGCTCGGATGGGGATCACCTACCACGGCTTCAAAGTCTGCAGAGGATTCTCCAAGGAAGTGTTGCAGTGCAGGTGAACAGTGGGGTGTTGAGCGTGTGCACAGCATTCTTATCAGGAGAGCCTGCAACTAGATTGCGTTCGCAGGAACTGCAGCAACTGATCGCGGCACTGCTTGAATTCATGGCGGTTTGTAAGCGAGCCATTAGGGTTCACTTTAGATTAATCGGAGAAGAAGATCAGGAATTCCATACTCAGCTTGTCAATGGATTTCAGTCTCTCACCGCTGAACTCTCCCATTACATCCCTGCTATCTTGTCCGAACTTTAG >AL727U10010 AAGAGAGAGAATATTTCTCTTTCGACTGGAAGTGTTCGAGCACGAGTGTTTGATCGCTTCTTGTTTGACACACCATTTACAAAAAATGGTAAGACCCAAGGTGGATTAGAAGATCAATGGAAGAGAAGAACAGTGCTGCAGACTGAGGGTTCATTCCCTGCGCTTGTGAATAGGCTGTTGGTTACCAAGTCTGAATCCCTTGAATTCTCGCCAGTGGAGAATGCGATTGGAATGATTGAAACGCGGACAACTGCTCTGAGAAATGAGCTAGAGGAGCCTCGTAGCTCGGATGGGGATCACCTACCACGGCTTCAAAGTCTGCAGAGGATTCTCCAAGGAAGTGTTGCAGTGCAGGTGAACAGTGGGGTGTTGAGCGTGTGCACAGCATTCTTATCAGGAGAGCCTGCAACTAGATTGCGTTCGCAGGAACTGCAGCAACTGATCGCGGCACTGCTTGAATTCATGGCGGTTTGTAAGCGAGCCATTAGGGTTCACTTTAGATTAATCGGAGAAGAAGATCAGGAATTCCATACTCAGCTTGTCAATGGATTTCAGTCTCTCACCGCTGAACTCTCCCATTACATCCCTGCTATCTTGTCCGAACTTTAG >GSVIVG01014992001 ATGGAAAATTTGTCACCTAGTGGGCATCGGTTTCGAAGAATACCTCGTCAGTCCATTGCTGCTAATCTGAAGTTGGACCCACTGCTTGATGAAAATTTGGAGCAGTGGCCGCATCTGAATGAACTTGTTCAATGCTACAGAACTGATTGGGTAAAGGATGAAAACAAATATGGTCATTATGAAAGCATCAGTCCAGTTTTGTTTCAAAATCAGATATTTGAAGGGCCTGATACTGATATTGAAACAGAAATGCAGCTTGCCAGTGCAAGGCAAATCAAGGCTGAAGATACTACTGATGATGATATTCCCAGCACCTCAGGAAGGCAATTTTCAGATGCTACTTTCTCTGATTCATCACACTCAAAAGTTTTAAAGCATTTTGGTCAATCTCCTCTTCCTGCTTATGAACCAGCTTTTGACTGGGAAAATGAAAGGTCAATGATATTTGGTCAAAGGACTCCAGAAACTCCAACAACACAGTATGGCAGTGGATTGAAGATCTCTGTGAAAGTCCTATCCTTGTCGTTTCAAGCGGGGCTAGTTGAGCCATTTTATGGCACGATTTGCTTGTATAATCGGGAAAGAAGAGATAAATTGTCAGAGGATTTCTTTTTTCGCATATTGCCAACTGAAATGCAGGATGCTTGCATTACTTATGAACCTCGTGGCATCTTCTATTTAGATGTGCCCTCAGCATCAGTTTGTCTGCTGATCCAGTTAGAGAAGCCTGCCACAGAAGAAGGCGGGGTTACTTCTTCAGTTTATTCGCGTAAAGAACCAGTGCATCTGACTGAGAGAGAAAGGCAGAAACTTCAGGTGTGGTCTCGAATCATGCCTTACAGGGAGTCCTTTGCTTGGGCAATCGTTCCATTATTTGATAACAGCATGAGTGCTGCTTCTGGTGGGTCTACTTCCCCCAGTAGTCCTCTTGCTCCTAGTGTATCGGGGTCAAGTTCCCATGAGGGTGTTTCAGAGCCCACTGCAAAGATCACATTGGATGGGAAACTGGGTTATTCAAGCAGAAGTTCTGTCATAGTTGAAATTTCAAACTTAAATAAAGTTAAAGAAAGCTACACTGAGGACTCACTTCAGGATCCTAAGCGCAAGGTTCATAAACCTGTGAAAGGCGTTTTAAGGTTGGAAATTGAAAAGCTCCAGGCTGGCCATGCTGATTTGGAAAATATTTCAGAAAGTGGGAGTGTGACCAATGATTCCATTGACCCTGGGGACCGAATTGCTGATTCCACTTTCACAAAATGCCCCAGCAATGGTTCTGATGGGCCTCAGAATAGCAATTCCAAGTGGAATTTCTTTGATGGAAAAGAAATTCCAAGAAATGGATCAAATGCATTTGGATATTCAGATTTTAATGCTGATGATTTCCAAGCTTTTGACTTCCGCAGTACAACAAGAAATGAACCTTTCTTGCAGCTTTTTCATTGTCTTTATGTATATCCTTTGACTGTTAGTTTAAGTCGGAAAAGGAATTTGTTCATACGGATTGAACTCAGAAAGGATGATGCAGATGCTCGCAGGCAGCCTTTAGAGGCAATGTGTATGAGGGAGCCAGGTGTCTCACTTCAGAAATGGGCTCACACACAAGTTGCTGTTGGGGCTAGGGTGGCCTGCTACCATGATGAGATCAAACTTTTCCTTCCTGCTATTTGGACACCAATGCATCACCTTTTATTCACTTTCTTTCATGTTGACCTGCAAACAAAACTTGAAGCTCCGAAGCCAGTGGTTGTAGGATATGCTTCACTTCCACTATCTACACATGCTCAGTTGCGATCTGAAATTTCTTTACCAATTATGAGAGAGCTGGTTCCGCATTATCTTCAAGACTCTGGCAAGGAGAGGCTGGATTATTTGGAAGACGGGAAAAATATTTTTAGATTGCGGTTAAGACTATGTTCATCCTTATACCCTATTAATGAGCGCATTAGAGATTTTTTTCTTGAATATGATAGGCATACTCTTCGAACAAGCCCTCCCTGGGGTTCTGAACTACTTGAGGCCATTAATAGTTTGAAGAATGTTGATTCCACTGCTTTGCTTCAGTTTCTTCATCCAATTTTGAATATGCTTCTCCATCTTATAGGCAATGGTGGTGAAACCCTCCAGGTTGCTGCCTTCAGAGCCATGGTTAATATTTTAACCCGGGTGCAACATGAGTCTGTTGATGATGCTGAAAGAAATCGTTTTCTGGTTAACTATGTTGATTATGCTTTTGATGACTTTGGGGGTCGTCAGCCACCGGTTTATCCTGGTTTGTCCACTGTGTGGGGAAGCTTAGCTCGCAGTAAGGCTAAAGGCTACCGTGTAGGGCCAGTGTATGATGATGTCTTGGCAATGGCTTGGTTTTTCCTCGAGCTAATTGTCAAGTCAATGGCATTGGAGCAGACTCGTCTTTTCTATCATAGCCTTCCCTTAGGTGAAGATGTTCCACCAATGCAATTGAAAGAGGGTGTATTCAGATGTATATTGCAGTTATATGATTGCCTTCTAACTGAAGTTCATGAGAGATGCAAAAAGGGCTTAAGCTTGGCCAAACGTTTGAACAGCAGTTTGGCCTTCTTTTGTTATGATCTGTTATCTATTATTGAGCCTCGCCAAGTTTTTGAATTGGTCTCTTTGTACTTGGACAAGTTTTCTGGGGTATGTCAGTCAGTTCTGCATGACTGCAAGCTTACATTTTTGCAGATCATATGTGACCATGATCTTTTTGTGGAAATGCCGGGCAGAGATCCTTCAGATAGGAACTACCTTTCATCTGTCTTGATACAGGAGCTTTTCCTTACATGGGATCATGATGATTTGTCTCAGCGAGCAAAAGCAGCTAGAATCTTGGTAGTCCTCCTGTGCAAGCATGAGTTTGATTCTCGATACCAGAAGCATGAGGATAAATTATATATTGCCCAGTTATATTTTCCACTTATTGGCCAGATTCTAGATGAGATGCCTGTCTTTTACAACCTAAATGCTGTTGAAAAGCGTGAAGTAGTAATAGTTATTCTGCAAATTGTGCGCAATCTGGATGATGCATCACTTGTCAAGGCTTGGCAGCAAAGCATTGCTCGAACAAGATTATTTTTCAAACTCTTGGAGGAATGCCTAATTCTTTTTGAGCACAGAAAACCTGCAGATAGCATGCTTATTGGCTGTAGTTCTCGCAGCCCTTCTGGGGATGGACCTGTGTCCCCAAAGTACTCAGATAGACTCTCGCCTGCTATTAACAACTATCTATCTGAGGCATCACGACAAGAAGTCAGACCTCAGGGAACACCTGAGAATGGTTATTTGTGGCAGAGAGTCAATTCTCATTTAAGCTCTCCCAGCCAGCCATATTCTTTGAGAGAAGCTCTTGCACAGGCACAATCTTCTAGAATTGGTGCTTCAACCCAAGCGCTAAGAGAATCCTTGCACCCAATGTTAAGGCAAAAACTGGAACTTTGGGAAGAGAACTTGAGTGCTGCTGTCAGTCTTCAGGTTTTGGAAATAACTGAGAAATTTTCCACAACTGCAGCATCCCACAGCATTGCGACTGACTTTGGAAAACTTGATTGCATCACATCCGTATTTATGAGCTTCTTCTTGCGTAATCAACCTCTCGTTTTTTGGAAAGCTTTATTTCCTGTGTTCAACAGTGTCTTCAATCTTCATGGAGCAACACTGATGTCAAGGGAGAATGATCGTTTCTTAAAACAAGTCGCCTTCCATCTTCTTCGCCTTGCAGTTTTTCGAAATGATAACATCAGGAAAAGAGCTGTTATTGGGCTCCTGATACTCGTCAGGAGCTCCTTCTATTACTTTATGCAGACAGCGAGGTTAAGAGTCATGTTGACAATTACGTTGTCGGAGTTGATGTCTGATGTGCAAGTGACTCAGATGAAATCTGATGGGACACTGGAAGAGAGTGGTGAAGCACGGCGTCTGCGAAAATCATTGGAAGAAATGGCAGATGAAGCTAGGAGTCCCAACCTATTAAGGGAGTGTGGGCTACCTGAGAATGCTCTTGTTGTAATTCCAGAAAAATTGTCAGAGAACCAGTGGTCCTTGTCTGAGGTGAAATACCTCTCTGACAGTCTTCTTTTGGCCCTTGATGCTAGCCTTGAACATGCACTGTTGGCTTCTGTCATGACTATGGATAGATATTCAGCAGCAGAGAGCTTCCACAAACTTGCATTGGCATTTGCCCCTGTCCCAGATCTTCACATAATGTGGTTACTGCATTTATGTGATGCACATCAAGAGATGCAATCTTGGGCTGAGGCTGCACAGTGTGCAGTTGCTGTTGCTGGTGTTGTGATGCAGGCTCTTGTGGGTAGAAATGATGGTGTCTGGAGCAGAGATCACGTGACTGCTTTACGTAAAATTTGCCCCATGGTCAGCAGGGAGATTACTTCTGAGGCATCTGCAGCAGAAGTAGAGGGATATGGTGCTTCAAAACTCACTGTGGACTCTGCCGTGAAATACCTACAGCTTGCAAATAAGCTTTTCTCTCAAGCTGAGCTTCATCATTTCTGTGCCAGCATTCTGGAACTTGTAATTCCAGTTTATAAAAGCAGGAGGGCATATGGACAGCTGGCCAAATGCCACACTTTGCTAACTAACATTTATGAATCAATCCTTGAGCAGGAATCAAGCCCAATACCATTCACTGATGCCACCTACTATAGGGTGGGATTCTATGGTGAAAAATTTGGGAAGCTGGATAAAAAGGAATATGTATACCGAGAGCCTCGTGATGTACGGCTGGGTGACATTATGGAGAAACTTAGTCATATATACGAGTCTAGGATGGATGGTAATCACACTCTCCACATCATTCCTGACTCTAGACAAGTCAAAGCAGATGACTTGCAGGCTGGAGTCTGCTATCTGCAAATAACTGCTGTTGATCCAGTCATGGAAGATGAGGATCTGGGAAGCAGAAGGGAGAGAATTTTTTCTCTTTCCACTGGAACCATTCGTGCACGTGTATTTGATCGTTTCTTGTTTGATACCCCATTTACGAAAAATGGCAAGACCCAAGGGGGTTTGGAAGACCAATGGAAACGGCGAACAGTTCTTCAGACTGAGGGCTCATTCCCAGCCCTAGTGAATAGGCTCTTGGTGATTAAATCTGAATCTCTAGAATTCTCCCCTGTTGAGAATGCAATTGGAATGATTGAAACTCGGACAGCTGCATTACGCAATGAGCTTGAAGAGCCTCGCAGCTCTGAAGGGGATCAACTCCCACGCCTCCAAAGCCTACAGAGAATACTCCAAGGCAGTGTTGCAGTTCAAGTGAACAGTGGAGTGCTGAGTGTGTGCACGGCCTTTCTTTCGGGTGAGCCTGCAACAAGGCTGCGTTCCCAGGAGCTTCAGCAACTCATTGCTGCCCTCCTTGAATTCATGGCTGTATGCAAACGTGCCATCCGGGTACACTTCAGGTTGATTGGAGAGGAAGACCAGGATTTCCACACACAACTTGTGAATGGGTTTCAGTCTCTCACTGCGGAGCTATCCCACTACATTCCTGCCATCCTCTCAGAACTCTGA >TPR.G9397 ATGCTTCATCTCCGTCACCGTCGAGATTCTACTCCGGCCACCACCAAATGGCGTAATAAGTTTGATGAGAATCTTGAGCAGTGGCCACACCTCAATGAGCTTGTTCATTGCTACACTACGGATTGGGTTAAGGATGAGAACAAATACGGTCACTATGAAAGTATTGGAACGCCGTCGTTTCATAATCAGATATATGAGGGACCTGATACTGACATTGAGACTGAAATGCGGCTTGCTGGTGCAAGACGAACGAAGGGTGAAGACATTAGTGAGGATGACATCCCCAGTACTTCAGGAAGGCAGTTTATGGAAACTGCAGATGGTGAACATTTGGTTGTTTCAAAGCATTTTGGTCAATCCCCCCTTCCTGCTTATGAGCCGGCATTTGATTGGGAAAATGAGAGGTCATTGATATTTGGGCAAAGGATACCGGAAACTCCTATATCACATGGAATGAAGATTTCTGTAAAGGTTCAGTCTTTACAATTTCAGGCAGGATTGTCCGAGCCCTTTTACGGTACCATTTGCTTATACAATAGGGAGAGAAGAGAGAAATTATCGGAAGACTTTTACTTTCACATCTTACCAACTGAAATACAGGATGCCAAAATTACCTGTGATCCTCGCGCAATTTTTTACTTAGACGCACCATCTGCTTCAGTTTGTTTGTTAATCCAGTTGGAGAAGCATGCTACTGAAGAAGGCGGAGTTACTCCATCTGTTTATTCACGTAAAGATACTGCACATTTGACTGAGAGAGAGAAGCAAAAATTGCAGGTGTGGTCCCAAATCATGCCGTACAAAGAGTCCTTCGCATGGGCCATTGTGTCATTATTTGATGGCAGTATTGGTGCAGCTTCAGTAGGGCCTGGTTCTCCAAGCAGCCCGCTTGCTCCTAGTGTATCTGGTTCAAGTTCGCATGAAGGTGTTTTTGAGACTAGTACCAAAGTCTCTTTAGATGGAAAGCTGAATTATTCAAATGGAAATTCTGTTGTGGTTGAGGTTTCAAACTTAAATAAAGTCAAAGAAAGCTATACCGAGGAATCACTTCAGGATCCCAAGCGTAAAGTACATAAACCTGTCAAAGGAGTTTTAAGACTGGAAATTGAAAAGCACCAGATTTCTCAAGCTGATTTGGATAATATGTCAGAATGCGGTAGTGCAACCAATGATTCTGTTGATCCCGGGGATCGCATTGCTGATTCCATGTCTGGAAAGTATCCTAGTAATGGTTGTGATGATCCTCAGGGTAGTATCTCCAGGTGGAACGTCAGTGATGCGAAGGAAGTTCTGGGCAATGGAGCAAATCAACATGGAACCTCAGATTTTAATGCTGATGATTTCCAAGCTTTTGACTTCCGCACAACTACAAGAAACGAGCCGTTTTTGCAACTTTTTCACTGCCTGTATGTGTATCCGTTGACTGTAAGTTTGGGTAGGAAAAGGAATTTGTTTATACGGGTTGAACTCAGAGAGGACGATGGTGATATTCGTAGACAGCCATTGGAGGCAATTTATCCTAGAGATCCAACTCTAGGGACATCATTTCAGAAATGGGGTCACACCCAAGTTGCTGTTGGGGCTAGGGTTGCTTGCTACCATGATGAAATTAAACTTTCCCTTCCTGCCATGTGGACACCAACACACCATCTTCTATTTACTTTATTTCATGTTGATCTGCAAACGAAATCGGAAGCACCAAAGCCAGTGGTAATTGGATATGCAGCACTTCCTTTATCGTCACATGCTCAGTTGCGGTCGGAAATAAATCTCCCGATTTTGAGAGAGTTGGTCCCACATTATCTCCAGGATGCAGGACGGGAGAGATTGGATTATTTGGAAGATGGAAAAAATGTCTTCAGACTACGTTTACGGTTATGTTCTTCTTTATACCCTATCAATGAACGTATTAGAGATTTTTTTCTCGAATACGATCGACACACTCTCCGAACAAGTCCACCTTGGGGTTCTGAACTGCTAGAGGCTATTAATAGTTTGAAGAATGTTGATTCTACTGCTTTACTTCAGTTTCTTCACCCAATTCTTAACATGTTGCTTCATCTTATCGGCAATGGTGGAGAAACACTCCAGGTTGCGGCTTTCCGGGCTATGGTTAATATTGTGACCAGGGTGCAGCAGGAGTCAGTTGATGACGCTGAAAGAAATCATTTTCTAGTCAACTATGTTGATTGTGCTTTCGATGATTTTGGGGGTCGTCAACCACCAGTATACCCTGGATTGTCCACTGTCTGGGGAAGTCTGGCACGGAGTAAGGCTAAAGGGTATCGTGTTGGACCAGTGTATGATGATGTTTTAGCAATGGCATGGTTTTTTCTGGAGTTAATTGTTAAATCAATGGCATTGGAGAAAACTCGCCTCTTCTATCATAGCCTTCCAATAGGTGAAGATATCCCACCGATGCAGTTGAAGGATGGTGTATTCAGATGCATAATGCAGTTGTATGATTGCCTTCTCACTGAGGTGCATGAGCGCTGCAAGAAGGGTTTAAGCTTGGCAAAGCGCTTGAATAGTAGTTTGGCCTTCTTTTGTTATGATCTTCTATCAATTATTGAGCCACGACAAGTTTTTGAGTTGGTATCATTATATCTCGATAAGTTCTCTGGTGTATGTCAACCAGTTCTTCATGAGTGCAAACTTACCTTTCTACAAATAATCTGTGACCATGATCTTTTTGTTGAAATGCCTGGGAGAGACCCTTCAGATAGGAACTACCTTTCGTCTGTATTGATACAAGAACTCTTTGTTACTTGGGATCATGAAGATCTGTCTCTACGGGCAAAGGCAGCAAGAATCCTGGTAGTGCTCTTGTGCAAGCACGGATTTGATGTGAGATACCAAAAGCCTGAAGATAAGTTGTATATCGCTCAGCTATATTTGCCGGTTATTGGACAGATATTAGATGAGATGCCTGTTTTCTACAACCTGAATTCTGTTGAGAAGCGGGAAGTTTCTATCGTAATTCTGGAAATAGTTCGAAACCTTGATGATGCATCACTGATCAAGGCATGGCAGCAAAGCATTGCCCGGACTAGATTGTTTTTCAAGCTCATGGAGGAATGCTTACTTCTATTTGAGCACAAAAAGCCTGCTGATGGCATGTTACTTGGCTCTAGTTCTCGCAACCCCGTAGGGGAGACACCTGCTTCCCCCAAATACTCTGAGAGACTTTCACCTGCAATCAACAACTATTTATCTGAGGCCTCAAGGCAGGAAGTCAGGCCTCAGGGAACACCTGATAATGGGTATCTATGGCAGAGAGTAAATTCCCAGTTAAGCTCTCCTAGCCAGCCATATTCCTTGAGAGAAGCTCTTGCCCAAGCACAGTCTTCTAGGATTGGAGCTTCTGCTCAAGCACTTCGAGAATCTTTGCACCCACTTTTGAGGCAAAAATTGGAACTATGGGAAGAGAATTTGAGCGCTTCTGTCAGTCTTCAGGTCTTGGAAGTGACTGAAAAATTTTCAACGATGGCAGCATCACGTAGCATTGCTACAGATTATGGAAAACTTGATTGCATCACAGCTGTATTCATGAGCTTTCTATCTAGAAATCAGCCATTGTCTTTTTGGAAAGCATTTTTCCCTGTATTTAATAGTGTGTTTGATTTACATGGGGCAACACTAATGGCAAGAGAAAATGACCGTTTTCTAAAGCAAGTCACTTTCCATCTACTTCGGCTTGCAGTTTTCAGAAATGACAACATCAGGAAAAGGGCAGTTGTTGGGCTTCAAATACTTGTGAGGTGTTCATTTCATTACCTTACACAGACGGCAAGGTTAAGAGTCATGTTGATCATCACTTTATCAGAGCTAATGTCTGATGTGCAAGTGACTCAAATGAGATCTGATGGAAGCCTAGAAGAGAGTGGTGAAGCACGGAGACTTAGAAAATCTTTAGAGGAAATGAAGGATGAAAGTAAAAGTTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATCTTCACATAATGTGGTTACTTCATCTGTGTGATGCACATCAGGAAATGCAGTCATGGGCTGAAGCTGCTCAATGTGCTGTTGCTGTTGCTGGTGTTGTAATGCAGGCCCTTGTTGCCAGAAGTGATGGTGTATGGAACAAAGACCATGTTGCGGCTTTACGTAAGATTTGTCCTATGGTTAGCAGTGAGATCACATGTGAAGCATCTGCTGCAGAGGTAGAGGGATATGGTGCTTCAAAACTAACAGTTGACTCTGCTGTGAAATACCTGCAGCTTGCTAATAAGCTTTTTTCACAAGCTGAGCTATTTCATTTCTGTGCAAGCATTCTGGAACTTGTAATCCCAGTATACAAGAGCAGGCGGGTTTATGGACAGCTGGCTAAATGTCACACCTTACTTACTAATATCTATGAATCAATACTTGAACAGGAATCTAGTCCGATTCCTTTCACTGACGCAACATACTACAGGGTTGGGTTTTATGGTGATAAATTTGGAAAACTTGACAAAAAGGAGTATATATATCGTGAACCCCGTGATGTACGTCTAGGGGACATAATGGAAAAACTTAGTCATATTTATGAGTCCAGAATGGATGGTAATCACACTTTGCATATTATTCCAGATTCTAGACAAGTGAAGGCTGAAGAGTTACAGCCTGGTGTCTGCTACCTTCAGATCACTGCTGTTGATGCGGTCATGGAAGATGAGGATTTAGGAAGTAGAAGAGAGAGAATTTTCTCTCTTTCCACTGGAAGTGTTCGTGCCCGTGTGTTTGACCGATTTTTGTTTGATACCCCATTTACAAAAAATGGCAAGAATCAAGGTGGATTGGAAGATCAATGGAAAAGACGCACTGTTCTTCAGACCGAGGGTTCATTTCCAGCTTTAGTAAATAGGCTATTGGTAATCAAATCCGAGTCCCTTGAATTTTCACCTGTAGAAAATGCCATTGGAATGATTGAAACACGAACAGCTGCATTACGAAATGAGCTTGAAGAGCCTCGAAGTTCTGAAGGGGATCAACTTCCAAGACTCCAGAGTCTACAAAGAATTCTCCAAGGCAGCGTTGCAGTACAAGTAAATAGTGGAGTTTTGAGTGTTTGCACAGCCTTCTTGTCTGGTGAGCCTGCTACAAGATTACGATCTCAGGAACTACAGCAACTTATAGCTGCCCTTCTCGAGTTCATGGCTGTTTGCAAACGTGCAATCCGGGTACATTTCAGATTGATAGGTGAGGAAGATCAGGATTTCCATACACAACTTGTAAATGGATTTCAGTCTCTAACCGCAGAGTTATCACATTACATTCCTGCCATTCTCTCAGAGCTATGA >ATR0068G076 ATGATAGTTCACCACATCGGTTTCCAGTTGCAAGAATGCTCTTTTAATGCCATTGGTAAAAAGAAAAGGAATGCTCTTTCAGTTTTTGTTGGACAAAAGGTGATGGAAGAATCAACATCTAGTGGACAGCGGTTTAAAAGAATTCCACGGCTACCCTTGGCTGCAAATTTGGAGTTGGATCCATTGCTTAATGAGAGCTTGGAGCAATGGCCACATTTGAATGAGTTGGTACAGAGTTATAAGGTTGACTGGGTAAAGGATGAGAATAAATATGGGCATTATGAAAGCGTTGCACCTCCACTGTTTCAAAGTCAAATTTTTGAAGGGCCAGATACAGACATAGAAACAGAAATGCGTTTGGCTAATGCGAGGCACACAAGGAATGAAGATGCTAATGATGACGACATTCCAAGTACCTCTGGAAGGCCGTCATCTGAGACAAGCTCATCAGAAGTGGTGTACCCAAGAAATCTTCAGAAGCATTTTGGTGCATCTCCATTGCCTGCATATGAACCAGTATTTGATTGGGAAAATGAGAGGTCAATGATCTTTGGGCAAAGGACACCAGAAGCCCTTCCATCGTTGTTTGGCAGTGGATTGAAGATCTCTGTAAAGGTTTTGTCCTTGTCATTTCAAGCTGGTTTTGTCGAGCCCTTCTATGGTACAATTTGCTTGTATAATCGTGAGAGAAGAGAGAAATTGTCAGAAGACTTCTATTTTCGGCTGCTACCAGCTGAGATGCAAGATGGTTCGGTTTCATCTGAGCGTCGTGCAGTGTTCTCATTGGACTCTCCTTCTGCTTCAGTTTGCTTGCTTATCCAATTGGAGAAGCCTGTAACTGAAGAAGGTGGTGTCACACCGTCTGTTTATTCACGCAAGGAGCCTGTGCATTTGACAGAGAGAGAAAAGCAGAAGCTGCAAGTTTGGACTCGGATTATGCCTTATAGAGAATCTTTTGCCTGGGCAATTGTTCCCTTGTTTGAAAACAACAACATTGCTGGTGTAGGTGGTAGTGCTTCTCCCAGCAGTCCACTAGCCCCAAGCATATCTGGGTCAAGTTCACAGGACAGTGCTGTTGAACCTCCTGTTGCAAGAACCGTTTCAGATGGAAGGCTGGGACAGTATTCCAGTGGCAGTTCTGTTATTGTCGAGATATCAAACTTAAACAAAGTCAAGGAAAGTTACACAGAGGACTCTCTTCAGGATCCTAAACGGAAGGTTCATAAACAAGTAAAAGGTATACTGAGGTTAGAAGTGGAAAAGCTTCAGTTGGGGCAATTTGAACTTGATGGAATTTCAGAAAGTGGCAGCATAAACAATGATACAACTGATGTTGGTGATCGGTTTGTGGAAGCATCATTCACAAGAGGCTTAAGTAATGGGTCTGAGGGACCTCAGAATGGTAATCCAAAGTGGTATTCATCCGATGGAAAAGACATGCAGAGGAATGGGTCCAATGTTGTTCTTGGAAATTATCCTGAATGCAGCCTTGATGATTTCCTTGCTTTTGACTTTCGAGCATCCACAAAAAGTGAGCCTTTCATTCACCTTCTACACTGCCTTTATGTATGCCCTTTAATGGTTAATTTGAGCCGTAAGAGGAATTTGTTTATAAGGGTGGAACTGCGAAACGATGATACTGAAATTCGTAAGCAACCATTAGAGGTAATGTACACAAGAGAGTTTGGCGAACCACTTCAGAAATGGGCTCACACCCAAGTTGCTGTTGGTGCCAGGATGGCATGTTACCATGATGAGATCAAGATTTGTCTCCCTGCCATTTTTACCCCCCAACAACATTTGTTGTTCACTTTCTTTCACGTTGATCTTCAAACAAAGCTTGAAGCTCCAAAGCCGGTGATTGTGGGATATTCTACACTTCCACTATCTACCAATGTGCAGCTGCGCTCTGAGATCACTCTACCAATCATAAAAGAGCTGGTCCCTCACTATCTCCAAGATAGTGTCAAGGAGAGGCTTGATTATTTGGAAGATGCCAAACATGTCTTTAGATTACGATTGAGGCTGTGCTCTTCTTTATATCCAGTGAATGAGCGTATTAGAGATTTTTTCCTGGAGTATGATAGGCATATTCTCCGGACAAGCCCGCCATGGGGTTCTGAACTTCTTGAGGCCATAAACAGCCTAAAGAATGTTGATTCCACTGCACTGTTGCAGTTTTTGCAGCCAATTCTGAATATGCTTCTCCACCTCATTGGTGATGGTGGCGAAACTCTTCAGCAGGAATCATCTGATGGGGCTGAAAGAAATCGTTTCCTTGTTAATTATGTTGACTATGCTTTTGATGATTTTGGTGGTCGACAACCCCCAGTTTATCCAGGTCTGTCAACAGTGTGGGGAAGCTTGGCTCGGAGTAAGGCTAAAGGTTATCGTGTTGGACCAGTATATGATGATGTGTTGGCAATGGCTTGGTTCTTCCTTGAGCTTGTTGTAAAATCTATGGCACTGGAGCAAGCTCGCATATTCTATCATAGTATTCCCTCAGGTGAAGAAATTCCACCATTACAATTGAAGGAAGGTGTATTCAGATGTATATTGCAATTGTATGATTGCCTTCTTACGGAGGTTCACGAACGCTGCAAGAAGGGATTGAGCTTGGCAAAACGTTTGAATAGCAGTCTGGCCTTCTTTTGTTATGATCTGTTGTCCATCATCGAGCCTCGCCAAGTTTTTGAGCTGGTGTCACTATATATGGACAAGTTCACAGGTGTTTGCCAATCTGTTCTCCATGACTGCAAGCTCACATTTCTGCAGATAATATGTGATCATGATCTTTTTGTTGAAATGCCTGGTAGAGATCCTTCAGATAGGAATTACCTTTCATCTGTTCTGATCCAGGAGCTTTTCCTCACCTGGGATCATGATGACTTATCTCAGCGTTCGAAAGCAGCTCGCATCTTGGTGGTCCTCCTGTGCAAGCATGAATTTGATGCTCGATACCAAAAGCAGGAAGACAAATTGTATATTGCCCAACTATATTTTCCACTTATTGGTCAGATTCTGGATGAGATGCCTGTGTTCTATAATCTTAATGCCATAGAAAAGCGTGAAGTACTAATTTGTATTATGCAAATTGTTCGTAACTTGGATGATGCATCACTTGTAAAGGCATGGCAGCAAAGTATAGCTAGGACCAGACTCTTTTTTAAGCTTATGGAAGAATCTCTTGTCCTGTTTGAGCATAGGAAACCGGCTGACACTTTGCTTATGGGCTCCAGTTCTCGAAGCCCTGATGGAGAAGGACCTATTTCTCCCAAGTATTCTGACAGGCTTTCACCAGCAATCAACAGCTACCTGACTGAAGCCTCTCGACAGGAAGTTCGACCTCAAGTAACACCGGAGAGTGGCTTCTTGTGGAACAAAGTCAGTCCACAGCTAAGCTCCCCAAGCCAACCATACTCCTTGAGAGAAGCTCTGGCCCAGGCTCAGTCTTCCCGGATAGGGGGGTCCACAAGAGCACTGAGAGAGTCTCTGCACCCCATGTTGAGACAAAAATTGGAGCTTTGGGAAGAAAACTTGAGTGCGGCAGTCAGTCTCCAAATTTTGGAGATAACTGGAAAGTTCTCTCTTGCCGTGGCTTCCCACAGCATTGCCACTGATTATGGGAAGCTGGATTGTATTACATCCATATTTATGAGCTTCTTTTCCCGAAGCCAACCTCTCGGATTTTGGAAAGCCATGTTTCCTGTATTTAACAGCGTCTTTAATCTTCATGGTGCCACATTGATGGCAAGAGAGAATGACCGCTTCTTGAAGCAAGTGGCATTCCATCTTCTTCGCCTGGCGGTTTTCAGAAATGACTCTATCAGGAAAAGGGCAGTTATTGGACTCCAGATTCTTGTGAGGAGTTCTTTTTATTATTTTCTGCAGACGACAAGGCTGAGGGTCATGCTCACGATTACTTTGTCAGAGTTGATGTCTGATGTACAAGTAACTCAGATGAAGTCTGATGGATCACTTGAAGAGAGTGGGGAAGCTCGGCGTTTGAGAAAGTCATTGGAGGAAATGGCAGATGAGAATAGGACTTCTGAGCTCTTAAAAGAGTGTGGACTTCCTGTGAGTGCTCTTCAGGCAGTGCCTGATGGGTCAGAAAAGAACCAGTGGTCTTGGTTAGAGGTGAAGCTACTCTCTAACGGTCTGCTTCAAGCCCTTGATGCAGGCTTAGAACATGCCATCCTGGGCTCGCTGATGACAGTGGACAGATACGCAGCTGCAGAGAGCTTTCATAGGCTAGCCATGGCGTATGCACATGTTCCTGACCTTCACATAATGTGGTTGCTCCATTTATGTGATGCTCATCAGGAGATGCAATCATGGGCTGAAGCTGCACAATGTGCGGTGGCCGTTGCTGGTGTCATCATGCAGGCTCTTGTGGGAAGGAATGATGCTGTGTGGAGCAGGGAACATGTTGCTGCTTTACGTAAAATTTGTCCAATGGTCAGCAGTGCAGTTACTGCCGAAGCAGCAGCTGCTGAAGTGGAAGGTTATGGTGCATCAAAGCTCACGGTTGACTCAGCTGTGAAGTACCTACAACTAGCCAATAAGCTCTTTTCTCAGGCAGAGCTCCACCACTTTTGCGCCAACATTTTGGAGCTCATAATTCCAGTGTATAAGAGCCGCAGGGCATTTGGACAGCTTGCAAAATGTCATACTTCTCTTACCAACATCTATGAAGCTATCCTTGAGCAAGAAACGAGCCCCATTCCATTCACTGATGCCACTTATTACAGGGTAGGGTTCTATGGGAGTCGATTCGGGAAACTGGATAGGAAGGAATATGTATACAGAGAGGCCCGTGATGTTCGTTTGGGAGATATAATGGAGAAACTAAGTCATATTTATGAGTCAAGAATGGATGGCAGTCACACCTTGCATATAATACCAGACTCTCGACAGGTCAATGCAGACGAATTGCAACCTGGTGTTTGCTATCTTCAGATTACGTCAGTGGACCCAGTCATGGAGGATGAGGACTTGGGGAGTAGGAGGGAGAGGATATTCTCTCTTTCCACAGGGAGCATGCGTGCACGTGTATTTGATCGCTTCTTGTTTGATACCCCTTTCACAAAAAACGGGAAGACCCAAGGAGGGCTTGAGGACCAATGGAAGCGGCGCACCGTCCTTCAAACAGAGGGGTCGTTCCCAGCTCTGGTAAACAGGCTCCTGGTGGTGAAATCAGAGTCCCTTGAGTTCTCCCCTGTGGAGAATGCGATCGGGATGATAGAGACGAGGACGGCTGCTCTGAGGGGGGAGCTTGAAGAGCCACGCAGCTCTGATGGTGACCAACTCCCCAGGCTTCAGAGCCTACAGAGAATACTGCAAGGCAGTGTTGCTGTTCAGGTGAACAGTGGAGTCCTGGGTGTATGCACAGCTTTCCTGTCAGGGGAGCCAGCGACAAGACTGAGGTCTCAAGAGTTGCAGCAACTGATTGCTGCCCTTCTTGAGTTTATGGCTGTTTGCAAGCGAGCGATACGGGTTCACTCAAGGTTGATTGGTGATGAGGACCAGGATTTCCACACACAGCTTGTGAATGGGTTTCAGTCTCTCACTGCAGAGCTCTCTCATTATATCCCTGCCATTCTATCAGAGCTTTAA >Zm00001d029004 ATGGAGCCCGCGGTGGCTACAGCGGGTGAAGGGCAGCGGTTCAAGCGGATTCCGCGGCAGGCGTGGTCGGGGAACCTCGAACTGGGTCCTCTGCTTAATGAAAGCTTAGATCACTGGCCACATCTAAATGAGCTGGTACAGTGCTACAAGGCTGATTTTGTGAAGGATGACTGCAAATATGGACACTATGAGAGTGTTGCATCACCGTCTTTCCAAAATCAAATTTTTGAGGGACCTGATACTGACATAGAAACAGAATTGCAGCTTTGCAATGCAAGGCATTCCAAGTCTGAGGATGCTACTGAAGATGATACACCAAGCACCTCAGGGAGGCAAATATATGAAACTGAATCATCTGGTTCGTCTTCAAAAGTGCACTGTAGTTTGTCACCATTGCCAGCATATGAGGCTGCATTTGATTGGGAGAATGAGAGGTCTTTGATATTTGGCCAAAGGGTGCCAGAAAGTATACCTGCAATAAGCAACAGTGGCTTGAAGATAACTGTCAAGGTACTATCTTTGTCATTCCAAGCTGGATTAGTCGAACCTTTCAGTGGAACGATTTGCTTGTATAACAGAGATAGAAGAGAGAGGCTGTCAGAGGACTTCTATTTCCATATGCTTCCAACAGATATGCAGGTTGACCAGGGTTCCTTGGATCGTCGAGGTGTTTTTTCATTGGACGCACCTTCTCCATCGGTCTGCCTTTTGATTCAATTGGAAAAGGCTGCTACTGAAGAAGGGGGAGTAACACCTTCTGTTTATTCTCGTAAAGAGCCTGTGCACTTAGCTGAGAAAGAGAAGCAAAAGCTGCAAGTATGGTCTCGAATCATGCCTTATAAAGAGTCATTTGCATGGGCCATGATTCCTCTGTTTGAAAGTAACCGTGCGGGTGGTCTTAGTGATGCTGCTTCTCCTAGCAGTCCTCTAGCACCGAGTTTATCAGGATCAAGTTCTCAAGATAGTATTGTGGACCCTATTTCGAAGCTTGCTTTAGATGGAAAAGTCAACCATTACTCAAGTGGAAGCTCAGTTATTGTAGAGATATCAAACCTAAACAAAGTGAAGGAAAGCTATATAGAGGACTCCCTCCAAGACCCAAAACGGAAAGTACATAAACCAGTGAAAGGTGTTTTGAGATTAGAAGTGGAAAAACTTCATGATGACCATAATGATGTGGATAACGCTTCTGAAGGTGGAAGCATGGCCAATGATTTGAATGATGCTGGTGACATCAATAATGGCAGAAGCAACAGAAGTAGCTTTGATGGGATTCACAGTTCTGTGAATTCTATTGCCATTGCCAAAAAAGATGCTCATCACAATGGACACACTTCTAATGCTGAGAATGTTGACAATTTTCAAGCTTTTGACTTTCGGGTGCTGACCCGAAGTGAGCCATTTTCGCAACTTTTTCATTGCCTCTATGTGTACCCATTGACTGTTAGCTTGAGCCGCAAAAGAAACCTCTTTGTTAGAGTGGAACTGAGAAAGGACGATTCTGACATCAGGAAGCCTCCATTAGAGGCTGTTCATCCTAGGGAGCGGAATACGATGCTACAGAAGTGGGGCCATACACAGATTGCTGTTGGAACAAGAATGGCTTCCTACCATGATGAAGTTAAAATCAGCCTACCTGCTCTTTTGACACCCCAACATCATCTTGTGTTCACATTTTTCCATGTAGATCTTCAAATGAAACTTGAAGCACCGAAACCAGTGATCATTGGATATTCTGTACTTCCACTGTCGACACATATTCAGTTACTTTCAGATGTGTCCTTGCCGATTTTGAGAGAGCTCGTTCCACATTACCTGCAGGAAAGTGGAAAGGAGAGAATGGACTATCTGGAAGATGGGAAAACTGTTTTCAGGTTACGTTTAAGGCTCTGCTCTTCATTGTTCCCAATTAATGAAAGGATAAGGGACTTTTTTGTTGAGTATGATCGCCATACTCTACATACAAGTCCCCCATGGGGTTCTGAGCTTCTTGAGGCCATAAATAGTTTGAAAAACGTCGAATCTACTGCATTATTACAATTTCTGCAACCAATACTTAACATGTTGCTTCATCTTATTGGTGATGGCGGTGAGACCCTTCAGGTTGCTGCATTTCGAGCCATGGTTAACATTTTAACCCGTGTGCAGCAGGAGTCATCAGATGGGGCTGAAAGAAATAGATTCCTTATTAACTATGTTGATTTTGCTTTCGATGACTTCGGTGATCGGCAAGCCCCTGTGTATCCTGGTCTGACTACTGTTTGGGGAAGTCTTGCTCGGAGTAAGGCGAAAGGTTATAGAGTTGGTCCTGTGTATGATGATGTGTTGGCAATGGCTTGGTTTTTTCTGGAGCTTATTGTAAAATCAATGGGATTGGAACAAAGTCGTCTCTTCTACCACAATCTTCCACTAGGTGAAGATGTCCCACCACTGCAATTGAAAGAAGGTGTCTTCAGGTGCATCATGCAGCTCTTTGATTGCCTTCTAACTGAGGTTCATGAGCGTTGTAAAAAGGGTTTAAGCTTGGCAAAACGCTTGAACAGCACACTTGCTTTCTTTTGCTATGATCTTTTATCAATTATTGAGCCTCGCCAAGTTTTTGAGCTGGTTTCGTTGTACATGGACAAGTTTGCAGGAGTTTGTCAATCAGTCCTTCATGACTGCAAATTGACATTCCTGCAGATAATATGCGACCATGATCTATTCGTTGAGATGCCTGGGCGGGATCCTTCTGATAGAAACTATCTCTCGTCAGTTCTCATCCAAGAGATCTTTCTGACCTTAGACCATGATGATTTATCTCAACGAGCGAAGGCTGCTCGGATTTTGGTTGTCCTTATATGCAAACATGAATTTGATGCACGCTATCAAAAAAGCGAAGACAAATTGTACATTGCTCAGCTGTATTTTCCTCTTATAGGGCAGATCCTTGATGAGATGCCTGTTTTCTATAATCTGAATGCCATTGAAAAGCGTGAAGTGCTAGTTGTCATTTTGCAAATTGTGAGGAACTTGGATGATGCAACTCTTATCAAAGCATGGCAACAAAGCATTGCTAGAACCAGATTGTTCTTCAAGCTTCTTGAAGAATGTATAATCCATTTCGAGCCTCAGGGAACACCAGAAAATGGATACATGTGGAACAGGGTTAGCCCTCAATTAAGTTCCCCTAATCAGCCCTATTCATTGAGAGAAGCACTTGCTCAAGCACAATCTTCAAGAATCGGGTCAACCGCCAGGGCATTGAGAGAGTCTCTACATCCAGTGCTGAGACAAAAAATGGAACTTTGGGAAGAAAATCTCAGTACTGCCGTGAGCCTCGAAGTGTTGGGAATAACTGAGAAGTTTTCAGTTGCTGCAGGCGCTCGAAGCATCACTACTGATTACGCGAAGCTAGATTGTGTAACATCAATCTTAATGGGTCTTTTATCTAGGAACCAATCCTTGGCTTTTTGGAAGGCTTTCCTTCCTGTGGTCTACAATATATTTAATGTTCATGGTGCAACACTAATGGCAAGGGAGAATGACCGCTTCTTGAAGCAAATTGCTTTTCATCTTTTGCGGCTTGCTGTTTTCCGAAACGATTCGATTAGAAAAAGAGCTGTTGTTGGGCTGCAGATTCTTGTTAGGAACTCATTCAACTATTTCAAAAACACTACAAGGTTAAGGGTCATGTTGACAATTACTTTGTCCGAGTTGATGTCCGACGTGCAAGTAACTCAAATGAAATTCGATGGTTCTCTTGAAGAAAGTGGTGAAGCTCGGCGCCTTAGGAAATCACTGGAGGAAATGGCTGATGTGAGAAGCAAGGATCTGTTAAAAGATTGTGGCCTCCCTGTTACTGCATTGGAGGCGGCCCCTGAAGGCTCCTCTGATAATAGGTGGTCTTGGGTAGAGGTGAAACATTTGTCTAAATGTCTAGTCCAGGCCCTTGATGCTGGTCTGGAACACGCCCTCCTGGGTTCTGTAGTGACTGTAGACAGGTATGCAGCTGCCGAGGGTTTCTATAAACTAGCTATGGCCTATGCACCCGTTCCAGATCTTCACATTATGTGGTTGCTTCATCTGTGTGATGCACACCAGGAGATGCAATCATGGGCTGAAGCAGCACAATGTGCAGTTGCTGTAGCTGGCGTGATCATGCAGGCACTTGTTGGAAGGAATGATGCTGTGTGGAGCAAGGAGCATGTTGCTTCGCTGCGCAAGATTTGCCCTATTGTCAACACTGATGTGAGTGCAGAAGCATCTGCAGCTGAAGTCGAGGGATATGGTGCATCCAAATTAACAGTGGACTCAGCGGTCAAATATCTTCAACTAGCCAATAAACTTTTCACACAAGCTGAACTCTACCATTTTTGTGCAAGCATTCAGGAACTCATAATTCCTGTGTATAAAAGCAGAAGGGCTTATGGACAGCTGGCCAAATGCCACACATCGCTCACAAACATCTATGAGTCAATTCTTGAACAGGAGGCTAGCCCTATACCATTCATTGATGCCACATACTACCGAGTTGGTTTCTATGGTGAGCGTTTTGGCAAGCTCAATAAAAAGGAGTATGTATTTAGAGAACCACGGGATGTACGTCTTGGTGATATTATGGAGAAGCTTAGTCATATATATGAGGCTAAAATAGATGGAAGTCACACTTTACACATAATTCCAGACTCTAGACAAGTCAACGCTGATGAGTTGCAGCCTGGCTTCTGCTATTTACAGATCACTGCTGTTGATCCTGTGATGGAGGATGAGGACTTGGGTAGCAGGAGGGAAAGAATATTTTCTTTATCTACTGGTACTGTTCGTGCACGTGTTTTTGACCGTTTTCTTTTCGATACACCATTCACAAAAAATGGAAAAACACAAGGTGGTCTAGAAGACCAGTGGAAGAGGCGCACAGTGCTCCAAACAGAGGGTTCCTTTCCCGCTTTGGTGAACCGTCTGCCAGTTATCAAATCTGAATCTCTGGAGTTCTCTCCTGTCGAGAATGCGATTGGAATGATCGAAACAAGGACAGCTGCATTGAGAAATGAGCTAGAAGAACCACGGAGTTCTGAAGGTGATCAACTCCCAAGGCTTCAGAGCTTGCAAAGGATACTCCAAGGAAGTGTGGCTGTGCAGGTCAACAGTGGGGTATTAAGTGTGTGCACTGCATTCTTATCTGGTGAGCCAGCGACTAGGCTCAGATCCCAAGAACTGCAGCAGCTCATCGCTGCATTGCTTGAATTCATGGCTGTCTGCAAGCGTGCAATCCGTGTGCATTTCAGATTGATAGGGGAAGAAGACCAGGAATTCCACACCCAACTTGTCAATGGGTTCCAGTCACTCACCGCTGAGCTATCTCACTATATCCCTGCTATACTCTCCGAGCTATGA >Zm00001d007384 ATGATGGAGGGAGGTAGCCGCGCGGATGGGCAGAACCCGAACCAGCTCCGGCTGTTCACCTGCACCGGGAACCTGCTCCACCGCGCCCACGGCTGCGCGTGGTGGGCGCAGGGCGGAATCGTCATGCTAGCCGCCGTGTATGGGCCCAAGCCGGGGACCGCTCAGGGTTCTTTGGATCGTCGAGGTGTTTTTTCATTGGACACACATTCACCATCAGTCTGCCTTTTGATTCAATTGGAAAAGGCTGCTACTGAAGAAGGGGGAGTAACACCTTCTGTTTATTCTCATAAAGAGCCTGTGCACTTAGCTAAGAAAGAGAAGCAAAAGCTGCAAGTATGGTCTCGAATTATGCCTTGTAAAGAGTCATTTGCATGGGCCATGATTCCTCTGTTTGAAGCTCCGATTCTAACAAGAACCTTCCTATTGCAGTTGAAACGGAAACATAACGACAGAACAGAAAATGAAGCTACCGAATCAAATGACTGGATGAGCCCTGGATATGCTAATGCTGGCAGCAGCCCAGTTCCTACACCCCCTTCAGGGAAAGGTTTAAAAGCATCCACCAAGCCTAAGGCTACGAAGGGCCAGAAATCTGGTCCTCGGACCCCTTTGGGTTTTGGTTCTCCGGGCAATCCTTCTACTCCTGTTGGTGGCTGCCGCTATGATAGCTCCCTCGGGCTCTTGACAAAGTTCCTGAACTTGCTAAAAGGTGCACCTGGTGGCATTGTTGATCTGAATAATGCTGCAGAAACTCTAGAGGTACAGAAAAGGCGTATATATGACATCACTAATGTTCTTGAAGGGATAGGACTGATAGAAAAGAAGCTTAAGAACAACATCCAGGAGTTGACGACTCTCGACCCGGAGATTAGTGATGATATGTCCATTTTACAGGCAGATATCAATGCTCTCACACTGCAAGAGCGCAATTTGGATGAACGAATAAGGGAGGTTCGACCTAGCTGA >Zm00001d047540 ATGCAGGATGCTCAGGGTTCTTTGGATCGTCGAGGCGTTTTTTCATTGGACACACCTTCACCATCAGTCTGCCTTTTGATTCAATTGGAAAAGGCTGCTACTGAAGAAGGGGGAGTAACACCTTCTGTTTATTCTCGTAAAGAGCCTGTGCACTTAGCTGAGAAAGAGAAGCAAAAGCTGCAAGTATGGTCTCGAATTATGCCTTGTAAAGAGTCATTTGCATGGGCCATGATTCCTCTGTTTGAAGGTAACCATGCGGGTGGTCTTAGTGATGCTGCTTCTCCTAGCAGTCCTTTAGCAACAAGTTTACCAGGATCAACTTCTCAAGATAGTATTGTGGACCCTATTTTAAAGCTTACTTTAGATGGAAAAGTAAACCATTACTCGAGTGGAAGCTCAGTTATTGTAGAGATATCAAACCTAAACAAAGTGAAGGAAAGCTATATAGTGGACTCCCTCCAAGATCCAAAACGGAAAGTACATAAACCAGTGAAAGGTGTATTGAGATTAGAAGTGGAAAAACTTCATGGTGGCCACAATGATGTGGATAACACTTCTGAAGGCGGAAGCATGGCCAATGATTTGAATGATGCTGGTGACATCAATAATGGCAGAAGCAACAGAAGTAGCTTTGATGGGATTCACAGTTTTGTGAATTCTATTGCCATTGCCCAGAAAGATGCTCATCACAATGGAATCATTTCTAATGCTGAGAATGGTGACAATTTTGAAGCTTTTGACTTTCGGATGCTGACCCGAAGTGAGCCGTTTTCACAACTTTTTCATTGCCTCTATGTGTACCCATTGACTGTTAGCTTGAGCCGCAAAAGAAACCTGTTTGTTAGAGTGGAACTGAGAAAGGACGATTCTGACATCCGAAAGCCTCCATTAGAGGCTGTTCATCCTAGGGAGCGGAATATGATGCTACAGAAGTGGGGCCATACACAGATTGCTGTTGGAACAAGAATGGCTTCCTACCATGATGAAGTTAAAATCAGCCTACCTGCTCTTTTGACACCCCAGCATCATCTTGTGTTCACATTTTTCCATGTAGATCTTCAAATGAAACTTGAAGCACCAAAACCAGTGATCGTTGGGCATTCTGTACTTCCACTGTCGACACATATTCAGTTACTTTCAGATGTATCCTTGCCAATTTTGAGAGAGCTCGTTCCACATTACCTGCAGGGAAGTGGAAAGGAGAGAATGGACTATCTGGAAGATGGAAAAACTGTTTTCAAGTTGCGTTTAAGGCTCTGTTCTTCATTGTTCCCGGTTAATGAAAGGATAAGAGACTTTTTTGTTGAATATGACCGCCATACTCTACATACAAGTCCCCCATGGGGTTCTGAGCTTCTTGAGGCCATAAATAGTTTGAAAAACGTTGAATCTACTGCATTATTACAATTTCTGCAACCAATACTTAACATGCTGCTTCATCTTATTGGCGATGGCGGTGAGACCCTTCAGGTTGCTGCGTTTCGAGCCATGGTTAACATTTTAACCCGTGTGCAGCAGGAGTCATCAGATGGGGCTGAGAGAAATAGATTCCTTATTAATTATGTTGATTTTGCTTTTGATGACTTCGGCGGTCGGCAAGCACCTGTGTATCCTGGTCTGTCTACTGTTTGGGGAAGTCTTGCTAGGAGTAAGGCGAAAGGTTATAGAGTTGGTCCTGTGTATGATGATGTGTTGGCAATGGCTTGGTTTTTTCTGGAGCTTATTGTAAAATCAATGGGATTGGAACAAAGTCGTCTCTTCTACCACAACCTTCCATTAGGTGAAGATGTCCCACCGCTACAATTGAAAGAAGGTGTCTTCAGGTGCATCATGCAGCTCTTTGATTGCCTTCTAACTGAGGTTCATGAACGCTGTAAAAAGGGTTTAAGCTTGGCAAAACGCTTGAACAGCACGCTTGCTTTCTTTTGCTATGATCTTTTATCAATAATTGAGCCTCGCCAAGTTTTTGAGCTGGTTTCGTTGTACATGGACAAGTTTGCAGGAGTTTGTCAAGCAGTCCTTCATGACTGCAAATTGACATTCCTGCAGATAATATGCGACCATGATCTATTCGTTGAGATGCCTGGGCGGGATCCCTCTGATAGAAACTATCTCTCGTCAGTTCTTATTCAAGAGATCTTTCTGACCTTAGACCATGATGATTTGTCTCAACGAGCGAAGGCTGCTCGGATTCTGGTTGTCCTTATATGCAAACATGAATTTGATGCACGCTATCAAAAAAGTGAAGACAAGCTGTACATTGCTCAGCTGTACTTCTCTCTTATAGGGCAGATCCTTGATGAGATGCCTGTTTTCTATAATCTGAATGCCATCGAAAAGCGTGAAGTGCTAGTTGTCATTTTGCAAATTGTAAGGAACTTGGATGATGCAACTCTTATCAAAGCATGGCAACAAAGCATTGCTAGAACCAGATTGTTCTTCAAGCTTCTTGAAGAATGTATAACCCATTTTGAGCACAACAAAACAGGAGGCAGCATGCTACTTGGTGCTAGTTCTCGGAGCCCAGATGTTGAGCGCCCTGCACCCCCAAAGTACTCTGAGCGATTATCCCCATCAGTCAATGCATATTTGTCGGAGGCTTCAAGGCATGAAATAAGGCCTCAGGGAACACCAGAAAATGGGTACATGTGGAACAGGGTTAGCCCTCAATTAAGTTCCCCTAATCAACCCTATTCATTGAGGGAAGCACTTGCTCAAGCACAATCTTCAAGAATTGGGTCAACCGCCAGGGCATTGAGAGAGTCTCTGCATCCAGTACTGAGACAAAAATTGGAACTTTGGGAAGAAAATCTCAGTACTGCTGTGAGCCTCGAAGTGTTGAGAATAACCGAGAAGTTTTCAGCTGCTGCAGGCACTAGAAGCATCACTACTGATTATGCGAAGCTAGATTGTGTAACATCTATCGTAATGGGTCTTTTATCTAGGAGCCAACCCTTGGCATTTTGGAAGGCTTTCCTTCCTGTGGTCTACAACATATTTAATCTTCATGGTGCAACACTAATGGCAAGGGAGAATGACCGCTTCTTGAAGCAAATTGCTTTTCATCTTTTGCGGCTTGCTGTTTTTCGAAATGATTCTATTAGGAAAAGAGCTGTTGTTGGGTTGCAGATTCTCGTTAGGAACGCATTCAACTATTTCAAGAACACTACAAGGTTGAGAGTCATGTTGACAATTACTTTGTCAGAGTTGTTGTCTGATGTGCAAGTGACTCAAATGAAATCCGATGGTTCTCTTGAAGAAAGTGGTGAAGCTCGGCGCCTTAGAAAATCACTGGAGGAAATGGCTGATGTAAGAAGCAAGGATCTGTTGAAAGATTGTGGCCTCCCTGTTACTGCATTGGAGGCGGCCCCTGATGGTTCCTCTGATAATATGTGGTCTTGGGCAGAGGTGAAACATCTCTCTAAATGTCTAGTCCAGGCCCTTGATGCTGGTCTGGAACACGCCCTCTTGGATTCTGTAGTGACTGTAGACAGCATTTGTGTGATGCACACCAGGAGATGCAATCATGGGCTGAAGCAGCACAATGTGCAGTTGCTGCAGCTGGCGTGA >AH021949 ATGGAGAATTCATATGGGCATCGATTTCGTAGAGTAACTCGGCATTCATGGGCTGCCAATATGAAATTAGAACCACTTCTTGACAAGGATGTGGAACAGTGGCCTCATTTGAATGAACTTGTCCAATGCTACAGAGCTGATTGGGTTAAAGATGAAAATAAGTATGGGCATTATGAGAGCATTGGTCTTACTGCATTTCAAAATCAGATATATGAAGGAGCTGACACTGATATTGAAACAGAGATGCATCTTTCCGAGGCCAGACAAACTGAAAACGAAGATGTTACTGATGAAGAATTACCAAGCACATCCGGGAGGCCATTTGGAGAGCATCTTGGGTTGTCGCCGTTGCCTGCTTATGAACCTGCATTTGACTGGGAGAATGAGAGGTCTATGGTATTTGGTCAAAGAGTTCCAGAAACTCAAGTGCAGTATGGAAGTGGCTTGAAAATATCAGTGAAAGTTCTTTCTCTTATGTTTCAAGCTGGACTAGCTGAACCATTTTATGGTACAATTTGCTTGTATAACAAAGTGAAAAGAGAGAAATTGTCAGAGGACTTTGTTTTCCATGTGCTTCCTACAGAAATGGAAAATACTGGTTGTTCAAATGAATCACGAGCTATATTCTACCTAGATGCTCCCTCAGCATCAGTTTGTTTGTTGATTCAGTTGGAGAAGCCTGCCACTGAAGAAGGAGGCATCACTTCCTCTATCTACTCGCGAAAAGAACCAAGCCAGCTGAGTGACAGAGAGAGGCAGAAATTGCAGGTCTGGTCTCGAATTATGCCTTACAGAGAGTCATTTGCTTGGGCTATGGTACCATTATTTGATAACAGCATTGCCGGAACCTCCGGTGGTACTGGCTCTCCAAGTAGCCCTTTGGCACCAAGTGTCTCTGGTTCTAGTTTCCATGAGGGTGCATCAGAGTCTACTGCCAAGATCACTTTAGATGGGAAACTGGGTTATATGAGCGGGAGCTCAATCGTTGTTGAAATATCAAATTTGAACAAAGTCAAAGAGAGCTACACAGAGGATTCTCTTCTGGACCCTAAAAGAAAGATCCATAAGCCTGTTAGAGGCATGCTGAAATTAGAGATTGAGAAACTCCATGCTGGGAATCTTGACTTCGAAAATGTTTCAGAAAGTGGCAGTATGACTAATGAATCATTTGATACGGGGAGTAATATCCTTGATTCTTCACAGATTCCAAATAATTTGGATAAGTCACAGAATACCAAATTAAAACAACATTCTACGGATGGAAACGAATCTGTTCGAAATGGGTTAAAAGCTCATGAGAATCAAGATTCCCAAATAGATGAATTTCATGCATTTGACTTCCGTGCGATCGCGAGGAATGAGCCTTTTTTGCAGCTTTTCCATTGTCTATATGTGTATCCATTGACTGTTAGCTTGAGTCGGAAAAGGAATTTATTCATACGGATCGAGCTCCGTAAGGATGACACAGATATTCGCCGACAACCTCTGGAGGCAACATACCCTAGGGAGCCTGGTGCATCACTAGAGAAGTGGGCTCACACGCAAGTTGCTGTTGGTGCAAGGGTGGGTTGCTATCATGACGAAATTAAAGTCTCTTTACCTCCTATGTGGACACCACTGCATCATGTATTGTTTACTTTCTTTCATGTTGACCTTCAAACTAAATTGGAAGCTCCTAAACCGGTGGTGATTGGCTATGCAGCACTTCCATTGTCTACATACGCTCAGTCAAGATCTGAAATTTCACTGCCCATTATGAGAGAGCTAGTTCCGCATTATCTTCAAGATGCTGGGAAGGAGAGGCTCGACTATTTAGAGGATGGGAAAAATGTCTTCAGATTGCGATTGAGATTGTGTTCTTCCCTGTACCCTACTAATGAACGTATTAGGGAATTCTTTCTTGAGTATGATAGGCACATCCTTCGAACAAGCCCTCCTTGGGGATCAGAGCTTCTTGAGGCCATTAACAGTTTGAAAAATGTTGATTCCACTGCTTTGCTCCAGTTTCTTCATCCAATATTAAATATGCTTCTCCATCTAATTGGGAATGGTGGTGAAACCCTTCAGGTTGCTGCTTTTAGAGCTATGGTTAATATCTTGACTCGGGTTCAGCAAGAATCAATGGATGATGCTGAAAGAAATCGATTTCTCATTAGCTATGTTGATTATGCATTTGATGACTTTGGAGGTCGTCAATTACCAGTTTATTCTGGTCTTTCTACCGTGTGGGGAAGCTTAGCACGTAGTAAGGCAAAAGGTTATCGTGTGGGACCAGTATACGATGATGTTTTAGCAATGTCTTGGTTTTTCCTTGAGCTAATTGTGAAGTCAATGGCTTTGGAACAAATACGTCTTTTCTATCATAGCCTTCCATCAGGTGAGGATGTCCCCCCTATGCAATTGAAAGAAGGAGTTTTCAGGTGCATTATACAGCTCTACGATTGTCTTATCTCTGAAGTGCATGAGCGTTGTAAAAAAGGGTTGAGCTTAGCCAAGCGTTTGAATAGTAGCTTGGCCTTTTTCTGTTATGACCTACTGTCTATTATTGAACCTCGCCAAGTTTTTGAACTGGCCTCCTTGTATCTGGATAAGTTTTCTGGGCTATGCCAATCTGTTCTTCATGACTGTAAGCTTACCTATCTACAGATCATATGTGATCATGATCTTTTTGTGGAAATGCCTGGTCGAGACCCTTCGGACAGGAACTATCTTGCATCAGTGCTGATACAGGAACTTTTTCTCACATTAGATCATGATGATATGTCACTCAAAGCGAAGGGAGCAAGAATCTTGGTGGTTCTCATGTGCAAACATGAATTTGATGCCCGCTACCAAAAGCCTGAAGATAAACTATATATTGCACAACTCTATTTTCCACTGATCAGTCAGATACTTGACGAAATGCCTGTCTTTTACAACCTTGGTGCTGCTGAGAAGCGTGAGATATTGATTGTTGTTCTGCAAATCGTACGCAATTTAGATGATGCATCGCTTGTCAGGGCCTGGCAGCAAAGCATTGCAAGAACCAGATTATTTTTCAAAATTCTTGAGGAATGCTTAATCCTTTTTGAGCATAAAAAACCAGCAGACAGTATGATTATTGGCAATAGTTCTCAAACTATTGTGGCGGATGGAGCAGCATCTCCAAAGTACTCGGATAGGTTATCTCCTGCTATCAACAATTATCTTTCTGAGGCATCTCGACAAGAACCCCATAGAACACCAGACAACTATTTGTGGCAGAGAGTGAACTCTCAGTTAAGCTCTCCTAGCCAACCATATTCCTTGAGAGAAGCTTTAGCTCAAGCTCAATCCTCCAGGATAGGAACCTCTGCACAAGCACTAAGAGAATCATTGCATCCGCTATTGAGACAGAAGCTGGAACTTTGGGAGGAGAATTTGTGTGCTGCTGTCAGTCTTCAGGTTCTAGAAGTTATTGAAAAATTTTCTACAACTGCTGCTTCACGTGGAATAGCAACAGATTATGGAAAACTTGATTGTATTACTTCCATATTCACAAGCTTCTTCTCAAGGAATCAGCCACTTACATTCTGGAAAGCTCTTCTTCTGGTGTTTAACAATATATTCAGCTCTCATGGATCAACACTAATGTCACGTGAAAATGATCGGTTTCTCAAGCAAATTGCTTTCCATCTTCTTCGTCTTGCTGTATATAGAAATGAAAACATCCGGAGAAGGGCGGTAATTGGTCTTCAGATTCTCGTAAGGAGCTCCTTCTGTAACTTCATGCAGACAACAAGGCTTAGAGTCATGCTGACCATTACATTGTCAGAGTTGATGTCTGATGTCCAGGCTACTCTTATGAAGCCTGATGGAAGTTTTGAGGAGAGTGGTGAACAGAAGCGGCTACGTAAATCTTTGGAGGAAATGGCTGATGAAGTGAACAGCACTAGTTTGCTGAGGGAGTGTGGTCTTCCCGAGAGTGCACTGGTTGCGATTCCCGAAAATTCTACGGAGAATAGGTGGTCCTGGTCAGAAGTCAAGTCTCTCTCTGACAGTTTGACTCTGGCTCTCGATGCGAGCCTGGAACATGCACTCCTTGGTCCCGTCATGAACATTGATAGATATGCTGCAGCGGAAAGTTTTTACAAACTTGCAGTTGCATTTGCTCCAGTTCCTGATCTTCACATAATGTGGCTATTGCATCTATGTGATGCACATCAAGAAATGCAGTCCTGGGCTGAAGCAGCACAATGTGCTGTTGCCGTTGCTGGTGTTGTCATGCAGGCTCTAGTTAGTAGAAATGATGGCGTGTGGAGCAATGAGCACGTTGCAGCTTTGCGTAAAATATGCCCCATGGTCAACAGTGAAATCACGGCTGAGGCATCTGCTGCCGAGGTGGAAGGCTATGGTGCTTCAAAGCTAACTGTCGATTCAGCTGTAAAATACCTTCAGCTTGCAAACAAACTGTTTTCTCAAGCTGAGCTTTATCACTTCTGTGCAAGCATTCTAGAATTGGTGATTCCTGTGTACAAAAGCAGAAGAGCGTATGGACAGCTAGCCAAATGCCACACAATGCTAACTAGTATATATGAATCAATCCTTGAACAAGAAGCAAGTCCAATTCCTTTTGCTGATGCAACATACTATAGGGTAGGTTTCTACGGCGAAAAGTTTGGAAAACTGGATAATAAAGAATATGTATACAGAGAGCCTCGTGATGTACGGCTGGGTGACATCATGGAAAAGCTTAGTCATATATATGAATCCAGGATGGATGGTAATCACCGGCTGCATATTATTCAAGATTCGAGACAAGTGAAGGCAGATGAGCTGCAGCCGGGTGTCTGTTACTTGCAGATCACTGCTGTTGATCCCGTTATGGAAGACGAGGATCTCGGAAGCAGGAGGGATAGGATATTTTCCCTTTCCACTGGAAGCGTCCGTGCTCGTGTTTTTGATCGATTTCTGTTCGACACTCCCTTTACTAAAAATGGGAAGACTCAGGGTGGATTAGAGGATCAATGGAAACGTCGAAGTGTTCTTCAAACAGAAGGCTCGTTTCCGGCTCTCGTTAACAGGCTTCTGGTGACAAAATCTGAATCTATGGAATTCTCACCTGTAGAAAATGCTATTGGGATGATTGAAACTCGGACTGCTGCTCTCCGAAATGAGCTTGAAGAACCTCGGAGCTCTGAAGGGGACCAGTTGCCACGTCTACAAAGCCTTCAAAGAATACTGCAAGGCAGTGTCGCAGTTCAAGTGAATAGTGGAGTGTTGAGCGTTTGTACAGCATTTCTCTCCGGTGAGCCTGCAACAAGACTTCGTTCACAAGAACTCCAACAGCTCATTGCTGCACTACTCGAATTCATGGCTGTTTGTAAGAGGGCAATTCGAGTACACTTCAGGCTAATCGGAGAAGAAGACCAAGAGTTTCACACGCAGCTTGTAAATGGATTTCAATCACTTACAGCCGAGTTATCTCACTACATTCCTGCCATTCTTTCTGAGCTCTAA >NNU_03339 ATGATCTCTAGGGACAAGGAGGGTGGGAAAATAGGGAGAGCCGACAAAAGGGTACAACAGGAATCAGCAGATGGTGCTGAAAGAAACCGTTTTCTTGTTAATTATGTGGATTATGCTTTTGATGACTTTGGGGGTAGACAGCCACCAGTTTATCCTGGCTTATCCACGGTCTGGGGCAGCTTGGCTCGCAGCAAGGCTAAAGGTTACCGTGTTGGGCCAGTTTATGATGATGTGTTAGCAATGGCTTGGTTTTTTCTAGAATTAATAGTGAAGTCAATGGCGCTAGAGCAGACTCGTCTATTCTATCATAGTCTTCCTTTAGGTGAAGATGTTCCACCATTACAATTGAAGGAAGGTGTATTCAGATGCATCATGCAGCTGTATGACTGCCTACTTACAGAGGTGCATGAACGCTGCAAGAAGGGGTTAAGCTTGGCAAAACGTTTGAATAGCAGCTTGGCCTTCTTTTGTTATGATCTTTTGTCTGTTGTTGAGCCTAGACAGGTTTTCGAGCTGGTATCATTGTACATGGACAAATTCTCTGGGGTTTGTCAATCTGTTTTGCATGACTGCAAACTTACATACTTGCAGATATTATGTGATCATGATCTTTTCGTGGAAATGCCAGGGAGGGATCCTTCTGATAGGAACTACCTTTCATCTGTTCTAATACAGGAGCTTTTCCTTACATGGGATCATGATGATTTATCTCTGCGATCCAAAGCGGCTCGAATCTTGGTTGTGCTTACGTGCAAGCATGAGTTTGATGTTCGATACCAAAAGCCTGAAGATAAATTATACATTGCCCAGTTGTATTTTCCACTTATAGGACAGATCCTAGATGAAATGCCTGTTTTTTACAACCTGAATGCGGTTGAAAAGCGTGAGGTCTTAATAGTTGTTATGCAAATTCTGCGCAATTTGGACAATGCATCACTTGTCAAGGCCTGGCAACAAAGTGTTGCTCGAACCAGATTATTCTTCAAACTCCTAGAGGAGTGTCTTGTTCTTTTTGAGCACAAAAAACCAAATGACAGCACACTACTGGGGTGTAGTTCTCGTAGCCCTGACAGAGAAGGACCCGTTTCCCCAAAGTACTCTGATAAGCTCTCACCTGCAATCAACAACTATCTTTCTGAGGCATCTCGACAAGAAGTTAGACCTCAGGGAACACCAGAAAATGGTTATTTGTGGCAGAGAATCAGTCCCCAGTTGAGCTCCCCTAGCCAGCCATATTCTTTGAGAGAAGCTCTTGCTCAGGCACAGTCTTCTAGGATTGGACCTTCAACACGGGCACTAAGAGAGTCTTTGCACCCGATATTAAGGCAAAAACTGGAGCTTTGGGAAGAAAACCTAAGTGCATCTGTTAGTCTTCAAGTTTTAGAGATCACTGAGAAGTTTTCAACTGCTGCAGCATCCCACAGCATATCTACTGATTATGGAAAGCTAGATTGTATCACTTCAATACTTATGAGTTTTTTCTCACGAAGCCAGTCACTGGCCTTTTGGAAATGTTTGTTTCCTGTGTTTAACAATATCTTCAATCTTGATGGTGCAACACTAATGGCAAGGGAGAATGATCGCTTCTTGAAGCAAATTGCATTCCATCTTCTTCGACTAGCGGTTTTCCGAAATGATAATATTAGGAAAAGGGCAGTCATTGGTCTTCAAATACTTGTTAGGAGTTCCTTCTATTACTTCATGCAGACAACAAGGTTGAGGGTAATGCTGACAATAACCTTGTCAGAGTTGATGTCTGATGTTCAAGTGACTCAAATGAAATCTGACGGATCACTTGAGAAGAGTGGTGAAGCTAAGCGTCTTGGGAAATCCTTGGAGGAAATGGCGGATGATGTTAGGAGTCCTAACCTATTAAAAGAATGTGGACTTTCAGAGGATGTTCTTACAGCAGTTCCTGAAGGTTCTACAGAGATTCGGTGGTCATGGTTAGAAGTGAAACCTCTCTCTGACAGTCTACTTCAGGCCCTTGATGCTGGTTTGGAACATGCACTTCTTGCTTCCACAATGACAGTAGATCGATATGCGGCTGCAGAGAGCTTCTATCGACTTGCAATGGCATATGCACCTGTTCCTGATCTTCACATAATGTGGTTGTTGCATTTATGTGATGCACATCAGGAGATGCAGTCCTGGGCTGAAGCTGCACAATGTGCTGTTGCTGTGGCTGGTGTTATCATGCAGGCCCTTGTTGGAAGAAATGATGCTGTGTGGAGCAGAGACCATGTTGCTGCTTTACGGAAAATCTGTCCCATGGTCAGCAGTGAGATTACTGCTGAGGCTTCTGCGGCTGAAGTAGAGGGTTATGGTGCATCAAAGCTTACTGTTGACTCTGCTGTGAAATACCTACAGCTTGCAAACAAGCTATTCTCTCAAGCAGAGCTTTATCATTTTTGTGCAAGCATTCAAGAACTGATCATTCCAGTTTATAAGAGTCGGAGGGCATATGGGCAGCTTGCAAAATGCCATACAACCCTGACCAACATCTATGAGTCAATCCTTGAGCAGGAATCAAGCCCAATACCATTCACTGATGCTACATACTACCGTGTGGGGTTCTATGGAGAAAGATTTGGCAAGCTAGACAGGAAGGAGTATGTATACAGAGAACCCCGTGATGTACGCCTTGGTGATATAATGGAGAAGCTTAGTCATATCTACGAGTCCAGGATGGATGGGAATCAAACACTGCATATAATTCCTGATTCTAGACAAGTCAATGCAGATGAGTTGCAGCCAGGGGTATGCTATTTGCAGATAACTGCAGTGGATCCTGTCATGGAGGATGAGGATCTTGGCAGCAGAAGAGAGAGGATCTTCTCTCTTTCTACTGGGAGCATGCGCGCACGTGTCTTTGATCGCTTCTTGTTTGACACTCCATTTACAAAAAATGGAAAGACCCAAGGTGGCCTGGAAGATCAGTGGAAGAGACGAACTGTACTTCAGACAAAGGGCTCATTCCCAGCTCTAGTAAATCGTCTTCTGGTGATCAAATCTGAATCACTTGAGTTCTCACCAGTAGAGAATGCAATTGGGATGATTGAAACTCGGACAGCTGCACTAAGGAATGAGCTTGAAGAGCCTCGCAGTTCTGAAGGAGATCAGCTTCCACGCCTCCAAAGTTTACAAAGAATACTCCAGGGCAGTGTAGCTGTTCAGGTGAACAGTGGAGTTCTGAGCGTGTGTACAGCCTTTCTATCAGGCGAGCCTGCAACCAGGCTGCGTTCACAAGAACTGCAGCAACTTATTGCTGCTCTGCTTGAATTCATGGCAGTTTGCAAGCGTGCAATCAGGGTGCACTTTAGGTTAATTGGAGAAGAAGACCAAGATTTCCACACGCAGCTT >NNU_03340 ATGGAAGAATCACCATCTGGTGGACATCGGTTTAGAAGAATACCACACCAACTATTTGATTCTTGTCCAGAGTTAGATCCACTGCTATTTGAAGGGCCTGATACTGATGTAGAAACGGAGATGCGTCTTGCCAATGTAAGGCATTCCAAGGCTGAAGATGCTACTGATGATGATGCTCCTAGCACCTCAGGAAGGCAATCCTCAGATATTGGCTCAACTAACATGCTGTACTCAAAGGTTTTGAAGGATAGACTTTCTTCTGAGCGACACGGTGTTTTCTCTTTAGATGCTCCATCACCAGCAGTTTGCCTGCTGATACAGCTAGAGAGGCCAGCAACAGAAGAAGGAGGGGTTACTCCTTCTGTATATTCACGCAAAGAACCAATTTGA >Glyma.08G148300 ATGCTACACCTCCGCCAGCGCCGCGATGCCGCCGCGCCCGCCACCACGCGCTGGCGCAACACGTTCGAGGAGAATCTGGAGCAGTGGCCGCACCTCAACGAGCTCGTCCATTGCTACACCACGGATTGGGTCAAGGATGAGAACAAGTACGGACACTACGACTCCGTCGGAACCCCGTCGTTTCATAACCAAATATATGAAGGCCCCGACACTGACATTGAAACCGAAATGCGCCTTGCTGGGGCAAGGCAAACGAAGGGTGATGAAGTTAATGATGATGACATACCTAGTACTTCGGGAAGGCAGTTTACGGAAGGTGTAGATGGTGACTTGCTGCCTTCAGATGTTCCAAAGCATATTGGTCAATCTCCCCTTCCTGCTTATGAGCCTGCATTTGATTGGGAAAATGAGAGGACATTGATATTTGGACAAAGGATACCGGAAACTCCTCTATCGCATGGAATGAAGATCTCTGTAAAAGTTCAGTCTTTACAATTTCAAGCAGGATTGGCTGAGCCCTTTTATGGTACAATTTGTTTGTACAATAGGGAGAGAAGAGAAAAGTTATCAGAAGACTTTTACTTTCATGTCTTGCCAACTGAAACGCAGAATGCCAAAATTACATGTGAACCTCGTGCAGTCTTTTACTTAGATGCGCCATCTGCTTCAGTTTGTTTGTTAATCCAGTTAGAGAAGCATGCTACTGAAGAAGGCGGGGTTACTGCTTCTGTTTATTCACGTAAAGATCCAGTGCACTTGACTGAGAGAGAAAAGCAAAAACTGCAGGTGTGGTCTAAAATCATGCCTTACAAAGAGTCCTTTGCATGGACCATCGTATCATTATTTGATAGCAGTATTGGTGCAGCTTCAGTAGGGCCTGCTTCCCCTAGCAGCCCTCTTGCTCCTAGTATATCTGGTTCAAGTTCTCATGAAGGTGTTTTTGAGACTAGTGCAAAAATCTCTTTAGATGGAAAGCTGAGTTACTCTAATGGAAATTCAGTGGTAGTAGAGGTTTCAAACTTAAATAAAGTCAAAGAAAGCTATACTGAGGAATCACTTCAGGATCCTAAACGTAAGGTGCACAAACCTGTCAAAGGTGTTTTGAGGCTGGAAATTGAAAAGCACCAGATTTCCCAGGCTGATTTGGAAAACATGTCAGAAAGTGGTAGTATAACCAATGATTCTGTTGACCAAGGGGATCGAATTGCGGATTCACTGTCTGGAAAGTACCCTAGTAATGGTTGTGATGATCCTCAGGGTAGCAACCTCAGGGTAGTATCTCCAGTTTTGGGAAATGGAGCAAATCAACATGGAAATTCAGATTTTAATGCCCATGATTTCCATGCTTTTGACTTCCGCACTACAACAAGAAACGAGCCTTTTTTGCAACTTTTTCACTGCCTGTATGTGTATCCGTTGACTGTAAGTTTGGGTAGGAAAAGGAATTTGTTTTTACGGGCTGAACTCAGGGAGGATGATGGTGATATTCGTAGGCAGCCATTGGAGGCAATATATCCTAGAGATCCAGGTCTCGATGCATCATTTCAAAAGTGGGGTCACACCCAAGTTGCTGTCGGAGCTAGGGTTGCTTGTTACCATGATGAAATCAAACTTTCCCTTCCTGCTATGTGGACACCAACGCACCACCTTCTATTTACTCTATTTCATGTTGATCTGCAAACAAAATTGGAAGCTCCAAAGCCAGTGGTAATTGGATATGCAGCACTTCCTTTATCTTCCCATGCTCAGCTGCGGTCAGAAATAAATCTTCCAATTATGAGAGAATTGGTTCCTCATTATCTCCAGGATGCAGGACGGGAGAGATTGGATTATTTGGAAGATGGGAAAAGTGTCTTCAGATTGCGTTTGCGACTGTGTTCGTCTTTATACCCTATCAATGAACGTATTAGAGATTTCTTTCTTGAATATGACCGGCATACTCTTCGAACAAGTCCACCATGGGGTTCTGAACTTCTGGAGGCTATTAATAGTTTGAAGAATGTTGATTCCACTGCTTTACTTCAGTTTCTTCACCCAATTCTTAACATGCTACTTCATCTTATTGGCAATGGTGGAGAAACACTTCAGGTTGCTGCGTTTCGGGCCATGGTTAATATTGTAACCAGGGTGCAGCAGGAATCAGTTGATGATGCTGAAAGGAATCATTTCCTAGTCAACTATGTTGATTGTGCCTTTGATGATTTTGGTGGTCGTCAACCGCCTGTATATCCTGGACTGTCCACTGTTTGGGGAAGCTTGGCACGAAGTAAGGCCAAAGGGTATCGTGTTGGACCTGTGTACGATGATGTTTTGGCTATGGCATGGTTTTTCCTGGAGCTAATTGTTAAATCAATGGCATTGGAGAAGACTCGTCTCTTTTATCACAGCCTTCCAATAGGTGAAGATATCCCTCCAATGCAGTTGAAGGATGGGGTATTCAGATGTATATTGCAGTTGTATGATTGCCTTCTTACTGAGGTGCATGAGCGCTGTAAGAAGGGTTTAAGCCTGGCAAAACGCTTGAACAGTAGTTTGGCCTTCTTTTGTTATGATCTTCTATCCATTATTGAGCCACGGCAAATTTTTGAGTTGGTATCATTATATCTTGACAAGTTCTCTGGTGTATGTCAATCAGTACTTCATGAATGCAAACTTACCTTTTTACAAATAATATGTGATCACGATCTTTTTGTGGAAATGCCTGGAAGGGACCCTTCTGATAGGAACTACCTTTCTTCTGTATTAATACAAGAACTCTTTGTTACTTTGGATCATGAAGATTTGTCTCTAAGAGAAAAGGCAGCAAGAATCTTGGTAGTGCTCTTGTGCAAACATGAGTTTGATGTCAGATACCAGAAACCTGAAGATAAATTGTATATTGCTCAGCTATATTTCCCACTTGTTGGACAGATATTAGATGAAATGCCTGTTTTCTACAACCTCAATTCTGTTGAAAAGCGGGAAGTTTCAATTGTAATTTTGCAAATAGTTCGAAACCTTGATGATGCATCACTTGTCAAGGCATGGCAGCAAAGCATTGCTCGGACTAGATTGTTTTTCAAGCTCATGGAGGAATGCTTGCTTTTATTTGAGCACAAAAAACATGCTGATGGCATGTTACTTGGCTCCAGCTCTCGCAACCCAGTAGGGGAGGCACCTGCTTCCCCAAAGTACTCTGACAGACTTTCTCCTGCAATCAACAATTATCTGTCTGAGGCCTCAAGGCAGGAAGTCAGGCCTCAGGGAACACCAGATAATGGTTATTTATGGCAGAGAGTAAATTCCCAGTTAAGCTCCCCTAGCCAGCCATATTCCTTGAGAGAGGCTCTAGCTCAAGCACAGTCTTCCAGGATTGGAGCTTCTGCTCAAGCACTTCGAGAATCTTTACATCCACTTTTGAGGCAGAAATTGGAACTTTGGGAGGAAAATTTGAGTGCCTTTGTCAGTCTTCAGGTTTTGGAGGTGACTGAGAAATTCTCCATGATGGCAGCATCCCATAGCATTGCCACCGATTATGGAAAACTTGATTGCATAACTTCTGTGTTCATGAGCTTTTTATCCAGAAATCAGCCGTTGACTTTTTGGAAAGCATTTTTTCCTGTATTTAACAGTGTGTTTGATTTACATGGGGCAACTTTGATGGCAAGGGAAAATGATCGTTTTCTAAAGCAAGTCACTTTTCATCTCCTTCGGCTTGCAGTCTTCCGAAATGAAAACATCAGGCAAAGGGCAGTTGTTGGTCTTCAAATACTTGTGAGGAGTTCATTTCATTACTTTATGCAGACAGCTAGATTGAGAGTCATGTTGATTATCACATTATCAGAGCTAATGTCTGATGTGCAAGTGACTCAGATGAGATCTGATGGAAGCTTAGAAGAAAGTGGTGAAGCACGGAGACTTAGGAAGTCTTTAGATGAAATGAAGGATGAAACTAAAAATGCTTACTTGTTGAAGGAGTGTGGATTACCTGAGAATGCTCTTGTGATCGTACCCGAAAAAATGACAGAGAATAGATGGTCCTGGTCTGAGGTGAAATATCTCTCTGACAGCCTTCTTTTGGCCCTTGATGGCAGCTTGGAGCATGCACTATTGGCCCCCATGATGACTATGGATAGATATGCTGCTGCTGAAAGCTTTTATAAACTGGCCATGGCATTTGCCCCAGTCCCTGATCTTCACATAATGTGGTTGCTTCATCTTTGTGATGCACATCAGGAAATGCAGTCATGGGCAGAAGCTGCTCAGTGTGCTGTTGCTGTTGCTGGTGTTGTAATGCAGGCCCTTGTTGCCAGAAATGATGGTGTTTGGAGCAAAGACCATGTTGCTGCTTTACGTAAGATTTGTCCTATGGTTAGCAATGAGATTACGTCTGAAGCATCTGCTGCGGAGGTTGAGGGATATGGTGCTTCAAAACTGACTGTTGACTCTGCTGTGAAATACTTGCAGCTTGCTAATAAGCTCTTCTCACAAGCTGAGCTTTTTCATTTCTGTGCAAGCATTCTGGAACTTGTAATCCCAGTTTACAAAAGCAGGAGGGCTTATGGACAGTTGGCTAAATGTCACACATTACTTACCAGTATCTATGAATCAATTCTTGAACAGGAATCTAGTCCAATTCCTTTCACAGATGCAACTTACTACAGGGTTGGATTTTATGGTGATAGATTTGGGAAACTTGATAAAAAGGAGTATGTATATCGTGAGCCTCGTGATGTACGTCTAGGTGACATAATGGAAAAACTTAGTCACACATATGAGTCTAGAATGGATGACAATCACACTTTGCATATTATTCCAGATTCTAGACAAGTGAAGGCAGAGGAGTTGCAGCTTGGTGTCTGTTACCTTCAGATTACTGCCGTTGATCCAGTAATGGAAGATGAGGATTTAGGAAGTAGGAGAGAAAGAATTTTCTCTCTCTCTACTGGAAGCGTTCGAGCCCGCGTATTTGATCGATTCTTGTTTGACACCCCATTTACCAAAAATGGCAAGACTCAAGGTGGATTGGAAGATCAATGGAAGAGACGCACTGTTCTTCAGACTGAGGGTTCTTTTCCAGCGTTAGTAAATAGGTTATTGGTAATCAAATCCGAGTCCCTTGAGTTCTCTCCTGTAGAAAATGCAATCGGAATGATTGAAACACGAACTGCTGCCTTAAGAAATGAGCTTGAAGAGCCTCGAAGTTCAGAGGGGGATCAACTTCCAAGACTCCAGAGTCTGCAAAGAATCCTACAAGGCAGTGTTGCAGTACAAGTGAATAGTGGAGTCTTGAGTGTCTGCACAGCCTTCTTGTCCGGGGAGCCTGCGACGAGGTTACGATCACAGGAACTGCAACAACTTATAGCTGCCCTTCTTGAGTTCATGGCTGTTTGTAAACGTGCCATCCGCGTACATTTCAGATTGATTGGTGAGGAAGATCAGGATTTCCATACCCAGCTTGTAAATGGTTTCCAGTCATTGACAGCAGAGTTATCACATTACATTCCTGCCATTCTCTCGGAGCTATGA >Glyma.15G212800 ATGCTCCACCTCCGCCAGCGCCGCGACGCCGTCGCGCCAGCCACCACGCGCTGGCGCAACACGTTCGAGGAGAATCTGGAGCAGTGGCCGCACCTCAACGAGCTCGTCCATTGCTACACCACGGATTGGGTCAAGGATGAGAACAAGTACGGACACTACGACTCCGTCGGAACGCCGTCGTTTCATAACCAGATATATGAAGGCCCCGACACTGACATTGAAACCGAAATGCGCCTTGCTGGGGCAAGGCAAACAAAGGGTGATGATATTAGTGAAGATGACATACCTAGTACTTCAGGAAGGCAGTTTATGGAAGGTGCAGATGGTGACTTGCTGCCTTCGGATGTTCCAAAGCATATTGGTCAATCTCTCCTTCCTGCTTATGAGCCTGCATTTGATTGGGAAAATGAGAGGGCATTGATATTTGGACAAAGGATACCGGAAACTCCTGTATTGCATGGAATGAAGATCTCTGTAAAAGTTCAGTCTTTACAATTTCAAGCAGGATTGGCCGAGCCCTTTTATGGTACAATGTGCTTGTACAATAGGGAGAGAAGAGAAAAGTTATCAGAAGACTTTTACTTTCATGTCTTACCAACTGAAATGCAGAATGCCAAAATTACATGTGAACCTCGTGCAGTCTTTTACTTAGATGCGCCATCTGCTTCAGTTTGTTTGTTAATCCAGTTGGAGAAGCATGCTACTGAAGAAGGCGGGGTTACTGCTTCTGTTTATTCACGTAAAGATCCAGTGCACTTGACTGAGAGAGAGAAGCAAAAACTGCAGGTGTGGTCTAAAATCATGCCTTACAAAGAGTCCTTCACATGGACCATCGTATCATTATTTGATAGCAGTATTGGTGCAGCTTCAGTAGGGCCTGCTTCCCCAAGCAGCCCTCTTGCTCCAAGTATATCTGGTTCAAGTTCTCATGAAGGTGTTTTTGATACTAGTGCAAAAATCTCTTTAGATGGAAAGCTGAGTTACTCCAATGGAAATTCTGTGGTAGTAGAGGTTTCAAACTTAAATAAAGTCAAAGAAAGCTATACTGAGGAATCACTTCAGGATCCTAAACGTAAGATGCACAAACCTATCAAAGGTGTTTTGAGGCTGGAAATTGAAAAGCACCAGATTTCCCTAGCTGATTTGGAAAATGTGTCAGAAAGTGGTAGTATAACCAATGATTCTGTTGACCCTGGGGATCGAATTGTGGATTCACTGTCTGGAAAGTATCCTAGTAATGGTTGTGATGATCCTCAGGGTAGCAACCTCAGGGTAGTATCTCCAGTTTTGGGAAATGGAGCAAATCAACATGGAAATTCAGATTTTAATGCCGATGATTTCCATGCTTTTGACTTCCGCACTACAACAAGAAACGAGCCTTTTTTGCAACTTTTTCACTGCCTGTATGTGTATCCGTTGACTGTAAGTTTGGGTAGGAAAAGGAATTTGTTTATACGGGTTGAACTCAGGGAGGATGATGGTGATATTCGTAGGCAGCCATTGGAGGCAATATATCCTAGAGATCCAGGTCTAGATGCATCGTTTCAGAAGTGGGGTCACACCCAAGTTGCTGTTGGAGCTAGGGTTGCTTGTTACCATGATGAAATTAAACTTTCCCTTCCTGCTATGTGGACACCAATGCACCACCTTCTATTTACTCTATTTCATGTTGATCTGCAAACAAAATTGGATGCCCCAAAGCCGGTGGTGATTGGATATGCAGCACTTCCTTTATCTTCCCATGCTCAGCTGCGGTCAGAAATAAATCTTCCAATTATGAGAGAATTGGTTCCTCATTATCTCCAGGATGCAGGGCGGGAGAGATTGGATTATTTGGAAGATGGGAAAAGTGTCTTCAGATTGCGTTTACGACTATGTTCTTCTTTATACCCTATCAATGAGCGTATTAGAGATTTCTTTCTTGAATATGACCGGCATACTCTTCGAACAAGTCCACCATGGGGTTCTGAACTTCTGGAGGCTATTAATAGTTTGAAGAATGTTGATTCCACCGCTTTACTTCAGTTTCTTCACCCAATTCTTAACATGCTACTTCATCTTATTGGCAATGGCGGAGAAACACTCCAGGTTGCTGCCTTTCGGGCCATGGTTAATATTGTAACCAGGGTGCAGCAGGAGTCAGTTGATGATGCTGAAAGAAATCATTTCCTAGTCAACTATGTTGATTGTGCTTTTGATGATTTTGGTGGTCGTCAACCACCTGTATATCCTGGACTGTCCACTGTTTGGGGAAGCTTGGCACGAAGTAAGGCCAAAGGGTATCGTGTTGGACCTGTGTATGATGATGTTTTGGCTATGGCATGGTTTTTTCTGGAGCTAATTGTTAAATCAATGGCATTGGAGAAGACTCGTCTCTTTTATCACAGCCTTCCAATAGGTGAAGATATCCCTCCAATGCAGTTGAAGGATGGTGTATTCAGATGTATATTGCAGTTGTATGATTGCCTTCTTACTGAGGTGCATGAGCGCTGTAAGAAGGGTTTAAGCTTGGCAAAACGCCTGAACAGTAGTTTGGCCTTCTTTTGTTATGATCTTCTATCCATTATTGAGCCACGGCAAGTTTTTGAGTTGGTATCATTATATCTTGACAAGTTCTCTGGTGTATGTCAATCTGTACTTCATGAATGCAAACTTACCTTTTTACAAATAATATGTGATCACGATCTTTTTGTGGAAATGCCTGGAAGGGACCCTTCAGATAGGAACTACCTTTCTTCTGTACTAATACAAGAACTCTTTGTAACTTGGGATCATGAAGATTTGTCTCTAAGAGCAAAGGCAGCAAGAATTTTGGTAGTGCTCTTGTGCAAACATGAGTTTGATGTGAGATACCAGAAGCCTGAAGATAAATTGTATATTGCTCAGCTATATTTCCCACTTGTTGGACAGATATTAGATGAAATGCCTGTTTTCTACAACCTTAATTCTGTTGAAAAGCGGGAAGTTTCAATAGTAATTTTGCAAATAGTTCGAAACCTTGATGATGCATCACTTGTCAAGGCATGGCAGCAAAGCATTGCCCGGACTAGATTGTTTTTCAAGCTCATGGAGGAATGCTTGCTTCTTTTTGAGCACAAAAAACCTGCTGATGGCATGTTACTTGGCTCCAGTTCTCGCAACCCAGTAGGGGAGGCACCTGCTTCCCCTAAGTACTCTGACAGACTTTCTCCTGCAATCAACAATTATCTGTCTGAGGCCTCAAGGCAGGAAGTCAGACCTCAGGGAACACCAGATAATGGTTATTTATGGCAGAGAGTAAATTCCCAGTTAAGCTCCCCTAGCCAGCCATATTCCTTGAGAGAAGCTCTAGCTCAAGCACAGTCTTCTAGGATTGGAGCTTCTGCTCAAGCACTTCGAGAATCTTTACATCCACTTTTGAGGCAGAAATTGGAACTTTGGGAGGAAAATTTGAGTGCCTTTATCAGTCTTCAGGTTTTGGAGGTGACTGAGAAATTCTCCATGATGGCAGCATCCCATAGCATTGCCACTGATTATGGAAAACTTGATTGCATAACTGCTGTGTTCATGAGCTTTTTATCCAGAAATCAGCCGTTAACTTTTTGGAAAGCATTTTTTCCTGTATTTAACAGTGTGTTTGATTTACATGGGGCAACTTTGATGGCAAGGGAAAATGATCGTTTTCTAAAGCAAGTCACTTTCCATCTCCTTCGGCTTGCAGTTTTCCAAAATGAAAACATCAGGCAAAGGGCAGTTGTCGGGCTTCAAATACTTGTGAGGAGTTCATTTCATTACTTTATGCAGACAGCAAGATTGAGAGTCATGTTGATTATCACATTATCAGAGCTAATGTCTGATGTGCAAGTGACTCAGATGAGATCTGATGGAAGCTTAGAAGAAAGTGGTGAAGCACGGAGACTTAGGAAGTCTGTAGATGAAATGAAGGATGAAACTAAAAATGCTTACTTGTTGAAGGAGTGTGGTTTACCTGAGAATGCTCTTGTGACTGTACCAGAAAAAATGACAGAAAATAGATGGTCCTGGTCTGAGGTGAAATATCTCTCTGACAGCCTTCTTTTGGCCCTTGATGGCAGCTTGGAGCATGCACTATTGGCCCCCATGATGACTATGGATAGATATGCTGCTGCTGAAAGCTTCTATAAACTGGCCATGGCATTTGCCCCAGTCCCTGATCTTCACATAATGTGGTTGCTTCATCTATGTGATGCACATCAGGAAATGCAGTCATGGGCAGAAGCTGCTCAGTGTGCTGTTGCTGTTGCTGGTGTTGTAATGCAGGCCCTTGTTGCCAGAAACGATGGTGTTTGGAGCAAAGACCACGTTTCTGCTTTACGGAAGATTTGTCCTATGGTTAGCAATGAGATTACGTCTGAAGCATCTGCTGCGGAGGTTGAGGGATATGGTGCTTCAAAACTGACTGTTGACTCGGCTGTGAAATACTTGCAGCTTGCTAATAAGCTCTTCTCGCAAGCTGAGCTTTTTCATTTCTGTGCAAGCATTCTGGAACTTGTAATCCCAGTTTACAAAAGCAGGAGGGCTTATGGACAGTTGGCTAAATGTCACACATTACTTACTAATATCTATGAATCAATTCTTGAACAGGAATCTAGTCCAATTCCTTTCACAAATGCAACGTACTACAGGGTTGGATTTTATGGTGTTAGATTTGGGAAACTTGATAAAAAGGAGTATGTATATCGTGAGCCTCGTGATGTACGTCTAGGTGACATAATGGAAAAACTTAGTCACACATACGAGTCTAGAATGGATGGTAATCACACTTTGCATATTATTCCAGATTCTAGACAAGTGAAGGCAGAGGAGTTGCAGCCTGGTGTCTGTTACCTTCAGATTACTGCCGTTGATCCAGTAATGGAAGATGAGGATTTAGGAAGTAGGAGAGAAAGAATTTTCTCTCTCTCTACTGGAAGCGTCCGAGCCCGCGTATTTGACCGATTCTTGTTTGACACCCCATTTACCAAAAATGGCAAGACTCAAGGTGGATTGGAAGATCAATGGAAGAGACGCACTGTTCTTCGGACTGAGGGTTCTTTTCCTGCATTAGTAAATAGGTTATTGGTAATCAAATCCGAGTCCCTTGAGTTCTCTCCTGTAGAAAATGCAATCGGAATGATTGAAACACGAACCGCTGCCTTAAGAAATGAGCTTGAAGAGCCTCGAAGTTCAGAGGGGGATCAACTTCCAAGACTCCAGAGTCTACAAAGAATCCTACAAGGCAGTGTTGCAGTACAAGTGAATAGTGGAGTCTTGAGTGTCTGCACTGCCTTCTTGTCCGGGGAGCCTGCGACCAGGTTACGATCACAGGAACTGCAGCAACTTATAGCTGCCCTTCTTGAGTTCATGGCTGTTTGTAAACGTGCCATCCGTGTACATTTCAGATTGATTGGTGAGGAAGATCAGGATTTCCACACACAACTTGTAAATGGTTTCCAGTCACTGACAGCAGAGTTATCACATTACATTCCTGCCATTCTCTCAGAGCTATGA >MELO3C012607 ATGCATCTTCTACATCGTCGAGATTCCACTCCCGCCTCTATCAAGTGGCACAACAAGTTCGAGGAGAATTTGGAGCAATGGCCATACCTCAATGAGCTCGTGCAGTGCTATTCCACTGACTGGGTAAAGGATGAAAATAAGTACGGTCACTATGAGACTATCGGTCCCGTCTCCTTTCAGAATCAGATATATGAAGGCCCCGATACTGACATTGAAACTGAAATGCGTCTTACTTATGCTAGACGCACAAAGCCTGATGATACTACAGAGGATGATGTACCTAGTACCTCCGGAAGGCCAGAGTCTACCACATATGATCCATTGTTATCGAATGTTCCAAAGCAGATTGGTCCTTCTCCTCTTCCAGCTTACGAGCCAGCTTTTGATTGGGAAAATGAAAGGTCAATGACATTTGGTCAGAGGATACCAGAAACTCCTGCAACACATGGCTTGAAGATTTCTGTTAAAGTTCTATCACTATCCCTTCAAGCGGGGTTGGTTGAGCCATTTTATGGTACAATTTGCTTGTATAATAGGGAGAGGAGGGAAAAATTATCTGAGGATTTCCATTTTCGCATTGCACCTAAAGAAATGCAGGATCCTAAAATATCATTTGAACCGCGCGGAATTTTCTATTTGGAGGCTCCATCAGCATCTGTCTGTCTTTTCATTCAGTTAGAGAAACATGCCACAGAAGAAGGAGGGGTTACTGCTTCTGTGTATTCACGTAAAGAACCAGTGCATTTGAATGAAAGAGAAAAGCAAAAATTGCAGGTCTGGTCTCAAATCATGCCTTACAGAGAATCCTTTGCCTGGGCCATTGTTTCATTATTTGACAACAGCACTGGTGCAGCATCTGCTGGATCTGCTTCCCCAAGTAGTCCTCTTGCTCCTAGCATAACTGGCTCTAGTTCCCATGAAGGCGTCTTTGAGCCTAGCACCAAGGTCACAGTAGATGGAAAGCTGGGTTACTCTAGTGGAAGCTCTGTAGTTGTTGAAATATCCAACTTAAATAAGGTTAAGGAAGGCTACACGGAAGATGCACTTCAGGATCCCAAACACAAGGTTCATAAGCCCGTAAAAGGAGTTCTTAGGCTGGAAATTGAGAAGCACCAGATTTCCCATGCTGACAATGAAAACATGTCAGAGAGTGGCAGTGTGATCAGTGACTCCGTCGATATGGTGGACAGATTGGTTGATTCCACATTCAAGAAGTTCCCCAATAATGGTTCTGATAGCCAGCATCTTAGTTGCAGCTCAAAGTCAAATTTTCCTGTCGGGAAAGAATTTTCTGGAAATGGATCATTATCTCATGAAAATGTCGATACAAATGCAGATGACTTCCACGCATTCGACTTCCGCGTTATGATGAGGAACGAGCCATTCTTGCAGCTCTTTCACTGTCTTTATGTTTATCCCCTGACTGTTAGTTTGAGCCGCAAGAGGAACTTGTTCATTCGAGTAGAACTTAGAGAGGATGATAGTGACCCACGCAGACAGCCTCTGGAGGCTATGTATCCAGTGGAGGTGGGTGCATCTCTTCAGAAGTGGGCTCACACTCAAGTTGCTGTAGGTGCAAGAGTGGCTTGCTACCATGATGAGATTAAACTCTCCCTCCCGGCTACCTGGACACCAAAGCATCACTTGTTGTTTACTTTCTTCAATATTGATATGCAAGCAAAACTAGAAGCTCCCAAGCCAGTGCCGATTGGATATGCATCACTCCCCTTGTCAACACATGCTCAGTTACGGTCTGAAATTTCTTTGCCAGTAATGAGAGAGCTTGTTCCACATTACCTCCAAGATACAAACAGGGAGAGGCTAGATTACTTGGAAGATGGGAAGAACATCTTCAAATTGCGCTTAAGACTGTGTTCCTCCCTTTATCCCATCAACGAACGAATCAGGGACTTTTTTCTGGAATACGATAGGCACACTCTTCGAACAAGTCCTCCTTGGGGTTCTGAACTTCTGGAGGCTATTAACAGTTTAAAGAATGTTGATTCCACTGCGTTACTCCAATTCCTTCATCCTATTTTGAATATGTTGCTCCATCTCATTGGCAACGGCGGAGAAACCCTCCAGGTTGCGGCTTTTAGAGCAATGGTTAATATTGTTACTAGGGTGCAGCAGGAATCGGCCGAAGATGGTGAAAGAAATCACTTCCTTGTTAATTATGTTGATTATGCTTTTGATGACTTTGGAGGTCGCCAGCCACCCGTATACCCTGGTCTGTCCACTGTCTGGGGAAGCTTGGCTAGGAGCAAGGCCAAAGGCTATCGTGTTGGACCAGTTTATGATGATGTTTTGGCTATGGCCTGGTTTTTCCTTGAGCTAATTGTCAAATCAATGGCACTGGAGAAAACTCGACTTTTCTATCATAGCCTTCCATTAGGTGAAGATATTCCTCCAATGCAATTGAAAGAAGGTGTATTTAGATGCATAATGCAGTTGTATGATTGCCTTCTTACCGAAGTACATGAACGTTGCAAGAAGGGATTAAGCTTGGCTAAACGTTTAAATAGCAGTTTAGCGTTCTTTTGTTATGATCTTCTATCCATTATTGAGCCTCGCCAAGTATTTGATTTGGCAGCCAGAATTTTAGTTGTTCTCTTATGCAAGCATGAATTTGATGCCCGGTACCAGAAGCCTGAAGATAAACTATACATTGCTCAGCTGTACTTTCCACTTATCGGGCAGATTTTAGATGAAATGCCTGTCTTCTATAACCTAAACGCCACAGAGAAGCGTGAAGTTTTGATTGTGATTTTGCAAATTGTGCGCAACTTAGATGATACTTCTCTTGTCAAGGCATGGCAACAAAGCATTGCTCGAACCAGATTGTTCTTCAAGCTCATGGAAGAATGCCTTGTTCTTTTTGAGCATAGAAAACCTGCTGATGGCGTGCTTATGGGATCCAGTTCTCGGAGCCCTGCTGCTGTTGGAGATGGTCCTGGTTCCCCGAAATATTCTGACAGACTTTCTCCTGCAATCAACAACTACCTATCTGAGGCATCAAGACAAGAATTCAGACCTCAGGGAACGCCTGATAATGGTTATTTGTGGCAAAGGGTGAATTCTCAGTTGAGCTCCCCAAATCAGCCATATTCCTTGAGAGAGGCACTAGCTCAGGCACAATCTTCTAGGATTGGTGCATCTGCACAAGCATTAAGGGAGTCGCTGCACCCGGTATTAAGACAAAAATTGGAACTTTGGGAAGAAAACTTAAGTGCAGCTGTAAGTCTTCAAGTTTTGGAAATAACAGAGAAGTTTTCCTCGATGGCATCATCTCATAGCATTGCCACTGACTACGGGAAACTTGATTGCATCACCTCCATATTCATGAGCTTCTTCTCTAAGAATCAACCTTTGGCATTCTACAAGGCCTTATTTCCTGTCTTTAACAGTGTCTTTGATCTTCATGGCGCAACTTTAATGGCAAGAGAAAATGACCGTTTCTTAAAGCAAGTAACATTCCATCTTCTTCGGCTTGCAGTTTTCCGAAATGATAGCATAAGGAAAAGGGCAGTTACAGGACTTCAGATACTTGTGAGGAGTTCTTTCTGTCACTTTATGCAGACGGCTAGATTGAGGGTCATGCTTATAATTACTTTGTCAGAGTTGATGTCTGATGTGCAAGTAACGCAGATGAAGGCAAATGGGACACTTGAAGAGAGTGGTGAAGCACAGCGTCTACGAAAATCCTTAGAAGACATGGCAGATGAATCAAAGAGCTCCAGTCTGTTGAATGAATGTGGACTTCCTGAGAATGCTCTCGTCATAATTCCAGAAGCTTCCGCTGATAATAGGTGGTCCTGGTCAGAGTTGAAATATCTTTCTGACAGTCTCCTTCTGGCTCTTGATGCTAGTCTAGAGCATGCTCTTTTAGCCTCTGTGATGTCAATGGATAGATATGCTGCTGCAGAAGGTTTCTACAAACTTGCAACGGCATTTGCCCCTGTGCCTGATCTTCATATTATGTGGTTATTGCATTTATGCGATGCGCATCAAGAGATGCAGTCATGGGCAGAGGCTGCACAGTGTGCTGTGGCCGTTGCAGCTGTGGTCATGCAGGCTCTTGTCGCTCGAAATGATGGTGTCTGGAGCAGAGATCATGTGACAGCTCTACGCAGAATATGTCCTATGGTTAGCAGTGAGATCACATCAGAAGCATCAGCAGCTGAGGTGGAGGGATACGGTGCCTCTAAACTCACAGTCGACTCTGCTGTGAAGTACCTACAGCTTGCGAACAAGCTTTTCTCCCAAGCTGAGTTGTATCATTTTTGTGCTAGTATTCTGGAGCTTGTAATTCCAGTTTATAAAAGTAGGAGATCATATGGACAACTGGCGAAATGTCACACTTTACTAACAAATATTTACGAATCGATCCTTGAGCAGGAATCAAGCCCAATCCCATTTACTGATGCAACATATTACAGAGTGGGATTCTATGGTGAAAAATTTGGGAAGCTGGACAGGAAGGAATACGTATATCGTGAACCCCGTGACGTACGGTTGGGTGACATAATGGAGAAACTCAGTCATGTATACGAGTCTAGAATGGATGGCAGTCACACACTGCATATTATTCCAGACTCTAGGCAAGTGAAGGCGGAGGAGTTGCAGCCGGGAGTTTGCTACCTACAGATAACGGCAGTTGATCCTGTTATTGAAGATGAAGATCTGGGAAGTAGAAGAGAGAGAATCATTTCGTTATCTACCGGGAGTGTCCGTGCTCGTGTATTTGACCGCTTCTTATTTGACACCCCATTTACCAAAAATGGAAGAACTCAAGGTGGGCTAGAAGACCAATGGAAGAGGAGGACTGTTCTACAGACTGAGGGATCCTTCCCGGCCTTGGTAAATAGACTCTTAGTAACTAAGTCCGAATCGCTCGAGTTCTCCCCTGTGGAAAATGCAATCGGAATGATCGAAACTAGAACTGCTGCTCTGCGGAATGAACTGGAAGAGCCTCGCAGTTCTGAGGGCGACCAACTTCCACGACTCCAGAGTCTTCAGAGAATACTCCAAGGCAGCGTCGCAGTTCAAGTTAACAGTGGAGTCTTGAGCGTGTGCACTGCATTCTTGTCTGGTGAGCCGGCTACAAGGTTGCGGTCGCAAGAGTTGCAGCAACTCATTGCTGCACTTCTCGAATTTATGGCTGTATGTAAGCGTGCTATTCGAGTTCATTTTAGATTAATTGGAGAGGAAGACCAGGAGTTCCACACCCAACTAGTGAATGGATTTCAGTCTCTCACCGCCGAACTATCGCATTACATTCCCGCTATTCTATCCGAATTGTAA >Eucgr.K02348 ATGCGTCTTGCCTGTGCCAGGCAAGCAAAGGCAGATGACACTACTGATGATGACGTCCCTAGCACTTCGGGAAGGCAATTTACAGAGGCTACATCTTCTGACTCTAAGCATTTTGGTCTATCTCCACTGCCTACTTACGAACCAGCATTCGATTGGCAAAATGAGAGGTCAATGATATATGGGCAGAGGATTCCGGATTCTCATAGCTCGCAGCATGGCAGTGGATTGAAGATCTCGGTGAAAGTGTTATCTCTCTCATTTCAAGCAGGATTAGTCGAGCCATTTCATGGTACGATATGCCTGTACAATAGGGAGAGGAGAGAAAAGTTGTCAGAAGATTTTTATTTTCAAGTGCTACCAACTGAGACACAGGATAACAAAATGTCAAATGAGCCACTTGGAATCTTCTATCTGGATGCACCATCAGCATCAGTTTGTCTGTTAATCCAGCTGGAGAAACCTGCCACTGAAGAAGGCGGAGTTACTTCATCTGTTTATTCACGCAAGGAGCCTGTGCACTTGACTGAGAGAGAGAGGCAGAAATTGCAGGTGTGGTCCCGAATCATGCCATACAGAGAGTCCTTCGCCTGGGCTATTGTTCCATTATTTGATAACACCATTGGTGCAGCTTCTGGTGGTTCTGCTTCTCCAAGTAGCCCTCTTGCTCCTAGCATTTCTGGGTCCATCTCCCATGATGGTGGAGTGGAACCTGTTTCTAAGATCACATTACATGGGAAGCTGGGTTATTCAAGTGGAAGCTCAGTTGTAGTTGAACTATCAAACTTAAACAAAGTTAAAGAAAGCTACACTGAGGATTCACTTCAGGATCCAAAGCGCAAGGTTCATAAACCTGTGAGAGGTGTTTTGAGACTTGAAATTGAAAAACACCAGACTGGTCATGTTGATTTGGAGAATGTATCAGAAAATGGTAGCATGACCAATGATTCTGTTGATCCTGGTGATACTATTACTGCTTCTACTTTTTCAAAATGTCCTAGTAATGGTTCGGATGGGACCCAAAGTAGCAATATCAAACAGCATTCCTTTGATGGAAAAGAAGCCTCAGACAATAGATTGAACATCCAAGGAAATTCAGACTTCAATGCTGATGATTTCCAAGCCTTTGACTTCCGGACCACCACAAGGAATGAGCCTTTCCTGCAGGCTTTTCATTCTCTCTATGTATATCCCCTAACAGTGGCTTTGAGTCGGAAGAGGAACTTGTTTATACGGGTTGAACTTAGAAAGGATGATGCTGATGTGCGTAGACAGCCTCTGGAGGCACTGTATCCAAGGGAGCCAGGTGCATCACCACAGAAGTGGGTCCATACACAAGTTGCCGTTGGAGCTAGGGCAGCTTGCTATCATGACGAACTTAAACTTCTTCTTCCTGCCATTTGGACCCCGCTTCATCACCTATTATTCACTTTCTTCCACATTGACCTTCAAACAAAGCTGGAAGCTCCAAAGCCGGTGGTGATTGGTTATGCAGCACTTCCACTATCTACACATGCTCAGTTGCGATCTGAAATTTCTTTGCCTATCATGAGAGAGCTAGTTCCGCATTATCTTCAGGATGCTGGAAAGGAGAGGTTGGACTACTTGGAAGATGGGAAAAATGTGTTTAGATTGCGCTTGAGACTCTGCTCATCTTTGTACCCTATTAATGAGCGAGTTAGGGATTTTTTTCTTGAATATGATAGACACACACTGCGGACAAGCCCACCCTGGGGTTCTGAACTTCTGGAGGCTATTAACAGTCTAAAGAATGTTGATTCTACTGCTTTACTCCAGTTCCTTCACCCAATCTTGAATATGCTACTACATCTTATAGGCAATGGTGGAGAAACCCTTCAGGTTGCGGCTTTCAGGGCTGTGGTGAATATTCTGACTAGGGCGCAACAGGAATCTGTGGATGACAATGAAAGAAATCGTTTTCTTGTTAACTATGTTGATTATGCATTTGATGACTTTGGGGGACGTCAACCACCAGTTTATCCTGGTCTCTCTGCTGTTTGGGGGAGCTTAGCTCGAAGTAAGGCTAAGGGCTACCGTGTCGGACCGGTCTATGATGACGTATTGGCTATGGCTTGGTTTTTCCTCGAACTAATTGTCAAGTCAATGGCCTTGGAGCAGACTCGACTATTCTATCACGTGCTTTCACTAGGTGAAGATATTCCACCTATGCAGCTGAAAGAAGGTGTATTTAAATGCATATTGCAGTTGTATGATTGCCTTCTAACAGAAGTCCACGAGCGTTGTAAGAAGGGATTAAACTTAGCAAAGCGGTTGAATAGTAGCTTGGCCTTCTTCTGTTATGATCTCTTATCAGTGATTGAACCTCGCCAAGTTTTTGAACTAGTGTCCTTGTACCTGGACAAATTTTCTGGAGTATGTCCATCGGTTCTTCATGATTGCAAGCTCACATTCTTACAGATTATATGTGACCATGATCTTTTCGTGGAAATGCCTGGAAGAGACCCTTCGGATAGGAACTACCTTTCATCTGTCCTAATACAAGAAATTTTCCTCAGCTGGGATCATGATGATTTGTCTCAGCGTGCAAAGGCAGCTAGAATATTAGTCATCCTCCTATGCAAGCATGAGTTTGATGCTCGATACCAGAAGCCTGAAGATAAACTCTACATTGCACAGCTATATTTTCCACTCATCGGACAGATCCTAGATGAGATGCCTGTCTTTTACAATCTGAATGCTGTGGAGAAGCGTGAAGTTCTGATTGTTATTTTGCAAATTGTGCGCAACCTAGATGACACGTCACTTGTCAAGGCGTGGCAGCAAAGCGTTGCTCGAACCCGACTATTTTTCAAACTCATGGAAGAGTGCCTTACTCTCTTTGAGCATAGAAAACCTTCTGATGGCATGCTCCTTGGCTCCAGTTCTCGCAGCCCCGCTGGGGATGGACCTGTCTCCCCAAAGTACTCTGAGAGACTTTCTCCTGCAATTAACACGTATCTTTCAGAGGCATCAAGACAAGAAGTTAGACCTCAGGGAACACCTGAGAATGGTTATTTATGGCAAAGAGTGAACTCCCAGTTGAGCTCCCCAAGTCAGCCGTATTCTTTGAGAGAAGCCCTAGCTCAGGCTCAATCTTCAAGGATTGGAGCTTCAGCTCAAGCTCTGAGAGAATCCTTGCACCCAATTTTGAGGCAAAAACTGGAGCTTTGGGAAGAGAATTTAAGCGCTGCTGTCAGTCTTCAAGTTCTGGAAATAACCGAGAAATTTTCCACAATGGCATCAACTCATAGCATCACAACAGACTATGGGAAACTCGATTGCATGACTGCTATTTTTATGAATTTCTTCTCCCGAAATCAACCACTGGAGTTTTGGAAAGCTTTATCACCTGTCTTCAGCAGTGTCTTTGATCTTCATGGTGCTACCCTTATATCCAGGGAGAATGATCGATTCTTAAAACAAGTTGCTTTTCATCTGCTGCGGCTTGGAGTTTTCAGAAATGACAGTGTTCGGAAACGGGCTGTTGTTGGGCTTCAGATACTTGTTAAGAGTTCTTTCTATCACTTAATGCAATCTGCAAGGTTAAGGGTCATGCTGACCATTACAATATCAGAGTTGATGTCCGAGGTGCAAGTCACTCAGATGAAATCTGATGGTACGCTAGAGGAGAGTGGTGAGGCACGGCGACTTAGAAATTCTTTGGAGGAAATGGCAAATGAAGGCAAGAGCCCTAGCATATTGAAAGAATGTGGTCTTGCAGAAAATTCTCTCGTCTCAATTCCAGAAAGAATGACAGAAAATCGGTGGTCCTGGTCGGAGGTCAAATATCTCTCTGATTGCCTTCTTTTGGCACTAGATGCAAGCCTTGAGCATTCTCTTTTGGGATCTTTGATGAATATGGATAGATATGCTGCTGCAGAGAGTTATCACAAACTTGCTATGGCTTTTGCCCCTGTCCCGGATCTTCACATTATGTGGTTGTTGCACTTGTGTGATGCACACCAGGAGATGCAGTCTTGGGCTGAAGCTGCACAATGTGCTGTGGCTGTTGCTGGTGTTGTAATGCAGGCCCTAGTAGCTAGAAATGATGGTGTCTGGAGTAAAGACCATGTGACGGCACTACGTAAAATTTGCCCAATGGTCAGCAGTGAGATCAGCTGTGAGGCATCTGCTGCAGAGGTTGAAGGGTATGGTGCTTCGAAACTCACAGTAGACTCTGCTGTGAAATATCTGCAGCTTGCAAACAATCTTTTTTCTCAAGCTGAGCTTCATCATTTCTGCGCAAGCATTCTGGAACTTGTGATTCCAGTTTACAAAAGCAGGAGAGCATATGGACATCTGGCAAAATGTCACACCTTGCTCACCAATATCTATGCGTCAATCCTTGAGCAGGAATCGAGCCCAATTCCTTTTACAGATGCTACATATTACAGGGTGGGATTCTACGGGGAAAAATTTGGGAAGCTGGATAGGAAGGAATACGTTTATCGGGAGCCCCGTGATGTGCGCCTTGGTGATATTATGGAGAAGCTTAGTCATATTTATGAGTCCCGGATGGATGGAAACCATACACTGCACATTATCCCGGATTCTAGACAAGTAAAAGCCGAAGAGTTGCAGCCAGGAGTTTGCTATCTACAGATAACTGCTGTTGATCCTGTGATGGAAGATGAAGATTTGGGGAGCAGAAGGGAGAGGATCTTTTCTCTATCTACTGGTGGGGTCCGTGCACGTGTTTTTGATCGCTTTTTGTTTGATACCCCATTTACTAAAAATGGCAAGACTCAAGGTGGGTTAGAAGACCAATGGAAGAGGCGGACGGTCCTTCAGACTGAGGGCTCATTCCCTGCCCTTGTGAACAGGCTCTTTGTGATTAAATCTGAGTCTCTTGAGTTTTCGCCAGTAGAAAATGCAATTGGCATGATTGAAACCCGTACAGCTGCACTGCGCAATGAACTTGAAGAGCCTCGCAGTTCTGAAGGAGATCAACTCCCACGCTTGCAAAGTCTGCAGAGAATCCTCCAAGGCAGCGTGGCAGTCCAAGTGAATAGTGGGGTTCTTAGTGTTTGCACGGCTTTCCTGTCGGGTGAGCCTGCCACAAGGTTGCGGTCCCAAGAACTACAGCAACTCATCGCTGCACTTCTTGAATTCATGGCTGTTTGTAAGCGTGCGATACGGGTTCACTTCAGATTGATCGGGGAGGAAGATCAAGAATTCCACACGCAGCTTGTGAACGGGTTTCAATCTCTCACTGCAGAGTTATCTCATTATATCCCCGCCATCCTCTCGGAGCTTTGA >DCAR_001249 ATGGAGAATTCGTCTCCAAACGGGCATCGTTTTAGAAGAATTTCCCGTCAGTCCTTCGCTGGTAGTCTGAACTTAGATCCACTGCTTGATGAAAACTTGGAACAGTGGCCACATCTTAGTGAACTTGTTCAGTGCTACAGAACTGATTGGGTGAAGGATGATAACAAGTATGGGCATTATGAGAGCATCGGCCCAATATCATTTCAAAATCAAATTTTCGAGGGACCTGATACTGATATTGAAACAGAAATGCATCTTGCTAATGCAAGGCAAAATAAGATCGATGATACTGATGACGACATCCCAAGTACTTCTGGGAGGCAGTTTACAGATGCCGCCTCCAAGTCATCAAGCTTAAATGTTTTAAAGCATTTGGGAGAATCCCCACTGCCCACTTATGAACCTGTTTTTGACTGGGAAACTGAGAGGTCGACAATATTTGGGCAAAGGATCCCAGAAACTCAGCTAGCGCAATATGCCAGTGGATTGAAGATATCAGTTAAAGTCCATTCCTTGTCATTTCAAGCGGGACTAGTGGAGCCATTTTACGGCACTATCTGTTTGTATAACAAGGAAAGGAGGGAGAAACTCTCAGAGGACTTCATTTTTTCTGCATTACCCACAGAAATGCAGGAGGCTAGCAGTTCCTATGAACCTCGTGGTATTTTTTATTTAGATACCCCATCAGCATCAGTTTGTCTTCTGATCCAGTTAGAGAAGCCTGCCACAGAAGAAGGTGGGGTAACTCCCTCTGTTTATTCACGTAAAGAACCGGTCCACATGACTGAGAGAGAAAAGCAGAAACTCCAAGTGTGGTCCCGCATCATGCCCTACAGGGAATCTTTCGCCTGGGCTATTATTCCATTGTTTGATAGCAATATTAATTCTTCCCCTGGCGGGCCTGCTTCTCCTAGTAGTTCTGTTGCTCCTAATGTGTCCGTATCAAGTTCACAAGACGCCTCTGATCCTGTTGCAAAGTTAGATGGAAAACTAGGTTACTCAAGCGGAAACTCTGTTGTAGTTGAAGTATCAAATTTAAATAAAGTTAAAGAAGGGTATACTGAGGACTCACTCCAGGATCCCAAGCGGAAAATCCATAAACCTGTAAAAGGAGTGCTGAGATTGGAAATTGAAAAGCTCCAAGCTGGTCCGGTTGACTTTGAAAATGCTTCAGAAGGCGGAAGCATTGATCATGAAGATCAAATTACCGATTCAAGGTTTGCAAAGTGTCCCAGCAATGGTTCTGATGGACCTCAGAATGGGCATTCAAAAGTGAATTACTATGAAGGAAAAGAGTTACCTCGAAATGGATCAATTGCTTTGGGAAATACAGATTTAAATACTGATGATTTCCAAGCCTTCGACTTCCGAAGAACAACAAGAAACGAGCCGTTTCTGCAGCCATTTCATTGTCTCTATGTTTATCCAATTACTGTAAGTTTGAGTAGGAAAAGGAACCTGTTTATACGTGTTGAACTCAGGAAGGATGATGGTGATGCTCGTAAACAACAGCCATTGGAGGCAATGCATTCAAGGGAACCTGGTGCATCCCTCCAGAAATGTGCCCACACACAAGTTGCTGTTGGTGCTAGGATTGCTTCTTACCATGATGAAATCAAAGTTTCACTTCCGGCAATATGGACACCATCGCATCACCTTCTGTTCACTTTCTTGCATGTTGATCTTCAGACAAAACTAGAAGCTCCAAAGCCAGTGGTAATTGGATATGCATCACTCCCGTTATCAACACACGCACAGTTGAGATCAGAAATTTCACTGCCAATAATGAGAGAGCTGATTCCGCACTATCTTCAAGACGGCGGAAAGGAAAGGATAGATTACCTCGAGGATGGCAAGAATGTATTTAAATTGCGATTAAGGCTGTGTTCATCCTTATATCCAATTAGTGAGCGCATTAGAGATTTTTTTCTCGAGTATGATAGACACACACTCCGAACAAGTCCACCTTGGGGATCCGAACTACTTGAGGCTATTAACAGCTTGAAAAATGTTGATTCAACTGCTCTGCTTCAGTTCCTTCAGCCAATACTAAATATGCTTCTCCATCTAATTGGAAATGGTGGAGAAACTCTTCAGGTTGCAGCCTTCAGAGCCATGGTCAATATACTAACGCGGGTTCAACAAGAGTCAGTTGATGAGGCTGAACGGAACATTTTTCTAGTGAACTATGTGGACTACTCCTTTGATGATTTTGGGGGTCGTCAACCACCTGTTTATCCTGGTTTATCAACTGTATGGGGAAGCTTGGCTCGCAGTAAGGCAAAAGGATATCGTGTAGGACCAGTTTATGATGATGTCTTGTCAATGGCATGGTTTTTCTTAGAGTTAATTGTCAAGTCGATGGCATTAGAGCAGACTCGGCTGTTCTATCACAACCTTCCACTTGGTGAAGATATTCCTCCCATGCAGTTGAAAGAAAGTGTTTTCAGATGTATACTGCAGCTATATGATTGCCTTCTAACAGAAGTACATGAGCGTTGCAAAAGGGGTCTAAGCTTGGCAAAACGCTTGAACAGTAGTCTGGCGTTCTTTTGCTATGATCTTTTGTCAATCATTGAGCCTCGTCAAGTATTTGAATTGGTCTCTCTGTACATTGATAAGTTCTCTGGGGTGTGTCAGTTAGTGCTTCATGATTGCAAGCTTACATTTTTACAGATTATTTGTGATCATGATCTTTTTGTGGAAATGCCTGGGAGAGATCCTTCAGATAGGAATTACCTTTCTTCTGTCTTGATACAAGAACTTTTCTTAACATGGGACCATGATGATTTATCTCTGCGGGCAAAGGCGAGTCCAGCAGCTAGAATCTTGGTAGTCCTTTTGTGCAAGCACGAGTTTGATGCTCGTTACCAAAAGCCTGAAGACAAATTATATATTGCACAACTGTACTTTCCCCTTGTTGGCCAGATTCTGGATGAGATGCCTGTATTTTATAATCTTAGTTCTGTTGAAAAACGTGAAGTCTTGATTGTCATCTTGCAAATAATACGTAATTTGGATGATGCATCATTGGTGAAGGCTTGGCAGCAAAGTATTGCTCGAACCAGATTATTTTTTAAACTGTTGGAGGAAAGCTTGGTTCTGTTTGAGCATAGGAAACCTGCTGATAGCATGCTTATGGGCGCTAGTTCTCGCAGCCCGGTTGCTGATGGACCTGTCTCTCCTAAATATTCTGACAGGCTTTCACCTGCCATTAACCACTATCTATCGGAGGCATCAAGGCAAGAAGTCAGACCGCAAGGCACTCCTGAGAATGGATACATGTGGCAGAGAGCAAATTCCCAGTTAAGCTCTCCTAGTCAGCCATATTCTTTAAGAGAAGCACTTGCTCAGGCACAGTCATCTAGAATTGGCGCTTCAACTCAAGCATTGAGGGAATCTTTGCACCCAATCTTGAGGCAAAAGCTTGAACTTTGGGAAGAAAACTTGAGCGCTGCTGTCAGCCTGCAGGTCTTGGAAATAACAGAGAAATTTTCCAGTACCGCTTCGTCACATAGTATCGCCACAGATTATGGAAAACTTGATTGCATAACATCCATATTTACAAGCTTCTTCTCACGTTATCAGCCGCTAGCATTTTGGAAAGCAATGTTTCCGGTGTTCACCAGTGTCTTTCAGCTTCACGGAGCAACACTAATGGCAAGGGAAAATGATCGATTCTTAAAGCAAATTGCTTTTCATCTTTTACGTCTTGCTGTTTTTCGAAATCACAATATCAGAAAAAGAGCTGTGGTGGGCCTTCAGATACTCGTCCGGAGCTCTTTCTCTTACTTTACTCAAACGGCAAGGTTAAGGGTGATGCTGACCATAACATTATCGGAGTTGATGTCTGATGTTCAAGTGACCCAGATGAAGTCTGACGGAACGCTTGAAGAAAGTGGGGAAGCACGCCGTCTCCGGAATTCTTTAGAGGAAATGGCGGACGAGTCTAAAAGTGGAAACTTAATCACAGAGTGTGGTCTACCGGAGAATGCACTTGGTACTATTCCAGACGCATTAGCTGAGAAAAAATGGTCGTGGTCGGAGGTGAAAATCCTTGCCAATAGCATTATTCTGGCTCTCGATGCTAGCTTGGAGCATGCACTCTTGGCTTCTGTTATGAACACGGACAGATATGCTGCCGCAGAAAGTTTCTTTAAACTTGCAATGGCATTTGCTCCTGTACCAGATCTCCACATAATGTGGTTATTGCATCTTTGTGATGCACATCAGGAGATGCAGTCATGGGCTGAAGCTGCACAGTGTGCGGTGGGCGTTGCAGGTGTTGTAATGCAGGCATACCTATTGAACAGAGTTCCGGCCTATCTGGATGTGGCTCTCGTAAGTAGAAATGATGGAGTCTGGGGCAATGATCATATTACTGCACTACGCAAAATTTGCCCCATGGTTAGCAATGAGATAACATCCGAGGCCTCTGCAGCTGAGGTAGAAGGATATGGTGCTTCGAAACTCACAGTTGATTCTGCAGTGAAATACCTACAGCTAGCAAATAAGCTTTTTTCTCAGGCTGAGCTCTACCATTTCTGCGCAAACATTCTCGAACTTGTAATTCCAGTTTATAAAAGCAGGAGGGCATATGGACAGCTAGCCAAATGTCACACAATGCTAACCAATATCTATGAATCAATTCTTGAGCAGGAATCAAGTCCAATTCCTTTCACTGATGCCACATATTATAGAGTTGGATTTTATGGTGAAAAATTTGGCAAGTTGGATAAAAAGGAATATGTTTACAGAGAGCCCCGCGATGTTCGATTGGGCGACATAATGGAAAAACTTAGTCATATATACGAGTCAAGGATGGATGGTAATCATACCTTGCACATAATTCCAGATTCTAGACAAGTCAAATCTGAAGAACTGCAGCCTGGAGTCTGTTACTTGCAGATAACTGCTGTGGATCCTGTTATGGAAGATGAAGATTTGGGAAGTAGAAGGGAGAGAATAATCTCTCTTTCTACAGGAAGCGTCCGTGCACGTGTCTTTGATCGCTTCTTGTTTGATACCCCTTTTACAAAAAATGGCAAGACCCAAGGTGGATTAGAAGACCAATGGAAGCGACGGACTGTTCTTCAGACTGAGGGATCGTTTCCTGCCCTTGTCAACAGGCTTGTTGTAACAAAATCAGAATCTCTTGAGTTCTCTCCCGTAGAGAATGCAATTGGAATGATTGAAACTCGCACGGCTGCATTAAGAAATGAGCTTGAAGAGCCTCGCAGTTCTGATGGTGATCAGCTCCCACGTTTGCAGAGTCTACAGAGAATTCTTCAAGGCTCTGTCGCAGTTCAGGTAAACAGTGGCGTCCTTAGTGTATGCACAGCTTTCCTGTCAGGTGAGCCAGCGACAAGGCTGAGATCACAGGAGCTGCAGCAACTCATTGCTGCTCTCCTTGAATTTATGGCTGTTTGCAAACGTGCCATTCGTGTACACTTCAGGTTAATTGGGGAGGAAGACCAAGATTTCCACACACAGTTAGTCAATGGGTTTCAGTCACTGACTGCAGAGTTGTCTCATTACATCCCTGCCATTCTTTCCGAGCTCTGA >THA.LOC104823022 ATGGAGAACAGCAATCTTAGCCTTCGCTTTCGCAAGATTTCTCGACAGCCTGTTGCGCTTCCGAAGCTTGATCCCTTGCTTGATGAAAATCTGGAACAGTGGCCGCATTTGAGCCAACTGGTCCAGTGCTATGGAACTGAATGGGTCAAGGATGTGAATAAATATGGACACTACGAAAGTATTCCACCTGCTATCTTCCAGAATCAAATATTCGAAGGTCCCGACACTGATACTGAGACAGAAATCCGTCTATCCAGTGCCAGGAGTGCAACATTTGATGAAAATGTGACCAGCACATCGGGGAGGCATTTTGCTGATCCTGGCTCTGCCAAGCATTTTGGACAACCTCCCCTCCCTGCTTATGAACCAGCTTTTGACTGGGAAAATGAGAGATCTATGATATGTGGCCAGAGAACTCCAGAAACTCTTTCAGCTCACTATTCCAGTGGATTGAAGATATCTGTTAGAGTTTTGTCTCTATCTTTCCAGGCTGGCTTAGTTGAACCATTTTATGGCTCACTTTCATTGTACAATCAAGAGAGAAAAGAGAAGCTGTCAGAAGACTTTTATTTTCACAAGTTACCGACAGAAATGCAGGATGCGAACACCTCGTCTGACACTCGTGGAGTCTTCTATCTAGATGCCCCATCAGCATCAATTCATCTGCTGATCCAGTTGGAAAAAACAGCAACAGAGGAGGGAGGAGTTACCACTTCTGTCTATTCCCGGAAAGAGCCTGTGCACTTAAGTGAGAGAGAAAAGCAGAAGTTGCAAGTCTGGTCCCGCATTATGCCTTACCGGGAGTCGTTTGCCTGGGCAATTGTTCCACTGTTTGATAATAGCATCACGGCAAACTCAGGTGGGTCAGCTTCACCTAGTAGTCCTCTAGCTCCCAGTATGTCTGGGTCGAGTTCCCACGAGGGTGTCATTGAACCCATTGCAAAGATCACATCGGATGGAAAGCAAGGTTATTCAGGTGGAAGCTCTGTCATAGTAGAAATATCCAACTTAAACAAAGTTGACGAGAGCTATTCTGAGGACACTATTCAGGACCCTAAACGCAAGGTTCATAAACATGTTAAGGGGGTTATAAGACTCGAAATTGAGAAACACCAGAGTGGACATGGTGACTTTGAGAATTTGTCTGAAAATGGCAGTTTGACAAATGACTATTTCGATCCGACAGACCATCTTGCTGACCTGACACCTATGAAGTGTCCAAGTACTGGTTTTGGTGGACCTCGAAGTAGTTGCTCCAAGCTGAATTTTGAGGATACAAAGGAAATACGAAGAGACACTACAAGTGCAAGTGGAAGTCTCGACTTAAATTGTTATTATGCTTTTGATTTCTGCGCTACAACAAGAAATGAGCCTTTTCTGCATCTTTTTCATTGCCTTTATGTGTATCCCTTATCTGTTGCTTTGAGTCGGAAGAGGAATATTTTCATTCGTGTGGAACTAAGAAAGGATGATGCAGATGTCCGTAGTCAACCGTTTGAGGCAATTTATCCAAGAGAGCCTGGTGTGGCACTCCAGAAATGGGCTCACACACAAGTTGCTGTTGGAGCTAAGGTTGCTAGTTACCATGATGAAATCAAAATTTCCCTTCCTACCACATGGACGCCATCTCATCATCTATTATTCACTTTCTTCCATATTGATCTCCAGACAAAGCTTGAAGCTCCAAGACCAGTGGTGGTTGGATATGCATCACTTCCACTATTGACATATATCCACTCACGCTCTGAAATTTATCTTCCGGTCGTGAGGGAACTGGTTCCACACTACCTTCAGGATAACACCAAAGAGAGGCTGGATTTCTTGGAAGATGGCAAGAATATTTTCAAGTTGCGACTGAGACTTTGTTCATCGTTGTATCCCACTAATGAGCGTGTTAGGGATTTCTTTCTAGAGTATGATAGGCATACCCTCCGGACAAGCCCACCTTGGGGTTCAGAACTGCTGCAGGCAATAAACAGTTTGAAGCATGTCGACTCCACTGCTTTGCTTCAGTTTCTTCACCCAATTCTTAACATGCTCCTTCATCTTATTGGCAATGGTGGAGAGACTCTTCAGGTGGCAGCATTCAGAGCCATGGTGGATATTTTAACTCGGGTGCAGCAGGTGTCATTTGATGATGCTGACCGAAATCGTTTTCTGGTTACCTATGTTGATTTTTCTTTTGATGACTTTGGAGGCCGTCAGCCACCGGTTTATCCTGGTTTGTCAACTGTTTGGGGAAGTCTAGCTAGAAGCAAGGCTAAAGGTTACCGTGTTGGACCTGTATATGACGACGTTTTATCAATGGCTTGGTTTTTCCTTGAGCTAGTTGTTAAATCAATGGCATTGGAGCAGGCACGTCATTTTGATCATAGTCTACCTTCAGGCGAGGATGTTCCACCCATGCAGCTCAAAGAAAGTGTCTTTCGTTGTATCATGCAACTATACGACTGCCTTTTAACTGAAGTACATGACCGTTGCAAGAAGGGATTAAGCTTGGCAAAACGTCTGAATAGCAGTTTGGCCTTCTTTTGTTATGATCTTCTATATGTCATTGACCCACGCCAAGTTTATGAACTGGTATCACTATACATGGACAAGTTTTCTGGCATTTGCCAATCTGTGCTGCATGAATGCAAGCTTACATTTTTGCAAATTATCTCGGATCATGATCTTTTTGTGGAAATGCCTGGAAGAGATTCTTCAGACAGGAACTATCTCTCATCCGTCTTAATACAGGACCTATTTCTGACCTTGGATCATGATGATCTGCCTCTACGGGCGAAGGCTGCAAGAATTTTGGTGATCCTCTTATGCAAGCATGAGTTTGATGCTCGGTACCAGAAAACTGAAGATAAGCTATATATTGCGCAACTATATTTTCCATTTGTTGGACAGATTTTAGATGAGATGCCTGTTTTCTACAACCTAAATGCTACCGAAAAGCGTGAGGTTTTAATCGCTGTTCTGCAAATTGTTCGTAATCTGGATGACACATCTCTTATCAAAGCATGGCAGCAGAGCATCGCTCGGACTAGATTATTTTTCAAACTCATGGAAGAATGCCTCATACTTTTTGAGCATAGGAAAGCTACAGACAACATGCTTGTGGGCAATAATCCTCGTGGTCCTGTCAGTGAAGGACCTGGGTCCCCAAAGTACTCGGAGAGACTTTCTCCTGCAATCAGCAATTATATGTCAGAGGCTGCCCGGCAAGAAGTGAAGCTTGAGGGAACACCTGACAATGGGTATCTGTGGCAGAGAGTTAATTCTCAGATGGCCTCTCCTAGCCAGCCTTACTCTCTTAGAGAAGCTTTGGCTCAGGCGCAATCATCACGGATTGGAGCTTCAGCTCAGGCTCTGAGAGAATCTCTGCATCCTATTTTAAGGCAAAAGCTGGAACTTTGGGAAGAGAATTTGAGCGCCGCTGTTAGCCTTCAGGTTTTGGAAATTACTGAGAAGTTCTCGTCATTGGCAGCCTCTCATAATGTTGCTACTGACTATGGGAAGTTGGATTGCATTACAACAATAGTCATTAGTTTCTTCTCCCACAACCAGTCATTAGCTTTTTGGAAAGCCTTCTTTCCCGTGTTCAACAGGATCTTTGATCTTCATGGGGCCATACTGATGGCAAGGGAGAATGATCGCTTCTTAAAACAAATTGCCTTCCATCTTCTCCGCCTTGCTGTTTATCGAAATGACAACATCAGAAAAAGGGCTGTCACTGGTCTTCAAATACTTTTAAAGAGCTCGCTCTATTTTATGCAGATTGCTAGACTGAGGGTGATGTTGACCATTACACTATCAGAACTCATGTCGGATGTTCCAGTGACCCATGCGAAGACAGATAATACATTAGAAGAGAGTGGCGAGGCACGGCGGCTTCGACAGTCATTAGAAGAAATGGCTGATGAAGTTAAGAGTGCTGATTTGTTGAGGGAGTGTGGCCTTCCTGATCATACTCTCTTGACAGTTCCACACAAATTTACAGATAACCGCTGGTCATGGGCTGAAGCGAAACATCTTTCCGACAGTCTTATTTTGCCGCTTGATGCTAGCCTTGAGTATGCACTTCTGGCATCTGTGATGGCATCAGACAGATATACTGCGGCAGAAAGCTTCCATAAACTTGCAATGGCTTTTGCTCCTGTTCCAGATCTTCACATAATGTGGTTGTTGCATCTCTGTGAATCACACCAGGAAATGCAGTCCTGGGCTGAAGCTGCGCAGTGTGCTGTGGCTGTTGCTGGTGTTATAATGCAGGCCTTGGTGGCTAGGAATGATGGTGTATGGAGCCAGGATCACATGGCTGCTTTGCGCAAAATTTGCCCTGTGGTAAGTGCGGAGTTTACTACAGAGGCATCTGCAGCTGAGGTAGAGGGTTATGGCGCTTCAAAGCTGACAGTTGACTCCGCTGTCAAGTACCTACAGCTTGCTAATAAGCTTTTCTCTCAAGCTGAGCTCTACCACTTCTGTGCTAGCATTTTAGAACTTGTTATTCCAGTTTATAAGAGCAGGAAAGCTTATGGGCAATTGGCCAAGTGTCATACATTACTTACTAATATATATGAGTCCATCCTGGAGCAAGAATCAAGCCCGATCCCGTTTATTGACGCCACTTATTATCGGGTGGGATTCTATGGTCAAAAGTTTGGGAAACTGGACAAGAAAGAATACATATATCGTGAACCACGCGATGTACGGCTAGGTGATATCATGGAAAAACTGAGCCATATATATGAATCTAGGATGGACAGCAACCATATTTTGCACATTATTCCAGATTCCAGACAAGTGAAGGCAGAAGAACTGCAGCCAGGAGTGTGCTACCTGCAAATAACAGCTGTTGATCCAGTCATGGAAGATGAGGATCTTGGCAGCAGGAGGGAGAGGATTTTTTCTCTCTCCACTGGAAGTGTCCGAGCTCGTGTCTTTGATCGGTTCTTGTTTGATACCCCGTTTACGAAGAATGGCAAGACACAAGGTGGATTAGAAGATCAATGGAAAAGGCGAACAGTACTCCAGACAGAAGGTTCATTCCCTGCCCTGGTAAATAGGCTATTGGTTATCAAGTCTGAATCTCTCGAGTTCTCACCGGTGGAGAATGCAATTGGAATGATAGAAACCCGAACAGCTGCTCTAAGGAATGAACTTGAAGAGCCTCGTAGCTCTGAGGGGGATCAACTCCCACGCCTTCAGAGTCTGCAGAGGATTCTGCAAGGAAGTGTTGCAGTCCAGGTTAACAGCGGGGTCTTGAGTGTATGTACGGCTTTCCTATCAGGTGAGCCTGCAACTAGACTGCGATCACAGGAACTGCAGCAGCTAATTGCAGCACTGCTTGAATTCATGGCTGTGTGCAAGAGAGCCATCAGGGTTCACTTCAGATTAATAGGTGAAGAAGACCAAGAATTCCACACCCAACTTGTTAATGGATTCCAGTCTCTTACCGCGGAACTGTCACATTTCATTCCGGCTATTTTGTCTGAACTTTAG >Brara.A01917 