>PAB00029023 ATGCTCTTAAGAATCCCACATATTCTCAATCCTTGGGGTGGCTATGATATGATTGGCTTTGGAGACATCCTCTTACCTGGTTTACTTGTTTCTTTTGAAGTTAGGTATGACAGGTCGACAAAAAAGAGTCTTTGGAATGGGTATTTTCTCTGGTCAACAATCAGATACAGATTTGGTCTCTTCCTCACTTATGTTTCCTTGCACCTAATGGATGGGCACAGCCAACCAGCACTACTTTATCTTGTTCCATGTACACTAGATCTTATCCTAATTTTGGCATTGCTGCAATGGGAATTCAAAGACTTATGGGTTTATGAAGAGCGTGCTGGTCCAAAACCTCAAGATGAAATACTGCAAGCATGA >PAB00039982 ATGGATATATTTAAGGTATCTGCAGTTCTTCTAAGTTGTGCCTTTCTGTATGACATCTTTTGGGTGTTTGTTTCACCTAAACTATTCCATGAAAGTGTGATGATTGTGGTTGCTCGTGGTGATAAAAGTGGGGAGGACGGCATACCCATGCTACTGAAAATTCCACGCTTGTATGATCCATGGGGTGGCTACAGCATCATTGGCTTTGGAGACATACTTTTACCAGGACTGCTGATAGCATTTGCATTAAGATATGATTGGGCAGCTAAGAAGAGTTTGCAAGGAGGCTATTTTCTGTGGTCCATGATTGGCTATGGCTTTGGTCTATTCATTACATATGTTGCTCTGAATCTGATGGATGGAAATGGCCAACCTGCTCTTCTGTATATTGTTCCTTGTACCCTTGGCACTGTTCTAACCTTGGGATGGTTGCGGGGTGAACTGAGTAATTTATGGTCAAAGGGAGAGCCTCAAATGCCTTGCCCACATGTTGGACCCAAGGTTGGCACATGA >PAB00056836 ATGGTTGGACTGAGTGCCAGGTTTGGTACTTCTGTACCAACTAATGAAGATGAAGCTCATCAGATGACCGTTGTTGAGTCAAATCCACTAAATTGTTGTGAAAACTCTTCTACACGGTTATCAGGATATGCTGCATTGTCCAAATGGGGAAATTGTACTTTCACTATGAAAGCAAATATTGCACAAGTAGGGGGAGTAGTGGCATTACTTGTAATGAATGATAAAGAAGACCTTTTTAAAATGGTGTGCTCTGAAAATGATACTTTCTTCGACATTAAGATTCTTGTTGTCATGATCCCCAAATCAATAGGGGAGAGTCTTCAAGACCACCTGTCCACTGGCCAAAAGGTGGTCTTGCTACTTTACTCCCCAAACCAACTATTTATATATTCCTCAGAAATTTTCATATGGATGATGGCGGTTGGTACCATAGTGTGTGCTTCCCTATGGTCGAAATTCATTGGAAATGAACAATGTGATGACCAGTACAAGAAATTGACAAGAAAGGAGACCCAAGATGATATATCTGCAAGCAAAATTGAGCTAGAGAAGGATGTCATGCATGTAACCACCAAGGCAGTTGTTTTCTTCATACTGATATCATCGATATTTTTTATGCTTCTTTATTGGTTCATGTATGATTGGTTCATCTGGATTCTCATTGTCCTCTTCTATATAGGTGGAGTTGAGGGAATGCATATTTGTTCAGTGACTTTATTGTCCAGGTCATTTGGTCACTTTACTGACATGACAATAAAGGTTCAATTTGTGGGTGAGGTCTCACTCCTGTCTGTGATAGTTTTGCCCTTCTGTATAGCTTTTGTTGTTACTTGGGCTGCAAATCAGCATGCTTCCTATGCCTGGATTTGTCAAGATGTTCTAGGCATATCATTGATGATTATAGTTTTGCAAATAGCCCGATTACCAAATATCAAAGTTGCAGCCGTTTTATTAAGCTATGCATTTGTCTATGATATTTTCTGGGTCTTCATATC >PAB00060141 GTTAAAGTGAAGAACTGGATAGATGGTGTAGAAGGAACAAGCATGGTTGGACTGAGTGCCAGATTTGGTACTTATGTACCAACTAGTGAAGATGAAGCTCATCGGATGACCGTTGTTGAGTCAAATCCACTAAATTGCTGTGAAAACTCTTCTACACAGTTATCAGGATATGCTGCATTGTCCAAACGTGGAAATTGTACTTTCACTATGAAAGCAAGTATTGCACAAGTAGGGGGAGCAGTGGCATTACTTGTAATAAATGATAAAGAAGACCTTTTTAAAATGGTGTGCTCTAAAAATGATACTTTCTTCGACATTAAGATTCCCATTGTCATGATCCCCAAATCAGCAGGGGAGAGTCTTCAAGACCACTTGTCCACTGGCCAAAAGGTGGACTTGCTACTTTACTCCCCAAACCAACCATTTATAGATTTCTCAGAAATTTTCATGTGGATGATGGCGGTTGGTACCATAGTGTGTGCTTCCCTATGGTCGAAATTCATTGGAAATGAACAATGTGATGACCGGTACAAGCAATTGACAAGAAAGGAGACCCAAGATGATATATCTGCAAGCAA >Pp3c12_2120 ATGGAGTCGAAGGAGGACTGGCGCCTCGGGCGTTTTGTGTGGATCGTGACGGTTGTTTTGCTGCTGCTGCTGCTGGCGGCGCGTCCCTGTGATGGGCGAGGGAACAGGGACATCATGCACGATGATGCGGATACGCCGAAGCAGCCTGGATGCGAGAATAGTTTCGTCCTGGTTAAAGTACGAACTTGGATGGATGGCGTTGAAACGACTGAACTAGTTGGCGTGAGTGCGCGTTTTGGAGAATCAATATCAAACCGTGCTCAGGAAATCAATGCCCTCCCTTTGGCAGTGCCAAGTCCTGCGACCTTGTGCAACATGTCCTCTTTACTGCTCACGGGTCGTGCCGCCTTGGTGCGGCGTGGAGATTGTACTTTTACCAAGAAGGCTCGAATGGCACAGGCAGCAGGTGCTAAGGCTCTCATCGTGATTAATGATAAAGAAGAGTTGTACAAGATGGTGTGTGATGACAACGGCACCTTCCTGGACATCCAAATTCCGTCAGTCATGCTGCCCCAGTCAGCTGGAGACACCTTAGAGGCTGGTTTGCTTCGTGATGAATCAGTTAAGATCTTGATGTACTCTCCAAAGCGGCCTGTAGTTGATATATCAGAAATATTTTTGTGGCTTATGGCCGTTGGCACAGTCCTTGGTGCCTCTTTCTGGTCAGCCTGGACCGCCAAAGAAGCAGCCCAGGAGCACTATAGGAGTATGAAGGATGGAGGAGATTCTTATGTTTCTGATAGCGAGCACGATACAATCAAGGATGTTGTAGACATTAATGTTGTATCTGCATGCCTGTTCATGGTTCTTGCATCAGTATTTTTGCTCATACTTTATTACTTCATGTCGCACTGGTTCCTTCTTCTATTGGTCATCCTTTTCTGTGTTGGCGGTTTTGAGGGTCTGCAAACCTGCATGGTGTCCCTTCTTTCCAGGTGGTTTCCCAAAGCAGCCGGAACATATTTCAGTGTGCCACTTTTGGGATCAATGTCAATTCTCTCGTTGACAGTGGCCCCTTTTGCATTCCTGTTTGCATCATTGTGGGGTGTATATCGAAATCTGAGTTTTGCCTGGATTGGTCAGGACGCGCTTGGAATTTCGTTGATCTTGAGTGTTCTCCAGATAGTGCGCATACCTAATATTAAGGTTTCTGCGGTACTCCTGGGTGCTGCCTTTATATACGACATATTTTGGGTGTTTGTGTCACCGCTTATTTTTGATGAAAGTGTCATGATAGTGGTTGCTCGGGGAGATAAGAGCAATGGAGAGGGTATTCCTATGCTTCTGAAAGTCCCCCGGTTGTATGACCCATGGGGTGGCTACAGCATCATCGGCTTTGGAGATATTCTGCTTCCAGGACTTTTAGTGTCCTTCTGCTTACGGTATGATTGGGTGTCGAAGAAGAGTCTTTTCAACGGGTACTTTTTGTGGACATCAGTGGGTTATGGCTTAGGGCTGTTCTGGACTTACGTAGCCCTCAATTTGATGGTTGGGAATGGCCAGCCTGCATTGCTGTATATAGTTCCGTGCACTCTAGGAACTGTGCTATTTCTCGGTTGGTGGCGAGGAGAATTAAGATCTTTGTGGACGAAAGGAGAACAAGTTTCACAACTGGAGAATTATGTGAATTCTTCACGCATTCACAATCATCCACATAAATGA >Pp3c15_1670 ATGGCGTCGGAGCAGCGACTTGCCAGTGCCTCGACTTGGATCTTGTTGTTGGTTGCTTTATCGGCGCATTTGTGCCGGGGAGATAGCTCTATCACCCACGATGATTTGAATACGCCTTCGCAGCCCGGCTGCGACAACAGCTTCGTTCTGGTCAAAATACGAAACTGGATGAACGATGTTGAAGTGACCGAACTAGTGGGTGTAAGTGCACGATTCGGCGAGAAAATATCCGACATTAATGTGGCACTTGATGCTATTCCTCTGGCGATGCCAAGCCTTGTTTCCTCCTGCAATACGTCCTCTATACCGCTCAATGGTCATGCCGCTTTGGTACGACGCGGAGAATGCACTTTCACAAGGATGGCACGAACGGCACAGGCAGCCGGTGCCAATGCCCTCATTGTTGTTAATGATAAAGAAGAGCTTTGCAAGATGGTGTGCTCAGAGAACGGCACCTTCACAGATATCCAAATACCGTCGGTTCTGGTACCCAAGTCAGCTGGAGATATCTTGGAGGCTGGTTTACTTCGTGGTGAAACAGTTAAGATCTTGATGTACTCTCCGAAGCGACCCATTATCGATATATCGGAAATATTTTTGTGGCTGATGGCCGTTGGTACAGTTGTTGGTGCTTCTTTCTGGTCAGCCTTAACTGCTAAAGAAGCAGCTCTGGAACACTACCGAAGTATCAAGGAGGGAGGAGATCCCGATCTTTCTGATGCAGATCATGATGGAAACAAAGATGTTGTGGACATCAACGTTATGTCGGCATTCCTGTTTTTGGTTATGGCATCTGTATTTTTACTGGTGCTATATTATTTCATGTCGCAGTGGTTTCTAATTCTACTGGTTATCTTTTTCTGTATTGGTGGATTTGAGGGTCTACAAACTTGTATGGTAGCCCTTCTTTCTTGGTGGTTTCCCCGAGCAGCAGGTACATACTACGGCGTGCCATTTTTGGGAGCCGTTTCAGGACTTTCCCTTGCAGTGGGCCCCTTCTCACTGTTGTTTGCAGTGTTGTGGGGTATTTATCGAAATCACAGTTATGCCTGGATTGGCCAGGACGTGCTTGGAATTTCATTGATTTTGAGTGTTCTCCAAGTTGTGCGCTTACCTAATATCAAGGTTTCTACTGTATTATTGAGTGCTGCCTTCATATACGATATATTCTGGGTATTCATATCCCCGCTCATTTTTGATGAAAGCGTCATGATTGTGGTTGCTCGGGGAGATAAGACCAATGGAGAGGGTATTCCTATGCTTCTTAAAGTTCCACGTCTTTTTGATCCATGGGGTGGCTACAGTATCATTGGTTTTGGCGATATTTTGCTTCCAGGACTTTTGGTTTCCTTCTGCTTACGGTATGACTGGTCTACAAAGAAAAGACTCTTCAATGGATACTTTTTGTGGACGGCAGTGGGTTACGGCCTAGGGTTATTCTGGACTTATATAGCGCTCATTTTGATGAACGGGAATGGCCAGCCTGCACTGCTTTACATTGTTCCTTGCACTCTAGGAACCGTGTTTCTTCTGGGATGGTGGCGGGGAGAGTTGATAACTTTGTGGAACAAAGGAGAACAAGTTCCTCCACTGGAGGACTATGTGAATTCGTCACAAATCGATGAGCATCCGGACAGAAGTTCATAG >Pp3c4_30740 ATGGAGGGCAAGCCTCGGGGACGATGTTTTTGCTGCAACAGGGTGTTCTTAATGTTGGTTCTGCTTGTCTTAGTTAGTTTTCTTATGCAGTTTGCTTCCGCGGACGACATCGAGCATGACGATGCGATGGCCCCGTCGCAGCCTGGCTGCTCCAACAGCTTCGTTCTTGTTAAAGTTAGGAACTGGATTGCAGGACTAGAGGAACCAGAGGTTGTGGGTGTGGGCGCAAAATTCGGCGAGCTTATCACCGACTTTGAACAAGATCATAGTGCCCCACTGGCAAAGCTAGATCCTGAGGATGCCTGCACAGATTCTATCAAACCACTTCAGGGATACACAGCCCTGGTTAGACGTGGAAATTGCGAATTCACAACCAAAGCGAGGGTGGCGCAGAAGGCTGGAGCGGTTGCACTTCTTGTTGTGAACGATAAACAAGAGCTTTACAAGATGGTATGCTCTGAAAACAGTACTTTTACAGATATCACCATTCCATCTGTCATGTTACCAAAGGCAGCTGGAAACAATCTGGAGGATGCTCTAAATCTTGGAAAAGAAGTGAGAGTGGTGATGTATTCTCCAAGAAGAACACTAGTCGACATAGCAGAGGTGTTTTTATGGTTGATGGCTGTGGGCACCATTTTGAGTGCCTCATTTTGGTCGGCCTGGACTGCGAAGGAAGCTGCTCAAGAGCACAACCGTCTCATGAAGCAAGAACGACCAGAGGTTCCAGCTGAGGATACGACAGCAATACATGATGCTGAGAAGTACTCGAAGGATACAATTGATATCAATGAGTTCTCGGCGGTGCTATTTGTGTTGTTGGCCTCAGCTATCTTGATGCTTCTCTACTTCTACATGTCGGATTGGTTTATACGGGTGTTGGTTATCCTGTTCTGTATCGGTGGCTTCGAGGGTTTGCAGACCTGTCTTGTATCCCTTCTGTACAGGTGGTTTCCGAAAGCAGGGACTTTCTTCATCAAAGTACCTCTTATTGGAGCAGTATCAGTCCTTGCTCTATGCCTGTCACCCTTTTGCCTCACGTTTTCTGTTGGTTGGGGCTACTTCCGTCTTAGTTCATACGCCTGGATAGGCCAGGACATTCTTGGAGTTGCACTTATTCTTACAGTTCTTCAGATTGTTCATCTCCCAAATATCAAGGTCTCTACAATATTGCTGAGCTGTGCATTTCTTTATGACGTTTTCTGGGTGTTCATCTCGCCGAAAATTTTTCACGAGAGTGTGATGATAGTGGTAGCACGGGGAGACAAAGGTGACGGCGAAGGCATACCAATGCTTTTAAAGGTCCCAAGGTTGTATGACCCTTGGGGTGGTTACAGTATTATTGGCTTTGGTGACATTCTCCTGCCAGGGTTGCTGATTTCTTTCTGCCTACGGTATGACTGGATTGCAAGAAAGAGTTTGCTCCGGGGCTACTTTCTGTGGGCCACAGTTGGTTATGGACTAGGCTTGTTTCTGACATACGTAGCTCTCAACGCTATGAACGGCAGCGGACAGCCTGCACTTCTATACATCGTGCCGTGTACTCTCGGCACGGTGCTATTACTTGGGTGGTGGCGAGGTGAACTGAAATCGTTGTGGTTTAAAGGAGATTCTCTGTATCATTTTTCATCAGAGGCGGCATAA >Pp3c3_2740 ATGGAGGCCCGGGGGGGATGGCGCCATGCTGCGTCGCCGCGGCTGCCTCTGCTGCTGCTGCTGCTGCTGCTTGTGAGCTGCTTGGTAGTGCAGCCTTGTCAAGCGGACGACATCGTCCACGACGACACGCTGGCTCCGTCACAACCTGGCTGCTCGAACAGCTTCGTTCTTGTTAAAATCAGGACCTGGATCAAAGGAGAAGAAGATTCCGAGATCGTGGGTGTGAGTGCAAGATTTGGCAAGCTTATTGCTGATCATGAGCAAGGAAAAACTAGTGTTCCATTGTCAAAGCTGGATCCTGAAGATGGATGCACTGACTCCATCAAGCCACTTCAGGGATTCACAGCCCTGGTTGAACGAGGTAACTGTACTTTCACAACCAAGGCCAGGACGGCTCAGAAGGCAGGAGCGGTCGCGCTTCTGGTTGTGAACGACAAACAAGAGCTTTACAAGATGATTTGCTCCGAGAATGATACTTTTCATGATATCATCATACCATCTGTTTTGCTACCAAAGGCTGCTGGAGAGCATCTGGAGGAAGCTTTAGATTCTAACAACGAAGTACGAGTGCTGCATTACTCTCCAAAGAGGACAATGGTTGATATAGCCGAGGTCTTTTTGTGGTTGATGGCTTTGGGTACTATTTTGAGTGCCTCATTCTGGTCAGCTTGGACTGCTAAAGAATCTGCGCAAGAGCACTACCGTCGCTTGAAGGAACTGCCAGAGCTTCCTGCCGAGGATCTAGTGGAGGCGAGAGATCCTGAGAAGGCAAACAAGGATGTAATTGATATCAACGTGCTCTCAGCGGTGCTATTTGTGCTTATGGCTTCAGCTTTTTTGATGCTTCTCTACTTCTACATGTCAGCTTGGTTTATGCGGGTATTGGTTATCCTTTTCTGCATAGGCGGGTTTGAGGGTTTGCAGACATGCCTTGTGTCCCTTCTGTACAGGTGGTTTCCTAAGGCAGGGAAAAAATTCATCAAAGTCCCTCTTCTAGGAGAAGTGTCTGTCCTTGCTCTGTTTCTCTCGCCCTTTTGTCTCGCGTTTTCCGTTGTTTGGGGCGTTTTCCGTTTGAACTCCTATGCCTGGATTGGTCAGGACGTTCTTGGGATGGCACTCATTCTCACAGTTCTTCAGATCGTTCGACTGCCAAATATTAAGGTTGCCGCAATACTTTTGGGTTGTGCGTTCCTTTACGATGTTTTCTGGGTTTTCATCTCACCAACCTTCTTCCACGAGAGTGTGATGATTGTGGTTGCACGTGGAGATAAAAGTGATGGCGAAGGGATACCAATGTTGCTGAAAGTTCCAAGGTTGTATGATCCTTGGGGAGGTTACAGTATCATTGGCTTTGGTGACATCCTACTCCCAGGGTTGCTTGTCTCCTTCTGCTTACGGTATGACTGGACAGCAAGAAAGAGTTTGTTCAGAGGCTACTTCCTATGGTCCACAGTTGGTTATGGCCTAGGTTTATTCATCACATACGTTGCACTGAATGCCATGAATGGGAGCGGGCAACCCGCACTCCTTTACATCGTGCCTTGTACTCTAGGGACGGTGCTTTTGCTTGGGTGGTGGCGAGGAGAATTGAAATCTTTGTGGTTCAAAGGAGACTCTCTGGACCAGTTTCCAGTGGATGGTGAACAGGACCACCATCCAGTGGGCAGATCACCGGAATAG >SMO115G0005 ATGGCGCTCTCTTCGCCGGGCAGTAACAAGCTGGGAGCTGCTCGTGTCTTGGTGGTGGTGCTCTTTGTGCTAATATCGAGATGTGGCGCCACCGGAGGAGGAGGAGACAATGATGTATCTCACGATGACGAGGATGCACCCAAGCATCTGGGCTGTGACAACAACTTCGAATTGGTGAAGGTGAGGAATTGGATTGACGCGGTGGAATCCAAGGAGTATGTGGGGATCAGTGCCAGGTTTGGAGCTTCCTTCAAGACGCTGGGGCGTGAAGAACACTTCCTGCCCCTGGCTCTGCTGGATTCACCGGATGGCTGTGTCAACACGTCTCAGCGGGCAAGTGGCGCTGCTCTGGTCCAGAGGGGTGGCTGCTCCTTCACCACCAAGGCTCGAGTTGCCCAGTCTGCCGGCGCTGTGGCCTTGCTCGTCTTCAACGACAGGGAAGAGCTCTACAAGATGGTGTGCTACGACAATGACACATCCTTGGACATCAAAATCCCCACAGCCATTTTGCCCATGTCTGCAGGCAACAGCCTCCAGAGTGCATTGGAGGCCAACAAGAAAGTCAGGGTGATTATGGATTCGCCTGGAAGGCCCCTGGTGGATGTTGCCGAAGTATGCCTGTGGCTCATCGCCATGGGCACTATCCTCTGCGCGTCATTCTGGTCTGCCTGGGAGGCAAAAGAGGCTGCTCACGAGCGCTGTAAACGGCTAAAGGACGCTCCAGACGCTCCGCTTACTCACACCTCCACGGTGGCCGCGACTCCAGCCGGCAATGGTCTCTATGTCACCGTTACGTCGGCAGTCCTGTTTGCGGTTTTTGCTTCGGTGTTCCTCATCCTCGTCTACTTTTTTATGTCCAAATGGTTCTTAACGCTTCTGGTCGTCATCTTCTGTTTTGGTGGAGTAGAGGGGCTACAAACTTGCTTGGTCGCTTTCCTTTCGAGGTGGTTTACGCATACAAGCCGAAAGTTTGTGCTCCTTCCCGTCTTTGGTAGCGTCTCAGTTCTCTCAATGCTTGTGTCACCATTCTGCATCACCTTCGCTGTCCTGTGGGCCGTGTACCGGCATGTAAACTTTGCGTGGATTGCTCAAGATATACTAGGCATTGCTCTCATTGTCACTGTTCTCCAGATTGTGCACCTTCCAAATATAAAGGTGAGTACTTTCCTTCTGGGATGCGCTTTCTTCTACGACATATTCTGGATTTTTATCTCCCCATTCATTTTCAAACAAAGTGTTATGATAGTGGTTGCACGGGGTGACAAAACCGCTGGAGAAGGCATACCAATGGTCCTTAAAGTACCTCTGATTTACGACCCCTGGGGAGGATACAGTATCATAGGCTTTGGTGATATACTACTTCCAGGGCTTTTAATATCCTTTGCTCTGAGGTTCGACACAGTGACTAGAAAAAGCTTGCGAGAAGGTTACTTTTTGTGGTCGATAATAGGCTATGGCCTGGGTTTGTTTCTTACGGACGTTGCATTGAACGTGATGCATGGGCATGGACAACCTGCCCTCCTCTACATCGTACCTTGCACTCTGGGAACAATCGTTGCTCTAGGGTGGCGAAGAGGCGAGCTGGGATCCTTGTGGTCCAAGGGAGACAGCCTTGAGATGCAGCTGGAAGACGATTGCACAGAAGCATAA >SMO234G0078 ATGACACACCATGGGCACGCTGCTCTAGCGAGTGCGCTCTCCGATTTGCTGCAGGCTAGAGGGGCGCATTTTCTGGTGCTGCTGCTGGTGATCATCGCCACTGACTACACTCGCGCGGACGAGATCTCTTACGACGATGTGGATGCTCCAAAACACCCCGGCTGCGACAACAAGTTCGTGCTGGTGAAGATCAGAAACTGGATTGACAACGTCCCCGCAAGTGACTATGTCGGCATCACAGCCAGGTTTGGGGGGCCCGTCGCAGCACGAGCTGACAAAGCTCATGTCACTTCCCTCTCGCGAGCGGATCCCATCGACTGTTGCTCCAATCCCGGCGGTGTCAAGCATGCAGGGAACGTACTCCTCGCTGAAAGGGGGAACTGCACTTTCACTACCAAGGCAAGGATTGCGCAGCAGGCTGGTGCCTCGGCTGTTCTCATCACAAACGACCGAGAAGAGCTTTACAAGATGGTCTGCTTTGAGAACGACACTTTCGCAGACATAACAATTCCAGCCATTATGATCCCCAGATCAGCAGGAGAAAGCTTGGAGTCTGCTTTGCAATCGAGCCAAAACGTGAAGCTGCTCCTGTATTCACCAGTGCGGCCTGTTGTTGACCTTGGCGAGCTCTTCTTGTGGTGTCTTGCGGTTGCGACCGTGATCGGCGCGTCCCTGTGGTCCGCATGCACTGCCAACGACGTAGGAAGCGGGCGGTACAAGCGCTTGAAGGAGGCTTCTGCAGCGTCTCGCACAAAGGACGATTCCGACGACAAGGAAGTGGTGGATATCAGCATCGCATCGGCCGTGTGCTTTTTGATCCTTGCGTCTGTCTTCCTGCTTCTGCTCTACTTATTTATGTCCAACTGGTTTCTGATGCTGCTCGTTGTCTTGTTTTGCATTGGCGGTGCTGAGGGATTACAAACGTGCCTCGTAACACTGCTATCCAGGTTATTTCCTGGTGTTGGTACGCGGCACATAACCATTCCAATCCTGGGGACTGTAAGTTCCCTATCTGTCGTGGTGTTTCCCATCTGTGTGGCCTTTTCTGTACTATGGGCTGTGTATAGGCACGCTCATGTGGCCTGGGTTGGCCAAGACGTATTGGGTGTAGCATTGATCCTGACCGTCTTGCAAGTTGTTCGCTTGCCAAACATTAAGGTTTCCACGGTTTTGTTGAGCTGTGCGTTTCTGTATGATATCTTTTGGGTCTTCATATCTCCATACATTTTCAAAGAGAGCGTTATGATCGTGGTGGCCAGGGGAGATAAGAGTGGAGGGGAGAGCATCCCAATGCTGCTCAGGGTCCCGCGTTTCTACGATCCCTGGGGTGGCTACTCAATCATCGGGTTTGGCGATATACTTCTGCCGGGCTTGTTGGTGTCATTCACACTCAGGTTCGATTGGGCCAACAAGAAGAGCCTTTCCGGGGGATACTTCTTGTGGACAACGGTCGGCTATGGCCTGGGACTCATGCTAACTTACGTTGCTCTCAACCTGATGGACGGCCATGGCCAGCCGGCGCTGCTTTACATCGTTCCCTGCACTCTAGGCATTGTGGTGCTGCTGGGATGGATAAGGAAAGAGCTGGGAGCACTGTGGAACAACAAGGACGTGGCCGAGGAGCCAAGCGCAGGCCAAGTTGGCGCCGCGCAAGCCTAG >Pbr009169.1.g ATGGATTTACAGAGAGGTGTGTGGGTGGTGGTGGGAGTGCTGGTGGTTAGTCTAAGTCTCAGCTCAGCTGGGGACATTGTTCACCATGATGATATTGCTCCCAAGAGACCTGGATGCAACAACAACTTCGTTCTGGTAAAGGTCCCAACTTGGATCAACGGCATAGAAGACGCTGAGTATGTTGGTGTTGGTGCTCGATTTGGACCTACCTTGGAATCAAAGGAAAAATATGCCACCAACACTAGAGTGGTTCTTGCGGACCCCCCTGATTGTTGTACCCGACCCAAGAATAAGCTCGCAAAAGAGGTCATTTTGGTGCACCGAGGAAATTGCAGTTTCACAACCAAGGCAAATATGGCTGAAGCTGCTAACGCTTCAGCCATCCTCATTATAAACAACCGCACAGAACTTTACAAGATGGTTTGTGAAAAAGATGAACCTGATGTCAAGATAGGCATACCAGCTGTTATGCTTCCTCAAGATGTTGGTGCAATCTTCGAAACTGATTTGATGAACAACTCCACAGTTTCTGTGCAGCTGTACTCCCCGTTGCGTCCACTAGTAGATATTGCAGAAGTTTTTTTGTGGCTTATGGCTGTTGGTACCATCTTATTTGCTTCTTATTGGTCTGCGTGGAGTGCAAGGGAAGCAGCTATTGAGCATGAGAAGTTATTGAAGGATGCTTCCGATAATTCTTTACATATGGAAGTTGATCGTTCCAATGCTTTAGTGGAGATTAGCACCACAGCAGCAATCCTCTTTGTTGTGATTGCTTCATGCTTCTTGATTATGTTTTACAAACTTATGTCATTCTGGTTTGTGGAGATTCTGGTGGTTTTGTTTTGCATTGGTGGGATAGAGGGCCTGCAGACTTGCTTGGTGACTTTTCTGTCATGTTTCAGTCGGTTCAAACGTGCTGGAGATTCATACGTTAGGCTGCCAATCTTTGGAGCTGTTTCCCATCTGACACTAGCTGTTGCTCCCTTCTGCATAGCATTTGCTGTTTTGTGGGCAGTGTATCGCCGCATTTCATTTGCTTGGATCGGTCAAGATATCCTTGGTATTGCACTGATAATCACAGTTCTTCAGATTGTTCGTGTACCAAATCTCAAGGTTGGAACAGTTCTTCTGTGTTGTGCGTTTTTATACGACATCTTTTGGGTATTTGTTTCTAAGTGGTGGTTCCATGAGAGTGTAATGATAGTGGTGGCTCGTGGTGATAAAAGTGGAGAGGACGGTATACCAATGCTACTGAAAATCCCACGGATGTTTGATCCTTGGGGTGGCTACAGCATCATCGGATTTGGTGATATTATCTTACCAGGATTGGTTGTAGCCTTTTCACTAAGGTACGATTGGTTGGCGAATAAAAAGCTTCGAGCTGGTTACTTTGTGTGGGCAATGACCGCTTATGGTTTAGGTCTCCTTATCACGTATGTGGCTTTGAACTTGATGGATGGCCATGGCCAACCCGCTTTGTTGTATATAGTTCCGTTCACACTTGGTACCTTTATAACTTTGGGACACATGAGAGGGGATCTCAAAGTTCTGTGGACGAGAGGAGAGCCGGAGAGGCCATGCCCGCACGTCCATCTGCGACCGCAACCCTCCTCTCAATAA >Pbr018178.1.g ATGGATTTGCAGAGGCTTTGTGGGTTGGTTTTTGTTTCAGCTTTGACTGTTATACTGGTCGGTAATCCGAGCTCTGTCACTGCCGGGGATATAGTGCACGATGACGATTCTGCTCCGAAGAAGCCCGGGTGCGAGAACAATTTCGTTTTGGTAAAAGTTCAAACTTGGATTGATGGAGTTGAGGCAAATGAGTTTGTTGGTGTGGGTGCTAGATTTGGAACTACGATTGTTTCAAAGGAGAAAAATGCACAGCAAACTCGCCTTGTTCTTTCTGATCCTCGCGATTGTTGCAGCAAACCAAAAAAGAAGCTTACTGGAGATGTCATCATGGTTGACCGAGGCCAATGCAAATTCACAACTAAGGCAAATATTGCCCAAGCTGCCAATGCTTCTGCTGTCCTCATTATAAATAACCAGAAAGAACTTTACAAGATGGTGTGTGAGCCAGATGAAACTGCTCTAGATATTCACATACCAACAGTCATGCTCCCACAGGATGCGGGTTCGACCTTGGAAAAGATGTTAATGAGCAATTCATTGGGTAAGGTTCTTTACCCTCAGGTGATTTCTAAGCTGCAAAAGTTTGTAACAGTTCTCTGGCTGTACTCTCCAAAGCGACCTGTAGTTGACATTGCAGAAGTATTTTTATGGTTGATGGCAGTCGGCACCATCTTGTGTGCATCCTTTTGGTCTGCATGGAGTGCCAGAGAAGCAGCTATTGAACATGAAAGGCTATTAAAGGATGCTGCTGATGAAATCCCACGTGCCAAAACTCCTTTAGGTGCTAGTGTAGTAGACATCAGCACAACGTCAGCAGTCTTGTTTGTTGTTATTGCTTCATGCTTCTTGGTTATACTGTACAAGCTTATGTCATCCTGGTTCGTTGTGCTTTTGGTGGTTCTTTTCTGCATAGGTGGTGTAGAGGGATTGCAAACTTGCTTGGTTGCATTGTTGTTGAGGTGGTTCAAACGTACTGGAGAATTGTACATTAAAGTACCTATCTTGGGAGCAGTCTCATACCTAACTTTGGCTGTTTCTCCGTTCTGCATAACATTTGCTGTTCTTTGGGGAGTTTATCGCAACCTTTCCTTTGCCTGGATTGGTCAAGATATACTTGGAATTGCGTTGATAATCACAGTTCTTCAAATTGTTCGAATACCTAATCTGAAGGTGGGTACGGTCCTTCTCAGTTGTGCCTTCTTGTATGACATCTTTTGGGTGTTTGTTTCTAAGAAGTTGTTCCATGAAAGCGTGATGATTGTGGTAGCTCGTGGTGACAAAAGTGGAGAGGATGGTATTCCAATGCTACTAAAGATCCCACGCATGTTCGACCCATGGGGTGGTTTCAGCATCATAGGATTTGGTGACATCCTATTACCAGGCCTGCTTGTAGCATTCTCGCTCAGGTATGATTGGTTGGCAAATAAGACTCTCCGTGCTGGATACTTCATTTGGGCAATGATTGCTTATGGATTAGGTCTTCTCATCACATATGTGGCATTAAACTTGATGGATGGGCATGGCCAACCAGCACTTCTTTACATTGTTCCATTTACACTTGGCACTTTGCTGACATTAGGTAAGAAGAGAGGTGACTTACAGATTCTGTGGTCTAGAGGAGAACCGGAATGGCCCTGCCCACATATTGAGCTTGAAGGTAGTCACGAAGTGAACGAATAA >Pbr031117.1.g ATGGCAATGGCGTCGGGTCTCCTCCGCCTTGTGTTTCTGTTTTCTCTGATTGCTCTTTCTTTGGCTCGTGGTGAAAAGGACATGGTTTTGGATGTGGATTCCCCCCCCGACACTCCTTCCTGCAGCAACCCTTACCTAATGGCAAAGGTTAAGAATTGGGTTAATGGCCATGAAGGAGAAACTATTGAAGGGGCAGGTGCAAAGTTTGGGGCTTTATTGCCTTCCAAAGAAGAAAAAGCCGTCAAATTGCCCGTTGTTATCTCGAATCCCTTAAATGGTTGTTCAGCGTCATCTTCGAAGTTATCTGGAGCTATTGCCTTGTCCACTCGTGGTGATTGTGACTTCTCCATAAAGGCAGAAGTTGCACAGTCAGGAGGTGCTAAGGCGCTCGTGGTGATAAATAATGAAGAAGATCTTGCCAAGATGGCTTGTCCTGATAATAGCACTTCTTTGAATATTTCAATTTTTGTCGTAATGGTTCCGAAGTCAGATGGAGAAGCTCTCAAGAAATCTATTGAAGATGGAAAGAAAGTGGAGCTTCTATTATATTCTCCCAAGCGTCCAGTGGTGGACTACTCAGTTGTGTTCCTGTGGCTGATGGCTGTTGGAACAATAATAGTTGCCTCATTTTGGTCAAAGATTACTGCTCCTGAGAAGTCTGATGAGAATTATAATGAACTAGCAGAAAAGGAATCTAATGCTGGAACAGCCAAAGATGATTCTGAGGACGAAGTCATGAATCTTAGTGTGGCAGGCGCTGTGTGTTTCGTCATAACAGCATCCACTTTTCTGTTGCTACTATATTTCTTTATGTCTACTTGGTTTATCTGGGTGCTGATTGTACTTTTCTGCATTGGTGGTATTGAGGGAATGCATAATTGTGTTCTGAGCCTGATTTTGAGAAAATGGAGAAGTGGTGGACAGAAGACGATAACTTTGCCTCTTCTGGATGAGGTTTCTATTCTCTCGCTTGTTGTATTGGCTTTCTGTGCGGCATTTGCAGTTTTCTGGGTTGTTACCCGGCGGGCATCATATTCATGGATTGGCCAAGATGTTCTTGGTATCTGCTTGATGATAACGGTCTTGCAAATTGCTCGATTGCCTAATATAAAGGTTGCTACCGTACTACTTTGTTGTGCATTTGTCTATGATATCTTTTGGGTATTCCTGTCACCCTTAATATTCAAAGATAGTGTCATGGTTACGGTTGCTAAGGGTGACAGCAGTGGTGAAGCCCTACCAATGCTTTTGAGAATCCCTCGCTTTTTTGACCCCTGGGGTGGTGTGAATATGATTGGCTTCGGGGACGTTCTGTTTCCTGGTTTGCTTATTGTATTTACTTACAGGTTTGACAAAGAAAATAAGAAGAGTGCGTTTAACGGATATTTTCCGTGGTTGTTAATTGGCTATGGAATTGGACTCGGTCTTACTTACCTGGGTTTGTATCTCATGAATGGCAACGGTCAGCCTGCACTCCTGTATCTTGTTCCATGTACACTAGGTGTTACAGTGATTTTGGGACTGATAAGGCACGAGCTGAAACAACTCTGGGATTACGGCGCAGAGGTATCTCCATCGAGCGTTGAACCATCCGTAGACGCCAGTAGATCGGTCTGA >Pbr031289.1.g ATGGATTTACACAGAGGTGTGTGGGTGGTGGTGGGAGTGCTGGTGGTTAGTCTGAGTCTGAGCTCAGCTGGGGACATTGTCCACCACGATAATATTGCTCCCAAGAGGCCTGGATGCGACAACAACTTCGTTCTGGTAAAGGTCCCAACTTGGATCAACGGCCTAGAAGACGCTGAGTATGTTGGTGTTGGTGCTCGATTTGGACCTACCTTGGAATCGAAGGAAAAACATGCCACCAACACTAGAGTGGTTCTTGCAGACCCCCCTGATTGTTGTAGCCTACCCAAGAAGAAGCTCACTAAAGAGGTCATTTTGGTGCACCGAGGAAATTGCAGTTTCACAACCAAGGCAAATATGGCTGAAGCTGCTAATGCTTCAGCCATCCTCATTATAAACAACCGCACAGAACTTTTCAAGATGGTTTGTGAAAATGATGAACCTGATGTCGAGATAGGCATACCAGCTGTTATGCTCCCCCAAGACGTTGGTGCAATCTTCGAAACTGATTTAAAGAACGGCTCCATGGTTTCTGTGCAGCTGTACTCTCCTTTGCGTCCACTGGTTGATATTGCAGAAGTTTTTTTGTGGCTTATGGCTGTTGGTACCATCTTGTTTGCTTCTTATTGGTCTGTGTGGAGTGCAAGAGAAGCAGCTATTGAGCATGAGAAGCTATTGAAGGATGCTTCCGATGATTCCTTACCTATCGAAGTTGATCGTTCCAATGCTTTAGTGGAGATTAGCACCACAGCAGCAATCCTCTTTGTTGTGATTGCTTCATGTTTCTTGTTTATGTTTTACAAACTCATGTCATTCTGGTTTGTGGAGATTCTGGTGGTTTTGTTTTGCATTGGTGGGATAGAGTTAACCAAATATAGTTTCAGACGGTTTAAACGTGCTGGAGAATCATATGTTAGGCTGCCAATCTTTGGAGCTGTTTCATATCTGACGCTAGCTGTTGCTCCCTTCTGCATAGCATTTGCTGTTTTGTGGGCAGTGTATCGCCGCATTTCATTTGCTTGGATCGGTCAAGATATCCTTGGTATTGCACTGATAATCACAGTTCTTCAGCTTGTTCGCATACCGAATCTCAAGGTTGGAACAGTTCTTCTGAGTTGTGCGTTTTTATACGACATCTTCTGGGTATTTGTTTCTAAATGGTGGTTCCATGAGAGCGTAATGATAGTGGTGGCTCGTGGTGATAAAAGTGGAGAGGACGGTATACCAATGCTACTGAAAATCCCACGGATGTTTGATCCCTGGGGTGGCTACAGCATCATCGGATTTGGTGATATTATCTTACCAGGATTGGTTGTAGCCTTTTCACTAAGGTACGATTGGTTAGCAAATAAGAAGCTCCGAGCTGGTTACTTTTTGTGGGCAATGACCGCATATGGTTTAGGTCTCCTTATCACGTATGTGGCTTTAAACTTGATGGACGGCCATGGCCAACCAGCTTTGTTGTATATAGTTCCGTTCACACTTGGTACCTTTTTGACTTTGGGACACATGAGAGGGGATCTCAAAGTTCTGTGGACAAGAGGGGAACCGGAGAGGCCATGCCCGCACGTCCATCTGCAACCCTCCTCTCAATAA >Pbr041342.1.g ATGGATTTGCAGAGGCTTTGTGGGTTGCTTTTTGTTTCAGCTTTGACTGTTCTACTGGTCGGTAATCCGAGCTATGTCACTGCCGGGGATATAGTGCACGATGACGATTCTGCTCCGAAGAAGCCCGGGTGCGAGAACAATTTCGTTTTGGTAAAAGTTCAAACTTGGATTGATGGAGTTGAGGCAAATGAGTTTGTTGGTGTGGGTGCTAGATTTGGAACTACGATTGTTTCAAAGGAGAAAAATGCACAGCAAACTCGCCTTGTTCTTTCTGATCCTCGCGATTGTTGCAGCAAACCAAAAAAGAAGCTTACTGGAGATGTCATCATGGTTGACCGAGGCCAATGCAAATTCACAACTAAGGCAAATATTGCCCAAGCTGCCAATGCTTCTGCTGTCCTCATTATAAATAACCAGAAAGAACTTTACAAGATGGTGTGTGAGCCAGATGAAACTGCTCTAGATATTCACATACCAACAGTCATGCTCCCACAGGATGCGGGTTCGACCTTGGAAAAGATGTTAATGAGCAATTCATTGGGTAAGGTTCTTTACCCTCAGGTGATTTCTAAGCTGCAAAAGTTTGTAACAGTTCTCTGGCTGTACTCTCCAAAGCGACCTGTAGTTGACATTGCAGAAGTATTTTTATGGTTGATGGCAGTCGGCACCATCTTGTGTGCATCCTTTTGGTCTGCATGGAGTGCCAGAGAAGCAGCTATTGAACATGAAAGGCTATTAAAGGATGCTGCTGATGAAATCCCACGTGCCAAAACTCCTTTAGGTGCTAGTGTAGTAGACATCAGCACAACGTCAGCAGTCTTGTTTGTTGTTATTGCTTCATGCTTCTTGGTTATACTGTACAAGCTTATGTCATCCTGGTTCGTCGTGCTTTTGGTGGTTCTTTTCTGCATAGGTGGTGTAGAGGGATTGCAAACTTGCTTGGTTGCATTGTTGTTGAGGTGGTTCAAACGTACCGGAGAATTGTACATTAAAGTACCTATCTTGGGAGCAGTCTCATACCTAACTTTGGCTGTTTCTCCGTTCTGCATAACATTTGCTGTTCTTTGGGGAGTTTATCGCAACCTTTCCTTTGCCTGGATTGGTCAAGATATACTTGGAATCGCATTGATAATCACAGTTCTTCAAATTGTTCGAATACCTAATCTGAAGGTGGGTACGGTCCTCCTCAGTTGTGCCTTCTTGTATGACATCTTTTGGGTGTTTGTTTCTAAGAAGTTGTTCCATGAAAGCGTGATGATTGTGGTAGCTCGTGGTGACAAAAGTGGAGAGGATGGTATTCCAATGCTACTAAAGATCCCACGCATGTTCGACCCATGGGGTGGTTTCAGCATCATAGGATTTGGTGACATCCTATTACCAGGCCTGCTTGTAGCATTCTCGCTCAGGTATGATTGGTTGGCAAATAAGACTCTCCGTTCTGGATACTTCATTTGGGCAATGATTGCTTATGGATTAGGTCTTCTCATCACATATGTGGCATTAAACTTGATGGATGGGCATGGCCAACCAGCACTTCTTTATATTGTTCCATTTACACTTGGCACTTTGCTGACATTAGGTAAGAAGAGAGGTGACTTACAGATTCTGTGGTCTAGAGGAGAGCCGGAATGGCCCTGCCCACATATTGAGCTTGAAGGTAGTCACGAAGTGAACGAATAA >Carubv10008675m.g AGTTTTTTTTTCCCTCTCTCTCTCTCTTGTTCCTTGTACCTTCCTCCATTTTTTTTTCTCCATCTTTCCTCTCTAATCTTTTTATCTTCTTCATCTTCTTCCTCCTATTTACGATTGTCTGTGGAGCCAGTTATGATCTTGTGGAAATCTCTCAGCTGTTTCTCGTTTGTTTTCGGGTTGTTGCTGTACAGTGCTAGTTTCGTTTCTGCTGGAGACATAGTTCACCACGATGATTCCCTCCCCCAGAGACCTGGCTGCAACAATAATTTCGTACTGGTGAAAGTCCCAACTCGAGTTAATGGGACGGAATCCATGGAGTTTGTTGGTGTTGGTGCTAGGTTTGGCCCAACATTGGAATCAAAGGAGAAGCATGCTACTCTCATCAAACTTGCTATTGCAGACCCTCCTGATTGTTGCACCACACCCAAAAACAAGCTTACAGGAGAGGTCATTCTTGTTCACCGTGGTAAATGCAGTTTTACCGCCAAAACTAAGATAGCTGAAGCAGCTGGTGCCTCAGCCATCCTTATAATAAACAACAGTACTGATCTTTTCAAGATGGTCTGCGAGAAGGGCGAAAATGTTTTAGATATAACTATTCCTGTTGTTATGCTGCCCGTTGATGCTGGTAGAAGTCTGGAGACCGTAGTCAAAACTAGTACAGTCACTCTGCAGCTCTACTCGCCGAAACGTCCAGCAGTTGATGTGGCTGAGGTCTTTCTATGGCTTATGGCTGTCGGTACCATTTTATGTGCTTCTTATTGGTCTGCGTGGACCGTCAAGGAAGAAGCTATTGAGCAAGACAAGCTGCTAAAGGACGGATCAGATGAACTTTTGCAGTTATCAACCACCAGTTCTAGAGGTGTTGTTGAGGTCACCGTGATATCAGCAATTTTGTTTGTAGTGGTTGCTTCTTGTTTCCTAATCATGCTCTACAAGCTTATGTCATTCTGGTTTATAGAGGTGTTGGTGGTACTCTTTTGCATAGGTGGCGTAGAGGGGCTGCAAACCTGTCTGGTCGCTTTACTCTCATGTTTCAGATGTTTCCGCCGCTTTGGAGAATCATATGTCAAAGTTCCTTTCCTGGGTGCTGTCTCATACTTGACGCTGGCTGTTTGTCCCTTTTGCCTAGCATTTGCTGTACTTTGGGCAGTTAAACGACAATACTCTTTTGCTTGGATAGGGCAAGATATACTTGGAATCTCACTAATAATCACGGTTCTTCAAATTGTTCGTGTACCAAATCTTAAGGTCGGGTTTGTTCTTCTCAGCTGTGCCTTCATGTATGACATCTTCTGGGTTTTTGTTTCGAAATGGTGGTTCCGTGAAAGCGTGATGATTGTTGTAGCACGTGGTGACAGAAGCGGAGAGGATGGAATCCCAATGCTACTAAAGATCCCACGTATGTTTGATCCCTGGGGTGGCTACAGCATCATTGGATTTGGTGATATAATCTTACCAGGACTGCTTGTAACTTTTGCACTGAGATACGACTGGCTGGCGAACAAGAGGCTGAAATCAGGATACTTCCTTGGGACAATGTCTGCTTATGGTCTAGGTCTTCTCATAACATACATAGCTCTAAACTTGATGGACGGACATGGGCAACCGGCTTTGCTTTACATTGTGCCATTCATACTCGGTACTTTGTTCGTGTTGGGTCACAAGAGAGGTGACCTGAAGACGCTATGGACAACAGGGGAACCAGAGAGGCCATGCCCTCACGTTCGCTTGCAACCTCAAGCGTCTTAA >Carubv10008828m.g ATGTCATTACCTCCGTTTAGCAGCCGTCTTCTCGCGGCGGCGGTTGCCCTCTATCTAATAGGTCTGTTTTGCGTGGGTGCTGACACGAAAGGTGATACCGCTCCGAAAATTCCTGGTTGTTCCAATGCGTTTCAATCGGTCAAAGTCGAGAATTGGGTTAACGGAGAAGAAGGTGAGAGTTTTACGGCCATGACTGCTCAGTTTGGTGCCATGCTTCCCTCTGATAAAGACAAAGCTGTTAAACTTCCGGTTTCTCTTACCACTCCTTTGACCAGTTGCTCCAATTTAACCTCAAAGCTATCTGGTTCTATTGCGTTATCTGTGCGTGGTGAATGTACTTTCACGGATAAGGCTGAAGTTGCGCAGGCAGGAGGAGCTGCAGCTTTGGTGTTAATAAACGATAAAGAAGAGCTGGAAGAGATGGTTTGTGATGAGAAAGATACTTCCTTGAATGTTTCTATACCTGTTTTGATGATTCCAACGTCATCTGGAGATGCACTGAGGAAATCCATTTTGCAAAATAAGAAAGTGGAGCTTTTATTGTATGCTCCAAAGAGCCCAATTTTGGATTATGCAGTGATCTTCCTCTGGCTCATGTCTGTTGGAACAGTTTTCATTGCTTCTGTTTGGTCACATGTCACCAGTCCTAAGAAGAATGATGAGCAATACAATGAATTATCACCCAAGAAATCTTCAAATGACGAGGCTAGCAAAGCTGCTGAAGACGAAACTCTTGATATCAGTGCTAAAGGTGCTGTTATCTTTGTCATATCAGCGTCCACATTCCTCATTTTGCTCTTCTTCTTCATGTCATCGTGGTTCATCTTGATCCTGACCATATTTTTCGTCATTGGTGGTATGCAGGGAATGCATATTATTATCACCACACTCATAAAAAGGAGATGCAACAAATCTGGCCAAAAGAATGTAAAACTCCCTCTGCTTGGGAATACCTCAATTCTCTCACTCGTGGTTCTGTTATTCTGCCTTGCGGTTGCTGTCGTCTGGTTTATCAAGCGCAAAGCTTCGTACGCATGGGCAGGCCAAGATCTTTTTGGTATTTGCATGATGATAAATGTCTTGCAAGTGGCTCGGCTACCTAATATCAGGGTTGCTACCATTCTTCTCTGTTGTGCATTTTTCTATGACATCTTTTGGGTATTCATATCACCACTAATTTTCAAGCAAAGTGTTATGATTGCGGTTGCACGTGGGAGCAAAGACACTGGAGAATCTATTCCCATGCTTTTGAGAATACCACGGCTTTCTGATCCATGGGGTGGTTACAACATGATCGGCTTTGGAGACATTCTTTTCCCAGGTCTTCTCGTATGCTTTATATTCAGATATGACAAGGAAAATAACAAAGGAGTCTTGAATGGATATTTCCCATGGTTAATGTTTGGGTACGGACTTGGCCTTTTCTTAACATACTTGGGATTGTATGTTATGAACGGACACGGACAACCTGCATTGCTCTATCTTGTCCCTTGCACGCTTGGAATCACGGTCATTCTGGGGTTGGTGAGGAAAGAACTCAGGGACTTGTGGAACTATGGGACTGAACAGCATTCAGCATTCAGCTGCAGA >Carubv10021480m.g ATGGATTCGTTTCGATTTCTCCGGATTCTTCTTCTATCATCTTCGATTCTACTCTTATCCCTCCCTTCTACGGTCACCGCCGGTGATATTGTTCATCAAGACGATTTAGCTCCCAAGAAACCTGGTTGCGAGAATGACTTCGTTTTGGTAAAAGTTCAAACGTGGGTTGATGGTGCTGAGAATGTGGAGTTTGTTGGGGTTGGAGCTAGATTTGGGAGGCGGATTGTGTCCAAGGAGAAGAATGCAAACCAGACACACCTTGTTTTTGCAAATCCTCGTGATTCTTGTACACCTCTCAAGAACAAGCTTTCTGGAGATGTTGTTATTGTGGAACGGGGAAACTGTAGGTTCACAGCAAAGGCAAATAATGCAGAAGCTGCTGGTGCCTCTGCTCTACTCATCATTAATAATCAGAAAGAACTTTACAAAATGGTTTGTGAACCGGATGAAACGGACTTAGATATACAGATTCCTGCTGTTATGCTCCCGCAAGATGCTGGCGCAAGCTTGCAAACGATGCTAGCCAATAGTTCAAAAGTGTCCGCACAGCTTTACTCCCCAAGACGACCAGCTGTTGACGTAGCTGAAGTTTTTTTGTGGCTAATGGCTATCGGTACCATTTTGTGTGCTTCTTATTGGTCTGCATGGAGCGCCCGAGAAGCAGCTATTGATCATGATAAACTACTGAAGGATGCTATAGATGAAATCCCTAACACAAATGATGGTGGTAGCGGTGTCGTAGAGATAAATACTATTTCAGCAATTTTTTTCGTAGTTCTTGCTTCGGGATTCCTTGTGATGCTTTACAAGCTTATGTCTTATTGGTTTGTGGAGCTTCTTGTGGTTGTTTTCTGCATTGGTGGTGTTGAGGGTTTGCAAACTTGCCTCGTTGCATTACTATCAAGATGGTTCCAACGTGCTGGAAATGCTTACATAAAAGTCCCTTTCCTTGGACCTATCTCTTACCTGACTCTTGCAGTATCTCCTTTCTGCATTGTCTTTGCTGTTCTCTGGGCTGTTTACCGAGTTACCTCCTTTGCTTGGATTGGGCAAGATGTTCTTGGTATCGCATTGATCATCACAGTACTACAGATTGTTCATGTCCCAAATCTAAAGGTTGGGACAGTTCTTCTCAGCTGTGCCTTCTTTTACGATATCTTCTGGGTGTTTGTTTCGAAGAAGTTGTTCCACGAAAGTGTAATGATTGTTGTAGCTCGTGGTGATAAGAGTGGAGAAGATGGCATCCCGATGTTACTGAAGATTCCGCGCATGTTCGATCCTTGGGGAGGCTACAGCATTATTGGATTTGGTGATATTCTTTTGCCTGGTTTGCTAATCGCATTTGCTCTCAGATATGATTGGTTAGCTAACAAGACTCTTAGAACCGGCTATTTTATATGGGCAATGGTTGCCTACGGATTAGGTCTTTTGATAACTTACGTGGCGCTAAACCTAATGGATGGACACGGCCAACCCGCACTGCTCTACATTGTCCCGTTTACACTCGGAACAATGTTAACGTTAGCTCGAAAACGAGGCGATCTTTGGATTCTATGGACAAAAGGAGAGCCAGAAAGGGCTTGTCCTCACCATGTCCGGCTTGAACAGTGCTCTGAGTGA >Carubv10022926m.g CTCTTTTTCTTCTTCTTCTTCACCTTCTCTCCGATTTGTTCCGTCGCTTCCGCCATGTCGTCGTATGATCCGCCGATTCACCGACACTCTGCCGTAGTATTGTTTCTCCTTCTGCTTGGTTTTTCTGTAGCGGCGGCCGACGATGTGTCCTGGACCGACGACTCCGGCGGCCTCGAGTCTCCTGGCTGTTCCAATAAGTTCCAAATGGTTAAGGTCTTAAATTGGATTGATGGGGTTAAAGGAGACTTCTATACTGGCTTAACTGCGCAATTTGGAGCACCGGTGCCTTCTGATGCTGATCATAGTGTCAGACTTCCGGCTGCTTTTGTAGATCCTTTGGACTCTTGTTCCAGTCTCTCGTCCAGGTTTGATGGACATATTGCCTTGTCTATCCGTGGCAATTGCGCTTTCACAGAGAAAGCAAAACATGCTGAGGCAGCTGGTGCTTCTGCTCTGTTGGTTATTAATGACAAAGAAGATCTTGATGAGATGGGGTGTATGGAAAAGGACACCTCTCTAAATGTGAGCATACCTGTCTTAATGATCTCTAAGTCAAGCGGGGATGCTCTCAACAAATCTATGGTAGAAAAAAAGATAGTTGAGCTTTTGTTGTATGCTCCAAAGCGTCCTGTCGTGGACCTGACAGCTGGATTGTTATTGCTCATGGCTGTTGGAACTGTTGTTGTTGCATCACTATGGTCAGATCTTACAGATCCTGACCAAGCTAATGAATCTTACAGCATATTAGCGAAGGAATTTTCTAGTGCTGGGACCAAAAAAGATGACCCAGAGAAGGAAATCCTTGATATAAGTGTCACTGGTGCTGTATTTTTTATTGTGACAGCCTCAATTTTTCTGCTGCTCCTTTTCTACTTCATGTCATCATGGTTTGTATGGGTGCTCACCATATTTTTCTGCATCGGCGGCATGCAGGGTATGCATAACATTATTACGGCAGTTATATTGAGAACATGTAGAAATCTTGGTCGGAAATCGGTGAATCTCCCTTTGCTTGGGACAATGTCAGTGATGTCGCTTTTAGTGAACATTTTCTGTTTGGCATTTGCTGTTTTCTGGTTCGTAAAACGGCACACATCGTATTCTTGGGTTGGCCAAGATATTTTGGGCATATGTTTGATGATCACGGCCTTGCAAGTGGTTCGATTACCTAACATCAAGGTTGCTACTGTACTTCTTTGCTGCGCGTTTGTCTATGACATTTTCTGGGTCTTCATATCACCACTGATTTTTCACGAAAGCGTTATGATTGTGGTTGCCCAAGGAGACAGCAGCAGTGGGGAGTCCATTCCAATGCTACTAAGGATTCCTCGGTTCTTTGACCCTTGGGGAGGGTATGACATGATTGGTTTTGGGGACATCCTCTTCCCCGGTTTGCTCATTTCCTTTGCTTCCAGATATGACAAGATAAAAAAGAGGGTAGTATTAAATGGGTACTTCCTTTGGTTGACTATCGGCTATGGAATAGGTCTGTTACTGACATATCTAGGTCTGTATCTTATGGACGGACATGGCCAGCCTGCGCTATTATACATTGTTCCCTGTACACTCGGTTTGGCCGTCATACTGGGGTTGGTAAGAGGTGAGCTTAAAGAACTATGGAATTACGGTATCGAAGAATCAGAATCTCACACACTGGAGGATCCAAGGCCTGCGGCATAA >Prupe.1G180000 ATGGCGTCGGGTCTCCTCCGCCTTGTGTTATTGGTATCTCTGATTGCTCTGTCTTTGGCCCGTGGTGGAAACGACATGGTTTTGGACACCGATTCCACCCCCAAAACTCCCTCCTGTAACAACCCTTACCTAATGGCAAAGGTTAGGAATTGGGTTAATGGCCGTGAAGCCGAAACTTTTGAAGGGGCTGGTGCAAAGTTTGGGGCTTTATTGCCTTCCGAAAAAGAAAACGCCGTCAAATTGCCTGTTGTTATCTCCAATCCCTTGAATGGCTGTAACGCATCATCTTCAAAGTTATCTGGCGCTATTGCCTTGTCTGCCCGTGGCGATTGTGAGTTCTCCGTAAAGGCAAAAGTTGCACAGTCAGGAGGTGCTAAAGCGCTGGTGGTGATAAATGATGACGAAGGTCTTGCCAAGATGGCTTGTCCTGAGGATAGCACTTCTTTGAACATTTCGATTTTTGTTGTGATGATTCCAAAGTCAAATGGAGAATCTCTCAAGAATTCTATTCAAGATGGAAAGAAAGTGGAGCTTCTATTATATTCCCCCAAGCGTCCAGTGGTGGACTTCTCAGTTGTGTTCTTGTGGCTAATGGCTGTGGGAACAATAATAGTTGCCTCATTTTGGTCAAAGATTACTGCTCCTGAGAAGTCTGATGAGCGCTATAATGAACTGGCAGAAAAGGAATCTAATACTGGAACAGCGAAAGATGATTCTGAGGATGAAGTCATGAATCTTAGCGTGAAGGGTGCTGTGTGTTTTGTCATAACAGCATCCGTTTTTCTGTTGCTACTATATTTCTTTATGTCTACGTGGTTTGTCTGGGTGCTGATCGTACTTTTCTGCATTGGCGGTATTGAGGGAATGCATAATTGTCTATTAAGCCTGATTTTGAGAACATGGAGAAGTGGTGGACGGAAGACAATAACTTTGCCTCTCCTGGATGAGGTGTCGATTCTCTCACTTGTTGTGCTGGCTTTGTGTGTGGGGTTTGCAGTTTTCTGGGTTGTAACACGACGGGCATCATATTCGTGGGTTGGCCAAGATGTTCTTGGTATCTGCTTGATGATAACAGTCTTGCAAATTGCTCGATTACCTAATATCAAGGTTGCTACCGTACTACTTTGTTGTGCATTTGTCTACGACATCTTTTGGGTATTCCTGTCACCCTTAATGTTCAAAGATAGCGTCATGGTTGTGGTTGCTAAAGGTGACAATAGTGGTGAAGGCCTACCAATGCTCTTGAGAATCCCTCGCTTTTTTGACCCCTGGGGTGGTCAGAACATGCTTGGCTTTGGGGATGTTCTGTTTCCGGGTTTGCTTATTGTATTTTCTTACAGGTTTGACAAAGAAAATAAGAAGCATGGAATTAGCGGATATTTCCTTTGGTTGGTAACTGGCTATGGAATCGGACTTGGTTTTACGTACCTGGGTTTATACCTCATGAACGGGAATGGTCAGCCTGCTCTCCTATATCTTGTTCCATGTACACTAGGTGTTACGGTGTTTTTGGGACTGATAAGGCGTGAGCTAAAACAACTTTGGGATTATGGCACGGAGCCAGAGGTATCGCGAAGTACCGTTGAGCCTGCTGTAGAAGGCACTAGATCAGTCTGA >Prupe.2G171000 ATGAATTTACGGAGAGGCGTGTGGGTAGTGGTTGGTGTGTTGGTCCTGAGTCTGAGTTTGAGCTCAGCTGGAGACATTGTTCACCATGATAATATTGCTCCGAAGAGGCCTGGTTGTGAAAACAACTTCGTTCTGGTTAAGGTCCCAACTTGGGTCAATGGTGTAGAAGACAGTGAGTATGTTGGTGTTGGTGCTCGATTTGGACCTACCTTGGAATCAAAGGAAAAACATGCCACCAATATGAGAGTGGTTCTCGCAGACCCCCCTGACTGTTGTAGCACACCTAATAATAAGCTTTCACAAGATGTCATTTTGGTGCACCGAGGAAACTGCAGTTTCACAAGGAAGGCAAATATTGCTGAAGCTGCTAATGCTTCAGCCATCCTCATTATAAACAACCGTACAGAACTTTTCAAGATGGTTTGTGAAGACGATGAACCTGATGTTCAGATAGGCATACCAGCTGTTATGCTTCCTCAAGATGTTGGTGCAATCTTAGAAAATGATTTAATGAACAAATCCAAAGTTTCTGTGCAGCTGTACTCTCCATTGCGTCCAGTGGTCGATATTGCAGAAGTGTTTTTGTGGCTTATGGCTGTTGGTACCATCATATTTGCTTCTTATTGGTCTGCATGGAGTGCAAGAGAAGCAGCTATTGAGCATGACAAACTATTAAAGGATGCCTCTGATGATTCTTTGCATATGGAAGTTGATCGTTCCAATGCTTTAGTGGAGATTAGCACCACGGCAGCAGTCCTGTTTGTTGTGATTGCTTCATGCTTCTTGGTTATGTTTTACAAACTTATGTCATTCTGGTTTGTGGAGATTCTGGTGGTTTTGTTTTGCATTGGTGGGATAGAGGGCCTGCAGACTTGTTTGGTGACTTTGCTATCATGTTTCAGACGATTTAAACGTGCTGGAGAATCATATGTTAAAGTGCCCTTCTTTGGAGCTGTTTCATATCTGACGCTAGCCGTTGCTCCCTTCTGCATAGCATTTGCTGTTGTTTGGGCAGTGTATCGCCGCGTCTCATTTGCTTGGATAGGTCAAGATATCCTTGGTATTGCACTGATAATCACAGTTCTTCAGATTGTTCGAGTACCAAATCTCAAGGTTGGAACAATTCTTCTCAGTTGTGCCTTTTTATATGATATCTTCTGGGTATTTGTTTCTAAATGGTGGTTCCATGAGAGTGTAATGATAGTGGTGGCTCGTGGTGATAAAAGTGGAGAGGATGGTATACCAATGCTACTGAAAATTCCACGGTTGTTTGATCCTTGGGGTGGCTACAGCATCATCGGATTCGGTGATATCATCATACCAGGATTGGTTGTAGCCTTTTCACTAAGGTATGATTGGTTGGCAAATAAGAAGCTTCGAGCTGGTTACTTTGTGTGGGCAATGACCGCTTATGGTTTAGGTCTCCTCATCACATATGTGGCTTTGAACTTGATGGACGGTCATGGCCAACCTGCTTTGTTGTACATAGTTCCCTTCACACTCGGTACTCTACTGACTTTGGCACAGATGAGAGGGGACCTTAAAGTTCTGTGGACAAGAGGAGAACCAGAGAGGCCATGCCCGCACGTCCATCTCCAACCCTCTCAATAG >Prupe.5G101300 ATGGATTTGCAGAGGCTGTGTGGGTTAGTGTTTGTGTCAGCTCTGATTCTACTGGTCTCTGAGCCTAGCTCTGTGACAGCTGGGGATATAGTGCATGATGACGATTCAGCTCCAAAGAAGCCTGGGTGTGAGAACAATTTCGTTTTGGTAAAAGTTCAAACTTGGGTTGATGGTGTAGAGGCAAATGAGTTTGTTGGCGTGGGTGCTAGATTTGGAACTACCATTGAATCAAAGGAGAAAAAAGCACAGCAAACTCGCCTTATTCTTTCAAATCCTCGTGATTGTTGTAACAAACCAAAGAATAAGCTTGCTGGAGATGTCATCATGGTGGACCGAGGCCACTGCAAATTCACAACTAAAGCAAATATTGCCCAAGAAGCTAATGCCTCCGCTGTACTCATTGTAAATAACCAGAAAGAACTTTACAAGATGGTGTGTGAGCCAGATGAAACTGCTTTAGATATACACATACCAGCTGTCATGCTCCCGCAGGATGCAGGTGCTACCTTGGAAAAGATGTTAATGAATAATTCATTGGTTTCTGTGCAGTTGTACTCACCGCAACGACCTGTTGTTGACATTGCGGAAGTATTTTTATGGTTGATGGCTGTCGGTACTATCTTGTGTGCATCTTATTGGTCTGCATGGAGTGCCAGAGAAGCATCTATTGAACAGGACAAGCTATTAAAGGATGCTTCTGATGAAATTCCAAGTGCCAAAGCTCCTTTAGGTGCCAGCGTAGTAGACATCAGCACAACATCAGCTGTCTTGTTTGTTATTATTGCTTCATGCTTCTTGGTTATACTCTACAAGCTTATGTCAGGCTGGTTTGTCGAGCTTTTGGTGGTTCTTTTTTGCATAGGTGGTGTAGAGGGTTTGCAAACTTGCTTGGTTGCGTTGTTATCGAGGTGGTTCAAACGTACTGGGGAATCATACATTAAAGTACCTATCTTGGGAGCAGTCTCATACCTTACTTTGGCTGTTTCTCCGTTCTGCATAGCATTTGCTGTTCTTTGGGCAGTTTTTCGCAACATTTCCTTTGCCTGGATTGGTCAAGATATACTTGGAATTGCACTGATAATCACAGTTCTTCAAATTGTTCGGATACCTAATCTCAAGGTAGGTACGGTCCTCCTCAGTTGTGCCTTCTTGTATGACATCTTTTGGGTGTTTGTTTCTAAGAAGTTGTTCCATGAAAGCGTGATGATTGTGGTAGCCCGTGGTGACAGAAGTGGAGAGGATGGTATTCCAATGCTACTAAAGATTCCACGCATGTTTGACCCTTGGGGTGGTTTCAGCATCATAGGATTCGGTGACATCCTCTTACCAGGCCTGCTTGTGGCATTCTCGCTCAGGTATGATTGGTTGGCAAATAAGGCACTTCGGGCTGGATACTTCTTATGGGCAATGATGGCTTATGGATTGGGTCTTCTCATCACATATGTGGCATTAAACTTGATGGATGGGCATGGCCAACCGGCACTGCTTTACATTGTTCCATTCACACTTGGAACTTTTCTGACATTAGGGAAGAAGAGAGGTGACTTACAGATTCTGTGGTGTAGAGGAGAACCAGAAAGGCCCTGCTCACATATTGAACTCGAACAGAGTCAAGAATTGGACGAAACAAAAAAAAGTAAGACAGCCTGTTCTTGTATGATATTTGTAGTGTTGGCATTTTATAATCATTAG >Manes.01G059500 ATGGATTTGGAGAAGCTCTATTTAGTTATCTCTGTTGCAATTGTGATTTCGTTGGTCTCTTATCCGTCTTCCGTTACAGCTGGGGACATAGTTCATGACGATGATTCTGCTCCCAAAAAGCCTGGATGCGAGAACGACTTCGTCTTGGTAAAAGTCCAAACTTGGATCAATGGTATAGAGGATGCTGAATTTGTTGGCGTGGGTGCTAGATTTGGCACCACCATTGTATCAAAGGAGAAAAATGCTAATCAAACTCGCCTCACTCTTTCAGATCCTCGAGATTGTTGTACTCCTCCCAAGAAAAAGCTTGATAGGGATATCATTATGGTTGATCGAGGCAAGTGCAAATTCACGACCAAAGCAAACAATGCAGAAGCTGCCGGTGCTTCTGCTGTCCTTATAATAAATAACCAAAAAGAACTTTACAAGATGGTTTGTGAGCCCGATGAAACTGATCTTGACATAAAAATACCTGCTGTTATGCTACCACAAGATGCTGGTGCAAGCTTGGAAAAAATGTTGTTGAATAGTTCATCAGTGTCTGTGCAGCTATACTCTCCAAAGCGACCACTAGTTGATATAGCCGAAGTATTTTTGTGGCTGATGGCAGTTGTTACCATCTTGTGTGCATCTTACTGGTCTGCATGGAGTGCTAGAGAAGCAGCTATTGAACATGACAAGCTATTGAAGGATGCTGTAGATGAAATTCCAAATGACAAAGTCGTGGGTGTTAGTAGCATCGTAGACATCAACACAACATCAGCTGTCCTGTTTGTTGTTGTCGCTTCATGCTTCTTGGTCATGCTTTACAAACTTATGTCATACTGGTTTGTTGAGCTTTTGGTGGTTCTTTTTTGCATAGGCGGGGTTGAGGGCTTGCAAACCTGTCTAGTTGCTTTATTATCAAGGTGGTTCAAGCATGCAGGGGAATCGTACATTAAAATACCTTTCTTTGGACCTGTTTCACAACTAACATTGGCTGTTTCACCATTCTGCATAACATTTGCTGTTGTTTGGGCTGTCTATCGCAATGTCTCCTTTGCCTGGATCGGCCAAGATATACTAGGAATTGCACTGATAATCACTGTTCTGCAAATTGTCCATGTACCTAACCTCAAGGTGGGAACAGTTCTTCTTAGTTGTGCATTCTTGTATGACATCTTCTGGGTGTTCGTTTCTAAGAAGTTGTTCCATGAAAGTGTCATGATTGTGGTGGCTCGTGGCGATAGAAGTGGAGAAGATGGTATACCCATGTTGTTAAAGATCCCTCGAATGTTTGATCCCTGGGGTGGTTACAGCATTATAGGATTTGGCGACATCCTTCTACCTGGACTGGTGATAGCATTCTCACTCAGGTATGATTGGTTGGCAAGTAAGTCTCTTCGAGCTGGATACTTCTTGTGGGCAATGATGGCTTATGGATTAGGTCTTCTCATCACATATGTGGCCCTTAACTTGATGGATGGCCATGGCCAACCTGCATTGCTCTACATTGTCCCATTCACTCTTGGAACCTTTCTGACATTGGGAAAGAAAAGAGGTGATCTCAACATTTTATGGACAAAAGGAGAACCAGAAAGAGCTTGCCCCCATGTCCATCTTGAACACTCTCATGAACTGAACATGGAAAAGTAA >Manes.01G256100 ATGGGTATTCATGGACCTCTGTTTATGATTGTAGCTGTTTTAGCTTTAACTCCATGGTTCGCCTCTGCTGGAGATATAGTACATCACGATGATGTAGCTCCCAAAAGGCCTGGTTGCGATAATAACTTCGTTCTGGTGAAAGTCCCTGCTTGGGTTGATGGTGTAGAAGATATCGAGTATGTTGGTGTTGGTGCTCGATTTGGTCTTACGTTGGAATCAAAAGAAAAACATGCCAATAAAACTAGACTCGTTTTGGCAGACCCACCTGATCTTTGCAGGCCACCCAAATATAAGCTTAACAGAGATGTCATTCTGGTGCACCGAGGTAATTGCAGCTTCACAACTAAGTCAAATATTGCTGAAGAGGCTAATGCTTCGGCTATTCTTATAATAAACAATCGAACAGAACTTTTTAAAATGGTTTGTGAAGCAAATGAAACTGATGTAAGCATCGGCATTCCTGCTGTCATGCTTCCACAAGATGCTGGTGCCAGCCTGGAAAATTACATCAAGAATAGCTCAACAGTTTCTGTGCAGCTATATTCTCCACAACGGCCACTTGTTGATGTTGCAGAAGTGTTTTTGTGGCTCATGGCTGTTGGTACCATCTTGGGTGCTTCTTACTGGTCTGCATGGAGTGCCAGAGAAGTGGCCATAGAGCAGGACAAGCTTCTAAAGGATGGTTCAGATGATATTATGCAGACAGAAGGTGTTACATCTAGTGTTGTTAACATCAACACAACATCTGCCATTCTCTTTGTTGTGATTGCTTCATGTTTCTTGGTCATGCTTTACAAACTTATGTCACTGTGGTTTATGGATGTTCTGGTGGTTCTCTTCTGCATTGGTGGGATAGAGGGCTTGCAAACTTGCTTGGTAGCTTTATTATCATGTTTCAGATGCTTTCAACATGCTGGAGAATCATTTATTAAAGTTCCCTTCTTTGGAGCTGTATCATTTTTGACCCTGGCTGTCTCTCCATTTTGCGTAGCATTTGCTGTTGTTTGGGCAGTTTACCGTCGTGTCTCCTTTGCCTGGATAGGTCAAGATATCCTTGGCATTGCACTAATCGTCACTGTTCTTCAGATTGTTCATATACCAAATCTCAAGGTTGGAACAGTTCTTCTAAGTTGCGCTTTCTTGTATGACATCTTCTGGGTATTTGTTTCCAAATTGTGGTTCAAGGAGAGTGTGATGATAGTGGTAGCTCGTGGTGATAGGAGTGGAGAGGATGGTATACCAATGCTACTGAAAATCCCTCGTATGTTTGATCCTTGGGGTGGCTATAGCATTATCGGATTTGGTGATATCATCTTACCAGGATTGCTTGTTGCTTTTGCATTAAGATATGATTGGCTGACAAAGAAGAATCTCCGAGCAGGATATTTTCTGTGGGCAATGACTGCCTATGGTTTAGGTCTCCTAATCACTTATATAGCTTTGAACATGATGGATGGCCATGGCCAGCCAGCGCTGCTCTACATTGTTCCCTTCACACTTGGCACCTTCTTGACGCTGGGAAAGAAGAGAGGAGATCTCAAGGCTCTATGGGCACCCGAGCGACTTTGCCCACACGTCCAGTTTCAGCCCTCACAATCTCAATAA >Manes.02G020000 ATGGATTTGAAGAAGTTCTGCTTGCTAATCTCTGTTGCGGCTGTGATTTCGTTGGTCTGTTACCCGCCTTCTGTTACAGCTGGGGACATAGTGCATGACGATGATTCATCTCCCAAAAAGCCTGGCTGCGAGAACGACTTCATCCTGCTTGATAGGGATGTCATTATGGTTGATCGAGGCAAGTGCAAATTCACAACCAAAACAAATAATGCAGAAGCTGCCGGTGCTTCTGCTGTCCTTATAATAAATAACCAAAAAGAACTTTACAAGATGGTTTGTGAGCCAGATGAAACTGATCTTGACATAAAAATACCTGCTGTTATGCTCCCACAAGATGCTGGTGCAAGCTTGGAAAAAATGCTACTGAATAGCTCATCTGTGTCTGTGCAGCTTTACTCTCCGAACCGGCCACTAGTTGATATAGCCGAAGTATTCTTGTGGCTGACAGCAGTTGTTACAATATTGTGTGCATCTTACTGGTCTGCATGGAGTACCAGAGAAGCAACTATTGAACATGACAAGCTATTGAAGGATGCTGTGGATGAAATTCCAAATTCCAAGGTCATTGGTGTTAGTAGTGTTGTAGACATCAACACAACATCAGCTGTCCTGTTTGTTGTTGTCGCTTCATGCTTCTTGGTCATGCTTTACAAACTTATGTCATACTGGTTTGTTGAGCTTTTGGTGGTTCTTTTCTGCGTAGGTGGGGTCGAGGGCTTGCAAACCTGCCTAGTTGCTTTATTATCAAGGGAATTGCATTGA >Manes.05G033700 ATGGGTATTTATGGACCTCTGCATATAATAGTAGCTGTATTAGCTTTATCTCCATGTTTCGCCTCTGCTGGAGACATAGTACATCAAGACGATGTAGCTCCCAAGAGGCCTGGCTGCGATAATAACTTTGTTCTGGTAAAAGTCCCTACTTGGGTTGATGGTGTTGAAGATATCGAGTATGTTGGTGTTGGTGCCCGCTTTGGTCCTACTCTGGAATCAAAAGAAAAACATGCCAACAAAACTAGACTCGTTTTGGCAGACCCTCCTGATCTTTGCAGGCCACACAAAAATAAGCTTAACAGAGAAGTCATTCTGGTGCATCGAGGTAATTGCAGTTTCACAACCAAGTCAAATATTGCTGATGGGGCTAATGCTTCAGCTATTCTTATAATAAACAACCGAACAGAACTTTTTAAAATGGTCTGTGAAGCAAATGAAACAGATGTAAACATAGGCATTCCTGCAATCATGCTTCCACAGGATGCTGGTGCTAGCTTGGAAAATTTTATAAAGACCAGCTCCACAGTTTCTGTGCAGCTATATTCTCCACAACGCCCGCTTGTTGATGTTGCAGAAGTGTTCTTGTGGCTCATGGCTGTTGGTACCATCTTAGCTGCTTCTTATTGGTCTGCATGGAGTGCCAGAGAAGTGGCTATAGAGCAGGATAAGCTTTTAAAGGATGGTTCAGATGATTTTACACATACAGAAAATGTTGCATCTAGTGGTGTTGTTAACATCAACACAACATCTGCTATTCTCTTTGTTGTGATTGCTTCATGTTTCTTGGTCATGCTTTACAAACTTATGTCATTATGGTTTATGGATGTTCTGGTGGTTCTGTTCTGCATTGGTGGGATAGAGGGCTTGCAAACTTGCTTGGTAGCTTTGTTATCATGTTTCAGATGCTTTCAACATGCCGGAGAATCATTTGTTAAAGTTCCCTTCTTTGGAGCTGTATCGTATTTGACCTTGGCGGTCTCTCCTTTTTGCATAGCATTTGCTGTTGTTTGGGCAGTTTACCGTCGTGTCTCCTTTGCCTGGATAGGTCAAGATATCCTTGGCATTGCACTAATAATCACAGTCCTTCAGATTGTTCATATACCAAATCTCAAGGTTGGAACAGTTCTTCTCAGTTGTGCATTCTTATATGACATCTTCTGGGTGTTTGTCTCCAAATTGTGGTTCAAGGAGAGTGTGATGATAGTGGTTGCTCGTGGTGATAAGAGTGGAGAGGATGGTATACCAATGCTATTGAAAATACCTCGGATGTTTGATCCTTGGGGTGGCTATAGCATTATTGGGTTTGGTGATATCATCTTACCAGGCTTGCTCGTAGCTTTTGCATTAAGATATGATTGGCTGACAAATAAGAATCTCCGATCAGGTTACTTTCTGTGGGCAATGACTGCTTACGGTTTAGGTCTCCTGATCACTTACATAGCATTGAACATGATGGATGGGCATGGCCAGCCGGCATTGCTCTACATTGTTCCATTCACACTTGGCACCTTCTTGACACTGGGAAAGAAGAGAGGTGAACTCAAAGCTCTATGGAGAAGAGGAGCACCCGAGAGGCCCTGCCCACACGTGCAGTTTCAGCCCTCTCAATCTCAATAA >Manes.06G032400 ATGGATTTGGAGAAGCTCTATTTAGTTATCTCTGTTACAATTGTGATTTCGTTGGTCTCTTATCCGTCTTCCGTTACAGCTGGGGACATAGTTCATGACGATGATTCAGCTCCCAAAAAGCCTGGATGCGAGAACGACTTCGTCTTAGTAAAAGTCCAAACTTGGATCAATGGTATAGAGGATGCTGAATTTGTTGGCGTGGGTGCTAGATTTGGCACCACCATTGTATCAAAGGAGAAAAATGCTAATCAAACTCGCTTCACTCTTTCAGATCCTCGAGATTGTTGTACTCCTCCCAAGAAAAAGCTTGATAGGGATATCATTATGGTTGATCGAGGCAAGTGCAAATTCACAACCAAAGCAAACAATGCAGAAGCTGCCGGTGCTTCTGCTGTCCTTATAATAAATAACCAAAAAGAACTTTACAAAATGGTTTGTGAGCCCAATGAAACTGATCTTGACATAAAAATACCTGCTGTTATGCTACCACAAGATGCTGGTGCAAGCTTGGAAAAAATGCTGTTGAATAGTTCATCAGGAACCTTTCTGACATTGGGAAAGAAAAGAGGTGATCTCAACATTTTATGGACAAAAGGAGAACCAGAAAGAGCTTGCCCCCATGTCCATCTTGAACACTCTCATGAACTGAACATGGAAAAACCAAAACCAGCTGATAGTTCAAATGCGTGA >Manes.11G113700 ATGGCGATTTCTTCACGATCTATCTCTTTTTTGGGCGTCCTCTTATTCGTTTCTTTCTTCCTTCTCATCGGTCTCTCTTTTGCCGATGATGCCTCCCACGATGATGCTTCCCCCAAGTCTCCCGGCTGTGATCGGCCTTACAAATTGGTCAAGGTTGTGAACTGGGTTAATGGTGTTGAAGGTGAAACTTTATCTGGATTATCTGCAAGATTTGGGGCTGTGTTGCCTTTGGAGGCTGAAAAAGGTCTTAGATTGTCTGCTGTTTTCTTAAATCCCTTAACAGGCTGTTCTAGTTCCTCGTCAAAGCTTTCTGGCTCTATTGCAGTGTCCATACGTGGTGATTGTACCTACACTGCAAAAGCAGAAGTTGCACAATCAGGAGGTGCACAAGCTCTTCTTGTGATAAATGACAAAGAAGCGCTTGCTGAGATGGGTTGTGATAAGGACAGTGGTGCCTCGAATATTAAAATTCCTGTTGTGATGATTTCAAAGTCAGCAGGCGAATATCTGAAAGAGTCGATGGTGGGTGGACAGAAAGTGGAAATCAAACTATATGCACCTACTCGTCCTGTTGTGGATTTTTCAGTGGTATTTTTATGGTTGATGTCGGTTGGAACAGTGATCAGTGCTACGCTTTGGTCAGAGTTTACTGCTACTGAAGAGAGTGATAAGCACTATAATGAATTATCATCAAAGGGAAATTCTTCTGCAGTCAAAGAAGAAGAGCAAGAGCACATTGATATTACTGCAAAGAGTGCTGTAGGTTTTGTCTTCACAGCATCAACTTTTCTTGTGCTACTCTACTTTTTTATGTCAAGTTGGTTTGTCTGGCTGCTGATTATACTCTTCTGCCTTGGTGGTGTTCAGGGTATGCATAATTGTATAGTAACTTTGATTGCAAGAAGGTGCAGAGATTGTGTGGAAAAGAAAGTAAATTTACCTCTTCTAGGGGAAACTTCTATTGTTTCGCTTGTTGTATGTTGTTGTTGTCTGGCATTTGCTATTGTCTGGATTGTGAATCGGCGGACATCATATTCGTGGATTGGGCAAGATATTCTTGGTATCTGCTTGATGATAACTGTCTTACAGGTGGCTCGATTGCCTAATATTAAGGTTGCTGCTGTACTTTTATGTTGCGCCTTTGTTTATGACATCTTTTGGGTCTTCCTATCCCCAATAATTTTCCACCAGAGTGTTATGATTGCTGTGGCTCGAGGTGACAACAGTGGTGGGGAATCCATTCCAATGCTTTTGAGAGTTCCTCGATTCAGCGATCCTTGGGGGGGTTATAACATGATTGGATTTGGAGACATTCTTTTTCCTGGTTTGCTTGTATCATTTACTCGGAGATATGACAAAGCAAATAAGAAGAGCGGGACCAATGGATATTTTCCTTGGTTGGTAATTGGCTATGGATTTGGTCTTTTCCTAACATACTTAGGTTTATATCTAATGGATGGGCATGGTCAACCTGCACTCCTCTATCTTGTTCCCTGTACCCTAGGTGTATGTGTGATATTCGGTCTGGTGAGAGGAGAGATAAAAGAACTCTGGAGTTTTGATCCAGAATCTTCTTCATCATCGTCGTCATCATCATCAGCTACAAGAAATGCTCCTGGGGATGCTTGA >Solyc08g081180.2 ATGGATTTTCTGAGAATTACTTCTGTAATTTTCATCTGTGGAGTTCTACTGAACTTTCCTGCTATAGTTACAGCTGGTGATATAGTTCATGATGATGACTTAGCTCCCAAGAAGCCTGGTTGTGAGAATGATTTTGTGCTGGTGAAAGTTCAAACTTGGATTAATGGGGAAGAAGATGCAGAGTTTGTTGGTGTTGGTGCTAGATTTGGCACTACTATTGTGTCAAAGGAGAAAAATGCACAACAAACTCCGCTTACTCTTTCTGACCCTCGAGATTGTTGTAAGCCTCCAAGGAAAAAGCTTTCTGGAGAAGTCGTCATGGTAGATCGCGGCCATTGCAAATTCACAACGAAGGCTAATAATGCTGAAGCAGCAGGGGCTTCGGCAATCCTGATAGTAAATAATCAAAAAGAACTCTACAAGATGGTTTGTGATCCTGGAGAAACTGACCTAGATATACACATTCCTGCTGTTATGCTACCTCAGGATGCTGGAATAACGCTTAATAAAATGCTTTTAAATGGCTCATCAGTTACTGTGCAACTCTATTCTCCAAAACGACCAGTAGTGGACATTGCAGAAGTATTTTTGTGGCTGATGGCTGTTGGTACAATCTTGTGTGGTTCTTATTGGTCTGCTTGGAGTGCTAGAGAAGCAGCTATAGAGCAGGACAAGCTGTTGAAGGATGCTTCAGAGGAAGAGCTTCCAAAATTTGGAACTGGTGATTCAAGCACTGTGATGGATATAAACATGATATCAGCAGTCTTATTTGTTGTTGTTGCTTCTTGCTTCTTGTTTGTTTTGTACAAGTTAATGAGGTTCACATGGTTCTTTGAAATCTTAGTGGTTCTCTTCTGCATCGGTGGTGTGGAGGGGCTACAAACTTGCTTAGTTGCCTTGCTAGCTAGGTGGTTTAAGCCTACGGGAGAGTCATACATTAAAGTACCCATTTTTGGTGCAGTTTCTTATCTTACTTTGGCTGTTTCGCCATTCTGCATAACTTTTGCAGTGGTTTGGGCAATGTACAGAAATTCTTCTTTTGGCTGGATAGGTCAAGACATACTTGGCATTGCACTTATAATTACAGTTCTGCAAATTGTGCGGATACCTAATCTCAAGGTTGGTTCAGTTCTTTTGGGTTGCGCCTTCATCTACGACATATTTTGGGTATTTGCTTCTCAGAGTCTCTTCCATGAAAGTGTGATGATTGTGGTAGCTCGTGGTGATAAAAGTGGAGAAGATGGTATTCCAATGCTGCTGAAGATTCCACGACTATTTGATCCATGGGGTGGTTACAGCATTATCGGCTTTGGTGACATCCTATTGCCTGGACTGCTAGTAGCATTTTCACTTAGGTATGATTGGCTTGCAAAGAAGAATCTTCGAGCTGGTTACTTCTTGTGGGCAATGATTGCATATGGATTAGGTCTTCTTATAACATATGTAGCATTGAACTTAATGGATGGTCATGGCCAACCTGCACTTCTTTACATCGTCCCATTTACCCTCGGGACCTTTTTGATGCTGGGGAGAAAGAGAGGTGACCTGAAAATTCTTTGGACAAAGGGTGAACCAGAAAGGGTGTGTCCACATGTTCGTCTCGAATCAATCGAGGAATCGAATCGAGAAGGATAA >Solyc09g098200.2 ATGTCTACGTGGTTTGTCTGGCTGCTGATATTGCTTTTCTGTCTCGGTGGAATCGAGGGACTGCATAACTGTATAGTGACGCTCATACTAAGCAAATTTAGAGGCTGTGGAAAGAAAACATTGAATTTGCCGCTTGTTGGGGAGGTCGCTATTCTGTCTCTAGTTGTCTTAACACTTTGTGTGGGATTCGCCATCTTCTGGGCAGTAAACAGGAAAGAATCATACTCTTGGGTTGGCCAAGACATTCTTGGGATTGCTTTGATGATCACTGTTCTGCAGATGGCTCAATTGCCTAATATAAAGGTTGCTACAGTGCTTCTCAGCTGCGCGTTTGTCTATGACATCTTCTGGGTTTTCCTATCTCCTACTATATTCCATGACAGTGTTATGATTTCAGTTGCTAAAGGTAAGAATGCCGGTGGAGAATCAATCCCGATGCTTCTGAGAGTTCCTAAATTAACAGATCCTTATAAAGGATTTGATATGCTTGGCTTTGGGGATATTCTCTTCCCTGGTTTGCTAATTTGCTTTACATACAGATTTGATGAAGCTAAAAAGAAGGGGATACTAAATGGATACTTCCTTTGGCTATTGATTGGTTATGGGACTGGTCTTTCCATTACTTACTTGGGCTTGTTTTTGATGAACGGACATGGTCAACCTGCTCTCCTGTATCTCGTGCCCTGCACATTAGGAACTTGTGTGGTACTGGGGGCAGTGAGACACGAATTGAAAGACCTTTGGACCAATTGCGATGAATCAAAACAAATGGCTGAAGCGCGTCTAGGAAGTGCTTGA >Solyc10g012430.2 ATGGGGTTCAAAAGAGGAGTTTTTTCTTGTTGTTTTTGTGTAGTTTTTGCTGTTGTTTTGCTGAATTCTTGTGTTTTGGTTATTGGAGGTGATATAGTTCATCAAGATAATGTAGCTCCACATCGGCCTGGTTGTAACAACAATTTTGTGCTGGTAAAAGTTCCAACGTGGGTTAACGGGAATGAAGTAACTCAGTTTGTTGGCCTTGGTGCTCGATTTGGCCCCACATTGGAATCAAAGGAGAAGCGTGCTAATCAGACGAGGCTTGCTTTTGCAGACCCACCAGATTGTTGTAGCATGCCTAGGAATAAGCTCACCAGTGAGGCCATCCTGGTGCACCGAGGTAATTGCAGTTTCACCACAAAAGCAAAAGTTGCAGAAGCTGCTGGTGCTTCAGCAATCATCATTATAAACAATCAAACAGAGCTCTTCAAGATGGTTTGTGATCCCGGTGAATCTGATGTGGACATCGGTATCCCTGCTGTAATGCTGCCACAAGATGCAGGTACAAGCCTGATAGAGTTTCTCAGGAACAGTTCTACAGTTTCTGTGCAGATGTACTCTCCGAAACGTCCAGCGGTTGATGTAGCTGAAGTGTTTCTATGGCTTATGTCAGTTGTTACGATTTTATGTGCTTCTTATTGGTCTGCATGGAGTGCTAGAGAAGCCGCAATCGAGCAGGACAAGTTCTTAAAAGATGGCTCAGATGATTATGGTGGCAAGGAGGTAACTCATTCTGGTGGTGTATTAGACATCAACACAATATCAGCACTTCTGTTCGTGGTGGTTGCATCCTGCTTCTTGATTATGCTTTACAAATTGATGTCCTTCTGGTTTATTGAGGTTCTGGTGGTTCTATTTTGCATCGGCGGTGTAGAGGGTCTACAAACCTGTTTGGTGACCTTGTTATCATGTTTCAGATGGTTTGAACATGCTCAAGAATCATTTCTTAAAGTTCCACTTCTGGGGCCCGTTTCATATCTCACTCTGGCAATTTCTCCTTTCTGCTTAGCTTTCGCTATTATGTGGGCGGTTTTCCGTCATGTCTCCTTTGCTTGGATAGGTCAAGACATACTTGGTATGGCATTGATCATCACTGTTCTTCAGATCATACGAGTTCCCAATCTCAAGGTGGGAACAGTTCTTCTTACTTGTGCTTTCTTCTATGACATTTTTTGGGTATTTGTTTCCAAATGGGTGTTTCACAAGAGTGTGATGATAGAGGTTGCACGTGGTTATAAAAGCGGAGAAGAAGGAATTCCCATGTTACTAAAAATCCCGCGAATATGTGATCCCTGGGGTGGCTACAGCATCATTGGGTTTGGCGACATAATTTTACCAGGATTACTAGTAGCATTTTCATTAAGATATGACTGGCTGTGCAAGAAGAGCCTTCGAGCCGGTTATTTTCTATGGACTATGACTGCTTATGGTTTAGGTTTGTTTGCAACATATGTGGCTCTGAACTTGATGGACGGCCATGGTCAACCTGCTTTGCTATATATAGTTCCGTCCACATTAGGCACATTTTTGATGTTGTCAGCCAAAAGAGGTGAGCTGAAGCATCTATGGACAAGAGGAGAACCATATAGGATTTGCCCGCATATCCAGCTTCAACCGGCCGAGTAA >Solyc01g094680.2 ATGGAGTTGAAGAAATTGGATTGTTCAATTTTTGCTGTTTTTGTTGTTGTAGTTGTGCTGTGTACTGGTTTAGTTAGTGGGGGTGATATAGTTCACCAAGATGATATTGCTCCAAGTAGACCTGGTTGTAACAACAATTTTGTTCTGGTCAAAGTTCCGATCTGGGTTGACGGTATAGAAGTAACAGAGTTTGTTGGTGTTGGTGCTCGATTTGGACCAACATTGGAATCAAAGGAGAAGCGTGCTAATCAGACAAGACTGGCTTTTGCAGACCCTCCGGATTGTTGTAGCACACCTAGGAATAAGCTCACTGGTGAGGCCATCCTGGTGCACCGAGGTAATTGCAGTTTCACTACCAAAGCTAACGTTGCAGAAGATGCCGGTGCTTCAGCTATCCTCATAATAAACAACCAAACAGAGCTCTTCAAGATGGTTTGTGAACCCCATGAACCTGACTTGGACATTGGCATCCCTGCTATCATGCTCCCACAACATGCTGGCACAAGCCTGATAAAGTTTCTTGGAAATAGCTCTTCTGTTTCTGTACAGCTGTACTCTCCAAAGCGCCCAATGGTCGATGTAGCTGAAGTCTTTTTATGGCTTATGGCAGTTGCTACCATATTATGTGCTTCTTATTGGTCTGCATGGCGTGCCAGAGAAGCTGCAATTGAGCAGGACAAGCTCTTAAAAGATGGCTCAAATGAATGCAATGTCACAGAGGGGTTTCGTTCCGGTGTTGTGCTTGAAATCAACATAATATCAGCAGTTCTGTTTGTGGTGGTTGCATCCTGCTTCTTGATTATGCTTTTCAAATTGATGTCCTCCTGGTTTATAGAGGTTCTAGTGGTTCTATTCGCCATTGGGGGTGTTGAGGGTCTACAAACTTGTTTGGTCGCTTTGCTATCATGTTTCAGATGGTTTGAACGTTTTGGACAGTCATACATTAAAATTCCTTTTCTGGGACCTGTTTCATATCTGACGCTGGCGATTTCTCCATTCTGCATAGCCTTTGCAGTTCTGTGGGCAGTTTACCGTCACATCTCCTTTGCTTGGATAGGTCAAGATATACTTGGTATTGCATTGATCATCACGGTTCTCCAGGTTGTGCAGATTCCAAACCTCAAGGTGGGAACAGTTCTTCTGAGTTGTTCTTTATTGTATGACCTTTTCTGGGTGTTTCTTTCCAAAAGTCTGTTCCATAAGAGTGTGATGATAGTGGTTGCACGAGGTGATAAAACCGGAGAAGATGGCATTCCTATGTTACTGAAAATCCCACGGTTGTTTGATCCTTGGCATGGCTACAGTATCATTGGGTTTGGTGACATAATTTTACCAGGTTTACTGGTAGCATTTTCTTTAAGGTACGACTGGTTGTGTAATAAGAAACTTCGAGATGGATACTTCTTGTGGGCTATGCTTGCTTATGGTTTAGGTTTGCTCACAACTTATGTGGCATTGAATTTGATGGATGGTCATGGTCAACCTGCTTTGCTTTACATTGTTCCTTTCACACTAGGCACATTTTTGACGTTGGGAAAGCAAAGAGGTGATCTCAAGCATCTATGGACAAGAGGAGAGCCAGATAGGCCTTGCCCGCATGTCCGGCTTCAACCAGAGTAA >Solyc12g098670.1 ATGGCATTTTCATTCCGATTAATCGGAGTAAGCATTATCAGTTGTCTTCTTCTGTTATCATCAACCGCAACCGGTGATGATGATATCTCACGCGCCGCCCCTGCTAATGCATCGAGCTCCTGTAACAATCCTTATCGAATGGTTCTGGTGAAGTTATGGATTGATGGTGCTGAGCAAGAATCAATAGGTGGCTTAAGTGCGGCATTTGGATCTCTTTTATCCACTGATACTAAAAATGCCCCTAGATTGCCTGCTACTTGTACAAAACCCTTGAATGGCTGTTCCAGCTCCTCTTTTAAGTTATCAGGCTCCATTGCACTAGCTCTTCGCGGTCAATGTGATTTTCTAACGAAGGCTATGGTTGCACAAGCAGGAGGTGCTGCAGGGATTGTGCTGATAAATGATCAAGAAGATCTTGTGGAGATGGCTTGTCCTAACAATTCTACAGTATCAAACGTAACAATTCCTGTTGTAACCATTTCAAAAGCCGGAGGAGATGTCATAGACAAGTATATCTCTGCTGGAAAGAAAGTGGAGATTATGTTTTATTCGCCAGATCGGCCCATTGTGGACTACTCAGCAATGTTCATATGGATGATGGCTGTTGGCACAATATTTTGTGCATCCTTTTGGTCGGAGTTCACTACATCTAAGGAAAACAATATCAATGAACAGTCACCAGAGGTGATTGCTGGAGGTTCCAGGGAAGAAGATGACAAGGAAATCCTAAATATCACTACAAAGAGTGCTTTTGTATTTGTCATCACAGCGTCTACGTTTCTGTTGCTACTTTACTTTTTCATGTCTTCTTGGTTTGTCTGGCTGCTGATAATACTTTTCTCTATTGGTGGAGTTGAGGGAATGCATAGCTGTATAGTATCCCTGGTATCGAGCAAATGTAAAGGTTGTGGAAGGAAGAAGTTGAATTTGCCGCTTCTTGGGGAGAGTTCTATTCTTTCTCTTGTGGTATTGATATTATGTGTGGCATTTGCAATATCATGGGTAGCAACTAGGAAAGCATCATACTCTTGGATCGGCCAAGATATTCTGGGAATCTGTTTGATGATAACTGTTCTGCAGTTGGCTCAGTTGCCTAATATAAAGGTTGCTACGGTGCTTCTGTGTTGTGCATTTCTATACGACATCTTTTGGGTTTTCCTTTCGCCTGCTATATTCCATGACAGTGTAATGATTGCAGTTGCCCGCGGTGACAAAGCTGGCGGAGAATCCATTCCAATGCTTCTGAGAATTCCTCGAGTATCAGATCCTTATGGTGGCTATGATATGATTGGTTTTGGGGATATTCTGTTTCCTGGTTTGCTGGTTTGTTTTGCTTTCAGATTTGACAAAGCTAGAAAGAAGAATGTACTAAATGGATACTACATCTGGATGGTAGTTGGTTATGGAATTGGTCTTCTATTCACATACTTGGGGATGTACCTAATGAACGGTCATGGTCAACCTGCTCTCCTATATCTTGTGCCCTGCACGCTAGGAGTTTATGTGTTGCTGGGATTGCTGAGAGGCGAACTTAAAGACCTATGGAACTATGATAGCGAATCAACAAGAGTTGCAGACTCACTATTGGGAGATGCCTGA >CAN.G78.84 ATGGAGTTCAAGAAAAGAGAGTGTTGTATTTGTGCTGTTTTTGTTGTACTTGTACTGTGTACTTCTTTGGTTAGTGGGGGTGATATAGTTCACCAGGATGATATTGCTCCAAGTAGACCTGGTTGTAACAACAATTTTGTTCTGGTCAAAGTTCCAATCTGGGTTGACGGTATAGAAGTAACCCAGTTTGTTGGTGTTGGTGCTCGATTTGGACCGACACTGGAATCAAAGGAGAAGCGTGCTAATCAGACAAGGCTGGCCTTTGCAGACCCTCCGGATTGTTGTAGCACGCCTAGGAATAAGCTCACTGGTGAGGCCATCCTGGTGCACCGAGGTAATTGCAGTTTCACTACCAAAGCTAACGTTGCAGAAGATGCCGGTGCTTCAGCTATCCTTATAATAAACAACCAAACAGAGCTCTTCAAGATGGTTTGTGAACCCCATGAATCTGACTTGGACATTGGTATCCCTGCTGTCATGCTCCCACAACATGCTGGCACAAGCCTGATAAAGTTTCTTGGAAATAGCTCTTCTGTTGCCGTGCAGCTGTACTCTCCAAAGCGCCCAATGGTTGATGTAGCTGAAGTATTTTTATGGCTTATGGCAGTTGCTACCATATTGTGTGCTTCTTATTGGTCTGCATGGCGTGCCAGAGAAGCTGCAATTGAGCAGGATAAGCGCTTAAAAGATGGCTCAAATGAATGCAATGTTACAGAGGTTTCTCGTTCCGGTGTTGTGCTGGAAATCAACGTAATATCAGCAGTTCTGTTCGTGGTGGTTGCATCCTGCTTCTTGATTATGCTTTACAAATTGATGTCCTCCTGGTTTATAGAGGTTCTAGTGGTTCTATTCTCCATTGGTGGTGTTGAGGGTCTACAAACTTGTTTGGTCGCTTTGCTATCATGTTTCAGATGGTTTAAACGTTTCGGACAGTCATTCATTAAAATTCCTTTTCTGGGACCTGTTTCATATCTGACGCTGGCGATTTCTCCATTCTGCATAGCCTTTGCAGTTCTCTGGGCAGTTTACCGTCATATCTCCTTTGCTTGGATAGGTCAAGATATACTTGGTATTGCATTGATCATCACGGTTCTCCAGGTTGTGCAAATTCCAAACCTCAAGGTGGGAACAGTTCTTCTGAGCTGTTCTTTATTGTATGACCTTTTCTGGGTGTTTCTTTCCAAAAGTTTGTTCCATAAGAGCGTGATGATAGTGGTTGCACGTGGTGATAAAAGTGGAGAAGATGGCATTCCTATGTTACTGAAAATCCCACGGATGTTTGATCCTTGGGGTGGCTACAGTATCATTGGGTTTGGTGACATAATTTTACCAGGTTTACTGGTAGCATTTTCTTTAAGGTACGACTGGCTGTGTAATAAGAGACTTCGACATGGCTACTTCATCTGGGCTATGATTGCTTATGGCTTAGGTTTGCTTACTACATATGTGGCATTGAATTTGATGGATGGTCATGGTCAACCTGCTTTGCTTTACATTGTTCCTTTCACACTAGGCACATTTTTGACGTTGGGAAAGCAAAGAGGTGATCTCAATCATCTATGGACAAGAGGAGAACCAGATCGGCCTTGCCCACATGTCCGGCTTCAACCAGAGTAA >CAN.G116.10 ATGGGGTTCAAAGGAGGAGTTTTTTGTTTAGTTTTTGCTGTTATTTTGCTGAATTGTTGTTATTCGGTTATTGGAGGTGATATAGTTCATCAAGATAATGTAGCTCCAAGCAAGCCTGGTTGTAACAACAATTTTGTGCTGGTAAAAGTTCCAACGTGGGTTGATGGGAACGAAGTAACACAGTTTGTTGGCCTAGGGGCCCGATTTGGCCCCACATTGGAATCAAAGGAGAAGCGTGCTAATCAGACAAGGCTTGCTTTTGCAGACCCACCAGATTGTTGTAGCAAGCAGAGGAATAAGCTCACCAGTGAGGCCATCCTGGTGCACCGAGGTAATTGCAGCTTTACCACCAAAGCAAAAGTTGCAGAAGCTGCTGGCGCTTCAGCAATCATCATTATCAACAATCAAACAGAGCTCTTCAAGATGGTTTGTGATCCCGGTGAATCTGATGTAGACATCGGTATCCCTGCTGTGATGCTGCCACAAGATGCAGGTACAAGCCTGATAGCGTTTCTCAGGAACAGCTCTGCAGTGTCAGTGCAGCTGTACTCTCCGAAACGTCCATCGATTGATGTAGCTGAAGTGTTTTTATGGCTTATGGCAGTTGTTACCATATTATGTGCTTCTTATTGGTCTGCATGGAGTGCTAGAGAAGCCGCAATTGAGCAGGATAAATTCTTAAAAGATGGCTCAGATGATTATGGTGGCAAGGAGGTTACTCATTCTGGTGTAGTGGACATCAACACAACATCAGCACTTCTGTTTGTGGTGGTTGCATCCTGCTTCTTGATAATGCTTTACAAATTGATGTCCTTCTGGTTTATTGAGGTTCTGGTGGTTCTATTTTCCATTGGTGGCGTTGAGGGGCTACAAACCTGTTTGGTGACCTTGTTATCATGTTTCAGATGGTTTGAACATGCTCAAGAATCATTTCTTAAAGTTCCACTTCTGGGGCCTGTTTCATATCTTACTCTGGCAATTTCTCCGTTCTGCTTAGCTTTTGCTGTTATGTGGGCGGTTTTCCGCCGTGTCTCCTTTGCTTGGATAGGTCAAGACATACTTGGTATGGCATTGATCATCACTGTTCTTCAGATCATACGAGTTCCCAACCTCAAGGTGGGAACAGTTCTTCTCACTTGTGCATTCTTCTATGACATTTTCTGGGTATTTGTTTCTAAATGGTTGTTCCACAAGAGTGTGATGATAGAGGTTGCGCGTGGTGATAAAAGCGGAGAAGATGGAATTCCCATGTTACTGAAAATCCCGCGAATACGTGATCCCTGGGGTGGCTACAGCATCATTGGGTTTGGCGACATAATTTTACCAGGGTTACTAGTAGCATTTTCCCTAAGATACGACTGGTTGTGCAAGAAGAGCCTTCGAGCTGGTTATTTTCTGTGGACTATGACTGCTTATGGTTTAGGTTTATTTGCAACTTATGTGGGTCTGAACTTGATGGATGGCCATGGTCAACCTGCTTTGCTATATATAGTTCCTTGCACATTAGGCACATTTTTGGTGTTGGCAACAAAAAGAGGTGAGCTGAAGCATCTGTGGACAAGAGGAGAACCATATAGGCCTTGCCCGCATATCCAGCTTCAACCGTCCGAGTAA >CAN.G710.36 ATGGCATTTTTATGGTATTTTATTGGATTATGTATTTTGATTTTATCATCAACAGCACATTCTAAACCTACAAATGCAACTAAATCTTGCAGCAATGAAATCAATATGATGCTGGTGAGGTTTTGGGTAAATGGTGCTGAGGAAGAGTCATTAGTTGGCACTACTGCTGCATTTGGGTCTGTATTACCGACTAAGACGTCACGTGCCTCCAGGATGCCTGCTGTTTATACACAGCCTTTGAACGGCTGTTCTTCTTCCTCCACTAAGTTATCAGGCTCTATTGCGCTCATTCGTCGTGGTGAATGTGACTTCATAATCAAGGCCACGGTTGCCCAACAAGGAGGTGCAGGAGGTGTTGTGCTAATAAATGATAAAGAAGGTCCTCTGGAGATTGCTTGTCCTAATAATTCTACCATTTCAAACGTAACCATTCCTGTTGTTTCACTTTCTAAGGCGGGGGCAGATATTATTGATGAATACATGAAGTCAGGAAAGAAAGTGGAGATGATGTTATATTCGCCAGATCGCCCTATTGTGGATTACTCGGTTTCTTTCATATGGTTGATGGCTGTTGGAACAATTGTTTGTGCAGCTCTTTGGAAAAAGTTCACTAAACCTAAGGAAAGTGACGACTGTAATGTCTTAAAAAGTGATCTGCTTTCCTTGCAGGATGGTGATGGAGCAGCCAAGGAGGAGGATGAAGAAATTCTGCACATTACTGCATGGACTGCTGTTGCATTTGTCATCTCAGCATCCACATTTCTGGTGCTACTTTACTTTTTCATGTCTTCGTGGTTTGTCTGGCTGCTGATAATACTTTTCTGTATCGGTGGAATTGAGGGACTGCATAACTGTATAGTAACGCTCATACTAAGCAAATGTAGTTGTAGAAAGAAAACATTGAAATTGCCGCTTTTTGGGGAGGTCACTATTCTATCTCTAGTTGTCCTAGTACTTGCTGTGGGATTCGCCATCTGGTGGGCAGTAAACCGGAAAGAATCATATGGTTGGATTGGCCAAGACATTCTTGGGATTGCGTTGATGATCACTGTTCTGCAGTTGGCTCAATTGCCTAATATAAAGATCGCTACGATACTTCTCTGCTGCGCGTTTGTCTACGACATCTTCTGGGTTTTCCTATCTCCTTCTATATTCCATGATAGTGTTATGATTTCAGTTGCTAAAGGTAAGAAAGCTGGTGGAGAATCAATTCCGATGCTTCTGAGAGTTCCTAAACTAACAGATCCTTATAAAGGATTTGATATGCTCGGCTTTGGGGATATTCTCTTCCCCGGTTTGCTAATTTGCTTTACGTACAGATTTGACGAAGCTAAAAACAAGACATTACTAAACGGATACTTCCTTTGGCTGATGGTTGGTTACGGGACTGGTCTTTGCATTACCTACTTGGGCTTGTATTTAATGCGTGGACACGGCCAACCGGCTCTCCTGTATCTCGTGCCATGCACACTAGGAACTTGCGTGGTACTGGGAGCAGTGAGACGCGAACTGAAAGACCTTTGGAACAATAGCGAAGAAAAAATGGCTGAAGCGCGTCTAGGAAGCGCGTGA >CAN.G774.54 ATGGATTTTCATAGAATTTTGATCTTTGGAGTTGTAGTTCTGTTACTGAAGTTTCCAGTTAAAGTTACAGCTGGTGATATTGTTCATGATGATAACTTAGCTCCAAAGAAACCTGGTTGCGAGAACGATTTTGTGCTGGTGAAAGTTCAAACTTGGGTTGATGGTAAAGAGGATGCAGAATTTGTTGGTGTTGGTGCTAGATTTGGCACTACTATTGTGTCAAAGGAGAAAAATGCACAACAAACTCCGCTTACTCTTTCTGACCCTCGGGATTGTTGCAAGCCTCCAAGGAATAAGCTCGCTGGAGAGGTCATCATGGTAGATCGAGGCCATTGCAAATTCACAACGAAGGCTAATAATGCTGAAGCGGCAGGGGCTTCGGCAATCCTGATAGTAAATAATCAAAAAGAACTATACAAGATGGTTTGTGATCCTGGAGAGACAGACCTAGATATACACATACCTGCTGTTATGCTACCTCAGGATGCTGGGACAACGCTTGATAAAATGCTTTTAAATGGCTCATCAGTTACCGTGCAACTCTATTCTCCAAAACGACCTGTAGTAGACATTGCAGAAGTATTTTTGTGGCTGATGGCTGTTGGTACAATCTTGTGTGGTTCTTATTGGTCTGCTTGGAGTGCTAGAGAAGCAGCTATAGAGCAGGACAAGTTATTGAAGGATGCTTCAGAGGAAGAGCTTCCATATATTGGAACTGGTGATTCAAGCACTGTGATGGATATAAACATGATATCGGCGGTCTTATTTGTTGTTGTTGCTTCCTTCTTCTTGGTTGTATTGTATAAGTTGATGAGGTTCACGTGGTTCTTTGAAATCTTGGTTGTTCTCTTTTGCATCGGTGGTGTAGAGGGGCTACAAACTTGCTTAGTTGCCTTGCTGGCAAGGTGGTTTAAGCGTACCGGAGAGTCATTCATTAAAGTACCCATTTTCGGTGCAGTCTCTTATCTTACTTTGGCTGTTTCGCCGTTCTGCATAACTTTTGCGGTGGTTTGGGCAGTGTACAGAAATTCTTCTCCTTTTGGCTGGATTGGTCAAGACATACTTGGCATCGCACTAATAATTACAGTTCTGCAAATTGTACGGATACCTAATCTCAAGGTCGGTTCAGTTCTTTTGGGTTGTGCCTTCATCTACGACATATTTTGGGTATTTGCTTCTAAGAGTCTCTTCCATGAAAGTGTGATGATTGTGGTAGCTCGTGGTGACAAAAGCGGCGAGGATGGCATTCCGATGTTGCTGAAGATTCCTCGACTATTTGATCCATGGGGTGGTTACAGCATTATTGGCTTTGGTGACATCCTATTGCCTGGCCTGCTAGTAGCATTTTCACTTAGGTATGATTGGCTTGCAAAGAAGAATCTTCGAGCTGGTTACTTCTTGTGGGCAATGATTGCATACGGATCAGGTCTTCTTATTACATATGTAGCGTTAAACTTAATGGATGGTCATGGTCAACCTGCACTTCTTTACATCGTTCCATTTACCCTCGGGACCTTTTTGATGCTCGGAAGAAAACGAGGTGACCTAAAAATTCTTTGGACAAAGGGTGAACCAGAAAGGGTGTGTCCTCATGTTCGCCTCGAATCAATGGAAGAATAA >CAN.G2157.1 CAGGTTCTGGTGAAGTTATGGATTGATGGTGTTGAGCATGAAACAATAGGTGGCTTAAGTGCGGCATTTGGGTCTCTTTTATCCACTCATGCTAAAAATGCCTCCAGATTGCCAGCTACTTATACAAAACCCTTGAATGGCTGTTCCAGTTCCTCTTTTAAGTTATCAGGCTCCATTGCACTGGCTCTTCGCGGTCAATGTGATTTTCTAACGAAGGCTGCAGTTGCACAAGCGGGAGGTGCTGCAGGAATTGTGCTGATAAACAATCAAGAAGATCTTCTGGAGATTTCTTGTCCTGACAATTCTACGATATCAAACATAACAATTCCTGTTGTAACCATTTCAAAAGCCGGAGGAGATGTCATTGACAAATATTTCTCTGCTGGAAATAAAGTGGAGATTCTGTTTTATTTGCCAGATCGCCCCCTTGTGGACTACTCGGCGATGTTCATATGGCTGATGGCTGTTGGCACAATCTTTTGTGCATCTTTTTGGTCAGAGTTAACTACATCTAAAGAAAGCAATGGCTATGAAAAGGCACCAGAGGTGATTGCTGGAGGCACCAGGGAGGAAGATGACAAGGAAATTCTAAATATCACTACAAGGAGTGCTTTTGTATTTGTCATCACAGCTTCTACGTTTCTGTTGCTACTTTACTTTTTCATGTCGTCTTGGTTTGTCTGGCTGCTGATAATACTTTTCTCCATTGGTGGAGTTGAGGGAATGCATAGCTGTATAATATCCCTGGTATTGAGCAAATGTAAAAGTTGTGGAAGGAAAACGTTGAATTTGCCGCTTCTTGGGGAGATTTCTATTCTATCTCTTGTGGTCTTGATATTTTGCGTGGCATTTGCTATCTTCTGGGCAGTAACTAGGAAAGCATCATACTCTTGGATTGGCCAAGATATTCTGGGAATTTGTTTGATGATAACTGTTCTGCAGTTGGCTCAGTTACCTAATATAAAGGTTGCTACGGTGCTTCTGTGCTGTGCATTTCTCTACGACATCTTCTGGGTTTTCCTTTCACCTGCTATATTCCATGACAGTGTAATGATTGCAGTTGCCCGTGGTGACAAAGCTGGCGGAGAATCCATCCCAATGCTTCTGAGAGTTCCTCGAATATCAGATCCTTATGGTGGCTATGATATGATTGGTTTTGGGGATATTCTCTTTCCCGGTTTGCTGGTTTGTTTTGCTTTTAGATTTGACAAAGCGAGAAGGAAGACGGTACTAAACGGATACTACATCTGGATGATGGTTGGTTATGGAATTGGTCTTCTATTCACATACTTGGGCTTGTATCTAATGAACGGTCATGGTCAACCCGCGCTTCTATATCTCGTGCCCTGCACACTCGGAGTCTACGTGGTGCTGGGATTGCTGAGGGGCGAACTTAAAGACCTATGGAGCTACGACAGCGAATCAACAAAAGTCGCAGACTCACTATTGGAAGACGCGTAA >FVE32502 ATGGATTTGCAGAGGCTTTGTGGGTTGGTGTTTGTTTCAGCTTTGATTCTACTGGGGTGTAATCACAGCTCTGTAGAAGCTGGGGATATAGTGCATGATGATGCTTCAGCTCCAAAGAAGCCTGGTTGTGAGAACGATTTCGTTTTGGTGAAGGTACAAACTTGGGTTGATGGTGTTGAGGCTAGTGAGTTTGTTGGTGTGGGTGCTAGATTTGGAAGAACCATTGAATCAAAAGAGAAGAAGGCAAACCAAACTCGCCTTATTCTTTCAAATCCTCGAGATTGCTGCAGTCCACCGGAAAATAAGTTTGCTCGAGATGTCATTGTGGTCGACCGAGGCAACTGCAAATTCACAACCAAAGCAAATAATGCTGAAGCTGCTAATGCCTCAGCTATCCTAATTATAAATAACCAGAAAGAACTTTACAAGATGGTGTGTGAGCCAGATGAAACTGCTCTAGATATACACATACCTGCTGTCATGCTCCCACAGGATGCTGGCACGACCTTGGAAAACATGTTAATGAGCAATTCAGTGGTGTCTGTGCAGTTGTACTCTCCACAACGGCCCGTGGTTGACATTGCAGAAGTATTTTTATGGCTGATGGCAGTTGGCACCATCTTGTGTGCATCTTATTGGTCTGCATGGAGTGCCAGAGAAGCAGCTATTGAACATGAAAATTTGTTAAAGGATGCTGCTGATGAAATAACAACTGCGAAAGCACCTTTAGGTGCTAGTATCGTAGACATCAGCACGACATCAGCAGTCTTGTTCGTCATTATTGCTTCATGCTTTTTGGTCATACTCTACAAGCTTATGTCAGCCTGGTTCATTGAGCTTTTGGTTGTTCTTTTCTGTATAGGTGGTGTAGAGGGCTTGCAAACTTGCTTGGTGTCTCTGTTGTCGAGGTGGTTTAAACGGACTGGAGAGGCATACATCAAAGTACCTATCCTGGGAGCAATCTCATACTTAACGTTGGCTGTTTCTCCATTCTGCATAGCATTTGCTGTTCTCTGGGCAGTTTTTCGCACTATTTCCTTTGCCTGGATTGGCCAAGATATACTGGGAATTGCACTGATAATCACAGTTTTGCAAATTGTTCGTATACCCAATCTCAAGGTGGGTACGGTACTCCTCAGTTGTGCATTTTTGTATGACATCTTTTGGGTCTTTGTTTCTAAGAAGGTGTTCCATGAAAGTGTGATGATTGTGGTAGCTCGTGGTGACAGAAGTGGAGAGGACGGTATTCCAATGCTACTCAAGATCCCCCGCATGTTTGACCCATGGGGTGGTTACAGCATTATAGGATTTGGTGACATCCTATTACCAGGCCTGCTTGTGGCGTTCTCACTCAGGTATGATTGGTTGGCAAGTAAGAGTCTGCGAGCTGGGTACTTCTTGTGGGCAATGATTGCTTATGGATTAGGTCTTCTCATCACATATGTGGCATTAAACTTGATGGATGGGCATGGCCAACCGGCACTACTTTACATTGTTCCTTTTACACTAGGAACTTTATTGACATTAGGGAAAAAGAGAGGTGACTTACCGATTCTGTGGAGTAGAGGAGAACCGGAAAGGCTATGCCCGCATGTCCGACTCGAACACAGTCAAGAACTGAGGGATGAATAA >Mapoly0014s0134 ATGGCAGGAGGAGGAGCAGCGTGGAGAGTGATGCTGCGGCTGCTTCTACCCGCCTTGTTGCTGTTAGCATATGCTCAAGGCGTTAGGGGAGACGACGATATTGTTCAGCCGGATGACGAGAAAGCGCCCAAAATGCCTGGATGTGATAACGATTTTGTGCTGGTGAAAATTCGAAATTGGATAGATGGCCGTGAGAGTGGAGAGTTTGTCGGAGTAAGTGCTCGTTTCGGAGCACCCATCAAACAACACAAAAAGGACGCTCCTGGTGCACCTTTAGCTCTGGTTAAACCACCCACTCTTTGCCAGAACTACACCTCGGAGGGCGAGCTGAATGGTTTTGCGGCTCTGGCCCAGCGAGGAAACTGTACATTCACCACGAAGGCCCGAATTGCCCAGGTCGCGGGGGCTGTGGCACTTCTAGTTGTCAATGATATGGAAGAGCTGTACAAGATGGTATGCACGGAGAATGATACTTTCACGGACATCACCATACCAGCTGTGATGCTACCAAAGTCAGCAGGAGAGACTCTGCAGAATGCTTTGCATTCTGGAAGCGAAGTGAGGGTGCTATTTTACTCCCCGAAGAGGCCACTTGTAGACGTCGCGGAGGTGTTTTTGTGGCTGATGGCGGTAGGCACGATCCTTGGGGCTTCTTACTGGTCTGCCTGGAGTGCCAAAGAGGCTGCTAATGAGCACTATCGGCGGCTGAAAGAGATGCCGGACGGTTATCTGGTTGATCAAGAGCAAGACGACAAGGATGTTGTTGATATCAGTGTGGCATCCGCCCTCCTCTTTCTAGTCATGGCCTCGGGTTTCTTGCTCCTGTTATACAAATTCATGTCCGACTGGTTCCTGTTACTGCTAGTCATACTGTTCTGTATCGGTGGCGTGGAGGGCCTTCAGACCTGCCTCACAGCCTTTCTCTCCCGGTGGTTCCCGCATGCTGCATCCTCTTATGTCAATCTGCCGTACTTTGGAACCGTTTCTGCACTTACCCTAGTCGTTTCTCCCTTCTGCATCACCTTCGCCGTGTTATGGGCTTGTTTCCGGCATCTGTCATTCGCTTGGATTGCCCAAGATATTCTTGGCATTTCGCTCATACTCACCGTTCTTCAAATTGTGCGGCTGCCAGATATCAAGGTCTCCACAGTCTTGTTGAGCTGTGCTTTCTTGTACGATATCTTCTGGGTTTTCATCTCGCCGGTTTTCTTTCATGAAAGTGTGATGATTGTGGTTGCGCGTGGTGACAAAAGCGGAGGTGAAGGGATACCCATGCTCTTAAAGGTCCCACGATTGTTTGATCCATGGGGTGGTTACAGCATCATTGGGTTCGGTGATATTTTGTTGCCAGGTCTCCTTGTTGCGTTCTGCCTCAGATATGACTGGGCAGCTAAGAAGACCCTCTATGGAGGTTACTTTCTTTGGTCAACCGTGGGCTATGGCTTAGGGCTTTTCTTAACGTATGTCGCTCTGAATTTGATGAACGGCAATGGTCAACCAGCTCTTCTGTACATTGTTCCATGTACACTTGGCACTGTAATCGCTTTGGGCTGGTGGAGGGAAGAGTTCGGCATATTGTGGAATAAGGGAATTTATCACACAACTGCTACAGTTATGGGTGGTCAGTGGGCAACTAAATATGAGCAGATCGAGGGCTCACTAAGGTAG >TCA.TCM_005321 ATGGAAATAAATAAGGGTGTGTTTATAGTAATTTTAATAGTAGTTCTGAGTGCTGGGTTGGGGTCAGCTGGGGACATAGTTCATCAAGACAACGTTGCTCCAAAGAGACCTGGTTGTGCTAACAACTTTGTTCTGGTAAAAGTCCCAACCTGGATTAATAGTTTAGAAGATAATGAGTATGTTGGTGTTGGCGCTCGTTTTGGACCTACTTTGGAGTCCAAGGAAAAACATGCAAGCCGTACAAGGCTTGCTCTTGCAGATCCTCCTGATTGTTGCAGCAAGCCTAGGAATCAGCTTACAGAGGGGGAGGTCATTCTTGTACATCGAGGTAACTGTAGTTTCACAACGAAAGCAAATGTTGCTGAAGAAGTTGGTGCTTCTGCCATCCTCATAATAAACAACCAAACAGAACTGTTCAAGATGGTTTGTGAATCTGACGCGGATGTAGATATACAAATACCAGCTGTCATGCTCCCTCAAGATGCTGGTTCAAATTTGGAAAAATATATAAATAACAACACTATGGTATCTGTTGCGCTTTACTCTCCAAAGCGCCCAGCAGTTGATGTTGCAGAAGTGTTTTTGTGGCTAATGGCCGTTGGTACCATTTTGTGTGCTTCTTATTGGTCTGCATGGACTGCCAGAGAAGTTGCTATTGAGCAAGACAAGTTACTAAAGGATGCATCAGAACAATTTCTACAAGCCGGAGGTGTAGGTTCGAGTGGTTTTGTTGACATAAATACAACATCAGCAATTCTCTTTGTTGTGATTGCTTCATGTTTCTTGGTCATGCTTTACAAACTTATGTCATTCTGGTTTGTTGAGGTTCTGGTGGTTCTGTTTTGCATCGGTGGAGTCGAGGGCCTGCAAACGTGTTTAGTGGCTTTGTTATCATGTTTCAGGTGGTTTCAACGCTTTGCAGAATCATTTATCAAAGTACCCTTCTTTGGAGCTGTTTCGCATCTGACACTGGCTGTTTGTCCCTTCTGCATAGCATTTGCTGTTGTTTGGGCAGTGTATCGCCGTATCTCCTTTGCCTGGATAGGTCAAGATATTCTTGGTATTGCACTTATAATCACAGTTCTTCAGGTTGTTCGCATACCAAATCTCAAGGTTGGAACGGTTCTTCTGGGTTGTGCTTTCTTGTATGATATCTTTTGGGTGTTTGTTTCCAAATGGTGGTTTCATGAGAGCGTGATGATAGTGGTAGCTCGTGGTGATAAGAGTGGAGAGGATGGCATACCAATGCTACTAAAAATTCCACGCATGTTTGATCCTTGGGGTGGCTACAGTGTTATTGGATTTGGAGACATAATCTTACCTGGACTGCTTGTGGCATTCTCTCTAAGATATGATTGGCTGGCAAAGAAAAATCTCCGAGCTGGGTATTTTGTATGGGCAATGACTGCTTATGGTGTAGGTCTTCTGGTCACGTATGTGGCTTTGAACATGATGGATGGACATGGCCAACCAGCTTTGCTTTACATCGTTCCATTCACACTTGGGACCTTTATCACATTGGGAAAGAAGAGGGGAGATCTCAAAATTCTCTGGACAAGAGGAGAACCAGAAAGGCCTTGTCCGCATGTCCAACTTCAGCCCTTACAAGAAAAGTAA >TCA.TCM_016270 ATGGATTTGCGGAGTCTTTGCAGAGTAATCTTTGTAACAGCTCTGATTTCACTTGTCTGTCAGCCATGTTCTGTCACCGCCGGTGATATAGTACACGACGACGATTCAGCTCCCAAGAAGCCCGGTTGTGAGAACGACTTCGTTCTGGTCAAAGTTCAAACTTGGGTTAATGGCATAGAGGATGCTGAGTTTGTCGGTGTAGGTGCCAGATTCGGTACTACCATAGTGTCAAAGGAGAAAAATGCCAACCAAAGACGCCTTATTCTTTCTGACCCTCGTGATTGTTGTAGTCCCCCAAAGAATAAGCTTGCTAATGATGTCATTATGGTGGACCGAGGCAACTGCAAATTCACAACCAAGGCAAATAATGCAGAGGCGGCTCATGCTTCAGCTGTCCTCATTATAAATAATCAGAAAGAACTCTACAAGATGGTATGTGAGCCTGATGAAACAGATCTAGATATACAAATACCTGCTGTCATGCTCCCACAAGATGCTGGTGCAAGCTTGGAGAAAATGTTGACAAGTAATGCATCAGTGTTGGTACAGCTTTACTCTCCAAAGCGACCGCTAGTTGACATAGCCGAAGTGTTTCTATGGTTGATGGCAGTTGGTACCATATTGTGTGCTTCGTATTGGTCTGCATGGAATGCAAGAGAAGCTGCTATCGAACAGGACAAACTATTAAAGGATGCCTTGGATGAAATTCCCGATACCAGTCATGTAGCTTCTGGTGGTATTGTGGACATTAACACTACATCAGCTGTCTTATTTGTTGTTGTTGCTTCTTGTTTCTTGGTTATGCTTTACAAGCTTATGTCATATTGGTTTGTTGAGATCTTGGTGGTTCTTTTCTGCATAGGTGGTGTGGAGGGCCTTCAAACTTGCTTGGTTGCTTTATTGTCAAGGTGGTTCAAGCATGCTGGAGAATCATATATAAAAGTCCCTTTCTTCGGAGCTCTCTCATATCTCACATTGGCTGTTTCGCCTTTCTGCATAGCATTTGCTGTTGTTTGGGCTGTTTACCGCAATGTTTCCTTTGCTTGGATAGGTCAAGATATACTAGGAATTGCACTGATAATCACAGTTCTGCAAATTGTCCATGTACCTAATCTTAAGGTGGGAACAGTTCTACTCAGTTGTGCCTTCTTATATGACATCTTTTGGGTGTTTGTTTCTAAGAAGTTGTTCCATGAAAGTGTGATGATTGTGGTAGCTCGGGGTGATAAAAGTGGAGAGGATGGCATTCCAATGCTACTGAAGATCCCACGAATGTTTGATCCATGGGGTGGTTATAGCATAATAGGATTTGGTGACATCCTCTTACCTGGATTACTGATAGCATTTTCACTCAGGTATGATTGGCTGGCAAACAAGACTCTTCGAGCTGGATATTTCTTGTGGGCAATGTTTGCTTATGGGTTAGGTCTTCTCATTACATACGTGGCACTAAATTTGATGGATGGACATGGTCAACCAGCGCTCCTTTACATTGTCCCTTTTACACTTGGAACCTTTTTGACCCTGGGAAGAAAGAGGGGTGATCTACGAGTTCTCTGGACAAGAGGAGAACCAGAAAGACCCTGCCCCCATATCCAACTCGAACACCTACACAGTGAAGAGTTGAGCGAAGAAAAGTAA >TCA.TCM_020054 ATGTCGTTTCCTCCGGGAAGCCGACGCCGCTTTTCGGCTGCTCTTCCTTTGTTGTTTCTCTTGGCTCTGTCATTTGCTGGTGCCGCCACCGCCGACGGTGCCTCCCAGGACGATGGCCCCCAGTTACCTTCCTGTAACAATCCGTTCAAATTGGTTAAGGTGAAGGTCTGGGTTGACGGCGTTGAAGGCGAAGATTTAGCTGGTTTAACTGCAAGCTTTGGAGCTTCATTGCCTGAGGAGGCCAGCAAAAGTCCCAAATTGCCTGCTGTTTTCTCAAATCCCCTAAATGGCTGTTCTAAATCTTCTTCAGAGCTCTCTGGCTCTGTAGCCTTGTCTACACGTGGTGATTGTGACTTCACAACTAAGGCAAAAGTTGCACAGTCAGGAGGTGCTGCAGCCTTGCTGGTGATAAATGACAAAGAAGAGCTTTACAAGATGGTTTGTTCTGAGAACGATACTTCTCTAAATATTTCGATACCTGTTGTGATGATTCCAAAATCAGCAGGAGATGTGGTTAACAAATCTATGGCAGACAAACATGTGGAATTCTTATTATATGCACCAACCCGTCCTGTTGTGGATTTCTCGGTGTTATTTTTGTGGGCAATGGCTGTTGGCACAATTGTCACTGCTTCACTTTGGCAAGAGTTTGGTACTTCTGAGCATACTAATGAACGCTATAATGAATTATCACCAAAGGAGTCTTCCAATGCTGGAATAAGCAATGATGATGAAAAGGAAATCCTTGATATCAGTGCAAAGGGTGCCGTAGTTTTTGTGATAACAGCATCCACTTTTCTGGTGCTACTCTACTTCTTCATGTCCTCTTGGTTTGTCTGGTTGCTGATTGTACTCTTCTGCTTAGGCGGTGTTCAGGGGATGCATAATTGCATTATGACGCCGATATTAAGAAAATGCAGGAATTGTCCACAGAAGACACTGAATTTGCCTCTTTTTGGGGAGGTTTCTATCCTCTCACTTGTGGTTGCGCTATTCTGTGTGACATTCGCTGTTGTCTGGGCTGTCCATAGGCGAGCATCATATTCATGGGTGGGCCAAGATATTCTTGGTATCTGTTTGATGATAACAGTCTTGCAGTTGGCTCGACTGCCTAATATCAAGGTTGCTACAGTGCTTCTCTGTTGTGCATTTGTCTATGACATCTTCTGGGTCTTCCTATCACCACTTATATTCCATCAGAGTGTGATGATTGCAGTTGCTCGAGGTGACAATAGTGGTGGAGAATCAATTCCCATGCTCTTGAGAGTTCCTAGAGTTTTTGATCCATGGGGTGGCTACGATATGATTGGATTTGGGGACATTCTCTTTCCTGGTTTGCTTGTTGCATTTGCTTTCAGATATGATAAGGAAAACAAGAAGCATCTGGCCAATGGATATTTTGTGTGGTTGATAATTGGCTATGGGTTTGGCCTCTTCTTTACATACCTAGGGTTGTATTTAATGAATGGGCACGGTCAACCTGCACTCCTCTATCTCGTTCCTTGTACACTAGGAGTTGCTGTCATATTAGGTTTGGTGAGAGGAGAGCTGAAAGGACTCTGGAATTACAGCCCTGAGTCATCTTCCATGACAAATCCCTCTGGAGAAGCTTGA >AUR62003174 ATGGATCTGCAAAGATTGAGCTTGTTTTTCTCTCTTTGTTTTCTTATAATAAGTGTTAGAGCTGGGGATATAATTCACCATGATGATAAAGCTCCACAAAAACCTGGGTGTGAGAATGATTTCATCCTGGTGAAAGTGCAAACATGGATTGGGGAAAAGGAAGATGTAGAATTTGTTGGTGTTGGTGCGAGATTTGGTACTAGGATTGTCTCGAAGGAGAAGAAAGCAAACCACTCTCGCCTTACTCTTTCAGACCCTAAAGATTGTTGCAGTCAGCCAAGAAACAAGCTTGCCGGAGATGTCATTATGGTACATCGAGGCCACTGCAGATTCACAACTAAAGCAAATGTTGCAGAAGCTGCTGGTGCTTCAGCAGTTCTCATTATAAATGATGCAAATGAGCTTTACAAGATGGTCTGTGAACCGGATGAGACTGATCTTGATATCCATATCCCTACGGTTATGCTCCCTCAAGATGCTGGTATAACGTTGGAAAAGATGCTGTCAAATAGTTCTTCAGTATCTGTGCAGCTATACTCTCCTCGAAGACCAGTAGTGGATATTGCCGAAGTGTTTTTATGGCTTATGGCAGTTGGCACCGTTCTATGTGCATCATATTGGTCAGCTTGGAGCGCCAGAGAAGCTGTTGCTGAGCATGAAAAGCTATTGGAAGATGCTTCAGATGAACTCTCAAATGTGAGCTATGGTGGTGTGGTGAACATCAGCACAAAATCGGCCCTACTGTTTGTTGTTGTAGCTTCAAGCTTTCTTGTTGTCCTTTACAAATTGATGTCGTCTTGGCTCATTGAGCTTTTGGTGTTGCTTTTTTGCATTGGCGGTGCCGAGGTGGGAACAATTCTTCTATCTTGTGCCTTCTTGTATGACATATTTTGGGTCTTTATCTCAAAGAAGTTATTCCATGAGAGTGTTATGATTGTGGTAGCCCGTGGTGATAAAAGTGGGGAGGACGGTATTCCTATGTTGCTTAAGATTCCACGCATGTTTGACCCATGGGGTGGCTATAGCATCATTGGTTTTGGTGACATCCTTTTGCCAGGATTACTAATAGCGTTTTCTCTCAGGTATGATTGGTTGGCAAAGAAGAGTCTTCGAGCTGGGTACTTCTTGTGGACTATGATCGCCTACGGATTAGGTCTTCTCATTACTTATGTCGCTCTTAATTTAATGGATGGACATGGCCAACCTGCTTTGTTATACATTGTCCCTTTTACTTTAGGTATGTTTTCTGATGCACCTTAG >AUR62010691 ATGAAGTTTCACAGATTAAGCTTGTCTCTCTTACTTTGTACTCTAGTAGTGAGTGTTAAAGCTGGGGACATTGTTCATCATGATGATAAAGCTCCCAAAAAACCTGGGTGTGAGAATGATTTTATTCTGGTGAAAGTGCAAACATTAGTCGATAACAAAAATGATCAAGAATTTGTTGGTGTTAGTGCAAGATTTGGTAAGAGGATCGTTTCGAAGGAGGAGAACGCTAAAAACTCGCGCCTAGTTCTTTCTGATCCTCCTGATTGTTGCACTAAGCCAAAAATAAAATTCACCACCAAAGCGAACATTGCAGAAGCTGCTGGTGCCTCAGCAGTTTTAATGGTAAATGATCAAAATGAACATTACAAAATGGTTTGTGAACCTGATGAGACTGATCTCAATATCCATATCCCTGCGGTTATGCTCCCTCAAGAAGCTGGTAAAACGTTGGAGAAACTGTTGTCAAATGGTTCTTCAGTGTCTGTGCAGCTGTACTCTCCACGACGACCAGTGGTTGACATTGCCGAAGTGTTCTTATGGTTGATGGCAGTTGGCACCATCCTGTGTGCATCATATTGGTCAGCTTGGACTGCCAGAGAAGCAGCTGCTGAACATGAAAAACTATTAGAAGATGCTTCAGATGATCTCTCAAACATGGGCTCTGGTGGTATTGTGAACATCAGCAGAACATCGGCTCTGCTGTTTGTAGTTGTAGCTTCATGCTTTCTCATTATCCTTTACAAACTGATGCTTCTTGGCTCATTGAGCTATTGGTGGTGCTTTTTTGCATTGGTGGTGCAGAGGGCTTACAAACATGCTTGGTTGCTTTACTTTCAAGAAATATCCCCTCCACTCCTTCAAGTTGGTTGCGCTTCCGTTTTCATCTGTTCCTTTGATTTCTTTGAGCTGTTCTGTTTTCACCTCTCCCTACTCTACACAAAGATGGTTCAAGTTAAAGTACCTTTTCATGGAGCTGTCTCGTATCTTACTTTAGCTGTTTCACCGTTCTGCATCACATGTGCTGTCCTTTGGGGAGTTTATCGAGATCTCCGATTTGCGTGGATTGGTCAAGATATACTTGGAATCTCTTTGATAATGACAGTTATTCAAATTGTTCGGATTCCAAATCGCAAGGTAGCCCGCGGTGACAAGAGTGGGGAGGATGGTATTCCGATGCTGCTGAAGGTTCCACGCATATCTGACCCATGGGGTGGTTATAGCATCATTGGTTTTGGTGACATCCTTTTGCCAGGATTGCTAGTAGCTTTTTCACTCAGGTATGACTGGTTGGCGAAGAAGAGTCTTCGAGTTGGATACTTCTTGTGGACGATGATTGCTTATGGATTAGGTCTTCTCATTACGTATGTGGCTCTAAATTTGATGGATGGACATAGCCAACCTGCCTTGCTGTATATTTACCCTTTTACTTTAGGAGCTGCTCTGGTCACATCAGTCTGCACTTCCTTGAATGGGGAATGCTTAATGCAGCCACTATTTAGGTCATTTTGGGTTCGCAGCTGTCTATCCAGAAGTCCTGACCATGAAGGCAAGGCCGTTCTTGCAACCAGATACCCTGCCACCCCGGAGAGTGTTAGTTGA >AUR62022573 