ATGGAGAACAACAACCTCCGCTTTCGCAAGATTCCTCGGCAGCCTCTCTCTCTCCCCAAGCTCGAACCTTTGCTTGATGGGAACCTGGAACAGTGGCCGCACTTGAACCAATTGGTTCAATGCTACGGAACGGAGTGGATTAAGGATGCTAATAAATACGGTCACTACGACACTACTCGCCCTGATACTTTCCAAACTCAGATTTTTGAAGGTCCCGACACTGATACTGAGACTGAGTTCCGTCTTGCTAGTGCTAGGAGTGCTACATTGGATGAGGATGTAGCCAGCGTTTCTGGGACGCCCTTTACTGATTCTGGATCCCCCAAGCATTTTGGGCTACCTCCGCTCCCTGCTTACGAACCGGCTTTTGACTGGGAAAACGAAAGATCTATGATATTTGGTCAGAGAACTCCTGAGTCTCCTGCAGCTAGCTATTCCAGTGGGTTGAAGATTTCTGTCAGAGTTTTGTCTCTAGCTTTTCAGTCTGGCTTAGTTGAACCATTTTATGGCTCCATTTCATTGTACAACCAAGAGAGGAAGGAGAAACTCTCTGAGGATTTTTATTTCCATATTTCGCCAACCGAAATGCAGGATGCCAAACCTTCATCTGAAAATCGTGGAGTGTTTTATCTAGATGCCCCATCAGCATCAGTTTGCTTGCTGATTCAATTAGAAAAAACAGCAACCGAGGAGGGAGGCGTTACAACATCCGTCTATTCCCGTAAAGAACCTGTGCATTTAACTGAAAGGGAAAAGCAAAAGTTGCAGGTCTGGTCCCGCATTATGCCTTACCGAGAATCTTTTGCCTGGGCAGTTGTTCCGCTTTTTGATAATAGTATCACCACAAACACTGGCGAATCTGCTTCCCCTAGCAGTCCTCTTGCTCCCAGTATGACTGCGTCAAGTTCCCATGATGGTGTTTTTGAACCCATGGCAAAGATCACATCAGATGGAAAGCAAGGTTCTTCAGGTGGAAGTTCTGTCGTTGTTGAAATATCCAATTTAAACAAAGTTAAGGAGAACTACTCTGAGGAGTCGATTCAGGACCCTAAACGGAAGGTTCATAAACCTGTTAAAGGAGTTCTAAGACTGGAAATTGAGAAACATAGGAATGGACATGGAGACGTTGAAGATCTATCTGAGAATGGGAGTATCAGAAATGAATCTCTTGATCTGACTGACCGCCTCGGTGACCTGACGCTTATGAAGTGTCCCAGTGCTGGTTCCGGTGGACCCCATAACAGTGGTTCCAAGTGGAGTACAGAGGATGTTTCAAAAAACCTAACGAGCTCAAGTGGGAATGTTGACAATTGTTATTATGCTTTTGATTTCTGCTCTACGACAAGAAACGAGCCTTTTCTACATCTCTTCCATTGCCTTTATGTGTATCCCGTAGCTGTTACACTGAGTCGGAAGAGGAATCCCTTTATCCGGGTAGAATTGAGAAAGGATGATACAGATGTCCGAAAACAACCACTGGAGGCAATATATCCAAGAGAGCCTGGTGTGTCACTCCAGAAGTGGGCTCACACACAAGTTGCTGTTGGAGCTAGAGCTGCTAGTTACCATGATGAAATTAAGGTGTCTCTCCCTGCCACCTGGACGCCATCACATCATCTGCTATTCACTTTCTTTCATGTTGATCTCCAGACAAAGCTTGAAGCTCCAAGACCAGTAGTTATTGGATATGCATCACTTCCATTGTCTACATATATCCACTCACGGTCTGATATTTCTCTTCCAGTTATGAGAGAACTGGTTCCCCATTATCTTCAAGAGACCACCAAGGAGAGATTAGATTATTTGGAAGATGGCAAGAGTATTTTTAAGTTGCGACTGAGACTTTGTTCATCGCTTTATCCCACCAACGAACGTGTCAGGGATTTCTGTCTAGAATATGATAGACATACCCTCCGAACAAGCCCTCCCTGGGGTTCAGAACTGTTGCAGGCAATTAACAGTTTGAAGCACGTTGACTCCACTGCCCTGCTTCAGTTTCTCTACCCAATTCTTAACATGCTCCTTCATCTTATTGGCAATGGTGGAGAAACTCTTCAGGTCGCAGCATTCAGAGCCATGGTGGATATTTTAACTCGGGTGCAGCAGGTGTCGTTTGATGATGCTGACCGAAATCGTTTTCTGGTCACCTATGTTGATTATTCTTTTGATGATTTTGGAGGCAATCATCCACCGGTTTATCCTGGATTATCAACTGTGTGGGGAAGTTTAGCTAGAAGCAAGGCTAAAGGTTACCGGGTTGGACCTGTATATGACGATGTTTTATCAATGGCGTGGTTTTTCCTCGAGTTAATTGTTAAATCAATGGCATTGGAGCAGGCACGTCTTTTTGATCACAATCTACCTTCAGGCGAGGATGTTCCACCCATGCAGCTCAAAGAAAGTGTCTTTCGATGTATCATGCAATTGTTTGATTGTCTTTTAACTGAAGTACATGAACGTTGTAAAAAGGGTCTAAGCTTGGCAAAACGTCTCAACAGCAGTTTGGCCTTCTTCTGCTATGATCTTCTATATATCATTGAGCCCTGCCAGGTCTATGAATTGGTATCGTTGTACATGGACAAGTTTTCTGGTGTTTGTCAATCCATCCTACACGAGTGCAAGCTGACATTTTTACAAATTATCTCCGATCATGATCTCTTTGTAGAAATGCCTGGCAGAGACCCATCAGACAGGAACTATTTATCATCCATCTTAATACAGGAGCTATTTCTCTCCCTGGACCATGATGAGCTACCTCTGCGGGCAAAGGGTGCAAGAATTTTAGTGATCCTCTTATGCAAGCATGAATTTGATGCTCGGTACCAGAAAGCCGAAGATAAGCTGTATATTGCACAACTATATTTTCCTTTTGTTGGGCAGATTTTAGATGAAATGCCTGTTTTCTATAACCTAAATGCTACTGAAAAGCGTGAGGTTTTAATCGGTGTGTTGCAAATCGTTCGAAATCTGGATGACACATCACTTGTCAAGGCATGGCAGCAGAGCATTGCTCGTACAAGATTGTATTTCAAACTCATGGAAGAATGTCTTATACTATTTGAGCACAAGAAAGCTGCTGATAGCATCCTCGGGGGCAACAACTCTCGTGGGCCTGTTAGTGAAGGAACTGGATCACCAAAGTACTCCGAGCGACTTTCTCCTGCTATCAACAATTATCTGTCAGAGGCATCCCGTCAAGAAGTCAGGCTAGAGGGAACACCTGATAATGGGTACCTGTGGCAGAGAGTAAATTCTCAGTTAGCCTCCCCTAGCCAACCTTATTCCCTAAGAGAAGCTTTAGCTCAAGCACAATCTTCGCGGATTGGAGCTTCAGCCCAGGCATTAAGAGAATCGCTGCACCCTATTTTAAGGCAAAAACTGGAACTATGGGAAGAGAATGTAAGTGCCACTGTCAGCCTCCAGGTTTTGGAGATCACTGAGAAATTTTCATCAATGGCCGCCTCTCACAATATTGCTACGGACTATGGCAAATTGGACTGCATTACTACAATACTGACCAGTTTCTTTTCCCGGAACCAGTCATTAGCCTTCTGGAAAGCCTTCTTTCCTATTTTCAACAGAATCTTTGATCTTCACGGGGCTACACTGATGGCAAGGGAAAATGATCGCTTCTTAAAACAGATAGCCTTCCATCTTCTCCGGCTTGCCGTTTACCGAAATGACAGTGTCAGGAAAAGAGCCGTTATTGGTCTTCAAATACTAGTCAAGAGCTCGCTATACTTTATGCAGACTGCTAGGCTGAGGGCTTTGCTGACCATTACACTGTCAGAGCTCATGTCGGATGTCCAAGTAACTCATATGAAAACAGATAATACATTGGAAGAGAGTGGAGAGGCAAGGCGGCTTCAACTGTCGTTAAGCGAAATGGCTGATGAAGCTAAGAGTGTCACTCTGTTGAGGGAGTGTGGTCTTCCTGATGATACTCTGTTGGTAATTCCCGAGAAATTTACGGAAAACCGCTGGTCTTGGGCTCAAGTGAAACAACTTTCTGACAGCCTTGTTCTTGCTCTTGATGCGAGCCTCGGACACGCCCTTTTGGGATCTGTGATGGCTATGGATAGATATGCTGCAGCAGAGAGCTTCTACAAACTTGGAATGGCATTTGCTCCTGTTCCGGATCTTCACATAATGTGGTTGCTGCACCTATGTGATGCCCACCAGGAAATGCAGTCCTGGGCTGAAGCTGCACAGTGTGCTGTGGCGGTTGCAGGTGTGATTATGCAGGCCTTGGTGGCTAGAAATGATGGTGTCTGGAGCAAGGATCATGTGTCTGCCTTGCGTAAAATCTGCCCCATGGTAAGTGGCGAGTTCACGACAGAGGCATCTGCGGCGGAAGTCGAGGGTTACGGTGCTTCAAAGCTAACAGTTGACTCTGCCGTCAAGTATCTACAGCTTGCAAATAAGCTTTTCTCTCAAGCCGAGCTCTACCATTTCTGTGCAAGCATTTTGGAGCTTGTTATCCCAGTTTACAAGAGCAGGAAGGCTTATGGGCAGTTGGCTAAGTGTCACACGCTACTTACTAACATCTACGAGTCCATTCTTGACCAAGAATCAAACCCTATCCCATTTATTGACGCCACGTATTACCGGGTGGGATTCTACGGGGAGAAGTTTGGGAAGCTGGACAGGAAAGAATATGTATACCGTGAACCACGAGATGTGCGGCTTGGAGATATAATGGAAAAGCTGAGCCATATATACGAATCAAGGATGGACAGCAATCATATACTGCACATCATTCCAGATTCGAGACAAGTGAAGGCAGAAGAGTTGCAAGCAGGAGCGTGCTACCTGCAAATCACTGCTGTTGATGCAGTCATGGAAGATGAGGATCTTGGGAGCCGAAGAGAGAGGATATTTTCTCTTTCGACTGGTAGTGTTCGAGCACGAGTCTTTGACCGGTTCTTGTTTGATACACCGTTTACAAAGAACGGTAAGACGCAAGGTGGATTAGAAGATCAATGGAAGAGAAGAACAGTGCTGCAGACAGAAGGATCATTCCCGGCTCTTGTGAATAGGCTGCTGGTTACCAAATCCGAATCCCTTGAATTCTCGCCGGTGGAGAACGCAATTGGAATGATTGAAACCAGAACAACCGCTCTTAGAAACGAGCTAGAGGAGCCTCGTAGCTCGGACGGGGATCACTTACCACGGCTTCAGAGTCTGCAGAGGATTCTCCAAGGAAGTGTTGCAGTGCAGGTCAACAGTGGGGTCTTGAGTGTTTGCACAGCCTTCTTATCAGGTGAGCCTGCAACGAGATTGCGTTCACAAGAACTGCAGCAACTCATCGCGGCACTTCTTGAATTCATGGCGGTTTGCAAGCGAGCCATAAGGGTTCACTTCAGATTAATCGGAGAAGAAGACCAAGAGTTCCATACTCAGCTCGTCAATGGATTTCAGTCTCTCACGGCAGAGCTCTCCCATTACATTCCTGCTATCTTGTCCGAACTTTAG >Cucsa.239810 ATGCATCTTCTACACCGTCGAGATTCCACACCCGCCTCTATCAAGTGGCACAACAAGTTTGAGGAGAATTTGGAGCAATGGCCACACCTCAATGAGCTCGTGCAGTGCTATTCCACTGACTGGGTAAAGGATGAAAATAAGTACGGTCACTATGAGACTATCGGTCCCGTTTCCTTTCAGAATCAGATATATGAAGGCCCCGATACTGACATTGAGACTGAAATGCGTCTTACTTATGCTAGACGCACAAAGCCTGATGATACTACAGAGGATGATGTACCTAGTACCTCCGGAAGGCCAGAGTCTACAACATATGATCCATTGTTATCGAATGTTCCTAAGCAGATTGGTCCTTCTCCTCTTCCAGCTTACGAGCCAGCTTTTGATTGGGAAAATGAAAGGTCAATGACATTTGGCCAGAGGATACCAGAAACTCCTGTAACACATGGCTTGAAGATTTCTGTTAAAGTTCTATCCCTATCGCTTCAAGCAGGGTTGGTTGAGCCATTTTATGGTACAATTTGCTTGTATAATAGGGAGAGGAGAGAAAAGTTATCTGAGGATTTCCATTTTCGCATTGCACCTAAAGAAATGCAGGATCCTAAAATATCATTTGAGCCGCGTGGAATTTTCTATTTGGAGGCTCCATCAGCATCCGTCTGTCTTTTCATTCAGTTAGAGAAACATGCCACAGAAGAAGGAGGGGTTACTGCTTCTGTGTATTCACGTAAAGAACCAGTGCATTTGAATGAAAGAGAAAAGCAAAAATTGCAGGTCTGGTCTCAAATCATGCCTTACAGAGAATCCTTTGCCTGGGCCATTGTTTCATTATTTGACAACAGCACTGGTGCAGCATCTGCTGGATCTGCTTCCCCAAGTAGTCCTCTAGCTCCTAGCATAACTGGCTCTAGTTCCCATGAAGGCGTCTTTGAGCCTAGCACCAAGGTCACTGTAGATGGAAAGCTGGGTTACTCTAGTGGAAGCTCTGTAGTTGTTGAAATATCCAACTTAAATAAGGTTAAGGAAGGCTACACTGAAGATGCACTTCAGGATCCCAAACACAAGGTTCATAAGCCTGTAAAAGGAGTTCTTAGGCTGGAAATTGAGAAGCACCAGATTTCCCATGCTGACAATGAAAACATGTCAGAGAGTGGCAGTGTGATCAGTGATTCTGTTGATATGGTGGACCGACTGGTTGATTCCACATTTAAGAAGTTCCCCAATAATGGTTCTGATAGCCATCATCTTAGTGGCAGCTCGAAGCTAAATTTTCCTGTCGGGAAAGAATTTTCTGGAAATGGATCATTTTCTCATGAAAATGTCGATACAAATGCAGATGACTTCCATGCATTTGACTTCCGCGTTATGATGAGGAACGAGCCATTCTTGCAGCTCTTTCACTGTCTTTATGTTTATCCCCTGACTGTTAGTTTGAGCCGCAAGAGGAACTTGTTCATTCGGGTAGAACTTAGAGAAGATGATAGTGACCCACGCAGACAGCCTCTGGAGGCTATGTATCCAGTGGAGCTGGGTGCATCTCTTCAGAAGTGGGCTCACACTCAAGTTGCTGTAGGTGCAAGAGTCGCTTGCTACCACGATGAGATTAAACTTTCCCTCCCAGCTACCTGGACACCAAAGCATCACTTGTTGTTTACTTTCTTCAATATCGATATGCAAGCAAAACTAGAAGCTCCCAAGCCAGTGCCAATTGGATATGCATCCCTCCCTTTGTCAACACATGCTCAGTTACGGTCTGAAATTTCTTTGCCGGTAATGAGAGAGCTTGTTCCACATTACCTCCAAGATACAAACAGGGAGAGGCTAGATTACTTGGAAGATGGGAAGAACATCTTCAAATTGCGCTTAAGACTGTGTTCTTCCCTTTATCCCATCAATGAACGAATCAGGGACTTTTTTCTGGAATATGATAGACACACTCTTCGAACAAGCCCTCCTTGGGGTTCTGAACTTCTGGAGGCTATTAACAGTTTAAAGAATGTTGATTCTACTGCGTTACTCCAATTTCTTCATCCTATTTTGAATATGTTGCTCCATCTCATTGGCAACGGTGGAGAAACACTCCAGGTTGCAGCTTTTAGAGCAATGGTCAATATTGTTACTAGGGTGCAGCAGGAATCGGCCGAAGATGGTGAAAGAAATCACTTCCTTGTTAATTATGTCGATTATGCTTTTGATGACTTTGGAGGTCGCCAGCCACCCGTATACCCTGGTCTGTCCACTGTCTGGGGAAGCTTGGCTAGGAGCAAGGCCAAAGGCTATCGTGTTGGACCAGTTTATGATGATGTTTTGGCTATGGCCTGGTTTTTCCTTGAGCTAATTGTCAAATCAATGGCACTGGAGAAAACTCGGCTTTTCTATCATAGCCTTCCATTAGGTGAAGATATTCCTCCAATGCAATTGAAAGAAGGTGTATTTAGATGCATAATGCAGTTGTATGATTGCCTTCTTACCGAAGTACATGAACGTTGCAAGAAGGGATTAAGCTTGGCTAAACGTTTAAATAGCAGTTTAGCGTTCTTTTGTTATGATCTTCTGTCCATTATTGAGCCTCGCCAAGTATTTGATTTGGTTTCCTTGTACCTGGACAAGTTTTCAGGTGTCTGCCAATCAGTTCTGCATGACTGCAAGCTTACATTTTTGCAGATTATATGTGATCACGACCTCTTTGTTGAAATGCCTGGAAGAGACCCTTCTGATAGGAACTACCTTTCATCTGTATTAATACAAGAACTTTTTCTTACTTGGGATCATGATGATTTACCTCTACGGGCAAAGGCAGCCAGAATTTTAGTTGTTCTCTTATGCAAGCATGAATTTGATGCCCGGTATCAGAAGCCTGAAGATAAACTATACATTGCTCAGCTGTACTTTCCACTTATTGGGCAGATTTTAGATGAAATGCCTGTCTTCTATAACCTAAATGCCATAGAGAAGCGTGAAGTTTTGATTGTGATTTTGCAAATTGTGCGCAACTTAGATGATACTTCTCTTGTCAAGGCATGGCAGCAAAGCATTGCTCGAACCAGATTGTTCTTCAAGCTCATGGAAGAATGCCTTATTCTTTTTGAGCATAGAAAACCTGCTGATGGCGTGCTTATGGGATCCAGTTCTCGGAGCCCTGCTGCTGTTGGAGATGGACCTGGTTCCCCAAAATACTCTGACAGACTTTCTCCTGCAATCAACAACTACCTATCTGAGGCATCAAGACAAGAATTCAGACCTCAGGGAACGCCTGATAATGGTTATTTGTGGCAAAGGGTGAATTCTCAGTTGAGCTCCCCAAATCAGCCATATTCCTTGAGAGAAGCACTAGCTCAGGCACAATCTTCTAGGATTGGTGCTTCTGCACAAGCATTAAGGGAATCGCTGCACCCGGTATTAAGACAAAAATTGGAACTTTGGGAAGAAAACTTAAGTGCAGCAGTAAGTCTTCAAGTTTTGGAAATAACAGAGAAATTTTCCTCGATGGCATCATCTCATAGCATTGCCACTGACTACGGGAAACTTGATTGCATCACCTCCATATTCATGAGCTTCTTCTCTAAGAATCAACCTTTGGCATTCTACAAGGCCTTATTTCCTGTCTTTAACAGTGTCTTTGATCTTCATGGTGCAACTTTAATGGCAAGAGAAAATGACCGTTTCTTAAAGCAAGTAACATTCCATCTTCTTCGGCTTGCAGTTTTTCGAAATGATAGCATAAGGAAAAGGGCAGTTACAGGACTTCAGATACTTGTGAGGAGTTCTTTCTGTCACTTTATGCAGACGGCTAGATTGAGGGTCATGCTTATAATTACTTTGTCAGAGTTGATGTCTGATGTGCAAGTAACGCAGATGAAGGCAAATGGGACACTTGAAGAGAGTGGTGAAGCACAGCGTCTACGAAAATCCTTAGAAGACATGGCAGATGAATCAAAGAGCTCCAGTCTGTTGAATGAATGTGGACTTCCTGAGAATGCTCTTGTCATAATTCCAGAAGCTTCTGCTGATAATAGGTGGTCCTGGTCAGAGTTGAAATATCTTTCTGACAGTCTCCTTCTGGCTCTTGATGCTAGTCTAGAGCATGCTCTTTTAGCATCTGTGATGTCAATGGATAGATATGCTGCAGCAGAAGGTTTCTACAAACTTGCAATGGCATTTGCCCCTGTGCCTGATCTTCATATTATGTGGTTATTGCATTTATGCGATGCGCATCAAGAGATGCAGTCATGGGCAGAGGCTGCACAGTGTGCTGTGGCCGTTGCAGCTGTGGTCATGCAGGCTCTTGTCGCTCGAAATGATGGTGTCTGGAGCAGAGATCATGTGACAGCTCTACGCAGAATATGTCCTATGGTCAGCAGTGAGATCACCTCAGAAGCATCTGCAGCTGAGGTGGAGGGATACGGGGCCTCTAAACTCACAGTCGACTCTGCTGTGAAGTACCTACAGCTCGCAAACAAGCTTTTCTCCCAAGCTGAGTTGTATCATTTTTGTGCTAGTATTCTGGAGCTTGTAATTCCAGTTTATAAAAGTAGGAGATCATACGGACAATTGGCGAAATGTCACACTTTATTGACAAATATTTATGAATCGATCCTTGAGCAGGAATCAAGCCCAATCCCATTTACTGATGCAACATATTATAGAGTGGGATTCTATGGTGAAAAATTTGGGAAGCTGGACAGAAAGGAATACGTATATCGTGAGCCCCGTGACGTACGGTTGGGTGACATAATGGAGAAACTCAGTCATGTATACGAGTCTAGAATGGATGGCAGTCACACTCTGCATATTATTCCAGACTCCAGGCAAGTGAAGGCAGAGGAGTTGCAGCCGGGAGTTTGCTACCTACAGATAACAGCAGTTGATCCTGTTATTGAAGATGAAGATCTGGGAAGTAGAAGAGAGAGAATCATTTCGTTATCTACTGGGAGTGTCCGTGCTCGTGTATTTGACCGCTTCTTATTTGACACCCCGTTTACCAAAAATGGAAGGACTCAAGGAGGACTAGAAGACCAATGGAAGAGGAGGACTGTTCTACAGACTGAGGGATCCTTCCCAGCATTGGTAAATAGACTCGTAGTAACTAAGTCTGAATCGCTCGAGTTCTCCCCAGTGGAAAATGCAATTGGAATGATCGAAACTAGAACTGCTGCTCTGCGGAATGAACTGGAGGAGCCTCGCAGTTCTGAGGGTGACCAACTTCCACGACTCCAGAGTCTTCAGAGAATACTCCAAGGCAGTGTTGCAGTTCAAGTTAACAGTGGAGTATTGAGCGTGTGCACAGCATTCTTGTCCGGTGAGCCGGCTACAAGGTTGCGGTCGCAAGAGTTGCAGCAACTCATTGCTGCACTTCTCGAATTTATGGCTGTATGTAAGCGTGCTATTCGAGTTCATTTTAGATTAATTGGAGAGGAAGACCAGGAGTTCCACACCCAATTAGTGAATGGATTTCAGTCTCTCACCGCCGAACTATCGCATTACATTCCCGCCATTCTATCCGAATTGTAA