ATGAATTTTTGGAGATTTTTGGGAATTTGTTGTTTGTTCGTGGGGTGGTTTTCAAGTGGGGTTTATGGCGGTGACATAGTTCATGAAGATAATAAAGCTCCCAAGAAGCCTGGCTGTGAAAACAATTTTGTTCTGGTTAAGGTGCCAACATGGGTTGATGGATTTGAGGATAATGAGTATGTGGGACTCGGTGCTCGATTTGGGCCTACACTTGAGTCGAAAGAGAAGCATGCCAATCAAACAAGACTCGCTCTGGCAGATCCTCCGGATTGTTGCAGTCCTCCCAGAAATAAGCTTACTGGTGAAGCTATACTAGTATACCGTGGTAATTGCAGTTTTACTACAAAGACAAACATTGCAGAAGATGCTGGCGCTTCAGCTATCCTTATTGTGAACAATAGCACAGAACTCTTCAAAATGGTCTGTGAGGAGGATGCTGATACAAATATCCACATTCCTGCTGTCATGTTACCAATATATGCTGGTGAAACCTTGGAAGATTTATTGTATAACAATTCTAGGGTTTATGTGCAGCTGTACTCTCCAAAGCGCCCAGAAGTTGATGTGGCAGAAGTTTTTCTGTGGCTCATGGCTGTCGGCACTATTTTATGTGCGTCTTACTGGTCTGCATGGAATGCAAGGGAGGCAGCTATTGAACATGATAAGATGTTAAAGGATGCATCAGAGGAGGTTGCAGTTTCTGAAGGAACTGGTTCATCTGCATTTGTAGATATCAGTACCAGATCAGCATTTCTTTTCGTTGTGGTTGCTTCATTGTTTTTGGTTATGCTGTACAAACTTATGTCACTCTGGTTTATCGATGTTCTGGTGGTTCTGTTTTGCATTGGTGGAGCAGAGGGTTTGCAAACGTGCTTGGTAGCGTTGCTATCAAGGTGCTTTAAACATGCTGCCGGAACATTTATTAAAGTGCCCATCTTTGGAGCAGTCTCATATCTGGCTATGGCTGTTTCTCCGTTCTGCATAGTATGTGCTGTTCTTTGGGGTGTTTACCGCCGGGAGCCCTTTGCATGGATTGGTCAAGATATTCTTGTTGGCACAGTTCTTCTCAGTTGTGCGTTCTTTTATGACATATTTTGGGTCTTTGCTTCCAAGTGGTTCTTCCATGAGAGTGTTATGATTGTGGTTGCTCGTGGTGATAATAGTGGGGAAGATGGAATTCCAATGTTGTTGAAGATACCAAGGATGTTTGACCCGTGGGGCGGTTACAGTGTCATTGGATTTGGGGACATCATCTTGCCAGGATTAGTAATAGCCTTCTCATTAAGATATGACTGGCTGGGGAACAAGAGAATTCGAGCTGGATACTTTTTGTGGGGAATGACTGCTTATGGTTTTGGTCTCCTTGTAACGTATGTTGCTTTGAACTTGATGGACGGACATGGCCAACCAGCTCTCCTCTACATAGTTCCTTTTACACTTGCCACCACTTCTTCTCTCCTCCGTGGCAAAGCCACTGGAAACCATGGCCATTCTGTAGACACCAGCAAGGGGCCAAGGCGGACAGGCGGTGGTCGGTGGAGCAGCGAGCCAGTGACGCCTGACGCACTCACGCACGCGCCAGCAGCGAAGACTGAAGATGGAGCACAGCCGCACAGGAGCAGCGACGCACCACGCACGCACGAAGCCTCGACGGTCGCCGGTTGGTGGAATGGTGGAGCAGCGACGCAGTGGACTAGTGGTAATGGCAAATTGGAGTGA >AUR62007992 ATGGATCTGCAAAGATTGAGCTTGTTTATCTCTCTTTGTGTTCTTGTAATAAGTGTTAGAGCTGGGGATATAATTCACCATGATGATAAAGCTCCACAAAAACCTGGGTGTGAGAATGATTTCATCCTGGTGAAAGTGCAAACATGGATTGGGGAAAAAGAAGATGTAGAATTCGTTGGTGTTGGTGCGAGATTTGGTACTAGGATTGTCTCAAAAGAGAAGAATGCGAACCACTCTCGCCTTACTCTTTCAGACCCTAAAGATTGTTGCAGTCAGCCAAGAAACAAGCTTGCCGGAGATATCATTATGGTACATCGAGGCCACTGCAGATTCACAACCAAAGCAAATGTTGCAGAAGCTGCTGGTGCTTCAGCAGTTCTCATTATAAATGATGCAAATGAGCTTTACAAGATGGTCTGTGAACCGGATGAGACTGATCTTGATATTCATATCCCTACGGTTATGCTCCCTCAAGATGCTGGTATAACGTTGGAAAAGATGTTGTCAAATAGTTCTTCAGTATCTGTGCAGCTATACTCTCCTCGAAGACCAGTGGTGGACATTGCCGAAGTTTTTTTATGGCTTATGGCAGTTGGCACCGTTCTATGTGCATCATATTGGTCAGCTTGGAGCGCCAGAGAAGCGGTTGCTGAGCATGAAAAGCTATTGGAAGATGCTTCAGAAGAACTCTCAAATGTGAGCTATGGTGGTGTGGTGAACATCAGCACAAAATCGGCCCTATTGTTTGTTGTTGTAGCTTCAAGCTTTCTTGTTGTCCTTTACAAATTGATGTCATCTTGGCTCATTGAGCTTTTGGTGGTGCTTTTTTGCATTGGCGGTGCAGAGGGGTTACAAACATGCTTGGTTGCTTTACTTTCAAGGTGGTTTAATTTGTTCGCACGCTCATATGTGAAAGTACCTCTTCTTGGAGCTGTTTCATACCTTACTTTAGCTGTTTCACCATTCTGCATCACATTTGCAGTCCTTTGGGGAGTTTATCGAGATCTTCATTTTGCCTGGATTGGTCAAGATGTGCTTGGAATTGCTTTGATAATTACTGTTATTCAAATTGTTCGGATTCCAAATCTCAAGGTGGGAACAGTTCTTCTCTCTTGTGCCTTCTTGTATGACATATTTTGGGTCTTTATCTCAAAGAAGTTATTCCATGAGAGTGTTATGATTGTAGTAGCCCGTGGTGATAAAAGTGGGGAGGATGGTATTCCTATGTTGCTTAAGATTCCACGCATGTTTGACCCATGGGGTGGCTATAGCATCATTGGTTTTGGTGACATCCTTTTGCCAGGGTTACTAATAGCGTTTTCTCTCAGGTATGATTGGTTGGCAAAGAAGAATCTTCGAGCTGGGTACTTCTTGTGGACTATGATCGCCTACGGATTAGGTCTTCTCATTACTTATGTCGCTCTAAACTTAATGGACGGACATGGCCAACCTGCTTTGCTTTACATTGTCCCTTTTACTTTAGGAACATTATTGATGCTGGGGAAAAAAAGAGGCACTCTCAAGGTTTTATGGACGAGAGGGGAGCCTGAAAGACCTTGCTCTCATTTGCATCTGCATATGTCTGAGGAATCGAATCAAGAAAAGTAG >AUR62037086 ATGGCGATTCATCTGCGTCTGAAGGGGACGTTGCTCCTCTTTGTTGTTGGTTTAGCCATCGCTTTTGCGGCCGATGATGCCGTTTCTTCCAAATGCAGCAACAAACCTAGGAAGGTTAAGGTGAAATACTGGATCAATGGTGTTGAAAAAGGTCTTTTGAAGGCATTAACTGCAGATTTTGGCCCTTACCCTCCTCGTGAGGAAAAAAGTCCTAGGTTACCAGCTGTATTAACAAATCCCGTGAATGGTTGCTCTAATTTAACATCGAAGGTGAGTCAATCAGTTGCACTCTCTAATCGGGGGGAATGTGAATACACAATCAAGGCAAAAGTTGCTCAATCTGGTGGTGCTGCAGCTTTGGTGCTAATAAATAACCAAGATGAACTAGATGAAATGGCTTGTTCCAAGAATGTAACTGATTTGAACATTACTATTCCTGTCGTCATGATTTTAAAATCCAGAGGAGAAATTCTTAGCAAAACTATTGAAGCAAGGAATCAAGTGGAGCTGCAAATAGACTTGCTAAAACGTCCAGTTATTGATCTCCCTAGGACCTTATTATGGGTTATAGCTGTTGCAACACTTACAATTGCTTGCATCTGGCCGGATCTATGTGTACAGGAAGAGACTGATGAAAGCTATGATGAACTGTCACGAAAGGAATCTTCTGCAGCCAAGGATGATTCTGAGCTGGATACACTTGACATAAATGTGATGGGTGCTGTGGTTTTTCTCATCGTGGCTTCAGCGTTCCTGCTGCTATTATATTTTTTTATGTCATCATGGTTTGTCATTGTGCTGATTATTATGTTCCTCATCGGAGGTTCTGAGGTAATATCTGGTTTCTGA >AUR62037087 ATGACGGCTCCCTTGTGTGCATTTTCAATTTGTCTCCAGGTTGCCAGTGGTCAAAATAGCGGTGGAGAAAATCTACCTATGCTTTTGAGAATCCCTCGCTTTGATGATCCATTTAGTGGGTATAATTTGCTTGGCTTTGGGGACATTCTTGTTCCTGGTTTACTTGTCTCATTTTGCTACAGATACGACAAGGCACATAAGAAGGGCTTAATCAATGGATATTTTTTCTGGTTGGTGATTGGTTATGGTGTTGGGCTCATATTCACATACATAGCTTTGTCCCTGATGGAACAGGGTCAACCTGCGCTGTTGTATCTCGTACCTTGTACATTAGGTCCGGCAGTTATATTGGGTTTCTTCAGAGGTGAGCTGAAAGATCTTTGGAATCGTGAATCTGATTCAGAATCAGATGGACAACAATCTGCTGAAGCATGA >AUR62017191 ATGAATTTTCAGAGACTAAGCTTGTCTCTCTTACTTTGCACTCTAGTAGTGTGTGTCAGAGCTGGGGACATTGTTCATCATGATGATAAAGCTCCCAAAAAACCTGGTTGTGAGAATGATTTTATTCTGGTAAAAGTGCAAACATTAGTCGATAACAAAAATGATCAAGAATTCGTTGGTGTTGGTGCAAGATTTGGTAAGAGGATTGTTTCGAAGGAGAAGAATGCTAAAAACTCGCGCCTAGTTCTTTCTGATCCTCCTGATTGTTGCACTAAGCCAAAAATAAAGCTTGCCGGAGATGTCATTATGGTACACCGAGGTCACTGCAGATTCACCACCAAAGCAAATGTTGCAGAAGCTGCTGGTGCCTCAGCAGTTCTAATTGTAAATGATCAAAATGAACTTTACAAAATGGTTTGTGAACCTGAAGAGACTGATCTCAATATCCATATCCCTGCGGTTATGCTCCCTCAAGAAGCTGGTAAAACATTGGAGAAACTACTGTCAAATGGTTCTTCAGTATCTGTGCAACTGTACTCTCCACGACGGCCGGTGGTTGACATTGCCGAAGTGTTCTTATGGTTGATGGCAGTTGGCACGATCCTGTGCGCATCATATTGGTCAGCTTGGACTGCCAGAGAAGCAGCTGCTGAGCATGAAAAACTATTAGAAGATGCTTCAGATGAACTCTCAAACATGGGCTCTGGTGGTATTGTGAACATCAGCACAACATCGGCTCTGCTGTTTGTTGTTGTAGCTTCATGCTTTCTCGTTATCCTTTACAAACTGATGTCTTCTTGGCTCATTGAACTATTGGTGGTGCTTTTTTGCATTGGTGGTGCAGAGGGCTTACAAACATGCTTGGTTGCTTTACTTTCAAGATGGTTCAAGTTGTTTGCGCACTCATATGTGAAAGTACCTTTTCTTGGAGCTGTCTCATACCTTACTTTAGCTGTTTCACCGTTCTGCATCACATGTGCTGTGCTTTGGGGAGTTTATCGAGATCTCCAATTTGCTTGGATTGGTCAAGATATACTTGGAATCTCTTTGATAATGACAGTTATTCAAATTGTTCGGATTCCAAATCTCAAGGTGGGTACAATTCTTCTCTCCTGTGCCTTCTTGTACGACTTATTTTGGGTCTTTCTGTCGAAGAAGTTATTTCATGAGAGTGTGATGATTGTGGTAGCTCGCGGTGACAAGAGTGGGGAGGATGGTATTCCGATGCTGCTGAAGGTTCCACGCATATCTGACCCATGGGGTATGATTGGTTGGCGAAGAAGTCTTCGAGCTGGATACTTCTTGTGGACGATGATTGCTTATGGATTAGGTCTTCTCGTTACGTATGTGGCTCTAAATTTGATGGATGGACATGGCCAACCTGCCTTGCTGTATATTGTCCCTTTTACTTTAGGTATGTTTCCTGATGCACCACAAAGGCTTTATCTGCTTAAGAGACTTCCACTCAGTTTGGGATTTAAAGCAATGAACACTATTGGTGCTAGGAAGAAAGAGAGGCAATCTCAAGAATTTATGGACAAAGGGGGAACCCATCTGGCCTTGCTCTCATATGCAACTGCATAA >AUR62036489 ATGGCGATTCATCTGCGTCTGAAGGGGACGTTGCTCCTCTTTGTTGTTGGTTTAGCCATCGCTTTTGCTGCCGATGATGCCGTTTCTTCCAAATGCAGCAACAAACCTCGAAAGGTTAAGGTGAAATACTGGGTCAATGGTGTTGAAAAAGGTCTTTTGAAGGCAATAACTGCAGATTTTGGCCCTTACCCTCCTCATGAGGAAAAAAGTCCTAGATTACCAGCTGTATTAACAAATCCCTTGAATGGTTGCTCTAATTTAACATCGAAGGTGAGTCAATCAGTTGCACTTTCTAATCGGGGGGAATGCGAATACACAATCAAGGCAAAAGTTGCTCAATCCGGTGGTGCTGCAGCTTTGATTGTCATAAATAACCAAGATGAACTAGATGAAATGGCTTGTTCCAAGAATGTAACTGATTTGAACATTGCTATTCCTGTCGCCATGATTTTAAAATCCGGAGGAGACGTTCTTAGCAAAGCTATAGAAGCAAGGAATCGAGTGGAGCTGCAAATAGACTTGCTAAAACCTCCAGTTATTGATCTTCCTAGGACCTTATTATGGGTTATAGCTGTTGCAACACTTACAATTGCTTCCATCTGGCCGGATCTATGTGTACAAGAACAGATTGATGAAAGCTATGATGAACTGTCACGAAAGGAATCTTCTGCAGCCAAGGATGATTCTGAGCTGGATACACTTGACATAAATGTGATGGGTGCTGTGGTGTTTCTCATTGTGGCTTCAGCGTTCCTGCTGCTACTATATTTTTTTATGTCATCATGGTTTGTCATTGTGCTGATTATTATGTTCCTCATCGGAGGTTCTGAGGTTGCCAGTGGTCAAAATAGCGGCGGCGAAAATCTCCCTATGCTTTTGAGAATCCCTCGCTTTAATGATCCATTTAATGGTTATAATTTGCTTGGCTTTGGAGACATTCTTGTTCCTGGTTTACTTGTCTCATTTTGCTACAGATTCGACAAGGCACATAAGAAGGGCTTAATCAATGGATATTTTTTCTGGTTGGTGATTGGTTATGGTGTTGGGCTCATCTTCACATACATAGCTTTGTCCCTGATGGAACAGGGTCAACCTGCGCTGTTGTATCTCGTACCTTGTACATTAGGCCCGGCAGTTATATTGGGTTTCTTCAGAGGTGAGCTGAAAGATCTTTGGAATCGTGAATCTGAATCAGAATCAGATGGACAACAATCTGCTGAAGTGTGA >AUR62004364 ATGAATTTTTGGAGATTTTTGGGAATTTGTTGTTTTTTTGTTGGGTGGTTTTCAAGTGGGGTTTATGGCGGTGACATAGTTCATGAAGATAATAAAGCTCCCAAGAAGCCTGGCTGTGAAAACAATTTTGTCCTGGTTAAGGTGCCAACATGGGTTGATGGATTTGAGGATAATGAGTATGTGGGACTCGGTGCTCGATTTGGGCCAACACTGGAGTCGAAGGAAAAGCATGCCAACCAAACAAGACTCGCTCTGGCAGACCCTCCGGATTGTTGCAGTCCTCCCAGAAATAAGCTTACTGGTGAAGCTATACTAGTATACCGTGGTAATTGCAGTTTTACTACAAAGACAAACATTGCAGAAGATGCTGGTGCTTCAGCTATCCTTATTGTAAACAATAGCACAGAACTCTTCAAAATGGTCTGCGAGGAGGATGCTGATACAAATATCCGCATTCCTGCTGTCATGTTACCAATATATGCTGGTGAAACCTTGGAAGATCTATTGTACAACAATTCTAGGGTTTATGTGCAGCTGTACTCTCCAAAGCGCCCAGAAGTTGATGTGGCAGAAGTTTTTCTGTGGCTCATGGCTGTCGGCACTATTTTATGTGCGTCTTATTGGTCCGCATGGAATGCAAGGGAGACAGCTATTGAACATGATAAGATGTTAAAGGATGCATCAGAGGAGGTTGCAGTTTCTGAAGAAAATGGTTCATCTGCATTTGTAGATATCAGTACCAGATCAGCATTTCTTTTCGTTGTGGTTGCTTCATTGTTTTTGGTTATGCTGTACAAACTTATGTCACTCTGGTTTATCGATGTTCTGGTGGTTCTGTTTTGCATTGGTGGAGCAGAGGGTTTGCAAACGTGCTTGGTAGCGTTGCTATCAAGGTGCTTTAAACATGCTGCCGGAACATTTATTAAAGTGCCCATCTTTGGAGCAGTCTCATATCTGGCTATGGCTGTTTCTCCGTTCTGCATAGTATGTGCTGTTCTTTGGGGTGTTTACCGCCGGGAGCCCTTTGCATGGATTGGTCAAGATATTCTTGTTGGCACAGTTCTTCTCAGTTGTGCGTTCTTTTATGACATATTTTGGGTCTTCGCTTCCAAGTGGTTCTTCCATGAGAGTGTTATGATTGTGGTTGCTCGTGGTGATAATAGTGGGGAAGATGGAATTCCAATGCTGTTGAAGATACCAAGGATGTTTGACCCGTGGGGTGGTTACAGTGTCATTGGATTTGGGGACATCATCTTGCCAGGATTAGTAATAGCCTTCTCATTAAGATATGACTGGCTGGGGAACAAGAGAATTCGAGCTGGATACTTTTTGTGGGGAATGACTGCTTATGGTTTTGGTCTCCTTGTAACGTATGTTGCTTTGAACTTGATGGACGGACATGGCCAGCCAGCTCTCCTCTACATAGTTCCTTTTACGCTTGGCACATTCTTGACACTTGCTAAAAAAAGAGGTGATCTTAAGAATCTATGGACAAGGGGAGAACCCGATAGACCTTGTCCGCATGTCCGGCTTCATTCGTCTCAATAG >Cla001232.g ATGAATTCGTGGGGAGATGTGATTACTACGGTGTTTTTGGGTTTGATGCTGAGTCTGAGGCTGGTTTCAGCTGGGGATATAGTTCATCAGGACAGTGTCGCACCTACGCGCCCTGGTTGTGAGAATAATTTCGTTCTGGTGAAAGTCCCTACTTGGGTCAATGGTGTAGAAGCCACAGAATATGTTGGTGTTGGTGCACGATTTGGCCCGACCTTGGAATCAAAGGAAAAACATGCTACCCATACTAGAGTTGCTCTGGCAGATCCTCCAGATTGTTGCAGTATGCCGAAGAATAAGTTGGCTGGAGAGGTCATTTTGGTACGTCGTGGAAATTGTAGTTTCACAGATAAGGCAAATATTGCAGAAGGTGCTAATGCTTCAGCCATCCTTATCATTAATAACAGTAAAGTATCTGTGCAACTTTATTCCCCACTTCGACCGGTAGTAGATGTTGCAGAAGTATTTTTATGGCTTATGGCTGTTGGTACTGTCTTATTGGCATCTTATTGGTCTGCATGGACTGCAAGAGAAGTGGCTATCGAGCAAGATAAGCTGTTGAAGGATGGTTCAGATGAGTTGCTGCAGATGGAAGCAACTGGTTCCAGTGGTTACATAGATATTAACACTACAGCTGCAATTCTCTTTGTCGTGATTGCTTCATGTTTCTTGGTTATGCTCTACAAACTAATGTCTGCCTGGTTTCTTGACGTTCTGGTGGTTCTGTTTTGCATCGGCGGTGCAGAGATTACTCTATAA >Cla001233.g ATGGAACTAAATGGTGGATTGCCTGATTTCTGCAGATATGATTGGCTTGCAAAGAAGAAACTCCGAGCAGGTTACTTCGTTTGGGCAATGACTGCTTATGGCACAGGCCTACTCATCACTTATGTAGCTTTGAATTTGATGGATGGACATGGCCAACCAGCTTTGTTATACATTGTTCCATTCACCCTGGGTAAGTACCACGGTTCTATTACCTGA >Cla011438.g ATGGATTTGCAGCAGAGGCATTTTCTTGGTGGGTTTGCCATATCCGCTCTAGTTTTGCTGCTGATTTTTCCTTGTCACGTGACTGCTGGGGATATAGTTCACCATGACGATTTGACTCCTAAAAAGCCTGGCTGTGAGAACGACTTCATTCTGGTTAAAGTTCAAACTTGGGTTGATGGCAAAGAAGCTAGTGAATTTGTCGGTGTCGGTGCAAGATTTGGTGCTACAATCGTGTCAAAGGAGAAAAATGCAAACCAAACACGCCTTGTTCTTGCAAATCCCCGTGATTGTTGCAGCGTGCCAAAGAACAAGCTTTCTGGAGATATAATCATGGTAGATCGTGGTCACTGCAAATTTACTACAAAAGCAAATATTGCAGAAGCTGCAGGTGCTTCAGCAATACTCATAGTAAATAACCAAAAAGAGCTTTACAAGATGGTTTGTGATCCTGATGAGACTGATCTTGATATACATATACCTGCTGTCATGCTCCCACAAGATGCTGGAACAAGCTTGGAGAAGATGCTTATAAGTAATTCATCAGTGTCTGTTCAGCTCTACTCTCCACTACGACCACCAGTTGACATAGCTGAAGTATTCTTATGGTTGATGGCTGTCAGTACGATCTTGTGCTCATCTTTTTGGTCTGCCTGGAGTGCTAGGGAAGCAGCCATTGAGCAGGACAAGCTGCTAAAGGATGGTGCAGATGATATTCAAAATGCTGAAGACATGGGCAGCCCTGGTGTTGTATATATTAACATGGCATCAGCAGTCTTGTTTGTTGTCGTTGCTTCGTGCTTTTTGATTTTGCTTTACAAACTCATGTCGTACTGGTTCATTGAGCTTTTGGTAGTTCTTTTCTGCATAGGAGGTGCAGAGGGTTTGCAAACTTGTTTGGTTGCGTTATTGTCAAGATGCTTTAAGCAAGTTGGAGAATCATACATCAAGGTGCCATGCTTTGGAGCTGTTTCATACCTCACTGTTGCTGTTTCTCCATTCTGCATAGCATTTGCTGTTGTTTGGGCTGTTTATCGGAATGTGTCATTTGCCTGGATCGGTCAAGACATACTTGTTGGAACAGTGCTACTCAGTTGTGCCTTCCTCTATGATATCTTTTGGGTCTTTGTTTCTAAGAAGTTGTTCAATGAAAGTGTGATGATTGTGGTGGCTCGTGGCGATAAAAGCGGAGAGGACGGAATCCCAATGTTGCTAAAGATTCCTCGCATGTTTGATCCCTGGGGTGGTTATAGCATTATTGGATTTGGTGACATCCTTTTACCTGGACTCGTAGTAGCATTTTCTCTCAGGTATGACTGGTTGGCAAATAAGAGCCTCCGGGTCGGTTACTTCTTACCAGCAATGCTTGCTTATGGGTCAGGTCTTCTGATTACTTATGTGGCTTTGAACCTGATGGATGGCCATGGCCAGCCCGCACTGCTTTACATCGTCCCGTTCACTCTCGGAACCCTTTTGACACTGGGGAAGAAGAGAGGAGATTTGGGGATTCTGTGGACAAAAGGAGAACCAGAAAGGGTCTGCCCTCATGCTCATCTTCTCATCAATGACGATTTAAATGAAGAAAAATGA >Cc02_g38090 ATGAAGTTAAAGATGAGAGCTTTGAGCTGTACTGTTAGTACAGTTGTTCTTGCAGTTGTGTTTTTGAGTAGTTCTTCAGTGTTTGCAGGCGATATAGTTCACCAAGATGATGAGGCACCTAGAAGACCTGGTTGTGACAATAATTTTGTTCTGGTGAAAGTTGCAACTTGGATTGATGGCAATGAGGAAATGGAATTTGTTGGTGTTGGTGCTCGATTTGGCCAAACCTTGGAATCGAAAGAGAAGCGTGCCGACCAAACAAGACTTGCCCTTGCTGACCCCCCTGATTGTTGTAGTAAACCAAAAAATAAGCTTACCGGTGAGGTCATCTTGGTGTACCGAGGTAATTGTAGTTTCACAACTAAAGCAAATGTTGCAGAGGATGCAGGTGCTTCTGCAGTCCTCATCATTAACAACCAGACAGAACTCTTCAAGATGGTTTGTGAACCCAACGAGACTGATATAGATATTCAGATACCTGCTGTGATGCTTCCTATTGATGCTGGTCAGCAGTTGGAGGCCGTTATGAAAAACAAGTCTGCTGTTATGGCGCAACTATATTCTCCGCACCGTCCACTTGTTGATGTAGCTGAAGTGTTTTTATGGCTTATGGCTGTTGGCACAATCTTATGTGCATCGTACTGGTCTGCATGGACTGCTAGAGAAGCAGCAATTGAGATGGACAAGCTTTTAAAGGATGGCTCAGATGACTATCTTAATTTGGAGAGTAGTAATTTAAGAGGAGTGGTGGACATCAACACAAGTTCTGCAGTTCTCTTTGTTGTAGTTGCTTCTGGTTTCTTGGTTATGCTTTACAAATTGATGTCATTCTGGTTCATTGAGGTGCTGGTGGTTCTATTTTGCATTGGCGGCATAGAGGGACTGCAAACCTGTTTGGTGGCATTGTTATCATGTTTCAGATGTTTTGAACATGCTGGAGAGTCTTTCATAAAGGTCCCCTTTATTGGAGCTGTATCATACGTGACACTGGCTGTTTCTCCATTCTGCATAGCATTTGCTGTTGTATGGGCAGTTTACCGCCGTGTCTCATTTGCTTGGATCGGTCAAGATATCCTTGGTATTGCTTTGATAGTCACAGTTCTCCAGATCATACGAGTTCCAAATTTGAAGGTTGGAACAGTTCTACTAAGTTGTGCATTCCTATATGACATTTTCTGGGTGTTTGTTTCAAAGTGGTGGTTTAAGGAGAGCGTGATGATAGTGGTTGCTCGTGGTGATAGAAGTGGAGAAGATGGTATACCAATGCTACTCAAGATCCCTCGGATGTTTGATCCATGGGGTGGCTACAGTATAATTGGATTTGGCGACATCATCTTGCCTGGATTGCTGGTGGCCTTTTCACTAAGGTATGATTGGCTGTCCAAGAAGAATCTTCGAGAAGGATACTTTCTGTGGGCAATGATTGCGTATGGATTAGGTCTCCTCATTACTTACGTGGCCCTGAACATGATGGATGGACATGGCCAACCAGCATTACTTTATATTGTTCCTTTCACACTAGGTACATTCTTGACATTAGGGAAGAAGAGAGGTGATCTTAAGAATCTATGGACAAGAGGAGAGCCAGAGAGACCTTGCACCCATGTCGAACTCCAACAGACTGAATGA >Cc03_g10520 ATGGCTTCAGTTTTATCTTCCTCTTTCGGTTTAATTTTTCAATTAGGTTTTGTTGTTCTTCTTTTTTGCTCGTCAATTGCTGAAGCTGATGATATCTCACGCCCATCCCCCAACGCCTTGAATTCTAGCTCCTGCAACAACCCTTATCGGTTGGTTAAGGTCAAATCATGGGTCAATGGCGATGAAGACGAAACATTAAGTGGGATAAGTGCTTCATTTGGTTCTTTGTTGCCTACTGAAGCTGAAAAAGGCTCCAAATTGCCTGCTGTGGTTTCTAATCCATTGAGTGGCTGTACTAGTTCCACTTCCAAGTTGTCAGGCTCCATTGTGCTCGCCTTTCGTGGTGATTGTGATTTTACAACCAAGGCTGAAGTTGCACAAGCACAAGGTGCTGCCGGACTTTTGATAATAAATGATGCAGAAGATCTCATAGAGATGGGATGTTCTGAAAAAGATACTAACTTAAACATTACAATCCCAGTTGTAATGATTTCAAAGTCAGGAGGAGAGGTTTTAAAACAATCTATGTCTGGTGGACATAGTGTGGAAATTTTGTTATATTCACCAAATCGCCCAATTGTCGACTTTTCTGTGGTATTCTTATGGTTGATGGCTGTTGGAACACTTGTTTGCGCATCACTTTGGTCAGAGTTTACAGCATCTGAGCAAACTGATGAACGCTATAATGAATTGTCACCTAAGGAATCATCAAATGCTGCCAAGGAAGAAACAGAGAAGGAGATTATCAGCATTAATACTAAGAGTGCTATTATTTTTGTCATATCAGCGTCCACATTTCTGGTGCTGCTTTACTTATTTATGTCAACTTGGTTTGTCTGGGTGCTGATCGTACTTTTCTGTCTTGGTGCGGTTGAGGGAATGCATTCTTGTATAGTATCTCTTGTTCTGAGCAAATGCAAAAATTGTGGAAGGAAAACTGTCAATTTGCCACTTCTAGGAGAGGTCTCCATTCTCTCTCTGGTAGTGTTGCTATTTTGCTTGGCTTTTGCCATTTTCTGGGCTGCAAATCGTAAGGCATCATACTCCTGGATAGGCCAGGATATTCTTGGCATCTGTTTGATGATAACTGTCTTGCAGTTGGCACAATTACCTAATATAAAGGTTGCTACTGTGCTTCTATGTTGCGCTTTTCTTTATGACATCTTCTGGGTGTTCCTGTCGCCTTACATTTTCCATGACAGCGTTATGATAGCGGTTGCTCAAGGTGACAAGGCTGGCGGAGAATCAATCCCGATGCTCTTGAGAATTCCTCGATTTTTTGATCCTTGGGGTGGTTATAACATGATTGGCTTTGGGGACATACTCTTCCCCGGTTTGCTTGTTTCCTTTGCACATAGATTTGATAAAGCCAAAAAGAAGACTGGTCGAAATGGATACTTCCTTTGGTTGGCCATTGGCTATGCATGTGGCTTGTTCTTTACTTACTTAGGCTTGTATCTAATGGATGGACATGGTCAACCTGCTCTCCTGTACCTTGTTCCTTGCACATTAGGACTTTGTGTTATATTGGGTTTGGTGAGAGGTGAGTTGAGAGAACTTTGGAGCTATGATGGCGATTCAACGAGCACTGATTCAACTCAACCACCGTTACCTTCTGGAGAAGCTTGA >Cc08_g14830 ATGGGTTTTGACAGAATTTGCAGTTTAATCTGCGTGTATGCAATTGTAGTGGTGGTCTTCAGTAGTCCAGCTGAAGTGACGGCCGGTGACATAGTTCATGAAGATGATTTAGCCCCTAAAAAGCCCGGTTGCGAGAATGATTTCGTTTTGGTAAAAATTCAGACTTGGGTTGATGGCATAGAGAACGCGGAGTTTGTTGGTGTTGGTGCTAGGTTTGGCACTACAATTGTTTCGAAGGAGAAAAATGCACAACAAACTCACCTTACTCGTTCAAACCCTAGGGATTGTTGTAGTCCTTCAATTAACAAGCTTGCTGGAGATGTCATCATGGTAGATCGTGGAAAGTGTAAATTTACAACTAAGGCTAATATTGCAGAGGCTGCTGGTGCTTCAGCTGTCCTTATTATCAATAATCAAAAAGAACTCTACAAGATGGTCTGTGAGCCTAATGAAACTGATCTGGACATAAAGATTCCAGCCGTGATGCTTCCGCAAGATGCTGGTGCAAGCTTGGAGAAGATGCTGTCAAATAGTTCATCAGGCAAGCTTCCCTCCTCATGA >Cc08_g14840 ATGACTATATGTGCTTTTTGTGCATTTTCTGTGCAGCTGTACTCTCCACGAAGACCAGTAGTTGACATAGCAGAAGTGTTTTTGTGGCTAATGGCAGTTGGTACGATCTTATGTGCCTCTTATTGGTCTGCTTGGAGTGCTAGAGAAGTGGCTGTTGAACAGGACCAGTTGTTAAAGGATGCATCAGATGAAGTTACAAGCCCAAAAGGTCTTGGTGTAAGCAATGTGGTGGATATAAGCACTGCATCGGCAGTCTTCTTTGTAGTCATTGCTTCATGCTTCTTGATTTTACTGTACAAGCTAATGTCATCCTGGTTCCTTGATCTCTTGGTGGTTCTTTTTTGCATTGGTGGTGTAGAGGGCTTGCAAACTTGCTTGGTTGCTTTGTTATCTAGGTGGTTCAAACGTACGGGAGAGTCATTCATTAAAGTGCCTTTCTTTGGAGCTGTCTCTTACCTTACTTTGGCTGTATCTCCATTCTGCATAGCTTTTGCTGTTATTTGGGCTGTGTACAGAAATGCCTCTTTTGGCTGGATAGGCCAAGATATTCTTGGGATTGCACTGATAATAACAGTTATTCAGATTGTGCGAGTCCCTAATCTCAAGGTGGGCACAGTTCTTCTTAGTTGTGCCTTCTTGTACGACATATTCTGGGTCTTTGTTTCAAAGTCGCTGTTCCATGAAAGCGTGATGATTGTGGTTGCTCGAGGTGATAGAAGTGGAGAGGATGGTATTCCAATGCTACTGAAAATTCCACGCTTGTTTGATCCTTGGGGTGGTTTTAGCATCATAGGCTTTGGTGACATCCTTTTACCTGGGCTGCTGATAGCATTTTCGCTCAGATATGATTGTCTTGCAAAGAAGAATCTTCGAGCTGGTTATTTTTTATGGGCAATGTTTGCTTACGGACTAGGTCTCCTTATTACATATGTGGCGTTGAACCTGATGGATGGCCATGGCCAACCTGCTCTTCTTTACATCGTCCCATTTACTCTTGGAACCTTTATAGCACTGGGAAAAATGAGAGGCGATCTAAAGATTCTGTGGACAAAAGGAGAACCCGAAAGGGTCTGCCCGCATGTCGGCCTTGAATCTAACAAGGAATGA >Gorai.001G169100 ATGGAAATAAATTGGGATGTATTTATAGTAATTTTAGTTGTAGTTTTGAGTGCCAGGTTGGGTTCGGCTGGAGATATTGTTCATATCGACAACGTTGCTCCAAAGAGACCTGGTTGTTCTAATAACTTCGTTCTGGTAAAAGTCCCAACCTGGGTTGAGGGTTTAGAAGACAATGAGTATGTTGGTGTTGGCGCTCGTTTTGGACCTACTTTGGAGTCGAAGGAAAAACATGCAAGCCATACCGAACTTGCACTTGCAGACCCTCCTGATTGTTGCAGCAAACCTAGGAATAAGCTTACAGGGGAAGTCATTCTGGTGCAACGAGGTAACTGTAGTTTCACAGTGAAGGCAAATGTTGCTGAAGAAGCTGGTGCTTCTGCCATCCTCATAATAAACAACCAAACAGAACTCTTCAAGATGGTTTGTGAATCTGATGCTGATGTAAATATAAAAATACCGGCTGTCATGCTCCCTCAGGATGCTGGTTCACGTTTGGAAAAATATATAACTAACACCACCATGGTGTCTGTTGCTCTTTACTCTCCAAAGCGCCCAGCAGTTGATATTGCTGAAGTTTTTTTGTGGCTAATGGCTGTTGGTACCATCTTGTGTGCCTCTTATTGGTCTGCATGGACGGCTAGAGAAGTTGCTATTGAGCAAGAGAAGCTACTCAAGGATGCTTCAGAAGAATTTCTACAAGTAGGAGCTGCAGGTTCAAGTGGTTTTGTTGACATAAATACAACATCAGCAATTCTCTTTGTTGTAATTGCTTCATGTTTCTTGGTCATGCTTTACAAGCTAATGTCATTCTGGTTTGTCGAGGTTCTGGTGGTTCTTTTCTGCATCGGTGGAGTAGAGGGCCTACAAACGTGTTTGGGGGCACTTTTAGCATGTTTCAGGTGGTTTCGACGCTATGCAGAATCATTTATTAAAGTACCCTTCTTTGGAGCTGTTTCGCATCTGACACTGGCTGTTTGCCCCTTCTGCATAACATTTGCTGTTGTTTGGGCAGTGTATCGGCGTATCTCATTTGCCTGGATAGGTCAAGATATTCTTGGCATTGCACTTATAATCACAGTCCTTCAGATTGTTCGTGTGCCAAATCTCAAGGTTGGAACCGTTCTTCTGGGTTGTGCTTTCTTGTACGATATCTTCTGGGTATTTGTTTCCAAATGGTGGTTTCATGAGAGTGTAATGATAGTTGTAGCTCGTGGTGATAAGAGTGGAGAGGATGGCATACCAGTGCTACTAAAAATTCCACGGATGTTTGATCCTTGGGGTGGCTACAGTGTTATTGGATTTGGAGACATAATCTTACCTGGACTGATTGTGGCATTTTCTCTAAGATATGATTGGATGACAAAGAAGAGCCTTCGAGCAGGATACTTTGTATGGGCAATGACTGCTTATGGTTTAGGTCTTCTGGTCACGTATGTCGCCTTGAACTTGATGGATGGACATGGCCAACCTGCTTTGCTTTACATTGTTCCTTTCACACTTGGTACCTTAATTACACTGGGAAAGAAGAGGGGTGATCTCAAAACTCTCTGGACAAGAGGAGAACCAGAAAGACCTTGTCCGCATGTGCAACTTCAGCCCTTAGAACAAAAGGAATAA >Gorai.003G158200 ATGGATTTGCAAAGTCTTTGCAAAGTAATCTTAGTATCAGCTCTAATTTCACTTGTCTGTCACCCATGTTCCGTCACCGCCGGTGATATAGTACACGACGATGATTCAGCTCCCAAGAAGCCTGGTTGTGAGAACGACTTCGTTCTTGTCAAAGTTCAAACTTGGGTTAATGGCATAGAGGATGCTGAGTTTGTTGGTGTTGGTGCTAGATTTGGTACTGCTATAGTGTCAAAGGAGAAAAATGCAAATCAAAGACGCCTCGTTCTTTCTGACCCTCGTGATTGTTGTAGCCACCCGAAGAATAAGCTTGATAATGATGTCATTATGGTGGACCGAGGTCACTGCAAATTCACTACCAAGGCAAATAATGCACAGGCAGCTAATGCTTCTGCTCTCCTCATTATAAATAACCAAAAAGAACTTTATAAGATGGTATGTGATCCTGATGAAACTGATCTAGATATACACATACCTACTGTCATGCTCCCACAAGATGCTGGTGTGAGCTTAGAGAAAATGCTGACAAGTAATTCATCGGTGTCTGTACAGCTTTACTCTCCAAAACGACCTCTAGTGGACATAGCTGAAGTGTTTCTATGGTTGATGGCGGTTGGTACCATATTGTGTGCTTCATATTGGTCTGCATGGAGTGCTAGAGAAGCTGTTATTGAACATGACAAACTATTAAAGGATCCTTTAGATGAAATTCCAGATACCAGGCATGTCGGTTCCGGTGGCCTTTTGAATATCAACACCACATCAGCTGTCTTATTTGTTGTTTTTGCATCTTGCTTCTTGATTATGCTTTACAAACTTATGGCATATTGGTTTGTGGAGCTCTTGGTGGTTCTTTTCTGCATAGGTGGTGTGGAGGGCCTTCAAACTTGCTTGGTTGCTTTATTGTCAAGGTGGTTCAAGCGCATTGCAGAATCATACGTTAAAATTCCTTTGTTTGGAGCTGTCTCATACCTTACATTGGCTGTTTCCCCCTTCTGCATTGCGTTTGCTGTTGTTTGGGCTGTTTACCGCAATGTTTCCTTTGCTTGGATAGGTCAAGATATACTCGGAATTGCATTGATAATCACAGTTCTGCAAATTGTCCATGTTCCTAATCTCAAGGTGGGAACAGTTCTACTCAGTTGTGCTTTCTTATATGACATCTTCTGGGTTTTTGTTTCAAAGAAGTTGTTCCATGAAAGCGTGATGATCGTGGTTGCTCGTGGTGATAAAAGTGGGCAGGACGGAATTCCGATGTTACTGAAGATCCCACGAATGTTTGATCCATGGGGTGGTTATAGCATAATAGGATTTGGTGATATCCTTTTACCTGGATTGCTTGTAGCATTTTCACTCAGGTATGATTGGCTGGCAAACAAGTCTCTTCGAGCTGGCTACTTCGTTTGGGCAATGATTGCTTATGGCTTAGGTCTTCTTGTTACGTACGTTGCACTAAATTTGATGGATGGACATGGTCAACCAGCACTCCTTTACATTGTCCCTTTTACACTTGGAACCTTTTTGACCCTAGGAAGAAAGAGAGGTGATCTAAGAATTCTCTGGACAAGTGGGGAACCAGAAAGACCTTGTCCCCATATCCGACTCGAACACCAAACTATCGAAGAGTTGAACGATGAAAAGTAA >Gorai.004G158800 ATGGAAATTAATATTGTGTTTATCGTAATTTTAATAGTAATTTTGAGTGCTGGGTTCGTTTCAGCTGGGGACATAGTTCATCAGGACAACGTTGCTCCAAAGAGACCTGGGTGTGCTAATAACTTTGTTCTGGTAAAAGTCCCCATCTGGATTGATGGTTTAGAAAACACAGAGTATGTTGGTGTTGGTGCTCGTTTTGGACCTACTATGGAATCGAAGGAAAAACATGCAAATCATACCAGGCTTGCACTTGCAGATCCTCCTGATTGCTGCAGCAAACCTAGGAATCAGCTTACAGGGGAGGTCATTCTAGTGCATCGGGGTAACTGTAGTTTCACTGTGAAGGCAAATGTTGCTGAAGAAGCTGGTGCTTCTGCGATCCTCATAATAAACAACCAAACAGAACTCTTCAAGATGGTTTGTGAATCAGATGCTGATGTAAATATAAAAATACCTGCTGTCATGCTTCCTCAGGACGCTGGTTCCAATTTGGAAAATTATATAAATAATAACACCAGGGTTTCTGTTGCGTTTTACTCCCCAAAGCGTCCGGCGGTTGATATTGCTGAAGTTTTTCTGTGGCTAATGGCTGTTGGTACCATTTTGCTTGCTTCTTATTGGTCTGCGTGGACTGCTAAAGAAGTTGCTATTGAGCAAGACAAGCTACTAAAGGATGCATCAGAAGAATTTCTACAAGTGGGAAGTGCAGGTTCAAGTGGTTTTGTTGACATAAATACAATGTCAGCAGTTCTCTTTGTTGTGTTTGCTTCATGTTTCTTGGTCATGCTTTACAAGCTTATGTCATTCTGGTTTGTTGAGGTCCTGGTGGTTCTCTTTTGCATTGGTGGAGTAGAGGGTCTGCAAATGTGCTTGGTGGCTTTGTTATCAAGTTTCAGGTGGTTTCAACGCTTTGCAGAATCTTTTATTAAAGTGCCCTTCTTTGGAGCTGTTTCCCATCTTACACTGGCTGTTTGTCCCTTCTGCATTGCATTCGCTGTTGTTTGGGCAGTGTATCGACGTATCTCCTTTGCCTGGATAGGTCAAGATATTCTTGGTATTGCGCTTATAATCACGGTCCTTCAGATTGTTCGTGTACCAAATCTCAAGGTTGGAACGGTTCTTTTGGGTTGTGCTTTCTTGTATGATATCTTCTGGGTCTTTGCTTCCAAATGGTTGTTTCATGAGAGTGTGATGATAGTGGTAGCTCGTGGTGATCGGAGTGGAGAGGATGGCATACCAATGCTACTAAAAATTCCGCGGATGTTTGATCCTTGGGGTGGTTACAGTGTTATTGGATTTGGAGACATAATCTTACCCGGACTGCTTGTGGCCTTTTCACTAAGATATGATTGGCTCGCAAATATGAATCTTCGAGCAGGCTACTTCGTATGGGCAATGACTGCCTATGGTTTAGGTCTTTTGGTCACTTATGTGGCCTTGAACCTGATGGACGGGCATGGCCAACCAGCTTTGCTTTACATCGTTCCTTTCACACTTGGGACCTTTATTACATTGGGAAAAAAGAGAGGTGATCTCAAAACTCTGTGGACACAAGGAGAACCGGAACGGCCTTGCCCCCACTTGCAACTTCAGCCGTTACAACAAAAAGATTAA >Gorai.004G212600 ATGGGTTTGCAGAGACTTTGTGGAGTAATCTTAGTATCAGCTCTGATTTCATTTGTCTGTCAGCCAAATTCTGTCATTGCCGGTGATATAGTACACGACGACAATTTAGCTCCCAAGAAGCCTGGTTGTGAGAACGATTTTGTTCTAGTCAAAGTTCAAACTTGGGTTAATTGCATAGAGGATTCTGAGTATGTTGGTGTAGGTGCCAGATTTGGCACTACGATAGTGTCGAAGGAGAAGAATGCAAACCAAAGATGCCTCATTCTTTCTGACCCTCGTGATTGTTGTAACCACCCAAAGAATAAGCTTGCTAATGATTTTATTATGGTGGACCGAGGCCACTGCAAATTCACAACCAAGGCAAATAATGCACAAGTAGCTCATACATCAGCTGTTCTCATTATAAATAACCAAAAAGAACTCTACAAGATGGTATGTGAGCCTGATGAAACTGATTAG >Gorai.005G128500 ATGTCGTTTCCTCCGGGGATCCGCCGCCGTTTTGTGGTGTCTTTTCCTTTATTGTTACTCGTGACTTCGTCTTTTGCTGTTGTTGCCACCGCCGACGGTGCTTCCCAGGACGACGGCCCTGAGCTACCTGCTTGCAACAACCCTTTCAAATTGGTCAAGGTAAAGATCTGGGTTGATGGTGTTGAAGGTGAAGATTTGTCTGGGATAACTGCGAGCTTTGGAGCATCATTGCCTGAGGAAGCCAACAAAAGTTCTAAATTGCCTACTGTTTTCTCAAATCCCCTAAATGGCTGTTCTAATTCTTCTTCAAAGCTAACTGGTTCTGTAGCCTTGTCCATACGTGGTGATTGTGACTTTGTAACTAAGGCAAAAGTTGCACAGTCAGGAGGTGCTTCAGCCTTGCTGGTGATAAATGACAATGAAGAACTTTACAAGATGGTTTGTTCTGAGAATGATACATCTTTAAATATTTCAATACCTGTTGTGATGATTCCGAAATCAGCTGGGGATGCAATTAACAAATCCATGGAAGAGAAACATGTGGAATTTTTATTATATGCACCAACTCGTCCGATTGTGGATTTCTCAGTGATATTTTTGTGGGCATTGGCTGTTGGCACGATTGTTACTGCTTCACTTTGGCAAGAGTTTGGCACTTCTGAGAATTCTGACGAACGCTATAATGAATTATCTAAGGAATCTCCTAATGCTGGAACAGGCGATGATGATGACAAGGAAATCCTTGATATTAGTGTAAAGGGTGCTATAGTTTTTGTTATAACGGCTTCCACTTTTCTGGTGCTACTCTACTTTTTCATGTCTGCTTGGTTTGTTTGGTTGCTGATTGTACTCTTCTGCATTGGTGGTGTTCAGGGAATGCATACTTGCATTATGACGCCTATAGCGAGCAGAAAGTGCAGAAATTGTCCGCAGAAGACACTGAATTTGCCCCTCTTTGGGGAGGTTTCAATTGTCTCATTTGTGGTTGCATTGTGCTGTTTGATATTTGCTGTTGTCTGGGCTGTCAACCGGCGAGAATCATATTCATGGGTGGGCCAAGATATTCTTGGGATCTGTTTGATGATAACAGTCTTACAGTTGGCTCGACTACCTAATATCAAGGTTGCTACAGTGCTTCTCTGTTGTGCATTTGTTTATGACATCTTCTGGGTCTTCCTATCGCCACTTATATTCCATCAGAGTGTGATGATTGTAGTTGCTCGAGGTGATAATAGTGGTGGAGAATCAATTCCCATGCTTTTGAGAGTTCCGAGAGCTTTTGATCCATGGGGTGGTTATGATATGATTGGATTCGGTGACATTCTCTTTCCTGGTTTGCTCGTTGCATTTGCTTTTAGATACGATAAAGCATACAAGAAGCATCTTGCCAGTGGATACTTTCTGTGGTTGATAATTGGCTATGGATTTGGGCTCTTGTTTACATACCTAGGGTTATATCTAATGAATGGACATGGTCAACCGGCACTCCTCTATCTTGTTCCTTGTACACTAGGTGTTACGGTTATATTAGGTTTGGTGAGAGGAGAGCTGAAAGAACTTTGGAATTACAGCCCTGAGTTGTCATCTGCCACGACAAATCTCACCGGAGAGGCTTGA >Gorai.007G099700 ATGGAAATAAATAGAGGCGTATTAATAGTAGTTTTAATTGTAGTTTCGAGTGCTGGGTTGGGTTTAGCTGGTGATATTGTTCATCAAGACGACGTTGCTCCAAAGAGACCTGGTTGTGCTAATAATTTTGTTCTGGTAAAAGTCCCGACATGGATTAATGGTTTAGAAGACAACGAATATGTTGGTGTTGGTGCTCGTTTTGGACCTACTTTGGAGTCAAAAGAAAAACATGCAAACCATACCAGGCTTGCACTTGCAGATCCTCCTGATTGTTGCAGCAAACCTAGGAATCAGCTTACAGGGGAGGTTATTCTGGTGCATCGAGGTAACTGTAGTTTCACAATGAAGGCAAATGTTGCTGAAGAAGCCGGTGCTTCTGCCATCCTCATAATAAACAACCAAACAGAGCTTTTCAAGATGGTTTGTGAATCTGATGCTGATGTAGATATAAAAATACCAGCTCTTATGCTCCCTCAAGATGCCGGTTCACGTTTGGAGAAATATATAAGTAACAACACCATGGTTTCTGTTGCACTTTACTCTCCCAAGCGGCCGGCAGTTGATATTGCTGAAGTGTTTTTGTGGTTAATGGCTGTTGGTACCATTTTGTGTGCTTCTTATTGGTCTGCTTGGACTGCTAGAGAAGTTGCTATTGAGCAAGACAAGCTGCTAAAGGATGCATCAGAAGAAATTCTAGAAGTTAGAGGTGCAGGTTCTAGTGGTTTTGTTGACATAAATACAATGTCAGCAATTTTCTTTGTTGTGGCTGCTTCATGTTTCTTGGTCATGCTCTACAAGCTTATGTCATTCTGGTTTGTTGAGGTTCTTGTGGTTCTGTTTTGCATCGGTGGAGTAGAGGGCTTGCAAACGTGCTTGGTGACTTTGTTATCATGTTTCAGGTGTTTTCAACGCTTTGCAGAATCATTTATTAAAGTACCCTTATTTGGAGCTGTTTCGCATCTGACACTGGCTGTCTGTCCCTTTTGCATAACATTTGCTGTTGTTTGGGCAGTGTATCGTCGTATATCCTTTGCCTGGATAGGGCAAGATATTCTTGGTATTGCACTTATAATCACAGTCCTTCAGATTGTTCGTGTGCCAAATCTCAAGGTTGGAACAGTTCTTCTGGGTTGTGCTTTCTTGTATGATATCTTCTGGGTATTTGTTTCCAAATGGTGGTTTCATGAGAGCGTGATGATAGTGGTAGCTCGTGGTGATAAAAGTGGAGAGGATGGCATACCAATGCTACTAAAAATTCCCCGGATCTATGATCCTTGGGGTGGCTACAGTGTTATTGGATTTGGAGACATTATCTTACCTGGACTGCTTGTGGCATTTTCACTAAGATATGATTGGCTGACAAAAAAGACTCTTCGAGCAGGGTACTTCATATGGGCAATGACTGCTTATGGTTTAGGTCTTCTAGTCACGTATGTGGCCTTGAACTTGATGGATGGACATGGCCAACCTGCGTTGCTTTACATTGTTCCTTTCATTCTTGGGACATTTATTACATTGGGGAAAAAGAGAGGTGATCTCAAAACTCTCTGGACAAGAGGAGAACCGGAAAGGCCTTGTCCGCATGTCCAACTTCAGCCCTTAGAACAGAGAGAATAA >Gorai.008G247500 ATGGATTTGCAGTTTTTTTGCAGAGTATTCTTAATTACAGCCCTGATTTCACTTGTCTGTCAAGTATGCTCTGTTACAGCCGGTGATATAGTGCACGACGATGATTTAGCTCCAAAGAAGCCCGGTTGTGAGAACGATTTCGTTCTGGTCAAAGTTCAAACTTGGATTGATGGCATAGAGGATGCCGAGTTTGTCGGTGTAGGTGCCAGATTTGGTACTACTATAGTGTCGAAGGAGAAAAATGCAAATCAAAGACGCCTCATTCTTTCTGACCCTCGCGATTGTTGTAGTGCCCCAAAGAATAAGCTTGCTAATGATGTCATTATGGTGGACCGAGGTCACTGCAAATTCACAACCAAGGCAAACTATGCACAGGCAGCTCATGCTTCAGCTATTCTCATTATAAATAACCAAAAGGAACTCTACAAGATGGTATGTGAACCTGATGAAACTGATCTAGATATACATATACCTGCTGTCATGCTCCCACAAGATGCTGGTACAAGCTTGGAGAAAATGCTGATTAGTAATTCATCAGTGTCTGTACAGCTTTACTCTCCGACACGACCGCTAGTTGACATAGCTGAAGTGTTTTTATGGTTGATGGCTGTTGGTACCATATTGTGTGCTTCATATTGGTCCGCATGGAGTGCAAGAGAAGCCGCAATTGAGCAGGACAAACTATTAAAGGATGCCTTGGATGAAATTCCAGACACCAGACCTGTAGGTTCTGGTGGAATTGTGGACATCAACACTACATCAGCCATCTTATTTGTTTTTGTTGCTTCTTGCTTCTTGGTTATGCTTTACAAACTTATGTCATATTGGTTTGTTGAGCTCTTGGTGGTTCTTTTCTGCATAGGTGGTGTGGAGGGCCTTCAAACTTGCTCGGTTGCTTTACTGTCAAGGTGGTTCAAGCGTGCTGGAAAATCATACATTAAAGTGCCTTTCTTTGGAACTCTCTCATACCTTACATTGGCAGTTTCCCCTTTCTGCATAGCATTTGCTGTTGTTTGGGCTGTTTACCGCAATGTTTCCTTTGCTTGGATAGGTCAAGATATACTAGGAATTGCTCTTATAATCACAGTTCTGCAAATTGTCCATGTACCTAATCTCAAGGTGGGAACAGTTCTACTCAGTTGTGCCTTCTTATATGACATCTTTTGGGTGTTTGTTTCAAAAAAGTTGTTCCATGAAAGCGTGATGATTGTGGTAGCTCGTGGGGATAGAAGCGGAGAGGATGGCATCCCAATGCTACTGAAGATCCCACGCATGTTTGATCCATGGGGCGGTTATAGCATAATAGGATTTGGTGACATCCTTTTACCTGGCCTGTTGATAACATTTTCACTCAGGTATGATTGGCTGGCTAACAAGACTCTTCGAGCTGGCTACTTTTTGTGGGCAATGATTGCTTATGGCTTAGGTCTTCTCATTACATATGTGGCTCTAAATTTAATGGATGGACATGGTCAACCAGCACTCCTTTACATTGTCCCTTTTACACTAGGAACCTTTTTAACCCTAGGAAAAAAGAGACGTGATCTAAGAGTTCTCTGGACAAGAGGAGAACCAGAAAGACCCTGTCCCCATATTCGACTTGAACACCAACATCGTGAAGAGCTGGACGACAACGACCATTAG >Gorai.011G143700 ATGTCGTTTCCTCTGGGAAACCGACGCCGGGTTTCGGCGACTCTTCCGTTTTCGTTTCTCGTCGCTTTGTCATTTGCTGTTGCCGCCATCGCTGGTGGCTCCAAGTCTCCTTACTGTAACAATCCTGTTCAACTGGCCATGGTGAAGATCTGGGTTGATGGTGATGAAGGTGAATATTTAGCTGGGTTAACTGCAAGCTTTGGAGCAACATTGCCTGAGGAAAAGAATAAAGTTCCCAAATTGCCTGCTGTTTTCTCAAATCCCCTAAATGGCTGTTCTAGTTCTTCTTCAAAGCTATCTGGCTCTGCGGCCTTGTCTGTACGAGGTGATTGTGACTTTGTAACTAAGGCAAAAGTTGCACAATCAGGAGGCGCTCAGGCCTTGCTGGTGATAAATGACAAAGAAGAGATTGAACAGATCGATTGTTCTGGTGATGTCAGTCCAAATATTTCGATACCTGTGGTGATGGTTCCAAAATCCGTTAGAGATGACCTTACCAAAACTATGGCAAACAAACGTGTTGAACTTTTACTATATGCACCAACTCGTCCCATCGTGGATATCTCGGTGGTATTTTTGTGGGCAATGTCTGTTGGCACAGTTTTTACTGCTTCACTTTGGCAAGAGTTTGGTATTTCTGAGCAAACTGAGAAACGATTAAATGAATCATCTTCAAAGGAGTCTTCCGATGCTGGAACAGACAGTGATAATGATCAGGAAACCATTGATATTAGTGTAAAAGGTGCTATACTTTTTGTGATATTAGCATCTGTTTTTCTGCTGCTACTCTTCTTTTTCATGTCTTCATGGTTTTTGTTGGTGTTGACTGTACTCTTCTGCATCGGTGGTGTCCAGGGGATGCACAATATCATTATGACTCCGGTAACAAGAAAATGCAGAAATTGTCCTCAGAAGACAGTGAGATTGCCTGTCATTGGGGAGGTTTCTGTTCTCTCACTTGGGGTTTTCCTATTCTGTGTGATATTCGCTGTTGCCTGGGCTGTTCATCGACGAGCATCTTATTCATGGGTGGGCCAAAATATTCTTGGTATTTGTATGATGATAAATGTCTTACAGTTGGCTCGACTACCTAATATCAAGGTTGCTACGGTGCTTCTGTGTTTGGCATTTTTTTATGACATTTTCTGGGTCTTCATATCACCGCTTATATTCCAGCAGAGTGTGATGATTGCAGTTGCTAAAGGAAAGAATACCGGTGGAGAAGCAATTCCCATGCTCTTGAGAGTTCCTAGACTTATTGATCCTTGGGGTGGCTATAATATGATTGGATTTGGGGACATTCTCTTTCCTGGTTTGCTTATTACATTTACGTACAGATTTGATAGAGAAAGCAAAAAGAGTATGGGCAAAGGGTATTTTGTGTGGCTGATGGTTGGCTATGGATTTGGCCTCTTCTTGACATACCTAGGCTTATACCTGATGAACGGGAACGGTCAGCCAGCACTCCTCTATCTCGTTCCTTGTACACTAGGAGTTACAGTTGTATTAGCTGCAATAAGAGGAGATTTGAAAGCGCTCTGGGGTTACAGCAGCAAGTCATCTGCCATGATAAATCCCACTGCAGAAGTTTGA >Cre07.g332786 ATGAAAGGCCGTTGGGCGGAGCGCTTTGCTTTCTTGTTGCTCTCAGCCTTCCTAATCCTTGCATCATTGTTGCAAGCGTCTGCAAGAGGAGATGAGTGCTTTGGCCCTGTCGTGGAGCTGGACGCAGATGGCCAGGGCCCAAAGTTCGGTGTGCTTGGTGGTTTCGGCAGCAATTTGACGGAGCCCCTTGTATCGCTAAAGCTGGTAGCAGCGAATCCGGCGGACGCGTGTGGCGAACTGGCGGGAGCACTGGCTGGCGCGGCGGTGATTGTGGTCCGCGGAAACTGCACCTTCACGGAGAAAGCCGCCGCCGTACAGGCCGCGGGGGGCGCCGCCATGCTGCTATACGACAGCCAGGTCGGCGGCTGCGTCACCATGGGCTTCGAGCCCAACGCCACGTCGAGCCTGACGCTGGCGGCCGTGTCCATTCCGCACGAGCTGGGGCTTCAGCTGCTGGGGCTGGTGGCTGGTGGGGGCAGCGCAGGCGGGGCCGGCGAGGCGCGCGTTTCGCTGCGGCGTGTGTCCGTGCCGCTGGTAGACTCGGGCGCGGTGCTGCTGTGGGTCCTGGCGGTGGGCACCGTCATTGCTGGCAGTGTGTGGGGCGGCCTGGACCACCTGACGCACCGCCGCACGGCAGAGGACCAGGCCCCACTCATCCACGCCGCCCACAAGCCGGCCTCGGCTGAGACGGTTGACCTGACCCCCAGGGCGGCGCTGGCATTTGTGGGCCTGGCCAGCTGCATGCTGCTGCTGCTCTACTTCGTGCTCAACAAGGCCTTCTTCTACGTACTGCTGGTGCTGTTCTGCGTCGCCTCGGTGCAGTCCCAGACAGTGCTGTACGCGGCGGCGCTGGCGCAGCTGCTGCCGCCGGCGAGGAAGAACGCACACGTGCAGCTGCCCTGGCTGGGCGCCACGCCGCTGACGGTGGTGGCCACGCTGCCGCTGGCGGTGGCGGTGGCGGCGGTGTGGGCGGTGTGGCGCAACTCGGCCTGGGCCTGGGTGCTGCAGGACCTGCAGGGTGTGGCGCTGATGCTGCTGGTGCTGCGCACGCTGCGTGTGCCCAGTCTCAAGGTGGCGTGCATCCTGCTGCCCGCCTGCCTGGCCTACGACGTGTTCTGGGTCTTCATCCAGCCGCTGCTGTTCGGCGGCGGCGAGTCGGTCATGGTGCACGTGGCGCAGGGCGGCAGCAGCGGCGAGTACATCCCCATGCTGCTGCGCGTGCCGCACTTTGGATTCGGCGGCCTGGCCGGATACTCGCTCCTAGGCTTTGGAGATGTCATCCTGCCCGGCCTGTTGGTCGCGTACACACGCCGAGCGGACCTAGACCTGGGACTGGCGGTGGGCGCCAGCGCCTCCGCCGCCGCCTCCATACAGTACTTCCTCAAGGTCTCGTACTTTCCGTACGCCGTGCTGTCGTACGGCGCGGGGCTGTGCCTGACGTACGCGGCGCTGGCGTTCTCCTGGTTTGGCGACCAGGGCCAGCCCGCGCTGCTGTACCTGGTGCCCTGCACGCTGGGTACCGTGCTGGCCTTGGCGGCGGCGCGCGGGCAACTGGGGCTGTTGTGGCGTGGCGCGCATGGGCCCGGAGGGAGGCTGGGCGCGGGAGACCACGACTCGGACGCAGGGGAGGAGGGGGCTAGGTTGGCAGGTGCTGGGCTAGGGGGAGCGGGCGGGGGAGGCGTGGTGGGGAATGGGGCGGGCCAAGTGGGGCCACTGGCGGGGCTGGCGGCGGGTGTGGCGGACGAGGATGGGGATGTGGAGGCGGGCGGGCGGGGTATAGGCCGCGCGCACCGGAGCTCGAGCGCGGTGAGCGCTGCGGCGCGCGCGAGAGGGTGA >C.cajan_08016.g ATGGCGTCCCCTTCTCTGGCGGTGGCCCTCCTCCTTCTCTTCTTCAACTTTGCGTCGGCCGCCGATGACGCCCTCTGCAATCATGACTTGCAATTGGTGAAGATAAAGAGCTGGGTTGACGGGAACAGAGATACAGAGTATAATGGTATGACTGCAGCATTTGGCTCTTATTTGCCTCAGAATCTTGATCAAGCTGTCAAATCTCCTGCAATTTTTGCTGATCCTATGGACTGTTGTTCCGCTTCAACCGCAAAGTTCTCTGGATCAGTTGTTCTATGTGTACGAGGTACTTGTGACTTCACAACCAAAGCTTCAATCGCACAGTCCGGAGGCGCTGCTGCCGCATTGATGATAAACGACGCAGATGAACTCTTTGAGATGGACTGCTCCTCCAATGACACTAGGACAAATATTTCAATTCCGATCGTGGAGGTAACAAAGACAACCGGAGAAACTCTCAAAAACTTTTTGACACCTAAAAGGAAAGTTGAGGTTTTGCTATATGCTCCAACTCGCCCAGTTGTAGACTACTCAGTTGTCTTTTTGTGGTTGATGGCTGTTGGAACGGTTATATGTGCTTCACTATGGTCAGATATAACTACTCCTGATCAATATGATGAACGCTATAATGAATTGTCTCCCAAGGGAACTAAGACTGAAGCAGGGAAAGATGATTCTGAGGACTTGGTTAACATAGATACAAAGGGTGCTATCGTCTTTGTTATTTCAGCATCTACTTTTCTTGTGCTACTGTTCTTCTTCATGTCCTCTTGGTTTATATGGGTTCTGATCGTACTTTTCTGCATTGGTGGTATTGAGGGGATGCACAATTGTATTGTGAGCCTTGTTTTAAGAAAACGTCCAAATTGTGGTCAGAAGACTCTGAATTTACCAATGTTCGGAGAGGTTTCTATTTTCTCGCTGATAGTGTTACTATTCTGCGTGATATTTGCGGTTCTATGGATTGTTTTTCGGCACGAAGCATTTTCATGGTTTGGGCAAGATTTTCTTGGCATCTGTTTGATGATAACAGTCTTACAGATGGCTCGATTGCCTAATATTAAGGTTGCAACTGTACTCCTTTGTTGTGCATTTATATACGACATCTTTTGGGTATTCATATCTCCAGTGATATTCAATAAGAGCGTTATGATTACAGTTGCTCGTGGTGACAAGGCTGGTGGTGAAGCAATTCCTATGCTTTTGAGATTTCCTCGTCTTTCTGATCCTTGGGGTGGCTATGATATGATTGGATTTGGAGATATTCTCTTTCCTGGTTTGCTTGTTTCCTTTTCTCGCAGATTCGATAAAGATAATAAGAAGGTTGGCTTTAGCGGATATTTTCCTTGGTTGATAGTTGGCTATGGCTTCGGCCTCTTCTTCACATATCTGGGGCTATATATGATGAACGGTCATGGACAACCTGCACTGCTCTACCTTGTACCGTGTACACTAGGGGTCACTGTGGTATTGGGATGCAAAAGAGGTGAGCTAAAGAGCCTTTGGAGTTATGATGCAGACTCGCCTACGTCCACCAAAGAACCTTCTCAAGTTTAG >C.cajan_13210.g ATGCCTTCGGAGAAGACTTGCTGGATTCTTTTCTTTTCTGTTGTTATTTTTCTTCTCCGTCATGCTCCTTCTGTTATAGCTGGGGACATAGTTCACGACGATGATTCAACTCCCAAGAAACCCGGTTGCGAGAACCAGTTCGTTCTGGTAAAAGTGCAAACTTGGGTCAATGGTGTAGAGGATGTTGAATTTGTTGGTGTCGGTGCAAGATTTGGCAGAGCGATTGTGTCTAAAGAGAGAAATGCACGGCACACGCGCCTTGTTCTTTCAGATCCTCGTGATTGTTGCAATCCACCAAAGAATAAGATTGTGGGAGATGTCATCATGGTGGATCGAGGCAACTGCACATTCACAAAAAAGGCAAATATTGCACAGAATGCTAATGCTTCAGCCATCCTCATTATAAATAACCAAAAAGAACTTTACAAGATGGTTTGTGAACCTGATGAAACTGATTTGAACATACACATACCGGCTGTCATGCTTCCGCTAGATGCAGGTACAAGGCTGGAAAAAATGCTGACGAGTACTTCATCTGTGTCTGTGCAGCTATACTCACCACTTCGACCAGCTGTTGACATAGCTGAAGTATTTCTTTGGATGATGGCAGTTCTTACTATATTGTGTGCATCATATTGGTCTGCTTGGACTGCCAGAGAAGCAGCTATTGAACAGGATAAGCTACTAAAGGATGCTTCAGATGATATCCCAAACACAAAATATGCTGGTGTTAGTGGAGTTGTAAATATGAATGTGAAAGCTGCAGTCCTTTTTGTTGTATTTGCTTCATGTTTCCTGTTTATGCTTTACAAACTGATGTCGTCATGGTTCATTGACGTTTTGGTTGTTCTCTTCTGTATTGGTGGAATTGAGGGCTTGCAAACTTGCCTGGTTGCTCTTTTGTCCAGGTGGTTCAAGAATGCTGGAGAGCCATGCATCAAAATACCTTTCTTAGGAGCTATCTCATACTTGACTTTGGCTGTTTCTCCATTCTGTACAGCATTTGCCGTTCTCTGGGCAGTTTATCGCAACCAATCCTTTGCCTGGATTGGTCAAGATATACTTGGAATTGCACTGATTATCACAGTTCTACAGATTGTACATGTACCAAATCTCAAGGTTGGTACAGTTCTTCTTGGTTGTGCCTTCATTTACGACATCTTTTGGGTGTTTGTCTCAAAGAAGTTTTTCAAGGAAAGCGTCATGATTGTGGTTACCCGAGGTGATCGAAGTGGAGAAGATGGAATTCCCATGTTACTGAAGTTCCCACGCATTTTTGATCCATGGGGTGGGTACAGCATCATAGGTTTTGGAGACATCCTTTTACCAGGAATGCTGGTGGCATTCTCACTCAGGTACGATTGGCTGGCAAATAAGAGCCTTAGAGGTGGATATTTCTTGTGGGCAATGTTTGCATATGGCTTTGGTCTTTTAGTTACGTACGTGGCACTAAACTTGATGGACGGGCATGGCCAACCAGCACTACTATACATCGTTCCATTTACCCTTGGGACCTTGATGACATTGGGGCGGAAGCGAGGAGATTTGAGGGTATTGTGGACAAGTGGAGAACCTGAAATACCGTGCCCACATATAAGACTTGATCAACAATTAAGCCCTGAATGCCATTAG >C.cajan_18268.g ATGGCTTCACTTGGAGCTACCTGTGCTGTGTGTTCTGTGTTCATGATGTTTGTCACCTTCACTCTCGCTGGGGACATAGTGCACCCTGATAATATTGCCCCCAAGAAGCCTGGCTGTGACAACAACTTTGTCCTGGTTAAAGTCCCAACTTGGATTGATGGTGTGGAAAGCTGTGAGTATGTTGGTGTTGGTGCAAGATTTGGCCCGACATTGGAATCTAAAGAAAAGCATGCTAACCATACTAGAGTTGCCATTGCGGACCCTCCTGATTGTTGTAGCAAGCCTAAGAATAAGCTCACTGGCGAGGTCATTTTGGTGCACCGAGGACAATGTAGTTTCACAACCAAGGCAAATATAGCTGAAGAAGCTGGTGCTTCAGCCATCCTCATTATAAATTATCGTACAGAACTTTTCAAGATGGTCTGTGAAGCGAATGAAACTAATGTTGATATTGGAATACCTGCTGTAATGCTTCCGCAAGATGCCGGTGAAACCTTGGAAAATCGTATACTAAACAATTCAGTAGTGTCTGTGCAGTTGTATTCTCCACTGCGTCCATTGGTTGATGTTGCAGAAGTGTTTTTATGGCTTATGGCCGTTGGTACCATTCTCTGTGCTTCTTATTGGTCTGCTTGGACTGCCAGAGAGACGGCTGTTGAGCAGGAGAAGCTATTAAAGGATGCTTCAGATGAATATGTAAATGCTGAGAATGTTGGTTCTAGTGCTTATGTGGAAATCAGTACTGCAGCAGCAATATCATTTGTTGTGATTGCTTCTTGTTTCTTGGTTATGCTTTACAAATTGATGGCATCATGGTTTGTTGAAGTTCTGGTGGTTCTATTTTGCATTGGTGGGGTTGAGGGGCTACAAACTTGCTTGGTGGCCTTGTTATCATGTTTCAGATGGTTCCAACATGCTGCACAAACATATGTCAAAGTACCCTTCTTTGGTGCTGTATCATATCTGACAGTTGCTGTTACTCCCTTCTGCATAGTGTTTGCTGTGCTTTGGGGAGTTTATCGTCGTGTATCATTTGCTTGGATTGGTCAAGATATTCTTGGCATTACATTGATAATTACAGTTCTACAGATTGTTCGCATACCAAATCTCAAGGTTGGAACTGTTCTTCTCAGTTGTGCCTTCCTATATGACATCTTTTGGGTGTTTGTCTCTAAATGGTGGTTCCATGAGAGTGTGATGATAGTGGTAGCTCGAGGTGATAGGAGTGGAGAAGATGGTATCCCCATGCTACTCAAGATACCACGTTTGTTTGATCCTTGGGGTGGTTACAGTATCATTGGTTTTGGGGACATCATCTTACCAGGGCTTCTAGTAGCATTTTCACTGAGGTATGATTGGTTGGCAAAGAAGAACCTTAGGGATGGATACTTTCTGTGGGCAATGACTGCTTACGGTTTAGGTCTCCTTATCACATACGTGGCTTTGAACTTGATGGATGGACATGGTCAACCGGCTTTGCTTTATATAGTCCCATTTACACTTGGTACCTTTTTGTCACTGGGAAAGAAGAGAGGTGAACTCAAGATTTTATGGACAAGAGGTGAACCAAAAATACTTTGCCCGCACATCCAAGAGGATCAATCAACAAATCAGTAA >C.cajan_19107.g ATGTCGTCTCGCGTGTTGCTGTTTGTGTTGTTTGTGATTGCAGCGAGCGCCGACGATGCCAAACGCGACGACGACAGGGCTCCCAAGTCCGAATCCTGCAATAACCCCTTCCAATTGGTGAAGGTGAAGAACTGGGTTGATGGTGAAGAAGCCGATGTTTATAACGGTGTGACTGCAAGATTTGGCTCTCTATTGCCCGAGAAACCTGAAAATAGTGTTAGAACTCCCGCTATTTTCTCCAATCCCGTTGACTGCTGTTCCACTTCAACTTCAAAGCTATCTGGATCAGTTGCTCTCTGTGTGCGTGGGGGTTGTGACTTCACAACTAAAGCTGCGTTTGTGCAGTCTCGAGGTGCTACTGGCATGTTGGTTATAAATGACGCTGAAGATCTCTTTGAGATGGTTTGCTCTAATAGCAGTGAGACAAACATTTCAATTCCAGTAGTGATGATAACAAAGTCAGCAGGTGAAGGTCTCAACAACTCTTTGACATCTGGAAGGAAAGTGGAAATTTTGTTATATGCTCCACCTCGGCCACTTGTAGACTTGTCAGTTGCATTTTTGTGGTTGATGTCTGTTGGAACAATTGTATGTGCTTCACTATGGTCAGATCTAACTACTCCTGAGAAGTCTGATGAACGCTATAACGAATTGTGTCCCAAGGAATCTTCAAATGCTGGAACAACGAAAGATGATTTTGACAATGAAATTGTTAACATTGATTCAAAGGGTGCTATCATATTTGTCATAGCAGCATCTACTTTTCTTGTGCTATTGTTCTTCTTCATGTCATCTTGGTTTGTCTGGGTGCTGATTATACTTTTCTGCATTGGTGGTATTGAGGGCATGCATAATTGTATTGTAAGCCTCACTTTAAGAAAATGCCAAAATTGTAGTCAGAAGATAGTGAGTTTACCTCTATTTGGGGAGATTTCTATTTTCTCATTGGTAGTATTGATATTCTGTGTGGCATTTGCGGTTTTCTGGGCTGCTACTCGACAGGAATCATATTCATGGATTGGCCAAGATATTCTTGGCATCTGTTTGATGATAACAGTCTTGCAGTTGGCTCGATTACCGAATATTAAGGTTGCAACTGTACTCCTTTGTTGTGCCTTTGTCTATGACATTTTTTGGGTATTCATATCTCCAGTGATATTCCACGAGAGTGTTATGATTGCAGTTGCTCGAGGTGACAAGGCTGGCGGGGAAGCAATTCCTATGCTTTTGAGATTTCCCCGTCTCTTTGATCCCTGGGGAGGTTATGACATGATTGGATTTGGAGATATTCTCTTTCCTGGTTTGCTTGTTTCCTTTGCTCATAGATTTGACAAAGATAATTGGAGAGTAGCAAAAAATGGATATTTTGTTTGGTTGGTAATTGGCTATGGCATTGGCCTCGTTTTCACATATTTGGGGCTATATCTGATGGATGGAAATGGACAACCTGCGCTTCTCTACCTTGTTCCATGTACACTAGGTGTCACTGTCATATTGGGATGTGTAAGAGGCGAGTTGAAGACCCTTTGGAATTATGGCACAGACTCATCGTTGTCCACTGAGCCTTCTGAAGTTTAA >C.cajan_20733.g ATGGTGTCACTGGGAGCTACATATAGTGTGGTCTATGCGTTTCTGCTTGGTGTCACTTTGGTTTTGGGTGGGGATATAGTTCACCATGATGATGTAGCCCCCAGAAGGCCTGGTTGTGAGAACAACTTTGTTTTGGTAAAAGTCCCCACTTGGATTGATGGTGTGGAAAACAATGAGTATGTTGGTGTGGGTGCAAGATTTGGCCCTACATTGGAATCAAAAGAAAAACGTGCCAATCTTACAAGAGTTGTCATGGCTGATCCTCCTGATTGTTGTACAAAGCCTAAGAATAAGCTCACCAGCGAGATCATTTTGGTGCACCGAGGAAAATGTAGTTTCACAACCAAGGCAAATATAGCTGATGAAGCTGGCGCTTCAGCCATCCTCATTATAAATTACCGTACAGAACTTTTCAAGATGGTTTGTGAAGAAAATGAAACTGATGTTGATATTGGAATACCTGCTGTCATGCTTCCGCAAGATGCTGGATTGAACTTGGAAAGGCATATAAAAAATAACTCCAATGTCTCCATACAGTTATACTCTCCACTGCGTCCATTGGTTGACGTTGCAGAAGTGTTTTTGTGGCTCATGGCTGTTGGTACCATTATAAGTGCTTCTTATTGGTCTGCCTGGAGTGCCAGAGAAGCGGCTATTGAGCAAGAGAAGCTTCTAAAGGATGCTTCAGATGATTATGCTAATACAGAAAATGTTGGTTCCAGTGGTTATGTGGAAATCAGTACTGCAGCAGCAGTTTTATTTGTCGTGATTGCTTCTTGTTTCTTGGTTATGCTGTATAAATTAATGTCATTTTGGTTTGTTGAAGTTCTGGTGGTTCTGTTTTGCGTTGGTGGGGTAGAGATCATAATCAATTTACTGATCAACCAGATTCCATGCTTTACTTTAGGACTGCAAACTTGTTTGGTGGCTCTGTTATCATGTTTCAGATGGTTTCAACCATCAGCACAAACATTTGTGAAGATACCCTTCTTTGGAGCTGTCTCATATCTGACACTTGCTGTTACTCCATTCTGCGTAGTGTTTGCCGTGGTTTGGGCAGTTTATCGCCGTGCATCATGGGCTTGGATTGGTCAGGATATCCTTGGTATCACATTGATAATTACAGTTCTTCAGATTGTTCGCATACCAAATCTCAAGGTTGGAACTGTCCTTCTCAGTTGTGCCTTCCTATATGACATCTTCTGGGTGTTTGTCTCTAAATGGTGGTTCCATGAGAGTGTGATGATAGTGGTTGCTCGAGGTGATAAGAGTGGAGAAGATGGTATCCCCATGCTTCTCAAGATACCACGTCTGTTTGACCCTTGGGGTGGTTACAGTATCATCGGATTTGGGGACATAATCTTACCAGGACTTATAGTAGCATTTTCGCTAAGGTATGATTGGTTGGCAAAGAAGAACCTTCGGGCTGGATACTTCTTGTGGGCAATGACTGCTTATGGTTTAGGTCTCCTCATCACATATGTGGCTTTGAACTTGATGGATGGGCATGGTCAGCCGGCTTTGCTTTATATAGTCCCATTTACACTTGGCACCTTTTTGTCATTGGGAAAAAAGAGAGGGGAGCTCAAGATTTTATGGACAAGAGGGGAACCAGAAAGGCCTTGCCCTCATATCCAAGAGGATGACCAATCAATTAACAGCCACCATTGA >Achn096031 ATGAGAGATGGACAGCAAGCCAATACTAGAGCTGTACAAGATGATGCTGAGAAGGAAGTCCTTGACATTACTGCGAAGAGTGCTATAGTTTTCGTCATAACAGCATCCACGTTTCTGGTGTTACTCTATCTGTTTATGTCATCGTGGTTTGTGTGGTTGCTGATTGTACTTTTCTGTATCGGTGGTATTGAGGGTATCTGCTTGATGATAACAGTTCTGCAGTTGGCTAGATTACCTAACATAAAGGTTGCTCGAGGTGACAACAGTGGTGGAGAATCAATACCAATGCTGTTGAGAGTTCCTCGACTTTTTGATCCTTGGGGCGGCTATGATATGATTGGCTTTGGAGACATTCTCTTTCCTGGTCTCCTAGTTTCATTTGCTTTCAGAAAGTTGCAGATAAGTGTGGATATGGACTTCCAGTACACACCACGTGGCCATCAAGTAACGCCACGAAGCCAATTCCAGGTAACGCCACGAAGCCAACTCCAAGTGATGCCACGAAAATAA >Achn188581 ATGAAGTCTTTATGTGCGATGGATTTGCGGAGAATTCGCTGCGTAGTGTGCATATACGCAGTAGTGTTGCTCTTCTTCAACAGCCCTTGTTCGGTGACCGCCGGCGACATCGTTCACGATGACGATTCGTCTCCGAAGAAGCCTGGTTGTGAGAATGATTTCGTACTGGTAAAAGTTCAAACTTGGATTGATGGCATAGAGGACAGCGAATATGTTGGTGTTGGTGCTCGATTCGGCACAACCATTGTGTCGAAGGAAAAAAATGCAAACCAAAAGCGTCTTACACTTGCAGATCCTCGTGATTGTTGTAGTGCACCAAAGAACAAGCTTACTGGAGATGTCATCATGGTGTACCGAGGTCACTGCAAATTCACAACCAAGGCAAATGTTGCACAAGCTGCCGGTGCTTCAGCAGTCCTCATTGTAAATAACCAGAAAGAGCTTTATAAGATGGTTTGTGAACCTGATGAAACGGATTTAGATATACACATACCTGCTGTCATGCTCCCACAAGATGCTGGTGCCAGCTTGGAGAAAATGCTGATGAATAGTTCATCTGTGTTTGTGCAGCTATACTCTCCACGACGACCACTAGTTGACATAGCCGAAGTTTTCTTATGGCTGATGGCAGTTGGTACCATCTTGTGTGCATCTTATTGGTCTGCATGGAGTGCAAGAGAAGCGGCTATTGAACAGGATAAGCTATTAAAAGATGCTTCAGATGAATTCCCCACTGTCAAAGACACTGGTACTGGTGGTGTGGTCGACATTAACACAGCATCAGCAATCTTGTTTGTTGTAGTTGCTTCATGCTTCCTGGTTATGCTTTATGAATTCATGTCCGACTGGTTCATTGAACTCTTGGTGGTTCTTTTTGCCATTGGTGGCGCAGAGGGCCTGCAAACGTGCTTAGTTGCATTTCTATCAAGGTGGTTCAAACGTACTGCAGAATCCTTCATTAGAGTACCGTTCTTAGGAGCTGTCTCACACCTTACTTTGGCTGTTTCTCCGTTCTGCATAGCATTTGCTGTTGTTTGGGCAGTTCGCAGAACTGTCTCCTTTGCTTGGATAGGCCAAGATGTGCTTGATTTTTCTGAGTTCTCGCAACGTCAAATTATGATACTTTTGTTTTATATCTTCTTTGATCAGGGAATTGCACTGATAATTACAGTTCTTCAGATTGTGCGGATACCTAATCTCAAGGTGGGTACTGTTCTTCTCAGTTGTGCCTTCTTGTATGACATATTCTGGGTGTTTGTTTCCAAGAAGTTGTTCCACGAAAGTGTGATGATTGTGGTGGCTCGTGGTGATAGAAGTGGAGAGGATGGTATTCCAATGCTACTGAAGATTCCACGCATGTTCGATCCGTGGGGTGGTTACAGTATCATCGGCTTCGGTGACATCCTTTTACCAGGATTGCTGATAGCATTTTCTCTTAGGTATGATTGGCTGGCGAAGAAGAATCTCCGTGCTGGATACTTCTTGTGGGCAATGCTTGCTTATGGATTAGGGACGTTTTTGGCACTCGGGAGGAAGAGGGGCGATCTGAAGTTTCTGTGGACGAAAGGGGAACCGGAGAGGGTTTGCCCTCATGTCCGACTTGAACCCGCCGAAGAATCAAGTCAAGAAGAGAACTGA >Achn197221 ATGAGTTGGGCCCACCCACCGTACCCTCAAAGAAAACCCTGCGTACATGCATTGTACCTGGAAAATCTAATCAACATTAACAAAAAAACAAAGGTGAAAATCCCGATTTTCATTGATGGCAAAGAAATGAGTGAAATTGTCGGTGTTGGTGCTCGCTTTGGCCCTACGTTGGAATCAAAAGAGAAGCATGCTAACCAGACCATACTTGCCCTTGCAGACCCACCTGATTGCTGCAGTGAGCCCAAAAACAAGCTCACGGGGGAGGTCCTCCTGGTGTACCGGGGTAAATGCAGCTTCACAGCCAAGGCAAATGTTGCAGAAGCTGCTGGTGCTTCAGCCATCCTCATTATAAACAACTGTGCAGAACTTTTCAAAATGGTCTGCGAAGCCAATGAAACTGATGTAGACATACGCATACCTGCTGTCATGCTCCCACAAGATGCTGGTGTGAGCTTGGAAGAAAATTTACTGAACAATTCCTCTGTTTCGGTGCAGCTATACTCTCCAAAGCGCCCATCGGTCGACGTAGCCGAAGTATTTTTGTGGCTTATGGCTGTTGGTACTATTTTATGCGCATCTTATTGGTCTGCTTGGAGTGCCAGAGAAGCAGCTATTGAGCAGGACAAGCTCTTAAAGGATGCTTCGGATGAATTTTTAAGCAATGAAGCCTCTGGTTCTAGCCGTGTGGTTGACATCAGCACGACATCAGCAATTCTCTTTGTTTTGATTGCTTCGTGTTTCTTGGTCATGCTTTACAAGCTAATGTCACTCTGGTTTATTAAGGGTCTGGTGGTTCTGTTTGCCATTGGTGGGGCAGAGGGTCTGCAAACTTGCTTGGTGGCTCTGTTATCAAGTTTCAGATGGTTTCAACATGCTGCAGAATCATTTGCTAAAGTACCCCTCGTTGGAGCTGTCTCATATCTGACGCTAGCTGTCTCTCCATTTTGCATAGCATTTGCTGTTGTTTGGGCTGTTTTTCGCCGTGTCTCCTTTGCTTGGATTGGTCAAGATATCCTTGTAGGAACAGTTCTTCTCAGTTGTGCTTTCTTGTACGACATTTTCTGGGTATTTGTTTCCAAATGGTGGTTCCACGAGAGTGTGATGATTGTGGTTGCTCGCGGTGACAAGAGTGGAGAAGATGGCATACCAATGCTCCTAAAGATCCCTCGGATGTTTGATCCTTGGGGTGGCTACAGTATCATTGGATTTGGTGACATTATCTTACCAGGACTGATTGTAGCATTTTCTCTAAGGTATGATTGGCTGTCAAAGAAGAATCTTCGGGCTGGATACTTCTTATGGGCAATGACGGCTTACGGGTTAGGTCTCCTCATCACATATGTGGCTCTGAACTTGATGGATGGACATGGCCAACCAGCTCTGCTTTACATTGTTCCTTTCACACTAGGCACCTTCTTGACATTGGGAAGACAGAGAGGTGATCTCAATAATCTATGGACGAGAGGAGAGCCGGAGAGACCTTGTCCACATGTCCAGCTACAACCTCCCCAATAG >Achn336351 ATGACGAAGAACGCTAGTAAAAACATAGACGATCAAAAGCAGCAAAAAGGCTGCAACGAGAAGAGAGAGGGAGAGTTTTTGATGGACTCGAAGTCAGCTCTAAAGGCCGTGTTTGGTCTTCTGCTTGTACTGTTCTGGTCTTCTTCGGTGTATGCCGGTGATATAGTTCACCAGGACGATAAAGCCCCAATGAGGCCTGGCTGCGAGAATAACTTTGTTCTGGTGAAAATCCCGATATACATTGATGGAAAAGAAGCGAGTGAAATTGTCGGTGTTGGTGCTCGCTTTGGCCCTACCTTGGAATCGAAAGAGAAGCATGCCAGCCAGACCATACTTGCCCTTGCAGATCCACCTGATTGCTGCAGTGTGCCCAAAAACAAGCTCACGGGGGAGGTCATCCTTGTGCACCGGGGTAATTGCAGCTTCACAGTCAAGGCAAATGTTGCAGAAGCTGCTGGTGCTTCAGCCATCCTCATCATAAACAACCGTGCAGAACTTTTCAAAATGGTCTGCGAAGCCAATGAAACTGATGTAGAAATAGGCATACCTTCTGTCATGCTCCCACTAAGTGCTGGTTTGAGCTTGGAAGAAAGTTTACTGAGCAATTCCTCTGTTTCGGTGCAGCTATACTCTCCAAAGCGCCCATCGGTCGACGTAGCTGAAGTATTTTTGTGGCTTATGGCTGTTGGTACTATTTTATGTGCATCTTATTGGTCTGCTTGGAGTGCCAGAGAAGCAGCTATTGAGCAGGACAAGCTCTTAAAGGATGCTTCAGATGATTTTTTAAGCACTGAAGCCTCTGGTTCTAGCCGTGTGGTTGACATCAGCATGACATCAGCAATTCTATTTGTTGTGATTGCTTCATGTTTCTTGGTCATGCTTTACAAGCTAATGTCACTCTTGTTTATTGAGGTTCTGGTGGTTCTGTTTGCGATTGGTGGGGCAGAGGTGAAAATCCCGATATACATTGATGGAAAAGAAGCGAGTGAAATTGTCGGTGTTGGTGCTCGCTTTGGCCCTACCTTGGAATCGAAAGAGAAGCATGCCAGCCAGACCATACTTGCCCTTGCAGATCCACCTGATTGCTGCAGTGTGCCCAAAAACAAGCTCACGGGGGAGGTCATCCTTGTGCACCGGGGTAATTGCAGCTTCACAGTCAAGGCAAATGTTGCAGAAGCTGCTGGTGCTTCAGCCATCCTCATCATAAACAACCGTGCAGAACTTTTCAAAATGGTCTGCGAAGCCAATGAAACTGATGTAGAAATAGGCATACCTTCTGTCATGCTCCCACTAAGTGCTGGTTTGAGCTTGGAAGAAAGTTTACTGAGCAATTCCTCTGTTTCGGTGCAGCTATACTCTCCAAAGCGCCCATCGGTCGACGTAGCTGAAGTATTTTTGTGGCTTATGGCTGTTGGTACTATTTTATGTGCATCTTATTGGTCTGCTTGGAGTGCCAGAGAAGCAGCTATTGAGCAGGACAAGCTCTTAAAGGATGCTTCAGATGATTTTTTAAGCACTGAAGCCTCTGGTTCTAGCCGTGTGGTTGACATCAGCATGACATCAGCAATTCTATTTGTTGTGATTGCTTCATGTTTCTTGGTCATGCTTTACAAGCTAATGTCACTCTTGTTTATTGAGGTTCTGGTGGTTCTGTTTGCGATTGGTGGGGCAGAGGTAGGAACAGTTCTTCTCAGTTGTGCTTTCTTGTACGACATTTTCTGGGTATTTGTTTCTAAATGGTGGTTCCACGAGAGTGTGATGATTGTGGTTGCTCGTGGTGATAAGAGTGGAGAAGATGGCATACCGATGCTCTTAAAGATCCCTCGGATGTTTGATCCTTGGGGTGGCTACAGTATCATTGGATTTGGTGACATTATCTTACCAGGACTGATTGTAGCATTTTCTCTAAGGTATGATTGGCTTTCAAAGAAGAATCTTCGGGCTGGATACTTCTTATGGGCAATGATTGCTTACGGGTTAGGTCTCCTCATCACATATGTGGCTCTGAACTTGATGGATGGACATGGCCAACCTGCTCTGCTTTACATTGTTCCTTTCACGCTAGGCACCTTCTTGACACTGGGAAGACAGAGAGGTGATCTCAAGAATCTGTGGACGAGAGGGGAGCCGGAGAGACCTTGTCCTCACGGCTGGCTACAACAGCCCCAATAG >ZJU.LOC107422166 ATGGCGTCTTTCTCAACCAGCCTCCTCCGCCTAATTCTTCTCTTCTCTCTCATTTCTCTCTCCTTTTCAGCTTCCAGCGATGTCACCCTTGACGACGATGGGTCTCCTAAGTCCCCCTCTTGTAACAACCCTTATAAATTGGTCAAGGTTAAGAATTGGGCTGATGGTGTAGAACGGGATACTTTTGTAGGGGTTAATGCAAGATTTGGGTCTTTATTGCCTATTCGTTATAACTCTACTCTCAAATGGCCTGTTGTTTTAACAAATCCCTTAAATGGCTGTTCTAAGTCCACAACACAGTTATCTAGATCTGTTGCATTGTCAGTACGTGGTGATTGTGACTTCACAGTTAAGGCACAGAATGCAGAGTCAGGAGGTGCCCTTGCACTGATGGTGATAAATGACAAAGAAGACCTTTACAAGATGGTTTGTCCTGAAAATGCCACTACTTTAAATATTTCAATACCTACTGTGATGATTCCAAAGTCAGGAGGAGAAAAGCTAAACGATTCTTTATCAAGTGGTAAAAAAGTGGAAGTTGCTATGTATTCTCCAAAACGCCCAGTCGTGGACTTCTCAGTGGTATTCTTATGGATGATGGCTGTTGGGACACTTGCAGTTGCTACACTTTGGTCAGATTTTACTTCTGTTGAGGAAACCGATGAGCGTTATAATGAGCTATCACCAAAGAGATCTTCTAAAGATGAAACAAGTAAAGATGATGAGAGTGACATTCTTGATATTAATGCAAAGGGTGCTGTAGTGTTTGTCTTAACAGCTTCAACTTTTCTGGTGCTTCTATATTTTTTTATGTCATCTTGGTTTGTCTGGGTGCTGATTATACTTTTCTCCATTGGTGGTATTGAGGGAATGCATAATGTTATAGTAAGCCTGATTTCAAGTAAATGCCGAAGCTGTGGGAGGAAGACGTTGACTTTGCCTCTTGTGGGGGAGATTTCTATCCTCTCATTCATTGTATTACTTTTCTGTATGGCATTTGCAATTGTCTGGATTATCAAGAGAAAATCTTCACTTGCTTGGATTGGGCAAGATATTCTTGGTATCTGCTTGATGATAACAGTCTTGCAAATCGCTCGATTACCTAATATCAGGGTTGCTACTATACTTCTATGTTGTGCGTTTGTTTATGACATCTTTTGGGTATTTATATCACCAGTGTTGTTCAAAGAGAGTGTCATGATTGCAGTTGCTCGAGGTGACAATAGTGGTGGAGAAGCTATGCCCATGCTTTTAAGAGTACCTCGTACTTTTGACCCTTGGGGTGGTTACGATATGGTTGGCTTTGGGGATATTCTCTTTCCTGGTTTGCTTGTTTCATTTTCTCATAGATTTGACAAAGCAAATAAGAAGAGTTTTTCAACTTCATACTTTCCTTGGTTGATGTCAGGCTATGGCTTAGGCCTTTTCCTTACATATCTGGGATTATATATAATGAATGGGCATGGTCAACCTGCACTGCTCTATCTTGTTCCATGTACACTAGGTGTTACTGTTATATTGGGTTCGATAAGAGGTGAGTTGAGGGAACTCTGGAATTATGGCACAGAGGAATCCCATGAATCGTCTAGTGAGGCTTGA >ZJU.LOC107429868 ATGGATTCGAAAAGGCTTTCTGGGTTTGTTTTTGTTTCAGTTTTTGTTCTACTTCTACTTTGCAATACTTGTTCTGTGAGAGCTGGGGATATAGTTCACGATGATGAAAATGCTCCTAAGAAGCCCGGTTGTGAAAACGACTTCGTTTTGGTGAAAGTTCAAACTTGGGTTAATGGCGTGGAGGATCGTGAATTTGTTGGTGTTGGTGCCAGATTTGGCACTACTATTGTATCAAAGGAAAAGAATGCAAATCAAATTCGCCTAACCCTTTCTGACCCTCGGGATTGTTGCAGTACACCAAAGAATAAGCTTGCTGGAGATGTCATCATGGTGGACCGGGGAAAGTGCAAATTCACAACTAAGGCAAATATTGCACAAGCTGCTGGAGCTTCAGCTGTCCTAATCATAAATAACCAGAAAGAACTTTACAAGATGGTTTGTGAGCCAGATGAAACAGATCTAGATATTCATATACCAGCAGTCATGCTACCACAGGATGCTGGTGCTAGCTTGCAGAAAATGCTAATGAATACTTCTTCAGTGTCTGTGCAACTGTACTCTCCACGGCGTCCTATAGTCGACATTGCAGAAGTGTTTTTGTGGCTGATGGCAGTTGGTACAATCTTGTGTGCATCTTATTGGTCTGCATGGACTGCCAGAGAAGCAGCTATTGAACACGACAAGATATTAAAGGATGCTGCCGATGAAATTCCCAGTACCAAATACAGTGGTTCAGGTGGTGTAGTAGACATCAGCACAACATCAGCAGTCCTGTTTGTTGTTATTGCTTCATGTTTTTTAATCGTACTTTACAAACTCATGTCATACTGGTTCGTTGAGCTTTTGGTGGTTCTTTTCTGCATTGGTGGTGTAGAGGGTTTGCAAACTTGCTTGGTTGCTTTATTGTCTAGGTGGTTCAAACACGCTGCTGAATCATATGTTAAAGTGCCTATCTTAGGAGTAATCTCGTACCTAACTTTGGCTGTCACTCCATTCTGCATAGTATTTGCTGTTCTTTGGGCAGTTTATCGCAATGTTTCCTTTGCCTGGATAGGTCAAGACATCCTTGGAATTGCATTGATAATCACAGTTCTTCAAATAGTCCGCATACCCAATCTCAAGGTTGGTACAATCCTTCTCAGTTGTGCCTTCTTGTACGACATCTTCTGGGTGTTTGTTTCCAAAAAGTTGTTCCATGAAAGTGTGATGATTGTGGTAGCTCGTGGTGACAAGAGTGGAGAGGATGGTATTCCAATGCTACTGAAAATCCCACGCATGTTTGATCCATGGGGTGGTTACAGCATCATTGGATTTGGTGACATCCTACTACCTGGACTTCTTGTAGCATTTTCACTCAGGTATGATTGGCTCGCAAATAAGAGTCTCCGAGCTGGATACTTCTTGTGGGCAATGTTAGCTTACGGATTAGGTCTTCTCATTACATATGTGGCATTGAACTTGATGGATGGACATGGCCAGCCAGCACTGCTTTACATTGTCCCGTTCACACTTGGGACTTTTCTAGCATTAGGGAGGAAGAGAAGAGACTTAAGGATTTTGTGGAGCAAGGGAGAACCAGATAGGCCGTGTCCTCATATCCAACTCCAGCACGCTCAAGAATCCGATCAAGATAAATAG >ZJU.LOC107432969 ATGATAGTGGTTGCTCGTGGCGATAAGAGTGGAGAGGATGGTATCCCCATGCTACTAAAAATCCCTCGGATGTGTGATCCTTGGGGTGGTTACAGAATCATGGGTTTTGGGGACATTATACTGCCAGGACTAGTGGTAGCATTTTCGCTAAGGTATGATTGGTTGGCAAATAAGAGGCTTAGAGATGGGTACTTTGTGTGGGCAATGACTGCTTACGGTTTAGGTCTCCTTATCACATATGTTGCTTTGAACTTGATGGATGGACATGGCCAACCGGCTCTGCTATACATAGTATCAAATGGTCGAATCGATATAGTATCATCTACTCTTTAA >ZJU.LOC107432989 ATGGTATGTGAGAATGAAAGTGATACAAATATAAGCATACCTACTGTTATGCTCCCTCAAGATGCTGGTACAAACTTGGAAAATGATCTAAAGAATAACTTGACAGTGTCGGTGCAGCTATACTCTCCACTGCGTCCGCTGGTTGACATTGCGGAAGTATTTTTATGGCTTATGGCTGTTGGTACCATCTTGTGTGCTTCTTATTGGTCTGCATGGAGTGCAAGAGAAGCAGCTCTTGAGCATGATAAGCTTTTAAACGATGATCCGGATGGAACTTTGCATTCGGAAGGTGTAGGTTCTTCAGGTTATGTGGACATTAACACCACTGCAGCAGTTCTCTTTGTTGTGATTGCTTCGTGCTTCCTGATTATGCTTTACAAACTTATGTCATTATGGTTTTTGGAGGTTCTGGTGGTTCTCTTTTGCATTGGCGGAGTAGAGGGATTGCAAACTTGCTTGGTGGCTTTATTATCATGTTTCAGATGGTTTAAACATGCTGGAGAATCGTACGTAAAAGTTCCGTTCTTTGGAGCCGTTTCGTATCTGACACTAGCTGTTTTACCCTTCTGCATGGTGCTCGCTGTTGTTTGGGCAGTTTATCGACGACGCATTTCCTATGCTTGGATAGGTCAAGATATCCTAGGTATTGCCTTGATACTGACAGTTCTTCAGATTGTGCGCATACCAAATCTCAAGGTTGGAACAGTTCTTCTCAGTTGTGCCTTTTTGTATGACATCTTCTGGGTATTCGTTTCGAAATGGTGGTTTGATGAGAGTGTGATGATAGTGGTTGCTCGTGGCGATAAGAGTGGAGAGGATGGTATCCCCATGCTACTAAAAATCCCTCGGATGTTTGATCCTTGGGGTGGTTACAGCATCATTGGTTTTGGGGACATTATACTGCCAGGACTAGTGGTAGCATTTTCGCTAAGGTATGATTGGTTGGCAAATAAGAGGCTTAGAGATGGGTACTTTGTGTGGGCAATGACTGCTTACGGTTTAGGTCTCCTTATCACATATGTTGCTTTGAACTTGATGGATGGACATGGCCAACCGGCTCTGCTATACATAGTACCTTTCACACTTGGCACGTTTTTGACACTGGGAAAGAAGAGAGGTGATCTGAAGATTCTGTGGACAAGAGGAGAACCTGAGAGGCCATGTCCACACGTGCAACTAAAACCGTTGGAAGAGAAGGAGCAGTAA >Tp1g00670 ATGATATCGCGGAGATCTTTTAGCTGTTTCTGGTTTGTTTACGGGTTGTTGTACAGTGTTAGCTTGGTTTCTGGTGGAGACATAGTTCACCATGATAACTCGCTTCCGGAGAGACCAGGTTGCAACAATAATTTCGTACTGGTTAAAGTCCCAACTCGAGTTAATGGCACAGAAAACAAGGAATATGTTGGTGTTGGTGCTAGGTTTGGCCCAACATTGGAATCACAGGAGAAACATGCTACCCTCATAAAACTTGCTATTGCAGACCCTCCTGATTGTTGCAGCACACCCAAAAATAAGCTTACTGGAGAGGTCATTCTTGTTCACCGTGGTAATTGCAGTTTTACCACCAAAACAAAGGTAGCTGAAGCAGCTGGTGCCTCAGCTATTCTTATAATAAACAACAGCACAGATCTTTTCAAGATGGTATGTGAGAAGGGCGAAAATGTTTTAGATATAAATATTCCTGTTGTTATGCTACCTGTTGATGCTGGTAGAAGTCTGGAAAATACCATTCACAGTAACTCCATAGTTACTTTGCAGCTCTATTCGCCGAAACGTCCAGCAGTTGATGTGGCTGAGGTCTTTCTATGGCTTATGGCTGTTGGTACCATTTTATGTGCTTCTTATTGGTCTGCGTGGACCGCGCGGGAAGAAGCCATCGAACAAGACAAGCTGCTAAAGGACGGATCAGATGAACTTTTGCAGTTATCAACCACCAGCTCCAGAGGTGTTGTTGAGATCACCGTGATATCAGCAATTTTGTTTGTAGTGGTTGCTTCTTGTTTCCTAATCATGCTCTACAAGCTTATGTCATACTGGTTTATAGAAGTCTTGGTGGTACTCTTTTGCATAGGTGGCGTAGAGGGACTGCAAACCTGTTTGGTCGCTTTGCTCTCATGTTTCAGATGGTTCCGCCGTATTGGAGAATCATATGTCAAAGTTCCTCTCCTGGGTGCTGTCTCATACTTGACTCTGGCCGTTTGTCCCTTTTGCATAGCATTTGCTGTTATGTGGGCAGTTTTCCGCCAATACTCTTTTGCTTGGATAGGGCAAGATATTCTTGGAATCTCGCTGATAATCACAGTTCTTCAAATTGTCCGGGTACCAAATCTTAAGGTTGGAGTTGTTCTTCTCAGCTGTGCCTTCATGTATGACATCTTTTGGGTTTTTGTTTCAAAATGGTGGTTCCGTGAAAGCGTAATGATTGTGGTGGCCCGTGGTGATAAAAGTGGAGAGGACGGGATCCCAATGCTACTAAAGATCCCACGTATGTTTGATCCTTGGGGTGGCTACAGTATCATCGGATTTGGTGATATCATCCTACCAGGACTGCTTGTAACTTTTGCACTGAGATACGACTGGCTGGCAAACAAGAGGCTCAAGTCAGGATACTTCCTTGGGACAATGTCAGCTTATGGTCTAGGTCTTCTCATAACATACATTGCCCTAAACTTGATGGATGGACACGGGCAACCAGCTTTGCTTTACATCGTTCCATTCATACTGGGTACTTTGATAATGTTGGGTCACAAGAGAGGTGACCTGAAGACCCTATGGACAACAGGGGAACCCGAGAGGCCATGTCCTCACGTCCGCCTTCATCCTCAATCTTAA >Tp1g04630 ATGTCATTACCTCCGTTTAGCTGCCGCATTATCGCGGCGGCGATGGCCCTCTATCTGGTCGGTCTGTTGTGCGATGGGGCTGGCGAAAATGTTGCCGCTCCGAAAATTCCTGGCTGTACCAATGAATTTCAAATGGTCAAGGTCGAGAATTGGGTTGACGGAGAAAATGGTGAAACTTTTACTGGCATGACTGCTCAGTTTGGCGCCATGCTTCCCTCTGATAAAGACAAAGCTGTTAAACTTCCGCTTCTTCTTACCACTCCTTTGAACAGTTGCTCCAATTTAACCTCAAAGCTTTCTGGTTCTATTGCGTTATCTGTACGTGGGGAATGTACTTTCACAGCTAAAGCTGAAGTTGCACAGTCAGGAGGAGCTGCGGCTTTGGTGTTAATAAACGACAAAGAAGAACTGGATGAGATGGCTTGTACTGAGAAAGATACCTCGTTAAATGTTTCTATACCTATTTTGATGATTACAACGTCCTCTGGAGATGCCTTGAAGAAATCTATTATGCTAAATAAGAAAGTGGAGCTTTTATTGTATGCTCCAAAAAGCCCAGTTGTGGATTATGCAGTGGCATTCCTCTGGCTAATGTCGGTTGGAACAGTTTTCATTGCTTCTGTTTGGTCACATGTCACCGCTCCTAAGAAGAACGATGAGCAGTACAATGAACTATCACCAAAGAAATCTTCAAATGGTGATGCTACCAAAGGTGACTCTACTAAAGATGACGCTGAAGAGGAAACCCTTGATATCAGTGCTACGGGTGCTGTTATCTTTGTCATATCAGCGTCCACATTCCTTGTTTTGCTCTTCTTTTTTATGTCGTCGTGGTTTATCTTGATCCTGACCATCTTTTTCTGCATTGGTGGTATGCAGGGAATGCATAATATTATCACTACTCTCATAACAAGGAGATGCAATAAATGTGGCCAGAAGAATGTGAAAGTCCCTTTGTTTGGGAATGTGTCCATTCTCTCACTCATCGTTCTGTTATTCTGCTTTGTGGTTGCCGTCATCTGGTTTACGAAGCGGAAAACTTCGTATGCATGGGCCGGCCAAGATATTTTTGGTATTTGCTTGATGATAAATGTCTTGCAAGTGGCTCGGCTACCTAATATCAGGGTTGCTACCATTCTTCTCTGTTGTGCGTTTTTCTATGACATCTTTTGGGTATTCCTGTCACCACTAATCTTCAAGCAAAGTGTAATGATTGCGGTTGCACGTGGGAGCAAAGACACAGGAGAATCTATTCCCATGCTCCTGAGATTTCCACGGCTTTCTGATCCATGGGGTGGTTACAACATGATCGGTTTCGGAGACATTCTATTCCCAGGCCTTCTCATATGCTTTATTTTCAGATATGACAAGGAAAACAACAAAGGAATATTGAAAGGATATTTCCCGTGGTTGATGTTTGGTTACGGACTTGGACTATTCTTAACATACTTGGGGTTGTATATTATGAACGGACACGGTCAACCTGCATTGCTCTATCTCGTCCCTTGCACTCTCGGAATCACGGTGATACTGGGGTTGGTGAGGAGAGAACTCAGAGACTTTTGGAACTACGGGACTGGACAGCCTTCAGCTGCAGATGTAAATCCATCTCCAGAAGCATAA >Tp2g00960 ATGGATTCGCTTAGATTTCTCCGGATTCTTCTCGTTTCTGCTTCGATTTTACTCGTCTCTCTCCTTTGTACAGTCACTGCTGGTGATATTGTTCATCAAGACGATTTAGCTCCGAAGAAGCCAGGTTGCGAAAATGACTTCGTTTTGGTTAAAGTCCAAACGTGGATTGATGGTGCTGAAGATGCGGAGTTTGTGGGCGTCGGGGCTAGATTTGGGAGGCGGATAGTGTCCAAGGAGAAGAACGCAAACCAGACACACGTTGTTTTTGCAAATCCTCGTGATTGTTGTACACCGCTCAAGAACAAGCTTTCTGGAGAAGTCGTTATTGTGGACCGGGGCAACTGTCGGTTCACAGCTAAGGCTAATAATGCGGAAGCTGCTGGTGCCTCTGCTCTGCTAATCATAAATAACCAGAAAGAACTGTACAAAATGGTTTGTGAACCGGATGAGACGGATTTAGATATAAAGATTCCTGCTGTCATGCTCCCACAAGATGCTGGTGCAACCTTGGAAAAAATGCTCACAAACAGTTCAAAAGTGTCCGTGCAGCTTTACTCCCCAAGACGACCAGCCGTTGATGTAGCCGAAGTCTTTTTGTGGTTAATGGCTATTGGTACCATTTTGTGTGCATCTTATTGGTCTGCATGGAATGCCCGAGAAGCAGCTATTGAACATGATAAGCTACTGAAGGATGCTATAGACGAAATCCCGAACACAAATGATGGGGGTAGTGGTGTCGTAGAGATCAATACTCTTTCAGCTATTTTTTTCGTAGTTCTTGCTTCGGGCTTCCTGGTGGTTCTTTACAAGCTTATGTCTTATTGGTTTGTGGAGCTTCTTGTGGTTGTTTTCTGCATTGGTGGTGTTGAGGGTTTGCAAACTTGCCTTGTCGCTTTGTTATCAAGATGGTTCCAACGGGCCGGAGATTCTTATGTAAAAGTCCCTTTCCTTGGACCTATCTCTTATCTGACTCTTGCAGTTTCTCCATTCTGCATTGTCTTTGCTGTTCTCTGGGCTGTTTACCGAGATCATTCCTTCGCGTGGATTGGCCAAGATGTTCTTGGTATCGCATTGATCATCACAGTACTACAGATTGTTCATGTCCCAAATCTTAAGGTCGGGTCAGTTCTCCTCAGCTGTGCCTTCTTGTACGATATCTTCTGGGTGTTTGTCTCCAAGAAGTTGTTCCATGAAAGCGTAATGATTGTCGTAGCTCGTGGTGATAAAAGCGGAGAAGATGGTATCCCAATGCTACTGAAGATTCCGCGCATGTTTGATCCCTGGGGAGGCTACAGCATTATTGGATTCGGTGATATTCTTTTGCCCGGTTTGCTAATTGCGTTTTCTCTCAGATATGACTGGTTAGCTAACAAGACTCTTCGAACCGGTTATTTTATATGGGCAATGGTTGCCTATGGATTAGGTCTTTTGATTACGTACGTGGCTCTAAACCTAATGGATGGACACGGCCAACCGGCACTGCTCTACATTGTCCCTTTTACACTCGGAACAATGTTAACGCTAGCTCGAAAACGAGACGATCTTTGGATTCTATGGACTAAAGGAGAACCAGAAAGGGCTTGTCCTCACCATGTCCGGCTTGAACAGTGCTCTGAGAAATGA >Tp4g25200 ATGTCGTCGTTTGATCCGCCGAGCCACCGTCGTCACCGATGCTCTGCGGTAGTAGTGATCCTCCTTCTGTTAGGTTTTTCCGTTGCAGCGGCCGACGATGTGTCGTGGACCGACGATTCCGGCCTCGAGGCTCCTGGCTGTTCCAATAAGTTTCAAATGGTGAAGGTCTTAACCTGGGTTGATGGCGTTGAAGGTGACTTCCTTACTGGCTTAACTGCCCAATTTGGAGCATCGTTGCCTTCTGATGCTGATCAAGGCGTTAGATTTCCGGCTACTCTTGTAGATCCTTTGGACTCATGCTCCAATCTCTCTTTCAGGTTAGATGGACATATGGCCTTGTCGACCCGTGGAAATTGTGCTTTCACAGAGAAGGCCAAAAATGCCGAGGCAGCTGGTGCTTCTGCTTTGTTGGTCATTAATGACAAAGAAGATCTTGATGAGATGGGATGTATGGAAAAGGACACATCTCTAAATGTGAGCATACCTGTCTTAATGATCTCTAAGTCAAGCGGGGATGCTCTCAACAGGTCGATGGTAGACAAAAAGAGTGTTGAGCTTTTGTTGTATGCACCAAATCGTCCTGCTGTGGACCTTACAGCAGGATTGTTGTTGCTCATGGCTGTTGGAACTGTTGTCGTTGCATCACTCTGGTCAGAGCTTACAGATCCTGACCAAGCTAATGAATCTTACAGCATTTTAGCAAAGGAATTTTCTAGTGCTGGAACCAGAAAAGATGACCCAGAGAAGGAAATCCTTGATATAAGTGTCACTGGTGCTGTATTTTTCATTGTAACAGCCTCCATTTTTCTGTTGCTCCTTTTCTACTTCATGTCATCATGGTTTGTATGGGTGCTCACCATATTTTTCTGCATTGGTGGCATGCAGGGTATGCATAACATCATTATGGCAGTTCTATTGAGAAAATGCAGACATCTTGGTCAGAAATCTGTGAAGCTTCCTTTGCTTGGGACAATGTCATGGATGTCCCTTTTGGTGAATATTTTTTGTCTGGCGTTTGCTATCTTCTGGTTTGTAAAGCGGCACACATCGTATTCTTGGGTTGGACAAGACATCTTGGGCATCTGTTTGATGATCACAGCCTTGCAAGTGGTTCGATTACCTAACATCAAGGTTGCTACTGTACTTCTATGCTGCGCGTTTGTCTATGACATTTTCTGGGTCTTCATATCACCATTGATATTTCACGAGAGTGTTATGATTGTGGTTGCCCAAGGAGACAGCAGCAGCGGGGAGTCCATCCCAATGTTACTAAGGATTCCTCGGTTTTTCGATCCTTGGGGTGGCTATGACATGATTGGTTTTGGGGATATCCTGTTCCCCGGTTTGCTCATTTCCTTTGCTTCCAGGTATGACAAGATCAAAAAGAGGGTAATATCTAGTGGGTACTTCCTTTGGTTGACTATCGGCTATGGAGTAGGTCTGTTACTGACATATCTAGGTCTGTATCTAATGGACGGACATGGCCAGCCTGCGCTACTGTACATCGTTCCCTGCACGCTCGGTTTGGCCGTCATTCTGGGGTTGGTAAGAGGAGAGCTTAAAGAACTATGGAATTACGGTATCGAAGAATCAGAATCTGATACGCCAGAGGATCATCTGCCTGTGGCATAA >Ca_13745.g ATGGTTTCATTGGGAGCTATATATACTATAGCCTATGTGTTTCTGTTTACTATCTCTTTGGTTTTGGGTGGTGATATAGTTCACCATGATGATGTTGCCCCCACAAGACCTGGTTGTGAGAACAACTTTGTTCTGGTCAAAGTCCCGACTTGGATCGATGGTGTGGAAAATGATGAATATGTTGGTGTTGGTGCAAGATTCGGCCCTACATTGGAATCAAAAGAAAAACATGCCAATCATACTAGAGTTGTCATGGCTGATCCTCCTGATTGTTGTAGCAAGCCTAAGAATAAGCTTACCAGTGAGATCATTTTGGTGCATCGAGGAAAATGTAGTTTCACAACCAAGGCAAATATAGCTGATGAAGCCGGTGCTTCAGCCATCATCATTATAAACTATCGTACAGAACTTTTCAAGATGGTTTGTGAGGAAAATGAAACTGATGTTGATATTGGAATACCTGCTGTTATGCTTCCACAAGATGCTGGATTAAATTTGGAAAGACATATAAAAAATAACTCCATAGTGTCCATACAGTTATACTCTCCGCTGCGTCCGTTAGTTGATGTTGCAGAAGTGTTTTTGTGGCTTATGGCTGTCGGTACGATTTTATGTGCTTCGTATTGGTCTGCTTGGACTGCCAGAGAAGCTGCTATTGAGCAAGAAAAGCTTCTAAAGGATGCTCCAGATGAATATGTTGCAGAAAGTGTTGGTTCTCGAGGTTATGTGGAAATCAGTACTACAGCAGCAATATTATTTGTTGTGCTTGCTTCTTGTTTCTTGGTTATGCTTTTCAGATGGTTTCGACAACCTGCACAGACATTTGTGAAAATACCCTTCTTTGGAGCTGTTCCATATCTGACACTTGCTGTTACTCCCTTCTGCATAGTGTTTGCAGTGGTTTGGGCGGTTAAACGCCATGCATCATGTGCGTGGATCGGTCAAGACATTCTTGGTATTGCATTGATAATTACAGTTCTTCAGATTGTCCGCATACCAAATCTCAAGGTTGGGACTGTTCTTCTCAGTTGTTCTTTCCTATATGACATCTTATGGGTGTTCGTCTCGAAATGGTGGTTCCATGAGAGTGTGATGATAGTGGTGAGTGTTCTCAACAAAGCTCTCATTTCTCCTGTTCTCTACAATGCTTGTTTTGACCTCATAAACATGATGATGTCTTCCCTTTATTCTTTTCCTAAAGAAGCAAAGACTTTTATTAAAATGGAAATACAAACAGTGTTGTTAAATAGAGGCTATGGCACCGTCATGGTGAAATGGCGTGGAGGATTCTTTTACAACTGCCATAGGCAAACTGTGAAGGGATGTTCGCCATGGCGGTGCCATAGGCTGCAATGGTGTGTTCATATGGTGGGCGTTTGGCCTTCATCCATTCCGTCATCTGCCATCAACAACACTAATTACAAGTGGTATTCTAACCCGAATATATGGTTTTGGCCTCAAAAGCATGATGCTTCCTTCCCCTTAAAATTAGTGTTACATTTTCTCTTCACAGGTAGCTCGAGGTGA >Ca_22218.g ATGGCTTCTGAGAAGATTTTGTGGGTTATTTCATTTTTTGCTGCAATTTTGCTTCTCTCCCAAGTTCCTTCAGTTTTAGCTGGTGACATAGTTCACGATGATTCAACTCCAAAGAAGCCCGGTTGCGAGAATCAGTTTGTTTTGGTCAAAGTGCAAACATGGGTTAACGGTTTAGAGGATGCTGAATTTGTTGGCGTGGGTGCTAGATTTGGTAGAACAATTGTGTCTAAAGAGAAGAATGCTCGGCATACACCCCTTATTCTTTCAGATCCACGAGATTGTTGCAGTCCTCCCATGAATAAGATTGCGGGAGATGTCATCATGGTGGATCGAGGTAACTGCACATTCACAAAAAAGGCGAATTCTGCACAAAATGCTAATGCTTCAGCTATCCTCATCATAAATAACCAGAAAGAGCTTTACAAGATGGTTTGTGATCCTGATGAAACTGATTATAACATACACATACCTGCTGTTATGCTCCCACAAGACGCAGGCACAAAGCTGGAAAAAATGTTGATGAGTACTTCATCTGTGTCGGTGCAGTTATACTCACCACGTCGACCAACTGTTGACATAGCAGAAGTGTTTCTTTGGCTGATGGCGGTTCTTACCGTATTTTGTGCATCATGCTGGTCAGCGTGGAGGGCTCGAGAAGCAGCTGTGGAACAGGATAAGCTGTTAAAGGATGCTTCTGCTGAAATCCCAAACACTAAGGATGCTGGCGTTAGTGGAATTGTAAATATGAATGCAAAAGCTGCAGTTCTTTTTGTTGTAGTTGCTTCGTGCTTCCTGTTTATGCTTTACAAATTGATGTCGTCGTGGTTCATTGAGGTTTTGGTTGTTCTCTTCTGTATTGGCGGGATCGAGGGCTTGCAAACTTGCTTGGTTGCACTTCTGTCAAGGTGGTTCAAGAATGCTGACGAATCATACGTTAAATTACCTTTCGTAGGAGCTGTCTCATACCTGACTTTGGCTGTTACTCCGTTCTGTATAACATTTGCCATTTTTTGGGCACTTTATCGTGACAAATCATTTGCCTGGATTGGTCAAGATATACTTGGAATTGCGCTGATAATTACAGTTCTGCAGATTGTACATGTGCCTAATCTCAAGGTTGGTACAGTTCTTCTAAGTTGTTCCCTCATTTACGACTTATTTTGGGTGTTCGCCTCGAAGAAGTTTTTTAATGAAAGCGTGATGATTGTGGTAGCACGAGGTGATAGAAGTGGAGAAGATGGTATTCCAATGTTACTAAAGTTTCCGCGCATTTTTGATCCATGGGGTGGTTACAGTATTATAGGTTTTGGAGACATTCTTTTACCAGGAATGCTGGTGGCATTCTCACTCAGGTATGATTGGCTGGCAAAGAAGAGCCTTGTAAGTGGATACTTTTTGTGGGCAATGTTTGCATATGGCTTTGGACTTTTTGTCACGTACGTCGCGCTAAATTTGATGGACGGGCACGGACAACCGGCACTACTTTACATTGTTCCATTTACTCTTGGAACCTTTCTGGCGTTGGGGCGAAAGCGAGGAGAACTTAAGGTTTTGTGGACAATTGGAGAACCAGAAAGATTCTGCCCACATATCAGACTCCATAACAGTGGAGAATTAAGTCCTAAATGA >Ca_14010.g ATGCCGTGGTTTTCGTATTCTTCCTACTTGGCGTCCGTCCTCGTTCTCTCATTCGTCTTCGTTGCAGCAGATGCCTATGACAACAATGCCTCCTGCAATCACGACATGCAATTGGTGAAGGTGAAGAACTGGGTTGATGGCAAGGAAGGTGACATGCTCAATGGTATGACCGCAACATTTGGCTCTTTTTTGCCCGAGGATGCCGATCAAACTCACAAAGCTCCTCTTCTTTATGCTATTCCCAATGACTGCTGTTCCCTTTCAACTTCAAAGTTATCTGGATCAGCTGCTGTTTGTGTTCGTGGTAACTGTGACTACACAACTAAAGCTGCATTCGCACAGTCAGGGGGTGCTACTGCTGTCGTGATGATTAATGACCAGCTCTATCAGATGGACTGCCCCGCTGATTCTACTGAAAAGATAAACATTTCAATTCCAGTCGTGGAAATGACTGAGTCTGTTGCAGATTCTCTCGTCAATTTTTTGAAGTCTGGAAGGAGAGTGGAAGTTCTACTATATGCTCCAACTCGTCCAATTATAGACTACTCTGTTGGAGTTTTGTGGTTGATGTCAGTTGGAACAGTTATATGCGCTTCATTATGGTCAGATTTCACTGCTTCTGATCAGTTTGATGAACACTATAATGGATTGTCTCCCAAGGGATCTTCCAGTGCTGAATTAGTGAAAGATGATTCTGAAAATGAAATTGTTAACATAGATGCAAAGGGTGCTGTCGTCTTTGTCATTACGGCTTCTACTTTTCTTGTGCTACTGTTCTTCTTCATGTCATCTTGGTTTATCTGGGTGCTGATTATACTTTTCTGCATTGGTGGTATTGAGGGGATGCATAATTGTATTGTAAGCCTCGTTTTAAGAAAACGGCCCAGTTATGGTCAGAAGATTGTGAATTTACCTCTGTTCGGAGAAGTTTCTGTATTCTCACTAGCAGTGTTACTATTTTCTGCGGCATTTGCGGTATTATGGGTTGCTACTCGACGGGAATCATTTTCGTGGTTTGGCCAAGATGTTCTTGGTATTTGTTTAATGATTACAGTATTGCAATTGGCTCGCTTGCCTAATATTAAGGTTGCAACTGTACTCCTTTGTTGTGCATTTGTATATGACATCTTTTGGGTATTCATATCTCCGGTGATATTCCGCAAGAGTGTTATGATTACAGTTGCTCGTGGTGACAAGGCTGGTGGTGAAGCAATTCCTATGCTTTTGAGATTTCCTCGTCCTTCTGATCCTTGGGGTGGCTATGATATGATTGGATTTGGAGACATTCTCTTTCCTGGTTTGCTTGTTTCCTTTGCTCGTAGATTCGACAAAGATAATAAGAAGGGGGTCTTTAGTGGATATTTTCTTTGGTTGGTAATTGGCTATGCCATTGGCCTTTTCTTCACATATTTTGGGCTATATATGATGAACGGTCATGGACAACCTGCACTTCTCTATCTTGTTCCATGTACACTAGGAGTGGCTGTGATATTGGGATGCATAAGAGGTGAACTGAAGTTTCTTTGGAGTTATAAGGCAGACTCGTCTTCATCGAGAGAGCCTTCTGAAGTTTGA >Ca_06200.g ATGGTTACATTTGGAGTTTCTACTTATGCTGTCTTCTTCTTCTTCCTCTCTGTGTTCATGCTTTTTCTTACTATGAGTTTTGGTGGAGACATAGTACACCCTGATAATATTGCTCCCAAGAGTCCTGGATGTGACAACAACTTTGTTCTGGTTAAAATCCCAATTTGGATTGATGGTGTGGAAAGTGACGAGTATGTTGGTGTTGGTGCAAGATTTGGCCCTACATTGGAATCGAAAGAAAAGCGTGCTAACCATACTAGAGTTGCCATTGCAGACCCTCCTGATTGTTGTAGCAAACCTAAAAATAAGCTCACTGGCGAGATCATTTTGGTGCACCGAGGACAGTGTAGTTTCACAACCAAGGCAAATATAGCTGAAGAAGCTGGTGCTTCAGCCATCCTGATTATAAATAACCGTGCAGGTATGGTTTGTGAAGAGAATGAAACTGATGTTGATATTGGAATACCTTCTGTCATGCTTCCACAAGATGCTGGTGAAACCTTGGAAAAATATATACATAACAAGTCCACAGTGTCTGTGCAGTTATACTCTCCACTGCGTACAACGGTCGATATTGCAGAAGTATTTCTATGGCTTATGGCTGTTGGTACAATTCTGTGTGCTTCTTATTGGTCTGCTTGGACTGCCAGAGAGGGTGCTATCGAGCGAGAGAAGCTATTAAAGGATGATTCAGATGAGTATCTAAATAATACAGATAATGCTGGTTCCAGTGGTTATCTGGAAATAAGTACTGTGGCAGCAGTTTTGTTCGTTGTGATCGCTTCATGTTTCTTGCTTATGCTTTACAAACTAATGGCATCCTGGTTTGTTGAAGTTCTGGTGGTTCTATTTTGCATTGGTGGGGTTGAGTTTGATGTTATTGTTGACACATCAGTTGAATCTTTATTCTTTGCATGTTTTCAGGGACTGCAAACTTGCTTGGTGGCTCTTTTATCATGTTTCAGATGGTCTCAACATGCTGCACAAACATATGTTAAAATACCCTTCTTTGGTGCTGTGTCATATCTCACACTTGCTGTTACTCCCTTCTGCATAGCGTTCGCCGTGCTTTGGGGAGTTAAACGCCATGCATCGTTTGCTTGGATTGGTCAAGACATTCTTGTTGGAACTGTTCTTCTCAGTTGTGCCTTCCTATATGACATTTTCTGGGTGTTTGTATCTAAATGCTGGTTCCATGAGAGTGTGATGATAGTGGTAGCTCGCGGTGATAAGAGTGGAGAAGATGGTATCCCCATGCTGCTCAAGATACCGCGTTTATATGATCCTTGGGGTGGTTACAGTGTCATCGGTTTTGGGGACATAATCTTACCAGGGCTTCTAGTAGCATTTTCATTAAGGTATGATTGGTTAGTGAAGAGGAACCTTCGATCAGGGTACTTCTTGTGGGCAATGGGTGCTTATGGTTTAGGTCTCCTCGTCACATACATAGCTTTGAATTTGATGGATGGACATGGTCAACCAGCTTTGCTGTATATAGTCCCATTTACACTTGGAACCTTTTTGTCATTGGGAAAGAAGAGAGGTGAACTCAAGATTTTATGGACAAGAGGGCAACCAAAAATGCCTTGCCCTCACATCCAAGATGATCATCAACCAATGGGCCAGTGA >Peaxi162Scf00008g02216 ATGGGGTTTAAAGGAGGAGTCTTTTTATGTTGTTTTTGTGTTGTATTATTGCTGAGTTCTTGTTTAGTTATTGGAGGTGATATAGTTCATCATGATGATGTTGCTCCAAAGAGACCTGTTCCAACATGGGTTGATAAGAAAGAAGTAACTGAGTTTGTTGGCATTGGGGCTCGATTTGGCCCCACTTTGGAATCAAAGGAGAAGCGTGCTAATCAGATAAGGCTTGCCTTTGCAGACCCACCAGATTGTTGTAGCAAGCCTAGGAATAAGCTCACCGGTGAGGCCATCATGGTGCACAGAGGTAATTGCAGTTTCACCAAAAAAGCAAAAGTTGCAGAAGCTGCTGGCGCTTCAGCGATCATCATTATAAACAACCAAACAGAGCTCTTCAAGATGGTCTGTGAGAATGCAACTGATGTGGACATTGGTATCCCTGCTGTGATGCTCCCACAAGATGCAGGTTCAACCCTGATAGAGTTTCTCGGGAACAGCTCTACAGTTTCCGTGCAGCTGTACTCCCCAAAACGTCCAGCGGTTGATGTAGCTGAAGTGTTTTTATGGCTTATGGCAGTTGCCACCATATTATGTGCTTCTTATTGGTCTGCATGGAGTGCCAGAGAAGCAGTAATTGAACAGGACAAGTTCTTAAAGGATGGATCAGATGATTACTGTGGCTTGAAGGAAACTCATTCTGGTGGTATGTTGGAGATCAACACAGCAGCAGCACTTCTCTTCGTGGTGGTTGCGTCCTGCTTCTTGATTATGCTTTACAAATTGATGTCATTCTGGTTTATTGAGGTTCTGGTGGTTCTATTTTGCATTGGTGGTGTTGAGGAATCGTTTGTTAAAATTCCAGTTTTGGGGCCTGTTTCGTATCTTTCGCTGGCAATTTCTCCATTCTGCATAGCTTTTGCTGTTCTGTGGGCGGTTTTCCGTGGTACTGTCTCCTTTGCTTGGATAGGTCAAGACATACTTGGTATCGCGTTGATCGTTACTGTTCTTCAGATCGTACGAGTTCCTAATCTCAAGGTGGGAACAGTTCTTCTCACTTGTGCATTCTTCTATGACATTTTTTGGGTATTTGTTTCCAAATGGTTGTTCCACAAGAGTGTAATGATAGTGGTTGCACGTGGTGATAAAAGCGGAGAAGATGGAATTCCCATGCTACTGAAAATCCCACGAATGTTTGACCCTTGGGGTGGCTACAGCATCATTGGGTTTGGCGACATAATTTTACCTGGATTAGTGGTGGCATTTTCATTAAGGTATGACTGGCTGTGTAAGAAGAGTCTTCGAGCTGGTTACTTTCTATGGACTATGACTGCTTATGGTTTAGGTTTATTTATAACATATGTGGCTCTAAACTTGATGGATGGTCACGGTCAACCTGCTTTGCTTTATATAGTTCCTTTAACACTTGGCACATTTTTAATGTTGGGAAAGAAAAGAGGTGAGCTGGGGCATCTATGGACAAGAGGAGAACCAGATAGGCCTTGCCCTCATATCCGGCTTCAACTGGCAGAGTAA >Peaxi162Scf00020g00522 ATGGAGTTCAAGATAGGTGATATAGTTCACCAAGATGATATTGCTCCTAGTAGACCTGGTTGTAACAACAATTTTGTTCTGGTAAAAGTTCCGATCTGGGTTGATGGTGTAGAAGTAACTGAGTTTGTTGGTGTTGGGGCTCGATTTGGCCCGACATTGGAATCAAAGGAGAAGCGTGCCAATCAGACAAGGCTGGCCTTTGCAGACCCTCCGGATTGTTGTAGCAAACCTAGGAATAAGCTCACTGGTGAGGCCATCCTGGTGCACCGAGGTAATTGCAGTTTCACTAGCAAAGCCAACGTTGCAGAAGATGCTGGTGCTTCAGCTATCCTCATTATAAATAACCAAACAGAGCTCTTCAAGATGGTTTGTGAACCCCATGAACCTGACTTGGACATTGGTATCCCTGCTGTAATGCTCCCACAACATGCTGGTACAAGCCTGATACATTTTCTTGGAAACAGCTCCTCTGTTTCTGTGCAGCTGTACTCTCCAAAGCGGCCAATGGTTGATGTAGCAGAAGTATTTTTATGGCTTATGGCAGTTGCTACCATATTGTGTGCTTCTTATTGGTCTGCATGGAGTGCCAGAGAAACTGCAATTGAGCAGGACAAGCTCTTAAAAGATGGCTCGAATGAATGCAATGGCACAGAGGTGTCTCGTTCTGGTGTTGTGCTGGAAATCAACATAATATCAGCAGTTCTCTTCGTGGTGGTTGCGTCCTGCTTCCTCATTATGCTTTACAAATTAATGTCCTCTTGGTTTATTGAGGTCCTGGTGGTTATATTCTCCATTGGGGGTGTTGAGCTAACAGTCATTATATATAGTTTCAGATGGTTCGAACGTTTTGGAGAGTCATTCATTAAAATTCCTTTTCTGGGACCTGTTTCATATCTGACGCTGGCGATTTCTCCATTCTGCATAACCTTTGCAGTTCTATGGGCAGTTTACCGTCATAAATCCTTGGCTTGGATAGGTCAAGATATACTCGGTATTGCATTGATCATCACGGTTCTCCAAATTGTGCAAGTTCCCAACCTCAAGGTGGGAACAGTTCTTCTAAGTTGTGCCTTATTGTATGACCTTTTCTGGGTGTTCCTTTCCAAACCGCTGTTCCATAAGAGTGTGATGATAGTGGTAGCACGCGGTGATAATAGTGGAGAAGATGGCATTCCTATGTTACTAAAAATTCCACGAATGTTTGATCCTTGGGGTGGCTACAGTATCATTGGGTTTGGTGACATAATCTTACCAGGTTTACTGGTAGCATTTTCTATGAGGTATGACTGGCTGTGTAATAAGAGACTTCGAGATGGCTACTTCTTGTGGGCTATGATTGCTTATGGTTTAGGTTTGCTTACGACATATGTGGCTCTGAATTTGATGGATGGTCATGGTCAACCTGCTTTGCTTTACATTGTTCCTTTCACAGTAGGCACATTTTTGACATTGGGAAAGCAAAGAGGTGATCTCAAGCATTTATGGACAAGAGGAGAACCAGATAGGCCTTGCCCGCACGTCCGGCTTCAAGCAGAGTAA >Peaxi162Scf00119g00949 ATGGATTTCCAAAAAATCAGTTCTTTAATTTTCATTTATGGAGTAATAATCTTTTTACTTAATTATCCAGCTAAAGTAACAGCAGGTGATATTGTTCATCATGATGAATCAGTACCCAAGAAACCTGGTTGTGAAAATGACTTTGTTCTGGTGAAAGTTCAAACTTGGGTTGATGGTAAAGAGGATGCAGAATTTGTTGGTGTTGGTGCTAGATTTGGCACTACTATTGTGTCAAAGGAGAAGAATGCACAACAAACTCCGCTAACTCTTTCTGACCCTCGGGATTGTTGCAAGCCTCCAAGGAAAAAGCTTGCTGGAGAGGTCATCATGGTAGATCGCGGCCGCTGCAAATTCACAACAAAGGCTAATAATGCTGAAGCAGCAGGGGCATCGGCAATCCTAATAGTAAATAATCAAAAAGAACTTTACAAGATGGTTTGTGATCCTGAAGAAACCGACCTAGATATACACATACCTGCTGTTATGCTACCTCAGGATGCCGGGACAACTCTGGATAAAATGCTTTTAAACCGCTCATCATCAGTTACTGTGCAACTCTACTCTCCAAGACGACCTGTAGTGGACATTGCAGAAGTATTTTTGTGGCTTATGGCTGTTGGTACAATCTTATGTGGTTCTTATTGGTCTGCTTGGAGTGCTAGAGAAGCATCTATTGAGCAGGACAAGCTGTTGAAGGATGCTTCAGAGGAAGAGCTTCCAAATTTTGGAACTGGTGGTTCAAGCACTGTGATGGATATAAACATGATATCTGCAGTCTTATTTGTTGTTGTTGCTTCATGCTTTTTGATCGTATTGTATAAGTTGATGAGATTCACATGGTTCTTTGAACTCTTGGTGGTTGTCTTTTGCATCGGTGGTGTAGAGGGTTTACAAACTTGCTTAGTTGCCTTGCTATCAAGGTGGTTTAAGCATACGGGAGAGTCATACATTAAAGTACCCATTTTTGGCGCTGTCTCTTATCTTACTTTGGCTGTTTCCCCGTTCTGCATAACTTTTGCGGTGGTTTGGGCAGTGTATAGAAATTATTCTTTTGGCTGGATAGGTCAAGACATACTTGGTATCACACTAATAATTACCGTTATGCAAATTGTACGGATACCTAATCTCAAGGGTATCACACTAATAATTACCGTTATGCAAATTGTACGGATACCTAATCTCAAGGTCGGTATGGTTCTTTTGGGTTGTGCCTTGATCTACGACATATTTTGGGTTTTTGCTTCTAAGAGGCTCTTCAATGAAAGTGTGATGATTGTGGTAGCTCGTGGTGATAAAAGTGGGGAGGACGGTATTCCAATGCTGCTGAAGATTCCTAGGCTATTTGATCCATGGGGTGGTTTCAGCATTATTGGCTTCGGTGACATCCTATTGCCTGGCCTGCTAGTAGCATTTTCGCTTAGGTATGATTTGCTTGCGAAGAAGAATCTCCGAGCTGGTTACTTCTTGTGGGCGATGATTGCATATGGATTAGGTCTTCTTATTACATATGTAGCTTTGAACTTAATGGATGGTCATGGCCAACCAGCCCTTCTTTATATTGTCCCATTTACCCTCGGAACCTTTTTGATGCTGGGGAGAAAGAGAGGTGACCTAAAAATTCTTTGGACAAAGGGTGAACCAGAAAGGGTGTGTCCTCATGTTCGTCTCGAATCAAAGGGAGAATCTGATCGAGAAGAATAA >Peaxi162Scf00286g00449 ATGGCATTTTCATCATTTCTTGGTTTTGTTGTGTTTGTTGTTGTATCATCATTTTCTTCAATTGCATATGCTGCCGATCTTCATAGTTCTTGCAGCAATGTTATTGATATGGCACTGATGAAGTTGTGGGTTAATGGGCATGAGCAAGATGCAATAGGTGTCTTGAGTGTAGCATTTGGGTCTAAATTACCCTCTGATGCTAAAAAGGCCCCCAGGTTGCCTGCTGTTTATCCACAACCCGTGAATGGCTGTTCTGCTTCCTCCTCCAAGTTATCAGGGTCTATTGCGCTAGTTCGTCGCGGTGAATGTGATTTTCTAGTCAAGGCTACGGTTGCGCAATCAGGAGGTGCAGCAGGTGTTGTGCTTATAAATACTGAAGGAGATGCTCTGGAGATTTCTTGTCCTAATAATTCTACCATATCAAATGTAACCATTCCCGTCGTTTCACTTTCAAAGGATGAGGGAGATATTATTGATAAATACATAGCTGCAGGAAAGAGAGTGGAGCTGCTATTATATTCGCCGGATCGCCCTATTGTGGACTACTCAATTTCGTTCATATGGTTGATGGCTGTTGGAACAATTATTTGTGCAGCTCTTTGGAAAAAATTTACTCAATCTGAGGAAACCAAGGAGGAGGATGACAGTGAAATTCTGCACATTACTGCAAGGACTGCTGTTGTGTTTGTCATCTCAGCATCCACATTTCTGGTGCTACTTTACTTTTTCATGTCTTCGTGGTTTATCTGGCTGCTGATAATACTTTTCTGTATCGGTGGAATTGAGGGATTGCATAGCTGCATAGTGTCGCTCATATTAAGCAAATGTAGCTGTTGTGGAAAGAAAAGTTTAAATTTGCCGCTTGTTGGGGAGGTCACTATTCTGTCTCTAGTTGTCTTAGTACTTTGTGTGGCGTTTGCCATCTTCTGGGCAGTAAACAGGAGAGAATCATACTCTTGGATTGGCCAAGACATTCTTGGAATTGCTTTGATGCTTACTGTTCTGCAGTTGGCTCAATTGCCTAACATAAAGGTCGCTACGGTGCTTCTGTGTTGTGCGTTTGTCTATGACATCTTCTGGGTTTTTCTATCTCCTACTATATTCCATGATAGTGTTATGATTGCGGTTGCTAAAGGTAAGAAAGGTGGAGGAGAATCAATCCCCATGCTTCTGAGAGTTCCTAAACTAACAGATCCTTATAAGGGCTTTGATATGCTTGGCTTTGGAGATATTCTCTTCCCTGGTTTGCTAGTTTGCTTTACATACAGATTCGACGAAGCTAAAAAGAAGGGAGTACTAAATGGATACTTCCTTTGGCTGATGGTTGGTTATGGCGCCGGTCTTTGCTTGACTTATTTGGCCTTGTATTTAATGAATGGACATGGTCAACCTGCTCTCCTGTATCTCGTGCCATGCACACTAGGAACTTGTGTGGCACTGGGTTTGATCAGGGGCGAATTGAAAGACCTTTGGAACCATAGCAGTGAGCCACAAATGGGTGAAGCACATCTAGGAAGCGCTTGA >Peaxi162Scf00378g00620 ATGGCAATTCCTCGGCGATTAATCGGAGTATTATTTTGCATTTTTAGTTTATCATTAACCACCGCTTCCGCCGATGATGATATCTCACGCGCCGCCCCTTCCAATTCATCAACCTCTTGCAATAATCCTTATCGATTGGTTCTGGTGAAGCTATGGATTGATGGTGCTGAACATGAGCCAATTGGTGGCCTAAGTGCAGCATTTGGGTCTCTTTTACCCACTGATACTAAAAATGCCCTTAGATTGCCCGCTATTCATACAATACCCTTGAACGGCTGTTCCAGTTCCTCCTCCAAGTTATCAGGCTCTATTGCACTAGCTCTTCGTGGTCAATGTGATTTTCTAACAAAGGCTATGGTTGCACAAGCAGGAGGTGCTGCAGGGATTGTGATGATAAACGATCAAGAAGATCTTCTGGAGATGGCCTGTCCTGACAATTCCACAGTATCAAACATAACAATTCCTGTTGTAACCATTTCAAAAGCTGGAGGAGATGTCATTGACAAATACATCTCTGCTGGAAAGAAAGTGGAAGTTCTGTTGTATTCCCCAGATCGCCCGGTGGTGGACTACTCAGCGATGTTCTTATGGCTGATGGCTGTTGGCACAATTTTTTGTGCATCTTTCTGGTCGGAGTTAACTACATACAAGGAAGGCAATGACTATCAACAGGCACCAGAGGTAAATGCTGGAGGCTCCATGGAGGAAGATGACAAGGAAATTCTAAATATCACTACAAAGAGTGCTTTCGTATTTGTCATCTCGGCGTCTTCGTTTCTGCTGCTACTTTACTTTTTCATGTCATCATGGTTTGTCTGGCTGCTGATAATACTTTTCTCTATTGGAGGAGTTGAGGGAATGCATAGCTGTATAATATCCCTGATAACAAGCAAATGTAAAGGTTGTGGAAGGAAAACATTGAATTTGCCGCTTCTTGGGGAGGTTTCTGTTCTATCTCTCGTGGTCTTGATAATCTGCGTGGCATTTGCCATCTTCTGGGCAGCAACTAGGAAAGCATCTTACTCTTGGATAGGCCAAGATATTCTTGGAATTTGCCTGATGATAACTGTTCTGCAGTTGGCTCAGTTACCTAATATAAAGGTTGCTACAGTACTTCTGTGTTGTGCATTTTTCTACGACATTTTCTGGGTTTTCCTTTCACCTGCTATATTCCATGACAGCGTAATGATTGCAGTTGCCCGTGGTGACAAAGCTGGCGGAGAATCCATCCCAATGCTTCTGAGAGTTCCTCGAGTTTCAGATCCTTACGGTGGCTATGATATGATTGGCTTTGGGGACATTCTCTTTCCTGGTTTGCTGGTTTGCTTTGCTTTTAGATTCGACAAAGCTAGAATGAAGAGTGTATTAAATGGATACTACCTCTGGATGATTGTTGGTTATGGAATTGGTCTTTTGTTCACATATTTGGGCTTGTATCTAATGAATGGACATGGTCAACCTGCTCTCCTATATCTCGTGCCCTGCACGCTTGGAACGTATGTGGTGCTGGGATTGATGAGGGGTGAACTTAAAGATCTATGGAACTACGACAGTGAATCAACAAAAGTTGCAGATTCACTATTAGAAGACGCATGA >HBR0388G058 ATGGGTATTCATGGACCTCTGTTTATGATTGTAGCTGTTTTAGCTTTAGCTCCATGTTTCGCCTCTGCTGGAGATATAGTACATCACGACGATGTAGCTCCCAAGAGGCCTGGTTGCGAAAATAACTTTGTTCTGGTAAAAGTCCCTGCTTGGGTTGATGGTGTGGAAGATATAGAGTATGTTGGTGTTGGTGCTCGATTTGGTCTTACTTTGGAATCAAAAGAAAAACATGCCAATAAAACTAGACTCATTTTGGCAGACCCACCTGATCTTTGCAGACCACCCAAAAATAAGCTCAACGGAGATGTCATTCTGGCGCACCGAGGTAATTGCAGCTTCACAACCAAGTCAAATATTGCTGAAGACGCTAATGCTTCAGCTATTCTTATAATAAACTATCGAACAGAACTTTTTAAAATGGTTTGTGAAGCAAATGAAACTGATGTAAGAATAGGCATTCCTGCTGTCATGCTTCCACAGGATGCTGGTGCAAGCTTGGAAAATTATATAAAGAATAGCTCTGCAGTTTCTGTGCAGCTATATTCTCCACAGCGGCCACTTGTTGATGTTGCAGAAGTGTTTTTGTGGCTCATGGCTGTTGGTACCATCTTAGGTGCTTCTTATTGGTCTGCATGGAGTGCCAGAGAAGTGGCTATAGACCAGGACAAGCTTTTAAAGGATGCTTCAGGTGATTTTACGCTCAAAGAAGGTGTTAAATCTAGTGGTGTGGTTAACATCAACACAACATCTGCCATTCTATTTGTTGTGATTGCTTCATGTTTCTTGGTCATGCTTTACAAACTTATGTCATTGTGGTTTATGGATGTTCTGGTGGTTCTGTTCTGCATTGGTGGGATAGAGGGCTTGCAAACTTGCTTGGTAGCTTTGTTATCATGTTTCAGATGCTTTCAACATGCTGGAGAATCATTTATTAAAGTTCCCTTCTTTGGAGCTGTATCATATTTGACCTTGGCCGTCTCTCCCTTTTGCATAGCATTTGCTGTTGTCTGGGCAGTTTACCGTCGTGTCTCCTTTGCCTGGATAGGTCAAGATATCCTTGGCATTGCGCTAATCATCACAGTTCTTCAGATTGTTCATGTACCGAATCTCAAGGTTGGAACAGTTCTTCTCAGTTGCGCATTCTTGTATGACATCTTCTGGGTATTTGTTTCCAAATTGTGGTTCAAGGAAAGTGTGATGATAGTGGTAGCTCGTGGTGATAAGAGTGGAGAGGATGGTATACCAATGCTTTTGAAAATCCCTCGTATGTTTGATCCTTGGGGTGGCTATAGCATTATTGGATTTGGTGATATCATCTTACCAGGATTGCTTGTTGCTTTTGCATTAAGATATGATTGGCTGACAAAGAAGAATCTCCGCGCAGGATATTTTCTGTGGGCAATGACTGCTTATGGTTTAGGTCTCCTAATCACATATATAGCTTTGAACATGATGGATGGCCATGGCCAGCCAGCACTGCTCTACATTGTTCCGTTCACACTTGGCACCTTCTTGACACTGGGAAAGAAGAGAGGTGATCTCAAAGCTCTATGGGCACCCGAGCGATCTTGTCCACACATCCAGTTTCAGCCGTCTCAATCTTAA >HBR0441G001 ATGGATTTGAAGAAACTCTGCTTAGTAATCTCTGTTTCAGCTGTGATTTCGTTGTTCTGTTACCCGTCTTCTGTTACAGCTGGGGACATAGTGCATGACGATGATTCAGCTCCCAAAAAGCCTGGTTGCGAGAATGACTTCGTCTTGGTAAAAGTTCAAACTTGGGTCAATGGAATAGAGGATGCTGAATTTGTTGGCGTGGGTGCTAGATTTGGCACCACCATTGTATCAAAGGAGAAAAATGCAAATCAAACTCGCCTCACTCTTTCAGATCCTCGAGATTGTTGCACTCCTCCCAAGAACAAGCTTGATAGGGATATCATTATGGTTGATCGAGGCATGTGCAAATTCACAGCCAAAGCAAATAATGCAGAAGCTGCTGGTGCTTCTGCTGTCCTTATAATAAATAACCAAAAAGAACTTTACAAGATGGTTTGTGAGCCTGATGAAACTGATCTTGACATAAAAATACCTGCTGTTATGCTACCACAAGATGCTGGTGCAAGCTTGGAAAAAATGCTATTGAATAGTTCATCAGTGTCTGTGCAGCTATACTCTCCAAAGCGGCCACTAGTTGATATAGCCGAAGTATTTTTGTGGCTGATGGCGGTTGTTACCATCTTGTGTGCATCTTACTGGTCTGCATGGAGTGCCAGAGAAGTAGCTATTGAACATGACAAGCTATTGAAGGATGCAGTAGATGAAATTCCAAATGACAAGGTTGTAGGTGTTAGTAGTGTTGTAGACATCAACACCACATCGGCCGTCCTGTTTGTTGTTGTTGCTTCATGCTTCTTGGTCATGCTTTACAAACTTATGTCATACTGGTTTGTTGAGCTTTTGGTGGTTCTTTTCTGTATTGGCGGGATTGAGGGCTTGCAAACCTGCCTAGTTGCTTTATTATCAAGGTGGTTCAAGCATGCAGGACAGTCATACATTAAAATACCCTTCTTTGGACCTCTTTCATACCTAACATTGGCTGTTTCACCATTCTGCATAGCATTTGCTGTTGTTTGGGCCATCTATCGCAATGTCTCCTTTGCCTGGATAGGCCAAGATATATTAGGAATTGCATTGATAGTCACTGTTCTGCAAATTGTCCATGTACCTAACCTCAAGGTGGGAACAGTTCTTCTCAGTTGTGCATTCTTGTATGACATCTTCTGGGTCTTTGTTTCTAAGAAGTTGTTCCATGAAAGTGTCATGATTGTGGTGGCTCGTGGTGATAGAAGTGGAGAGGATGGTATCCCTATGCTGTTAAAGATCCCACGAATGTTTGATCCCTGGGGTGGTTACAGCATTATAGGATTTGGCGACATCCTTCTACCTGGATTGGTGATAGCATTCTCACTTAGGTATGATTGGTTGGCAAATAAGAGTCTTCGAGCTGGATACTTCTTGTGGGCAATGATTGCTTATGGATTAGGTCTTCTCATTACATATGTGGCCTTGAACTTGATGGATGGGCATGGCCAACCAGCACTGCTCTACATTGTCCCATTCACTCTTGGAACCTTTCTGACATTGGGAAAGAAAAGAGGTGATCTCAACGTTTTGTGGGCACGAGGGGAGCCTGAAAGACCCTGCCCCCATGTCCATCTTGAACACTCTCATGAACTGAACGTGGAAAAATAA >HBR2687G083 ATGGATTTGGTGAAGCTTTGCTTCGTAATCTATGTTGCAGCTGTGATTTCGTTGGTGTGTTACCCGTCTTCTGTGATGGCTGGGGACATAGTGCATGACGATGATTCAGCTCCCAAAAAGCCTGGCTGCGAGAACGACTTCGTCCTGGTAAAAGTTCAAACTTGGGTTAATGGAATAGAGGATGCTGAGTTTGTTGGTGTGGGTGCTAGATTTGGTACTACAATTGTGTCAAAAGAGAAAAATGCAAATCAAACACTCCTTACTCTGTCAGATCCTCGAGATTGTTGTACTCCTCCCAAGAAAAAGCTTGATAGGGATATCATTATGGTTAATCGAGGCAAGTGCAAATTCACAACCAAAGCAAATAATGCAGAAGCTGCTGGTGCATCTGCTGTCCTTATAATAAATAACCAAAAAGAACTTTACAAGATGGTTTGTGAGCCCAATGAAACTGATCTTGACATAAAAATACCTGCTGTTATGCTACCACAAGATGCTGGTGCAAGCTTGGAAAAAATGTTACTGAATAGTTCATCCGTGTCTGTGCAGTTATACTCTCCAAAACGGCCCCTAGTTGATATAGCCGAAGTATTTTTGTGGCTGATGGCAGTTGTTACCATATTGTGTGGATCTTACTGGTCTGCATGGAGTGCCAGAGAAGCAGCTATTGAACATGACAAGCTATTGAAGGATGCTGTAGATGAAATTCCAAATGACAAGGTCGTTGGTCTTAGTAGTATTGTGGACATCAACGCAACATCAGCTGTCCTGTTTGTTGTTGTCGCTTCATGCTTCTTGGTCATGCTTTACGAACTAATGTCATACTGGTTTGTTGAGCTTTTGGTGGTTCTTTTCTGCATAGGCGGGGTCGAGGGCTTGCAAACCTGCCTAGTTGCTTTATTATCAAGGTGGTTCAAGCATGCAGGAGAATCATACATTAAAATACCCTTCTTTGGAGCTCTTTCATACCTAACATTGGCTGTTTCACCATTCTGCATAGCATTTGCTGTTGTTTGGGCGGTCTATCGCAATGTCTCCTTTGCCTGGGTAGGCCAAGATATACTAGGAATTGCACTGATAATCACAGTTCTGCAAATTGTCCATGTACCTAACCTCAAGGTGGGTACAGTTCTTCTAAGTTGTGCGTTCGTGTATGACATCTTTTGGGTGTTTGTTTCTAAGAAATTGTTCCATGAAAGTGTCATGATTGTGGTGGCTCGCGGTGATAGAAGTGGAGAGGATGGTATCCCCATGCTGTTGAAGATCCCTCGAATGTTTGATCCCTGGGGGGGTTACAGCATCATAGGATTTGGCGACATCCTTCTACCTGGATTGCTGATAGCATTCTCACTTAGGTATGATTGGTTGGCAAATAAGAGTCTTCGAGCTGGATACTTTTTGTGGGCAATGATTGCATATGGATTGGGTCTTCTCATCACATATGTAGCCCTGAACTTGATGGATGGGCATGGCCAGCCAGCACTGCTCTACATTGTCCCATTTACTCTTGGAACCTTTCTGACATTGGGAAAGAAAAGAGGCGATCTCAACATTTTATGGACACGAGGAGAACCAGAAAGACCTTGCCACCATGTCCATCTTGAACACTATCATGAACTGAACCTGAAAAAATAA >HBR3485G004 ATGGGATTTCATGGACCTCTATATATGGTACTAGCTATATTAGCTTTAACTCCATGTTTCGCCTCTGCTGGAGACATAGTGCATCACGACGATGTAGCTCCCAAGAGGCCTGGTTGTGATAATAACTTTGTTCTGGTAAAAGTCCCTACTTGGGTTGATGATGTAGAAGATATTGAGTATGTTGGTGTTGGTGCTCGCTTTGGTCTTACTTTGGAATCAAAAGAAAAACATGCCAATAAAACTAGACTTGTTTTGGCAGACCCTCCTGATCTTTGCAGGCCACCCAAAAATAAGCTTAACAGAGATGTCATTCTGGTTCACCGAGGTAATTGCAGCTTCACAACCAAGTCAAATATTGCTGAAGGGGCTAATGCTTCAGCTATTCTTATAATAAATAACCGAACAGCACTTTTTAAAATGGTTTGTGGAGCAAATGAAACTGATGTAATCATAGGAATTCCTGCTATCATGCTTCCGCAAGATGCTGGTGCAAGCTTGGAAAAATATATAAAGAGTAGCTCCAGAGTTTATGTGCAGCTATATTCTCCACAGCGCCCGCTAGTTGATGTTGCAGAAGTGTTTTTGTGGCTCATGGCTGTTGGTACCATCTTAGGTGCTTCTTATTGGTCTGCGTGGAGTGCCAGAGAAGTGGCTATCGAGCAGGACAAGCTTTTAAAGGATGGTTCAGATGATTTTACACACACAGAAGGTGTTACATCTAGTGGTGTTGTTAACATCAACACAACATCTGCTATTCTCTTTGTTGTGATTGCTTCATGTTTCTTGGTCATGCTTTACAAACTTATGTCATTGTGGTTTATGGATGTTCTGGTGGTTCTGTTCTGCATTGGTGGGATAGAGGGCTTGCAAACTTGCTTGGTAGCTTTGTTATCATGTTTCAGATGCTTTCAACATGCTGGAGAATCATTTATCAAAGTTCCCTTCTTTGGAGCCGTATCATATTTGACCTTGGCTGTCTCTCCCTTTTGCATATCATTTGCTGTTGTTTGGGCAGTTTACCGCCGTGTCTCCTTTGCCTGGATAGGTCAAGATATCCTTGGCATTGCACTAATCATCACAGTTCTTCAGATTGTTCATATACCAAATCTCAAGGTTGGAACAGTTCTTCTCAGTTGCGCATTCTTATATGACATCTTCTGGGTATTTGTTTCCAAACTGTGGTTCAAGGAGAGTGTGATGATAGTGGTAGCTCGTGGTGATAAGAGTGGAGAGGATGGTATACCAATGTTATTGAAAATCCCTCGAATGTTTGATCCTTGGGGTGGCTACAGCATTATTGGGTTTGGTGATATCATCTTACCCGGATTGCTTGTGGCTTTTGCGTTAAGATATGATTGGCTGACAAAGAAGAATCTCCGAGCAGGTTACTTTATGTGGGCAATGACTGCTTATGGGTTAGGTCTCCTAATCACTTACGTAGCTTTGAACATGATGGATGGGCATGGCCAGCCAGCATTGCTGTACATTGTTCCGTTCACACTTGGCACCTTCTTGACACTGGGAAAGAAGAGAGGTGAACTCAAAGCTCTGTGGACAAGAGGCGCACCTGAAAGGCCCTGCCCACACGTGCAGTTTCAGCCTTCTCAATCTCAATAG >Potri.014G150000 ATGACGTTTCCTTCAAGAAGAAGTTGCTCTCTTCACACAATCTTCTTTTGCATTTTCTTTCTGATCGGTCTCTCGTTTGCTGAGGAAGCTTCTCACGACGGCGATTCCCCCAAATTCCCTGCCTGCGACCATCCTTACAATTTGGTCAAGGTTAAGAACTGGGTTAATGGTGCCGGAGGTGAGACTTTGACCGGGATAACTGCAAGATTTGGAGCTCTTCTGCCAAAAGAGGAGAGAAATGGTGTCAGATTAACGGCTATTTTCTCTAATCCGTTAAATAGCTGTTCGCCTTCTTCTTCCAAGCTATCTGGTTCTGTTGCCATGGCTGTGCGCGGTGACTGTGACTTCACAACAAAGGCTAAAGTTGCTCAGTCCGGAGGTGCAGCAGCTTTGTTGGTGATAAATGACAAAGAAGAGCTTGCCGAGATGGGTTGTGAAAAGGATAGTTCTGCCCAAGATGTATCAATCCCTGTTGTACTGATTCCAAAGTCAGGGGGTGAATCTCTGAACAGATCTGTTGTGGATGGACAGAAAGTGGAGCTTCTGTTCTATGCACCCGTTCGTCCTCCAATGGATTTGTCGGTGATATTCTTATGGATGATGGCCGTCGGAACAGTTGTCTGTGCTTCACTTTGGTCTGAGATAGCTGCTTCTGAGGAGGCCGAGGAGCGGTATAATGAATTGTCACCAAAGGAAACTTCCAATGTCTCAGCATTCAAAGACAACGCTGAGAAAGATTTCCTTGATATTGATGTGAAGAGTGCAGTAGTTTTTGTGATAACAGCATCTGCATTTTTGTTGCTACTTTACTTCTTCATGTCAAGCTGGTTTGTCTGGCTGCTGATCGTACTCTTCTGCATTGGTGGTATTGAGGGGATGCACAATTGCATAACAACAGTTATTTTAAGAATATGCAAAAACTGTGGGCGGAAGAAGCTAAATTTACCTCTTCTTGGAGAAACTTCTCTTTTATCACTTATTGTATTATTCTGCTGTGTGGCATTTGCCATTTTCTGGGCTATAAATCGGCAGGCATCGTATTCATGGGCTGGGCAGGATATTCTTGGCATTTGCTTGATGATAACTGTCTTGCAGGTGGCTCGATTACCTAATATTAAGGTTGCTACAGTACTTCTTTGTTGTGCATTTGTTTATGACATCTTCTGGGTCTTTCTGTCACCAATAATATTCCATCAGAGTGTTATGATTGTGGTTGCTCGAGGTGACAACAGTGGCGGGGAAACTATTCCGATGCTTTTAAGAATCCCTCGATTTGCTGACCCTTGGGGTGGTTATGACATGATTGGATTTGGCGACATTCTTTTTCCTTGCTTGCTTGTATCATTTGCTTTCAGATACGACAAAACAAACAAGAAGGGTATAGCAAATGGATATTTTATTTGGTTGACAGTTGGCTATGGAGTCGGTCTTTTCCTGACGTACCTGGGCTTATATCTGATGAATGGGCATGGTCAACCTGCACTCCTCTATCTTGTTCCTTGTACTCTAGGAACTTGTGTCCTATTGGCTTTAGTGCGAGGAGAGCTGAAAAACCTCTGGAATTATAGTTCTGAAGAAGCTTCATCAAGGGTTTCTTCTGGCGATGCATGA >Potri.014G085300 ATGAATATTTGTAAAAATAAGTATGTATTTATAGTTGTTTTAGCTTCAAGCTTTTGTTTTGGATCAGCTAGTGATATAGTGCACCAGGACGACGTCGCTCCAAAGCGGCCTGGCTGTGAAAATAATTTCGTTCTGGTCAAAGTACCAACTTATATTAATGACGTAGAAGACATTGAGTATGTTGGTGTTGGTGCTCGTTTTGGCCTCACTTTGGAATCTAAGGAAAAACATGCGAATTTATCTACACTTGCTCTGGCTGACCCTCCTGATTGTTGCAGCAAACCCAGAAATAAGCTTTCAGGGGAGGTGATCTTGGCTTACCGAGGTAACTGTAGCTTCACAGCGAAGGCAAATGTTGCTGAAGATGCTGGTGCTTCAGCTATTCTTATCATAAACAACCGGACAGAACTCTTCAAGATGGTTTGTGAAGTCAATGAAACTGATGTAAAGATTGGCATTGCTGCTGTCATGCTCCCACAAGATGCTGGTGCAAGCTTGGAAAAATATTTGACGAGCAGCTCCACAGTTAAAGTGCAGTTATACTCTCCACGACGTCCAGTGGTAGATGTTGCAGAAGTGTTCTTATGGCTCATGGCTGTTGGCACCATTTTATGTGCTTCCTACTGGTCCGCGTGGAGTGCTAGAGAAGCTGCTATAGAGCAGGATAAGCTATTAAAGGATGGTTCGGATGAATTTATAGATATGGATGGTGTTCGCTCTAGTGGTATTGTTAACATCAACACAGCATCTGCAGTTCTCTTTGTCGTGATTGCTTCATGTTTCTTGATTATGCTTTACAAGCTTATGTCATACTGGTTTATTGAGGTTCTGGTGGTTCTGTTCTGCATTGGGGGAGTGGAGGGCTTGCAAACTTGCTTGGTTGCTTTATTATCATGTTTCAGATGGTTTCAACCTGCTGGAGAATCATTTATTAAAGTTCCCTTCTTTGGAGCTGTCTCATATCTGACTTTGGCAGTCTCTCCTTTCTGCATAGCATTTGCTGTTGTTTGGGCAGTTTTCCGCCGTGTCTCCTTTGCTTGGATTGGTCAAGATATCCTTGGTATTGTTCTGATCATTACTGTTCTTCAGATTGTTCGTGTGCCCAATCTCAAGGTGGGAACAGTTCTTCTAAGTTGTGCCTTTTTGTATGACATCTTCTGGGTTTTTGTTTCCAAATGGTGGTTCAAGGAGAGTGTGATGATAGTGGTAGCTCGTGGTGATAAGAGTGGAGAGGATGGTATACCAATGCTACTGAAAATCCCACGGATGTTTGATCCTTGGGGTGGCTATAGCATAATTGGGTTTGGTGACATCATCTTACCAGGATTGCTTGTAGCTTTTTCATTGAGATATGATTGGCTTGCAAAGAAGAATCTTCGAGCCGGATACTTCTTGTGGGCAATGACTGCTTATGGTTTAGGTCTCCTAATAACATACTTGGCTTTGAACATGATGGATGGGCATGGCCAGCCAGCTTTGCTTTACATTGTTCCATTCACCCTTGGTACGTTTCTGACGCTGGGAAGGCGACGAGGTGATCTCAAAACATTATGGACAATGGGAGAACCTGAAAGGCACTGCCCGCACATCCAATTTCAACCCCCTGGCTCTCAACAATAA >Potri.002G232200 ATGGCTTTTCCTTCTAGAAGAAGAAGAAGAAGCTGCTCTCTTCACGCAGTCCTCCTCTTTAGCTTCTTGTTTCTGATTGGTCTCTCATTCGCCGAGGAAGCTTCTCACGACGGCGATTCCCCCAAATTTCCCGGCTGCGATCATCCTTACAATTTGGTCAAGGTTAAGAACTGGGCTCATGGTGTTGAAGGCGAAACTTTTGCTGGAATAACTGCTAGATTTGGGGTTTTTCTGCCAAAAGAGGAGAAGAATAGTTACAGATTGACGGCTGTTTTCTCTAATCCATTAAATGGCTGTTCGCCTTCTTCCTCCAAGCTATCTGGTTCTATTGCCATGGCAGTGCGCGGTGGTTGTGACTTCACAACGAAGGCTGAAGTTGCACAGTCTGGAGGTGCAGCAGCCCTGTTGGTGATAAATGACGAAGAAGAGCTTGCTGAGATGGGTTGTGAAAAGGGCACTTCTGCTCAAGATATTTCAATCCCTGTTGTTTTGATTCCAAAGTCAGGAGGTCAATCTCTGAACAAATCTATTGTGAATGGACAGAAAGTCGAGCTTCTGTTCTATGCACCTGTTCGTCCTCCAGTGGATTTGTCAGTGATATTTCTGTGGATTATGGCTGTCGGAACAGTTGTCTGTGCTTCAGTTTGGTCTGAGATAGCTGCTTCAGAGGAGACCAATGAGCGGTATAATGAATTGTCACCAAAGGAAACTTCCAACGCCTCAGCATTCAAAGATGACACTGAGAAAGAGGTCATTGATATTAATGTGAAGAGTGCAATTGTTTTTGTGATAACAGCTTCTGCATTTCTGTTGCTACTCTACTTCTTCATGTCAAGCTGGTTTGTCTGGCTGCTGATTGTACTCTTCTGCATTGGTGGTATTGAGGGGATGCATAATTGCATAACAACAGTGATTTTAAGAATATGCAGAAACTGTGGGCGGAAGAAACTAAATTTACCTCTTTTTGGAGAAACTTCTCTTTTCTCACTTCTTGTATTAATCTGCTGTGTGGTATTTTCCACTGTGTGGGCTATAAATCGACAGGCATCATATTCATGGGCTGGACAAGATATTCTTGGCATTTGCTTGATGATAACGGTCTTGCAGGTGGCTCGATTACCTAATATCAAGGTTGCTACAGTACTTCTTTGTTGCGCATTTGTTTATGACATCTTTTGGGTCTTTCTGTCACCGATAATATTCCATCAGAGTGTTATGATTGCGGTTGCTCGAGGTGACAACAGTGGCGGGGAAACTATTCCGATGCTTTTAAGAATTCCTCGATTTGCTGATGAGTGGGGTGGTTATGACATGATTGGATTTGGTGACATTCTTTTTCCTGGCTTGCTTGTATCATTTGCTTTCAGATACGACAAAGCAAACAAGAAGGGTATAGCAAATGGATATTTTCTTTGGTTAACAATTGGCTATGGAGTTGGTCTTTTCCTCACGTACCTGGGCTTATATCTAATGGATGGGCATGGTCAACCTGCGCTCCTCTACCTTGTTCCTTGCACTCTAGGACTTTGTATCCTATTGGGTCTAGTGCGAGGAGAGCTGAAGGACCTCTGGAATTATAGCTCTGAAGATGCTTCATCAAGGGCTTCATCTGGCTTGGCCTGA >Potri.002G160500 ATGGATACTTATAAAAAGGTATATCTGTTAATAGCTTTGCTAGCTTCAAGCTTTTGTTTGGGATCAGCCGGTGATATAGTTCACCACGACGACGTCGCTCCTAAGCGGCCTGGCTGTGAAAATAACTTCGTTCTGGTCAAAGTACCAACTTGGATTAATGGCGTAGAAGACATTGAGTATGTTGGTGTCGGTGCTCGTTTTGGTCTCACTTTGGAATCGAAGGAAAAACATGCTAATTTATTTATACTTGCCCTGGCTGACCCTCCTGATTGTTGTAGCAAACCCAAAAATAAGCTTTCAGGGGAGATCATATTGGCGCACCGAGGTAACTGTAGCTTCACAACAAAGGCAAATGTTGCCGAAGATGCTGGTGCTTCAGCTATTCTCATCATAAACAACCGGACAGAACTGTTCAAGATGGTTTGTGAAGTCAATGAAACTGATGTAAAGATTGGCATTGCTTCTGTCATGCTCCCACAAGATGCTGGTGCAAGCTTGGAAAAATATTTGACGAGCAGCTCATCAGTTAAAGTGCAGCTATACTCACCACGACGTCCAGTGGTGGATGTTGCAGAAGTGTTCTTATGGCTTATGGCTGTCGGTACCATTTTATGTGCCTCTTACTGGTCTGCATGGAGTGCAAGAGAAGCTGCTATAGAGCAGGATAAGCTATTGAAGGATGGTTTGGATGAATTGATTCATATGGATGGTGTCCGTTCCAGTGGTATTGTTAACATCAACACGACATCTGCAATTCTCTTCGTTGTGATCGCTTCTTGTTTCTTAGTTATGCTTTACAAACTTATGTCGTACTGGTTTATCGAGGTTCTGGTGGTTCTGTTTTGCATTGGGGGAGTGGAGGGCTTGCAAACTTGCTTGGCTGCTTTGTTATCATGTTTCAGATGGTTTCAACCTGCGGGGGAATCATTTGTTAAAGTTCCCTTCTTTGGAGCTGTCTCGTATCTAACACTGGCAGTCTCTCCTTTCTGCATAGCATTTGCTGTTGTTTGGGCAGTTTTCCGCTCTATCTCCTTTGCCTGGATAGGTCAAGATATCCTTGGTATTGCTCTGATCATTACAGTTCTTCAGATCGTTCGTGTGCCAAATCTCAAGGTTGGAACAATTCTTCTAAGTTGTGCCTTCTTGTATGACATCTTCTGGGTTTTTGTTTCGAAATGGTTGTTCAAGGAGAGTGTTATGATTGTGGTGGCTCGTGGTGATAAGAGTGGAGAGGATGGTATACCGATGCTACTGAAAATCCCACGGATGTTTGATCCTTGGGGTGGCTATAGCATAATTGGGTTTGGTGACATCATCTTACCAGGATTGCTTGTAGCTTTTTCATTAAGGTATGACTGGCTTGTGAAGAAGAATCTTCGAGCAGGATACTTCTTGTGGGCAATGACTGCTTATGGTTTAGGTCTCCTAGTAACATACGTAGCTTTGAACATGATGGATGGGCATGGCCAGCCAGCTTTGCTTTACATTGTTCCATTCACCCTTGGTACCTTTTTGACGTTGGGAAAGCAAAGAGGAGATCTGAAAGCATTATGGACAATGGGAGAGCCTGAAAGGCCCTGCCGGCACATCCAATTTCAACCCTCTGGATCTTAG >Potri.001G103100 ATGGATTTTAAAAAACTGTGCTCTATAATCACTATAACAGGTGTGATTTTACTGGTGTGTCACCCATCTTCAGTTACAGCAGGAGATATAGTCCATGATGATAACTTAGCTCCCAAAAAGCCTGGCTGTGAAAATGACTTCGTTTTGGTAAAAGTTCAAACTTGGGTCGGTGGAGAAGAGGATGCTGAATTTGTAGGCGTGGGTGCTAGATTTGGCACTACCATTGTGTCAAAAGAGAAAAATGCAAACCAAATTCGCCTTACACTTTCAGACCCTCGAGATTGTTGTAGTGCACCTAAGCACAAGCTTGATAGAGATGTCATCATGGTTCACCGAGGTCACTGCAAGTTCACAACCAAAGCAAATAATGCTGAAGCTGCTGGTGCTTCAGCTGTGCTCATTATAAATAACCAAAAAGAACTTTACAAGATGGTCTGTGAGCCAGATGAAACTGATCTAGATATACACATACCTGCTATTATACTCCCACAAGATGCCGGTGCAAGCTTGGAAAAAATGCTATTGACTAATACATCAGTGTCTGTGCAGCTTTACTCTCCAAAGCGACCATTAGTTGATGTCGCCGAAGTCTTTTTGTGGTTAATGGCTGTTGGTACCATCTTGTGCGCGTCTTATTGGTCCGCGTGGACTGCCAGAGAAGCAGCTGCCGAACAGGACAAGCTATTGAAGGATGCTGTGGATGAAGTTCCAAATGACAAAGCTGTGGGTGTTAGTAGTGTTCTGGACATCAATACAGCATCAGCTGTCCTGTTTGTTGTCATTGCTTCATGCTTCCTGGTCATACTTTACGAACTCATGTCATATTGGTTCATTGAGCTTTTGGTGGTCCTGTTCTGCATAGGTGGTGTGGAGGGCTTGCAAACTTGCCTGGTTGCTTTATTGTCAAGGTGGTTCAAGCATGCTGGAGAATCGTACATAAAAGTACCATTCTTTGGAGCTCTCTCGTACCTAACGTTAGCTGTTACTCCATTCTGCATAGCATTTGCAGCTGGTTGGGCTATGCATCGCAATCTCTCCTTTGCCTGGATAGGTCAAGATACACTTGGAATTGCACTGATAATCACTGTTCTGCAAATTGTCCATGCACCTAATCTCAAGGTGGGTACTGTTCTTCTCAGTTGTGCGTTCTTGTATGACATCTTTTGGGTGTTTGTTTCCAAGAAGTTGTTCCATGAAAGCGTCATGATTGTGGTGGCTCGTGGTGATAGAAGTGGAGAGGATGGTATCCCAATGCTGTTAAAGATTCCACGCTTGTTTGATCCTTGGGGTGGTTACAGCATCATAGGGTTTGGCGACATCCTTTTACCTGGGTTGCTGATAGCATTTTCCCTCAGGTATGATTGGTCAGCAAATAAGAGCCTTTGTGCTGGGTACTTCCCATGGGCAATGCTTGCTTACGGATTAGGTCTTCTCGTTACTTATGTGGCACTGAACTTGATGGATGGCCATGGGCAGCCAGCACTGCTATATATCGTCCCATTCACCCTTGGAACTTTTCTTACGTTAGGGAAGAAAAGAGGGGATCTCAGAGTCTTATGGACACAAGGAGAACCACAAAGACCATGCCCCCATGTCCTTCTCCAACGTAGTCAAGAAATGGACTAG >Potri.003G128500 ATGGATTTGCAAAAACTGTGCCTTGTAATCACTGTCACAGCTGTGATTTCACTGGTCCCATCTTCAGTTACCGCAGGAGATATAGTTCATGATGATAATTTAGCCCCAAAAAAGCCAGGCTGCGAAAATGACTTCGTTTTGGTAAAAGTTCAAACTTGGGTCGATGGAGTTGAGGATGCTGAATTTGTTGGTGTGGGTGCTAGATTTGGCACTACCATTGTGTCAAAAGAGAAAAATGCAAACCAAATTCGCCTTACACTTTCAGACCCTCTAGATTGTTGTAGTGCACCTAAGCATAAGCTTGATGGAGATGTCATCATGGTTCACCGAGGTCATTGCAAGTTCACTACCAAAGCAAATAATGCTGAGGCTGCTGGTGCTTCAGCCTTGCTCATTATAAATAACCAAAAAGAACTTTACAAGATGGTCTGTGAGCCAGATGAAACTGATCTGGATATACACATACCTGCTGTTATGCTTCCACAAGATGCAGGTTCAAGCTTGGAAAAAATGCTGCTAACTAATTCATCTGTGTCTGTGCAGCTTTACTCTCCAAGGCGACCATTAGTTGATATTGCTGAAGTCTTTTTGTGGTTGATGGCAGTCGGTACCATCTTGTGCGCCTCTTATTGGTCTGCATGGAGTGCCAGAGAAGCAGCTATTGAACAAGACAAGCTATTGAAGGATGCTGTGGATGAAATTCCAAATGAAAAGGCTGTGGGTTTTAGTACTGTTGTAGACATTAATACAACGTCAGCTGTTCTGTTTGTTGTCATTGCTTCATGCTTCTTGGTCATACTTTACAAACTCATGTCATATTGGTTCATAGAGCTTTTGGTGGTCCTCTTCTGCATAGGTGGTGTGGAGGGATTGCAAACTTGCCTGGTCGCTTTGTTGTCAAGGTGGTTCAAGCATGCTGGAGAATCATACATTAAGGTGCCATTCTTTGGACCTCTCTCATACCTAACTTTGGCTGTTGCTCCATTCTGCATAGCATTTGCAGTTGTTTGGGCTGTGTATCGCACTGTTTCCTTTGCCTGGATAGGTCAAGATATACTCGGAATTGCACTGATAATCACCGTTCTGCAAATTGTCCATGTGCCTAATCTCAAGGTGGGTACAGTTCTTCTCAGTTGTGCGTTCTTGTATGACATCTTTTGGGTGTTTGTTTCTAAGAAGGTGTTCCATGAAAGCGTCATGATTGTGGTGGCTCGTGGTGATAGAAGTGGAGAGGATGGAATACCGATGCTGTTAAAGATCCCACGCTTGTTTGATCCTTGGGGTGGTTACAGCATCATAGGATTTGGTGACATCCTTTTACCTGGATTGCTGATAGCATTTTCCCTCAGGTATGATTGGTTAGCAACTAAGAGTCTTCGAGCTGGGTACTTCCCATGGGCAATGCTTGCTTATGGACTAGGTCTTCTCGTTACTTATGTGGCACTGAACTTGATGGATGGCCATGGGCAACCAGCACTGCTCTATATTGTCCCATTCACCCTTGGAACTTTTCTGGCACTGGGGAAGAAAAGAGGGGATCTCAGAGTCTTATGGACCCAAGGAGAACCAGAAACACCATGTTCCCATGTCCGTCTCCAACATAGTGAAGAATTGGACTAG >Araip.VBB27 ATGGCTGTGGAGAAGTTTTTACCGGTTGCTGCTTTTTTAGCTGTAATACTGCTTCTCCGTCACGCTCCTTCTGTCATTGCTGGGGACATAGTTCACGATGACGATTCTACCCCCAAGAAGCCCGGTTGCGAGAACCAGTTCGTTCTGGTGAAAGTGCAGACATGGGTCAATGACAAAGAGGATGATGAATTTGTTGGTGTGGGGGCCAGATTTGGCACAACAATTGTGTCCAAGGAGAAGAATGCTAAGCACACTCGCCTTATTCTTTCAGATCCCCGAGATTGTTGCAATCCTCCAAAGAATAAGATTGCGGGAGATGTCATCATGGTCGATCGAGGGAACTGCACCTTCACAAAGAAGGCAAAAACTGCACAAACTGCTAATGCTTCAGCTATCCTTATCATAAATAACCAAAAGGAGCTTTACAAGATGGTATGCGAACCAGATGAAACTGATTTGAACATACACATACCCGCTGTCATGCTCCCACGAGATGCAGGTGCAAGGCTCAAAGAAATGCTGACAAGTGCTTCATCTGTGTCTGTCCAGCTATATTCACCACGTCGACCAGCTGTTGATGTAGCAGAAGTATTTCTTTGGCTACTAGCAGTTCTTACCATATTGTGTGCATCATATTGGTCAGCATGGAGGGTCCGAGAAGCAGCTGATGAACACAACAAGCTATTAAAGGATGCTTCAGATGAAGTCCCAGACACTATAAACACAGGTGTTAGCAGAGTTGTAAACATGAATATGAAGGCTGCAATCCTTTTTGTTGTGCTAGCTTCATGTTTCCTGTTTATGATTTACAAATTGATGTCGCCATGGTTCATTGATATTTTGGTTGTTCTCTTCTGTATTGGTGGCGTTGAGGGCTTGCAAACTTGCTTGGTTGCTCTTTTGTCAAGGTGGTTCAAGCATGCTGCCAAGACATACATTAAAATACCTTTCTTTGGAGCTATCTCATACCTGACTTTGGCTGTTTCTCCATTTTGTATAACCTTTGCGGTTCTCTGGGCAGTTTATCGCACTCACTCGTTTGGGTGGATTGGTCAAGATATACTTGGAATTGCACTGATAATAACAGTTCTACAGATTGTACATGTACCTAATCTCAAGGTGGGTACGGTTCTTCTGAGTTGTGCCTTCATTTATGACCTCTTTTGGGTGTTTGTCTCGGCGAAGTTTTTCCAGCAAAGCGTGATGATTGTGGTAGCCCGAGCTGATGGAAGTGGTGAAGATGGTATCCCAATGTTACTGAAATTTCCCCGCATCTTTGATCCATGGGGTGGTTACAGCATTATAGGTTTTGGAGACATACTTTTACCAGGAATGCTGGTAGCATTCTCACTCAGATATGATTGGCTGGCGAACAAGAACATAAGAAATGGGTACTTCTTGTGGGCAATATTTGCATATGGCTTTGGCCTTCTAGTTACATATGTGGCACTAAATTTGATGGATGGACATGGCCAGCCAGCACTACTATACATTGTTCCATTTACCCTTGGGACTTTGCTGACATTAGGGCGAAAGCGAGGAGATCTGCAGGTTTTATGGACAAGAGGAGAACCAGAAAGACCCTGTCCACATATCAGACTCCAGCATAGTGGAGAAGTAAGCCCTGAATGA >Araip.V9H2E ATGGGACAAAGAGTGAGTGAGTTTCACCTCGAGGCATTGCAACAAGATGGTGTATGGAAGAGAGTTACAAATGGCACCACAATTGAATATCAGAGTTTTTTACTGTTTCCAAAAGTTGGAACTGTTCTTCTCAGTTGCGCCTTCCTATACGACATCTTTTGGGTATTCGTTTCTAAACGGTGGTTCCATGAGAGCGTCATGATAGTGGTAGCTCGAGGTGATAAGAGTGGAGAAGATGGTATCCCAATGCTGCTAAAGATACCACATTTGTTCGATCCTTGGGGTGGTTACAGCATCATTGGTTTTGGGGACATTATCTTACCAGGGCTTCTAGTAGCATTTTCACTAAGGTATGATTGGTTGGCAAAGAAGAGCCTTCGCGCTGGGTACTTCTTGTGGGCAATGACTGCCTATGGCTTAGGTATATTACAATATTATATCTAA >Araip.3F09X ATGGTTCTTCCACATGGTGTGTTCCTTCTCTTCTTCATGCTCTCTTCTGCAACTTTGGCTTTGGCTGGAGACATAGTTCACCATGATGATGTTGCTCCAAGAAGACCTGGTTGTGAGAACAACTTTGTTCTGGTCAAAGTCCCCACTTGGATTGATGGTGTTGAAAACAGTGAGTATGTAGGTGTTGGTGCAAGATTCGGCCCTACGTTGGAGTCAAAAGAGAAACGTGCCAACCACACTAGAGTTGTCATGGCTGACCCTCCTGATTGTTGTTCCAAGCCTAAGAATAAGCTCACTAGCGAGATCATTGTGGTGCAACGAGGAAAATGTAGTTTCACAACCAAGGCAAATATAGCTGAGGAAGCTGGTGCTTCAGCCATCCTCATTATAAATTATAGGACAGAACTTTTCAAGATGGTTTGTGAAGAGAATGAAACCGATGTTGATATTGGTATACCCGCTGTCATGCTTCCACAATATGCTGGATTAAACATAGAAAAACATATAAAAAACAACTCCACAGTATTTCTATGGCTTATGGCCGTTGGAACCATTTTATGTGCTTCTTATTGGTCTGCTTGGACTGCTAGAGAAGCAGCTATTGAGCAAGAGAAGCTTTTAAAGGATGCTTCGGATGAATACCTTAGCACACAGAATGTTGGTTCAAGTGGTTATGTGGAAATCAGTACCGTGGCTGCAATTTTATTTGTTGTGATTGCTTCTTGTTTCTTGGTTATGCTTTACAAGTTAATGTCATTCTGGTTTGTTGAAGTTCTGGTGGTTCTATTCTGCATTGGGGGAGGACTGCAAACTTGTTTGGTGGCTCTTTTATCATGTAAAATATGGTTTCAACATGCTGCACAAACATTTGTGAAAATTCCCTTCTTTGGAGCCGTCTCATATCTGACATTTGCCGTTACCCCCTTTTGCATAGTGTTCGCTGTGATATGGGCAGTTTATCGTCGTGCTTCGTTTGCTTGGATCGGTCAAGACATTCTTGGTATCACACTGATAATTACAGTTCTTCAGATTGTACGGATACCGAATCTCAAGGTTGGAACTGTTCTTCTCAGCTGCGCCTTCCTATACGACATCTTTTGGGTGTTCGTTTCTAAACGGTGGTTCCATGAGAGCGTCATGATAGTGGTAGCTCGAGGTGATAAGAGTGGAGAAGATGGTATCCCAATGCTGCTAAAGATACCACGTTTGTTCGATCCTTGGGGTGGTTACAGCATCATCGGTTTTGGGGACATTATCTTACCAGGGCTTCTAGTAGCATTTTCACTAAGGTATGATTGGTTGGCAAAGAAGAGCCTTCGTGCTGGGTACTTCTTGTGGGCAATGACTGCCTATGGCTTGGGTCTCCTCATCACATACGTGGCTTTGAACTTGATGGATGGACATGTCCAACCAGCTTTGCTTTATATAGTCCCCTTCACACTTGGAACCTTTTTGTCATTGGGAAAGAAGAGAGGTGAACTCAAGATTTTATGGACAAGGGGAGAACCAGAGAGACCTTGCCCTCACATGCAAGAAGAGGATCAACAATCACTTAACCAGCATTGA >Araip.Q896X ATGAAGCAATGGGTTGATGGCAATGTTGTGAATTCCGGGTACGGTGGCATGAGTGCAATGTTTGGTGCTCAGTTTCCCAAGGAAGTCGGTCAGAGTCCCAAATCTCCTCTTGTTTTTGCCAATCCTAGAGACTGTTGTGTCCCACCAATTACTAAGTTACTTGTTGGATCAGTAACTTTATGTCAGCGTGGTACTTGCGACTTCACAACTAAAGCTGCAATTGCACAGGCAGCAGGTGCAGTTGCCGTATTGGTCATAAATGAGTCGGACGACCTTTTCTCAATGGAGTGTTCCAATAGCTCTAGAGTAGACATTTCAATCCCAGTTGCAATGATATCAAAGACAGCAGGAGATGATCTCGACAATGAGTTGACATCTGGAAAGAAAGTGGAACTTTCGATATATGCTCCAACTCGCCCACTTTTAGACTATTCAGTTGCAGTTTTGTGGTTGATGGCTGTCGGAACAGTTATATGCGCTTCAACATGGGCAGATATAACAGCTGCTGATTGTGATGAACGCTACAATGAATTGTCTCCCAAGGGATCTTTCAAATCCGAAACAATGAAAGATGAGGAGGACATTGTTAACATAGACACAAAGGGTGCTATTATCTTTGTCATTTCGGCATCCACTTTTCTTGTGCTACTATTTTTCTTCATGTCATCTTGGTTTATCTGGGTGCTGATTGTACTTTTCTGCATTGGTGGTGTTGAGGGGATGCACAATTGTATTGTGAGCCTCGTTTTAAGAGTATTTCCAAAACTTGGACGGAATATAGTGAAGGTACCTATGTTTGGGAAGAGTTCTATCTTCTCAATAGTAGTTTTTATAGTATGTGTGGCATTTGCGGTATTATGGATTGTTAATCGGCGGGAGTCATATTCATGGTTCGGCCAAGATGTCCTTGGCATTTGTTTGATGATAACAATCTTGCAGTTGGCACGATTACCTAATATTAAGGTTGCAACTGTACTTCTTTGTTGTGCATTTGTATACGACATCTTTTGGGTGTTCATATCTCCAGTGATATTCCATAAGAGTGTTATGATTACAGTTGCTCGAGGTGACAAGGCTGGTGGGGAAGCAATTCCTATGCTTTTGAGGTTTCCTCGTCCACACGATCCTTGGAAAGGTTATGACATGATTGGATTTGGAGACATTCTCTTCCCTGGCTTGCTTGTTTGCTTTGCTCGTAGATTTGACAAAGAGAACAACAAGAGGTCAGTGAATGGATATTTTCTTTGGTTGGTAATTGGCTATGGCGTCGGCCTTTTTCTAACATATCTTGGGCTATACTTGATGAAGGGTCATGGACAACCAGCACTTCTCTACCTTGTTCCATGTACCTTGGGTACGGCTGTCATATTGGGATGTATAAGAGGAGAAATGAGGAGTCTTTGGGATTACAAACCAAACTTGCCTCCCTCCAAAGTGCCTCCAGAAGTGTAA >Araip.SF21Z ATGATAGTGGTAGCTCGAGGCGATAGGAGTGGAGAAGATGGTAACAAAAGTCATATATATTCGTATGATTGGTTGGCAAAGAGGAACCTTCGGTCTGGATACTTCATGTGGGCAATGAGTGCTTACGGTTTAGGTCTCCTTATTACATATGTTGCTTTGAACTTGATGGATGGGCATGGTCAACCAGCATTGCTTTATATCGTCCCGTTTACTCTTGGCACATTTTTGTTATTGGGAAAAAAGAGAGGTGAACTCAATCTTTTATGGACAAGAGGGGAACCAGAAATGCCTTGCCCTCATAACCAAGAGTCTCAACAATGA >Araip.AH9LW ATGATAGTGGTAGCTCGAGGCAATAGGAGTGGAGAAGATGGTATCCCCATGCTGCTTAGCATAATTGGTTTTGGGGACATAATCTTATCGGGGCTTCTAGTCGCATTTTCACTAAGGTATGATTGGTTGGCAAAGAGGAACCTTCGGTCTGGATACTTCGTGTGGGCAATGAGTGCTTACGGTTTAGGTCTCCTTCTAACATATGTTGCTTTGAACTTGATGGATGGGCATGGTCAACCAGCATTGCTTTATATCGTCCCGTTTACTCTTGGCACATTTTTGTTATTGGAAAAGAAGAGAGGTGAACTCAATCTTTTATGGATAAGAGGGGAACCAGAAATGCCTTGCCCTCATAACCAAGAGTCTCAACAATGA >Araip.A0GB7 ATGATAGTGGTAGCTCGAGGCGATAGGAGTGGAGAAGATGGTAACAAAAGTCATATATATTCGTATGATTGGTTGGCAAAGAGGAACCTTCGGTCTGGATACTTCATGTGGGCAATGAGTGCTTACAGTTTAGGTCTCCTTATTACATATGTTGCTTTGAACTTGATGGATGGGCATGGTCAACCAGCATTGCTTTATATCGTCCCGTTTACTCTTTGCACATTTTTGTTATTGGGAAAAAAGAGAGGTGAACTCAATCTTTTATGGACAAGAGGGGAACCAGAAATGCCTTGCCCTCATAACCAAGAGTCTCAACAATGA >Araip.6VZ2D ATGACATCTTCTGGGTATCAATGCACCACAACCAAGGCAAATATAGCTAAAGAAGCTGGTGCTTCAGCGATCCTCATTACAAATAATCGGACAGAACTTTTCAAGATGGTTTGTGAAGAGAATGAAACTGATATTGATATTGGAATTCCTACTGTGATGCTTCCACAAGATGCTGTGTCTGTGCAGTTATACTCTCCGCTGCGCCCATTAGTTGATGTAGCGGAAGTGTTTTTATGGCTTATGGCTGTTGGTACCATTCTCTGTGCTTCTTATTGGTCTGCCTGGACAACTAGAGAGGCTGCTGTTGAGCGTAAGAAGCTATTAAAGGATGCTTCGGATGAATATTTGAATACTGAGAATGCTGGTTCTACTGGTTATGTAGAAATCAGTACCATGGCAACAATTTCTTTTGTTGTGATCGCTTCTTGTTTCTTGCTTATGCTTTACAAATTAATGGCATCCTGGTTTATTGAAGTTCTGGTGGTTCTATTTTGCATTGGTGGTGTTGAGGGACTGCAAACTTGCTTGGTGGCTCTATGGTTTCAACATGCTGGGCAAACATTTGTAAAAATACCCTTCTTTGGAGCTGTCTCATATTTGAGACTTGCTATGACTCCCTTCTGCATAGTATTTCCCGTTCTTTGGGGAGTTTTTCGACATGTATCTTTTGCATGGATTGGACAAGATATTCTTTGTGCCTGTATGTAA >Araip.WR8UF ATGATAGTGGTAGCTCGAGGCGATAGGAGTGGAGAAGATGGTATCCCCATGCTGCTTAGCATAATTGGTTTTGGGGACATAATCTTATCGGGGCTTCTAGTCGCATTTTCACTAAGGTATGATTGGTTGGCAAAGAGGAACCTTCGGTCTGGATACTTCGTGTGGGCAATGAGTGCTTACGGTTTAGGTCTCCTTCTAACATATGTTGCTTTGAACTTGATGGATGGGCATGGTCAACCAGCATTGCTTTATATCGTCCCGTTTACTCTTGGCACATTTTTGTTATTGGAAAAGAAGAGAGGTGAACTCAATCTTTTATGGATAAGAGGGGAACCAGAAATGCCTTGCCCTCATAACCAAGAGTCTCAACAATGA >Araip.HSZ5V AGAAAAGAAACACAAAAACCACAAGCTCAGGAAGACTTTCTATTTCTCCGTGTGTGTGTGAGGATGTGGCGGGGGAGGTGTCATCCTGCTCAGGCCGTCTTGTTTGTGTTTGTGTTTGTGATTGCCGTGGCAGCGGCTGCCGACGATGTTAAACGTGATGACGTCAGGGCTCCCAAGTCTCAATCCTGCGATAATCCCTTCCAGCTGGTGAAGGTGAAGAACTGGGTTGATGGCGAGGAAGGTCGGGTCTACAATGGAGTTACAGCTAGATTTGGCTCTTCGCTGCCTGAGAGCGCTGAAAATAGTGATCCAGCCCCCGCCATTCTCCCTTATCCTATCGACTGCTGTTCTGCTTCCACTTCCAAGTTATCTGGTTCGGTTGCTCTCTGTGTGCGTGGTGGTTGTGACTTCACCACTAAAGCTGCATTTGTGCAGTCGGGAGGTGCTACTGCCATGTTGGTGATAAATGATGCCGAAGATCTCTTTGAGATGGTCTGCTCCAATAGCACCGAGGTAAGCATCTCAATCCCAGTTGTCATGATAACAAAGTCAGCGGGAGAAGCTCTCAACAAATCCTTGACTTCTGGAAGCCGAGTGGAAATTCTGTTATATGCTCCCCCTCGCCCACTTGTAGACTTCTCAGTCACATTTTTGTGGTTGATGTCTGTTGGCACAATTGTATGTGGTTCACTTTGGTCAGACCTAACTGCTCCTAATCAGTCTGATGAACGCTATAATGAATTGTGTCCCAAGGAATCTTCAAATGGTGAAACAGCAAAAGCTGATTCTGATAAGGAAATTGTGAACATCGATACAAAGGGTGCTATCATTTTTGTCATAACAGCATCAACTTTTCTTGTGCTGTTATTCTTCTTCATGTCATCTTGGTTTATCTGGGTGCTGATTGTATTTTTCTGTATTGGTGGCATTGAGGGGATGCACAGTTGTATTGTAAGCCTCTCTTTAAGAAAATGTCAAAGTTGCGGTCAGAAGACAGTGAATTTACCTCTGTTTGGGGAGGTCTCTATTTTCTCACTTGTAGTGTTATTATTTTCTGTGGCATTTGCGATTTTCTGGGCTGCTACTCGACAGCAATCATATTCATGGATTGGCCAAGATATTCTTGGCATCTGCTTGATGATAACAGTCTTGCAGTTGGCTAGACTACCTAATATTAAGGTTGCAACTGTACTCTTATGTTGTGCGTTTGTCTATGACGTCTTTTGGGTGTTCATATCTCCATTGATATTCCATGAGAGTGTTATGATAACGGTTGCTCGAGGTGACGGGGCTGGTGGGGAAGCGATTCCAATGCTTTTGAGATTTCCTCGTCTTGTTGATCCCTGGGGTGGTTATGACATGATTGGATTTGGAGATATTCTCTTTCCTGGTTTGCTTGCTTCCTTTGCCCATAGATTTGACAAAGATAAGAAGAAGGGAGCATTAAGTGGATATTTTCTTTGGTTGATAATTGGCTATGGCGTGGGCCTCATATTCACATATTTGGGGCTTTATCTGATGAACGGACATGGACAGCCAGCACTTCTCTACCTCGTTCCCTGTACATTAGGTGTGACCATTGTATTGGGATATGTAAGAGGTGAGCTAAGGGGCCTTTGGAATTATGGGACAGACTTATCGTCTTCCTTAGAGCCTTCTGAGGTTTAA >Araip.QR73J ATGCAGGGTATCACACTGATAATTACAGTTCTTCAGATTGTACGGATACCAAATCTCAAGGTTGGAACTGTTCTTCTCAGCTGCGCCTTCCTATACGACATCTTTTGGGTGTTCGTTTCTAAACGGTGGTTCCATGAGAGCGTCATGATAGTGGTAGCTCGAGGTGATAAGAGTGGAGAAGATGGTATCCCAATGCTGCTAAAGATACCATGGCTTCTAGTAGTATTTTCACTAAGGTATGATTGGTTGGCAAAGAAGAGCCTTCGCGCTGGGTACTTCTTGTGGGCAATGACTGCCTATGGCTTACGTATATGCTTGATCTGA >RCO.g.29888.000009 ATGGCGTTTTCACGGACTCTCCTCTTCCTTCTCTGTTTGTTGTTTCTGATCGGTTTCTCATTCGCCAACGACGCTTCTCATGACGACGATTCCCCCAAGTCTCCTGGCTGTGATCATCCTTACAAATTGGTTAAGGTTATGAACTGGGTTAATGGTGTTGAAGGTGAAACTTTAGCTGCGGTCAGTGCAAGGTTTGGGGCTATATTGCCTTCTGAGGCTGAAAAAGGTCTCAGACTGTCTGCCGTTTTCTCAAATCCCTTAAACTGCTGTTCTAGTTCCTCTTCAAAGCTTTCTGGTTCCATTGCAATGTCCATACGTGGTGATTGTACCTTCACTGCCAAGGCAGAAGTTGCCCAGTCAGGAGGTGCAGAAGCCTTGTTGGTAATAAATGATGAAGAAGAGCTTGCTGAGATGGGTTGTGATAATGGAAGTGCTGCACCAAATATTTCAATTCCTGTTGTGTTGATTCCAAAGTCAGGAGGTGAATATCTGAACAAGTCGATGGTAGCTGGACAGAAAGTGGAAATAAAGTTATATGCACCAAATCGTCCTGTTGTGGATTATTCAGTGATATTCATATGGTTGATGGCCGTTGGAACTGTGACCTGTGCTACACTTTGGTCAGAATTTACTGCTCCTGAGGAGACTGATGAGCGCTACAATGAATTATCACCAAAGGAAAATTCCAGAGTTTCAGCAATCAAAGATGATGAGAAAGAATTCCTTGATATCAATGCAAAGAGTGCAGTAATTTTCGTCCTAACAGCATCAACTTTTCTGGTTTTACTCTACTTTTTTATGTCAAGTTGGTTTGTCTGGCTGCTGATTATACTCTTCTGCCTCGGCGGTGTTGAGGGCATGCATAATTGTATAGTAACGTTAATTTCAAGAAAATGCAGAAATTTTGCGCAAAAGAAAGTCAACTTACCTCTTCTGGGAGAAACTTCTATTCTCTCCCTTGTTGTATTATGTTGTTGTCTGGCATTTGCTATTTTTTGGATTGCCAATCGTCGGGCCTCATATTCATGGATTGGACAAGATATTCTTGGTATCTGCTTGATGATAACTGTCTTGCAGGTGGCACGATTGCCTAATATTAAGGTTGCTGCTGTACTTCTCTGTTGCGCATTTGTTTATGACATCTTTTGGGTATTTCTATCCCCAATAATATTCCATCAGAGTGTTATGATCGCTGTTGCTCGAGGTGACAACAGTGGTGGGGAATCTATTCCCATGCTTTTGAGATTTCCTCGATTTGCTGATCCTTGGGGAGGTTATGACATGATTGGATTTGGGGACATTCTTTTCCCTGGTTTGCTTCTGTCATTTGCACGGAGATACGATAAAACAAATAAGAAAAGCTTGTGTAAGGGATATTTTCTTTGGTTGACAATTGGCTACGGAATCGGTCTTTTCCTCACGTACTTAGGTTTATATCTAATGGATGGGCATGGTCAACCTGCACTCCTCTATCTTGTTCCTTGTACCCTAGTGATTGTAGCGGTGGTACTTAGTAGTGATGGTCAATTGGCAGCGGTGGCAAAGGTGGTGTCAGTGGAGGCAGTTTTGGCGATAGTGATAATGCTAAAATCACCATACCTCTTGTAG >RCO.g.30174.000009 ATGGAAATAAAATTAAGTATATACTTAATTGTGAGCGTATTAGCTTTAAGTCCTTGTTATGGTTCAGCTAGTGATATAGTACATCACGATGATGTAGCTCCTAAGAGACCTGGTTGCAATAACGACTTTGTTCTGGTAAAAGTTGCTACTTGGGTTGATGGTATTGAAAACATCGAGTATGTTGGTGTCGGTGCTCGCTTTGGTCCTACTTTGGAATCGAAGGAAAAACGTGCCAATAAAACTAGACTTGTTTTGGCAGACCCTCCTGATCTTTGCATTCTGCCAAAGAATAAGCTTAATAGAGATGTCATTTTGGTGCGCCGAGGTAACTGCAGCTTCACTACCAAGTCAAATATTGCTGAAGAGGCTAATGCTTCAGCTATTCTTATAATAAATTACCGGACAGAGCTTTTTAAGATGGTTTGTGAAGCAAATGAAGCTGATGTAATTATAGGCATTCCTGCTGTCATGCTTCCACAAGATGCTGGAGCAAGCTTGGAACATTATGTTAAGAATAGCTCCACAGTTTCTGTGCAGCTATATTCTCCACAGCGTCCTCTTGTTGATGTTGCAGAAGTGTTCTTATGGCTCATGGCTGTTGGTACCATATTAGGTGCTTCTTATTGGTCTGCATGGAGTGCCAGAGAAGTGGCTATAGAGCAGGATAAACTTTTAAAGGATGGTTCAGATGACTTTCAACAAACAGAAGGTGTTCCATCCAGTGGTGTTGTTAACATCAACATAACATCTGCCGTTCTCTTTGTTGTGGTTGCTTCATGTTTCTTGGTCATGCTTTACAAACTCATGTCATTGTGGTTTATGGATGTTCTGGTGGTTCTGTTCTGCATTGGTGGCACAGAGGGCTTGCAAACTTGCTTGGTAGCTTTGTTATCTTGTTTCAGATGTTTCCAACATGCTGGAGAATCATTTATAAAAGTTCCCTTCTTTGGTGCTGTCTCACATTTGACATTGGCCGTCTCTCCCTTCTGCATAGCATTTGCTGTTGTTTGGGCAGTGTACCGGCGTGTTTCATTTGCCTGGATAGGTCAAGACATCCTTGGCATCACACTAATCATCACGGTTCTTCAGATTGTTCACGTACCGAACCTCAAGGTGGGAACAGTTCTTCTCAGTTGCGCATTTTTGTATGACATCTTCTGGGTGTTTGTTTCCAAGCTGTGGTTCAAGGAGAGTGTAATGATAGTGGTGGCTCGGGGTGATAAGAGCGGAGAGGATGGTATACCAATGTTATTGAAAATCCCACGGATGTTTGATCCTTGGGGTGGCTATAGTATTATCGGTTTTGGTGATATCATTTTGCCTGGATTGCTTGTTGCTTTTGCATTAAGGTATGATTGGCTGACAAAGAAGAATCTTCGAGCAGGATACTTTCTGTGGGCCATGACTGCTTATGGTTTAGGTCTTCTAATCACTTATGTGGCTTTGAACATGATGGATGGGCACGGCCAGCCAGCACTGCTCTATATTGTTCCGTTCACACTTGGCACTTTTTTGACACTGGGAAAGAAGAGAGGTGAACTCAAAGCACTATGGACAAGGGGAGCTCCTGAGAGGCCTTGCCCACACATCCGATTTCAACCCCCTCAATCTCAATAA >RCO.g.30190.000464 ATGGATTTATTAGAGAAGCTTTGTTTTGTAATCTTCGTGATTTTAGTGGCTTGTTATCCTTCTTCTGTAACAGCTGGTGACATAGTGCATGATGATGATTTAGCTCCTAAAAAGCCTGGCTGTGAGAATGATTTTGTATTGGTTAAAGTTCAAACTTGGGTCGATGGAGTGGAGGATGCTGAATTTGTTGGTGTGGGTGCTAGATTTGGCACTGCCATTGTGTCAAAGGAGAAAAATGCTAATCAAACTCACCTCACGCTTTCTGATCCTCGAGACTGTTGTACTGCGCCAAAGAAAAAGTTTGAGAGGGATGTTATCATGGTTGATCGAGGCCAGTGCAAATTCACAACCAAAGCAAATAATGCAGAAGCTGCTGGTGCTTCGGCTGTTCTTATCATAAACAACCAAAAAGAGCTTTACAAGATGGTTTGTGAGCCAGACGAAACTGATCTTGACATACACATACCTGCTGTTATGCTCCCACAAGATGCTGGTGCAAGCTTGGAAAAAATGCTATCGAGTAATGCGTCAGTGTCTGTGCAGCTGTACTCCCCTCGGCGGCCACTGGTTGATATAGCCGAAGTATTTTTGTGGTTGATGGCAGTTGTTACCATCCTGTGTGCATCTTACTGGTCTGCATGGAGTGCCAGAGAGGCAGCTATTGAACAGGACAAGCTATTGAAGGATGCTGTGGATGAAATACCAAATGACAAGGTTGTACGTGGTGGTAGTATCGTAGACATCAACACAGCATCAGCTGTCCTGTTTGTTGTTGTTGCTTCATGCTTTTTGGTCATGCTTTACAAACTTATGTCATACTGGTTCGTTGAGCTTTTGGTGGTCCTTTTTTGCATAGGTGGAGTAGAGGGCTTGCAAACCTGCCTGGTTGCATTATTATCAAGGTGGTTCAAGCATGCTGGAGAATCATACATTAAAATACCCTTCTTTGGAGCTCTCTCATACCTAACGTTGGCTGTTTCTCCATTCTGCTTAGCATTTGCTGTTGTTTGGGCTGTCTATCGCAATGTCTCCTTTTCCTGGATAGGCCAAGATATACTAGGAATTGCACTGATAATCACGGTTCTGCAAATTGTGCATGTACCTAACCTCAAGGTGGGTACAGTTCTTCTCAGTTGTGCATTCTTGTACGACATCTTTTGGGTGTTTGTTTCTAAGAAGTTGTTCCATGAAAGTGTCATGATTGTAGTTGCCCGTGGTGATAGAAGTGGAGAGGATGGTATCCCCATGCTGTTAAAGATCCCACGCATGTTTGATCCTTGGGGCGGTTACAGTATTATAGGATTTGGTGACATTCTTTTACCTGGATTGTTGATAGCATTTTCTCTTAGGTATGATTGGTTGGCAAATAAGAGTCTTCGAGCTGGATACTTCTTGTGGGCAATGATTGCTTATGGATTAGGTCTTCTCATCACATATGTGGCACTGAACTTGATGGACGGGCATGGCCAACCAGCTCTGCTCTACATAGTCCCCTTCACTCTAGGAACTTTTCTGACACTGGGAAAGAAAAGAGGCGATCTCTACGTCTTATGGACACGAGGGGAACCAGAAAGACCTTGCCCCCATATCCATCTCGAACACTGTCATGAACTGAACTTGGAAAAATAA >Ciclev10019598m.g ATGGATTTCAAGAGATTAAGCTGGGTTCTCTTTCCGGTTGCTGTAGTTTCCCTTGTCTGTTATCCAGCATCTGTCACAGCTGGTGACATAGTTCACGACGACGATTTGGCTCCAAAGAAGCCTGGTTGTGAGAACGACTTCGTTTTGGTAAAAGTTCAGACGTGGATTGATGGCATAGAGAATGAAGAATTTGTTGGTGTGGGTGCTAGATTTGGCACCACAATAGTGTCAAAGGAGAAAAATGCAAACCAGATTCACCTTACTCTTTCACATCCCCGGGATTGTTGCAGCATGCCAAAGCATAAGTATGCTGGAGATGTCATCATGGTCGACCGAGGCAACTGCAAATTTACAACTAAAGCAAATATTGCGGAGGCTGCTGGTGCTTCAGCCCTCCTCATCATAAATAACCAGAAAGAACTGTATAAGATGGTCTGTGATCCTGATGAAACTGATCTAGATATACACATACCAGCTGTCATGATGCCCCAGGATGCTGGTGCCAGCTTGGAAAAGATGCTTCTGAATACTTCATCAGTCTCTGTGCAGTTATATTCTCCACGACGACCGGTAGTTGATGTAGCTGAAGTATTTTTATGGTTGATGGCAGTTGGTACCATCCTGTGTGCATCGTATTGGTCCGCATGGAGTGCCAGAGAAACAGCTATTGAACAAGAGAAGTTATTGAAGGATGCTGTAGACGAAATTCCAGATGCCAAAGCAGTAGGTGTTAGTGGTGTTGTGGACATTAACACAGCATCTGCTGTCCTATTCGTTTTAGTTGCTTCATGCTTCTTGGTCATGCTTTACAAACTTATGTCAAACTGGTTCCTTGAGCTATTGGTCATTCTTTTCTGCATAGGTGGTGTAGAGGGCTTGCAAACTTGCTTGGTTGCTTTATTATCAAGGTGGTTCAGACGTGCTGGAGAATCATTCATCAAAGTACCTTTCTTTGGAGCTGTCTCTCATCTTACTTTGGCTGTTACTCCATTCTGCATAGCATTTGCTGTTGTGTGGGCCATTTATCGCAAGGTCTCCTTTGCATGGATTGGTCAAGATATTCTTGGAATTGCGCTGATAATAACAGTCCTGCAAATTGTCCATATTCCTAATCTCAAGGTGGGTACAGTTCTTCTCAGCTGTGCCTTCATGTACGACATCTTTTGGGTATTTGTTTCCAAGAAGTTGTTTCATGAAAGTGTGATGATTGTGGTGGCACGTGGCGATAAAAGTGGTGAGGATGGTATCCCAATGCTATTGAAGATTCCTCGCATGTTTGACCCATGGGGCGGTTACAGCATCATCGGTTTTGGTGATATTCTTTTACCTGGATTGATTATAGCATTTTCACTCAGGTACGACTGGCTAGCAAATAAGAGTCTTCAGGCTGGATACTTTTTGTGGGCAATGTTGGCTTATGGATTAGGTCTTCTCATCACATATGTGGCACTGAACTTGATGGATGGCCACGGCCAACCTGCTCTGCTTTATATTGTCCCATTCACGTTAGGGACTTTTCTGGCATTGGGGAAGAAGAGAGGCGATCTCAGGGTTCTATGGACAAGAGGAGAACCGGAAAGGCCCTGCCCCCATGTCCATCTCCAACACAGTCATGAACTAAATGTAGAAAAATAA >Ciclev10019661m.g ATGGATACAAAGAGAGTAATAAATATTTTTATTTTTATTCTGGTTTCGAGTCCATGCTTGGCGTCGGCCGGTGACATAGTTCATCAAGACAACAACGCGCCAAAGAGGCCTGGTTGCGATAACAATTTCGTCTTGGTTAAAGTTCCAACTTGGGTTGATGGTGGAGAAGACACTGAATATGTTGGTGTTGGTGCTCGTTTTGGCCGTACCTTGGAAGCCAAGGAGAAAGATGCCAGCCAAAACAGACTTGTACTAGCAGACCCTCCTGATTGTTGTAGCAAACCAAAGAATAAGCTCACGGGGGAGGCTATTCTGGTGCACAGAGGTGGTTGCAGTTTTACAGCTAAGGCAAATTTTGCTGAAGAGGCAAACGCTTCAGCCATCCTCATAATAAACAATAAAACAGAACTTTTCAAGATGGTTTGTGAATCAAATGAAACCGATGTAGACATACGCATACCTGCTATTATGCTCCCTCAGGATGCTGGTGCTAACTTGGAAAAGCTTATAAAGAACAACTCTGTAGTTTCTGTGCAGCTGTACTCTCCACGCCGTCCGGTGGTTGACGTTGCAGAAGTGTTTTTATGGCTTATGGCTGTTGGTACTATTTTGTGTGCTTCTTACTGGTCTGCATGGACTGCCAGAGAAACAGCAATTGAACTGGATAAGCTATTAAAGGATGGTTCAGATGAATTTTCAAACATGGAAGGTGTTAATTCCAATGGCTTTGTGGACATCAACATGGCTTCAGCAGTTTCCTTTGTTGTGATTGCCTCATGTTTCTTGGTTATGCTTTACAAACTGATGTCGTTCTGGTTTATTGAGGTTCTGGTGGTTCTATTTTGCATTGGTGGGGTAGAGGGCCTACAGACCTGCGTGGTAGCATTGTTATCATGTTTCAGATGGTTTCAACATGCTGGAGACTCGTTTATTAAAGTACCATTCTTTGGAGCTGTCTCATATCTCACATTGGCTGTTTGTCCGTTCTGCATAGCATTTTCTGTTGTTTGGGCTGTTTATCGCCGCATATCGTTTGCTTGGATAGGTCAAGACATCCTTGGAATTGCATTAATGATCACTGTTCTTCAGATTGTTCGTGTGCCAAACCTCAAGGTTGGAACAGTTCTTCTCAGTTGTGCTTTCTTGTACGATATCTTCTGGGTGTTTGTTTCTAAATGGTGGTTCCATGAGAGTGTAATGATAGTGGTGGCTCGTGGTGACAGGAGTGGAGAAGATGGTATCCCCATGTTATTAAAAATCCCACGATTGTTTGATCCTTGGGGTGGCTATAGTGTAATTGGTTTTGGTGACATTATATTGCCAGGACTGATCGTGGCTTTTTCACTAAGGTATGATTGGCTGATGAAGAAAAATTTTCGTTCAGGATACTTTGTTTGGGCAATGACTGCTTATGGTTTAGGTCTCCTGATTACGTATGTGGCATTAAACCTCATGGATGGACATGGCCAACCAGCATTGCTTTACATTGTTCCATTTACACTTGGAACCTTTTTGACCCTGGGAAAAAAGAGAGGTGAACTTAAAACGCTGTGGACAAGAGGAGAACCAGAGAGAGCCTGCCCGCACATCCAGCTTCAATCTTCATGA >Ciclev10019670m.g ATGGCGATGGCGCGTCGCATGGCGACTTTCATTTGCTTGTTTGTGGTTGGTCTGTCGTTTGCGGCCGCCGGCGATGTGACACTTGACGATGACGATTCCTCTCCTAATATCCCTGGCTGTAACAATAAGCTCCAATTGGTCAAGGTTAAGAATTGGGTTGATAATGTTGAAGGTGAAAGCTTTGCAGGGTTAACTGCAAGATTTGGATTGCCTTTGCCTTCTGATGCTGCAAAGGCTTTTAAACTGCCTGCTGTTTTATCAAATCCTTTAAACTGCTGTTCCACTGCTTCGAAGCTATCTGGCTCTATTGCTTTGTCTATGCGTGGTGATTGTGCCTTCACGACTAAGGCAGAAGTAGCTCAAGCTGCAGGTGCTGCAGCTCTGGTTGTGATAAATGACGAAGAAGATCTTTACAAGATGGTTTGTTCTGAAAATGATACTTCTTTAAACATCTCGATACCTGTATTGATGATTCCAAAGTCAAGAGGAGATGCTCTTAACAAATCTATTGCAGATAAACAGAGAGTGGAACTTTTACTATATGCGCCAAATCGTCCAGATGTGGACTTTGCAGTTATATTCCTCTGGATGATGGCTGTCGGAACAATTATCGCTGCTGCACTTTGGTCACTTTTAACTAGTGAGCAGACTGATGAGCGCTATAATGAATTATCACCAAAGGAATCTTCCAATCTTGAAGCAGTCAAAGATGATTCTGAGAAGGAAGTCCTTGATATCACTGCAAAGGGTGCTATAGTTTTTGTTATAGTAGCATCCACTTTTCTGGTGCTGCTTTACTTCTTCATGTCATCTTGGTTTGTGTGGCTACTGGTTGTTCTCTTCTGTATTGGCGGCATTGAGGGAATGCATAATATTATTGTAACACTAGTGTTGAGTAAATGTAGAAATTGTGGGCGGAAGACTGTGCATTTGCCTCTCTTGGATGAGGTTTCTGTTCTTTCGCTTGTGGTGTTGCTCTTCTGTGTTGTGTTTGCTGTTGTCTGGGCTGTACGGAGGCAGGCATCATATTCTTGGGTTGGTCAAGATATTCTTGGCATCTGTTTGATGATAACAGTTTTGCAAATGGCTCGATTACCTAATATCAAGGTTGCTTCGGTGCTTTTGTGCTGCGCATTTGTTTATGACATCTTTTGGGTCTTCGTCTCACCACTAATTTTCCATGAAAGCGTTATGATTGCAGTTGCTCGAGGTGACAACAGTAGTGGAGAATCTATTCCCATGCTTTTAAGAATCCCTCGACTTTTTGACCCTTGGGGTGGTTATGATATGATTGGCTTTGGGGACATTCTCTTTCCTGGTTTGCTAATTTGTTTTGCATTCAGATATGACAAGGAAAACAAGAAAGGTGTGGTAAAAGGATATTTTCTCTGGTTGATAATTGGCTATGGTTTTGGTCTCTTCCTTACATACCTAGGGTTATATCTAATGAACGGGCACGGCCAGCCAGCACTTCTATATCTTGTTCCCTGTACGCTAGGACTTACTGTAATACTGGGTTTGGCGAGAGGGGAGCTGAAACATCTTTGGGATTATAGTAGGGAACCATCTTCAGATATGAATCGTCCAGTAGAAGCATGA >Bv1_004550_iyof ATGATGCTGATACAAATATCCGGATTCCTGCTGTCATGTTACCAATATATGCTGGTGAAGTCTTGGAAGATCTTCTATCTAACAATTCCAGGGGATTCCCTTTCTTCAGTTTATGTGCAGCTGTATTCCCCTAAGCGTCCAGCAGTTGATGTCGCAGAAGTATTTTTGTGGCTCATGGCTGTTGGTACTATTTTATGTGCGTCTTATTGGTCCGCGTGGAATGCAAGGGAAGCAGCTATTGAGCATGACAAGATTTTAAAGGATGCATCAGATGAGGTGGCGGCTTCTGTAGAAACTGGCTCAGCTGGTTTTGTAGATATCAGTACCACATCAGCACTTCTTTTTGTTGTGATTGCTTCAGGCTTTCTGGTTATGCTGTACAAACTTATGTCAGTTTGGTTTATCGATATTCTGGTGGTACTGTTCTGCATTGGTGGGGCGGAGGGTTTGCAAACGTGCTTGGTAGCGTTCTTATCAAGTTTCAGGTGGTGTAAACATGCTGCTGGAACTTTTGTTAAAGTGCCCATCTTTGGAGCAGTCTCATATCTGGCAATGGCTGTTACTCCATTCTGCATACTTTGTTCTGTACTTTGGGGTGTTTACCGCCGTGAGCCCTATGCTTGGATTGGTCAAGACATCCTTGGAATTGCATTGATTCTCACTGTACTTCAGATTGTACGCGTACCAAATCTCAAGGTTGGCACAGTTCTTCTCAGTTGTGCTTTCTTTTATGACATATTCTGGGTCTTCGTTTCCAAGTCGATTTTCCATGAGAGTGTTATGATAGTGGTTGCACGTGGTGATAACAGTGGAGAAGATGGCATCCCAATGCTATTAAAGATACCAAGGATGTTTGACCCTTGGGGCGGTTACAGTGTCATTGGATTTGGAGACATTATACTACCAGGATTAGTAATAGCCTTTTCATTGAGATATGATTGGCTGGGGAACAAAAAGATTCGAGCTGGATATTTTTTGTGGGGAATGACCGCGTACGGTTTAGGTCTCCTCGTAACATATGTGGCTTTGAACTTGATGGATGGACATGGCCAACCAGCTCTGCTCTACATTGTTCCTTTTACACTTGGCACATTCTTAACACTTGGAAGAAAAAGAGGTGAGCTTAAAAATCTATGGACAAGAGGAGAACCCGATAGGCCGTGTCCGCATGTCCGACTCCCGCCATCTCAATAA >Bv5_112390_dmpm ATGGCGATAAATCTGCGCGTTAAGGCGATTTTGATCCTCTTTGTCGTCGGGTTTGCATCTTCTTTTGCAGATGGTGATGCTGTTTCTGCGAAATGCAACAATAAATCTCGATTGGTTAATATAAGATACTGGATTGATGGTGTTGAAAAAGGGCTTTTGAGTGCAGTAACTGCAAAATTTGGTCCTTACCCTCTTTTCGAGAAGAAAAGTCGTAAACTACCAGTTGTATCTACGGATCCCTTGAATGGTTGCTCTGAACTGTCATCAAAGGTGAGTCAATCAGTTGCACTGTCGACTCGTGGTGACTGCGAGTACACAACCAAGGGAAAAGTTGCTCAATCTGGTGGTGCTGCAGCCTTAATAGTCATGAATAACATTGAAGCTTTAGAGGAGATGTCTTGTTCGAAGAATGAGACTGATTTGGACATTACTATTCCTGTTGTCATGATCTTGAAATCTGGAGGAGACATTCTAAACAAAGCTGTGGAAGCCAGGAATAGAGTGGAAGTGCAAGTATACTTGGCAAAACGTTCAGTTATTGATCTTTCTAATAGCTCAATATGGGTGATATCTCTTGCAACACTAATTATTGCTTCAGTCTGGCCGGATCTAATACCACATGAGAAAAGTGATGAAGAATATGATGAATTGTCACCAAAGGAATCTTCTGCAGCCACAGCCAAGGATGACTCTGAGAACGATATACTTGATATAAGTGTAGTGGGTGCCGTAGTGTTTGTCATTGCAGCTTCTGCCTTCCTGCTGCTACTATATTTTTTTATGTCATCATGGTTTATCAAGGTGTTGATAATTATGTTCGTAATTGGAGGATCTGAGGGAATTTACTATTGCTTAACAGGCCTTCTGCTTAGACGATGTGGAAATGCCAGACAAATACATATTAAATTACCTCTTGTCGGTGAATTTTATGTTATTCGTACTTTGCTCTGGTTGGCTTGTTTTGGCTTCGCAGTTTTTTGGGTGCTGACACGGTTCAGATCATACTCATGGATTGGTCAGGATATTCTTGGAATTTGTTTTATGATCAGAGTTCTTCAGATTATTCGGTTGCCCAATATCAAGGTTGCAACAGCTCTACTGTGCTGTGCATTTTGCTACGACATCTTTTGGGTCTTTATATCTAAAGAGATTTTCCAAGAAAGTGTCATGGTTGTGGTGGCCAGTGGTGATAAAAGTGGCGGCGAGAATCTTCCTATGCTTCTTAGAATCCCTCGGTTTAAAGATCCACTTTCTGGATTTGATATGATTGGCTTCGGAGACATTCTCTTTCCTGGTTTACTTGTCTCATTCTGCTACAGATATGACAAGGCAAATAAGAGGGGCTTTATCAATGGATATTTTTTCTGGTTGACAATTGGTTATGGTATCGGGCTATTCCTCACGTACTTGGCTTTATACCTTATGGAGATGGGTCAACCTGCGCTATTGTACCTTGTTCCATGTACATTAGGGGTGGCAGTTCTATTAAGTTTGTTTCGAGGTGAGCTGAGGAATCTTTGGAATTACGATTTCGAATCTGATGGACAACAACCTGCAGAAGCTTGA >Bv6_137570_fhdy ATGATTGTGGTAGCCCGTGGTGATAAAAGTGGGGAGGATGGTATTCCAATGCTGCTAAAGATCCCACGCATGTTTGACCCGTGGGGTGGCTATAGCATCATTGGTTTTGGAGACATCCTTTTACCAGGATTACTAATAGCTTTTTCTCTCAGGTATGACTGGTTAGCAAAGAAGAATCTTCGAGCTGGATACTTTTTGTGGACAATGATTGCCTACGGATTAGGTCTTTTCATTACTTATGTGGCACTAAATTTGATGGATGGACATGGCCAACCTGCCTTGCTTTACATTGTCCCTTTTACTTTAGGCACATTATTTATGCTGGGAAGGAAGAGAGGCGATCTCAAGAAGTTATGGACAACGGGGGAACCCGATAGACCTTGCTCTCATATGCATCTGCAAATGTCTGATGAATGGAGTGAAGAAAGATAA >MDO.mRNA.g.1181.3 ATGCTACTAAAGATCCCACGCATGTTCGACCCATGGGGTGGTTTCAGTATCATAGGATTTGGTATGATTTGGTTGGCAAATAAGACTTTCCATGCTGGATACTTCATTTGGGCAATGATTGCTTATGGATTAGGTCTTCTCATCACTTATGTGGCATTAAACTTGATGGATGGGCATGGCCAACCAGCACTTCTTTACATTGTTCCATTTACACTTGGAAAAGAGGTGGCTTACAGATTCTGTGGTCTAGAGGAGAACTGGAATGGCCCTGCCCTCATATCGAGCTTGAAGGCAGTCATGAAGTGA >MDO.mRNA.g.615.8 ATGGGGAGCTCATTCAAGTACGAAAAGGATCAGTATTACAGACCTCACCATGACTACTTCTCTGACACTTTTAACTTGAAACGTGGTGGTCAGCGAGTAGCAACAATTCTGATGTATTTGAGTGATAATGTTGAGGGCGGAGAAACCATCTTCCCTACGGCTAGTTCAGGTAAATGTACCTGCGGTGGAAGAGCTGCCACAGGTTTGTCTGTGAAGCCAATTAAAGGGGATGCAGTACTTTTTTGGAGCATGAATCTTGAAGGAAAAGAGGATCCGACGAGCATACATGGAGGATGTGAGCTTAGTGATCCTGTAGTGTTTAGGTACAGCAGATTCCGAAACCAAGATGAACATGAAGCATATCAGCTCGTCGGAAATGTGATACATCGACAGCAGCATCATACAGCCTCAGTGAGGAGGAGGAGGAGGAGGAGATTGAATCTTCGAGTGGTGGTGGTGTCCAATGGCAATGGCAATGGCGTCGGTCTCCTCCGCCTAGTGTTTCTGTTATCTCTGATTGCTCTTTCTTTGGCCCGTGGTGAAAAGGACATGGGTTTTGGATGTGATTCCACCCCCGACACTCCTTCCTGCAACAACCCTTACCTAATGGCAAAGGTTAAGAATTGGGTTAATGGCCATGAAGGAGAAACTATTGAAGGGCAGTTATCTGGAGCTATTGCCTTGTCCACGCGTGGTGATTGTGACTTCTCCGTAAAGGCAAAAGTTGCACAGTCAGGAGGTGCTAAGGCGCTAGTGGTGATAAATAATGATGAAGAGCTTGCCAAGATGGCTTGTCCTGATAATAGTACTTCTTTGAATATTTCAATTTTTGTCGTAATGGTTCCAAAGTCAGATGGAGAAGCACTCAAGAAATCTATTGAAGATGGAAAGAAAGTGGAGCTTCTATTATATTCTCCCAAGCGTCCAGTGGTGGACTACTCAGTTGTGTTCCTGTGGCTGATGGCTGTTGGAACAATAATAGTTGCCTCATTTTGGTCAAAGATTACTGCTCCTGATAAGTCTGATGAGAATTATAATGAACTAGCAGAAAAGGAATCTAATACTGGAACAGCCAAAGATGATTCTGAGGACGAAGTCATGAATCTTAGTGTGGCAGGCGCTGTGTGTTTCGTCATAACAGCATCCACTTTTCTGTTGCTACTATATTTCTTTATGTCTACTTGGTTTATCTGGGTGCTGATTGTACTTTTCTGCATTGGTGGTATTGAGGGAATGCATAATTGTGTTCTGAGCCTGATTTTGAGAAAATGGAGAAGTGGTGGGCAGAAGACGATAACTTTGCCTCTTCTGGATGAGGTTTCTATTCTCTCGCTTGTTGTATTGGCTTTCTGTGCGGCATTTGCAGTTTTCTGGGTTGTTACCCGGCGGGCGTCATATTCATGGATTGGCCAAGATGTTCTTGGTATCTGCTTGATGATAACGGTCTTGCAAATTGCTCGATTGCCTAACATAAAGGTTGCTACCGTACTACTTTGTTGTGCATTTGTCTATGACATCTTTTGGGTATTCCTGTCACCCTTAATATTCAAAGATAGCGTCATGGTTACGGTTGCTAAAGGTGACGGCAGTGGTGAAGCCCTACCAATGCTTTTGAGAATCCCTCGCTTTTTACCCCTGGGGTGGTGTGAATATGATTGGCTTCGGGGACGTTCTGTTTCCTGGACTCGGTCTTACTTACCTGGGTTTGTATCTCATGAACGGCAACGGCCAGCCTGCACTCCTCTATCTCGTTCCATGTACACTAGGTGTTACAGTGATTTTGGACTGATAAGGCGCGAGCTGAAACAACTCTGGGATTACGGCGCAGAGGTATCCCATCGAGCGTTGAACCGTCCGTAG >MDO.mRNA.g.661.2 ATGGATTTACAGAGAGGTGTGTGGGTGGTGGTGGGAGTGCTGGTGGTTAGTCTGAGTCTGAGCTCAGCTGGTGACATTGTTCACCACGATAATATTGCTCCCAAGAGGCCTGGATGCGAGAACGACTTCGTTCTGGTAAAGGTCCCAACTTGGATCAATGGCGTAGAAGACGCTGAGTATGTTGGTGTTGGTGCTCGATTTGGACCTACCTTGGAATCAAAGGAAAAACATGCCACCAACACTAGAGTGGTTCTTGCAGACCCCCCTGATTGTTGTAGCCTACCCAAGAATAAGCTCGCTAAAGAGGTCATTTTGGTGCACCGAGGGAATTGCAGTTTCACAACCAAGGCAAATATGGCTGAAGCTGCTAATGCTTCAGCCATCCTCATTATAAACAACCGCACAGTTTTATTTTTGTCTCTATCATGGCCTTTGAAATCTCTCTCTTCAGTTTCTGTGCAGCTGTACTCTCCTTTGCGTCCACTGGTTGATATTGCAGAAGTTTTTTTGTGGCTTATGGCTGTTGGTACCATCTTGTTTGCTTCTTATTGGTCTGCGTGGAGTGCAAGAGAAGCAGCTATTGAGCATGAGAAGCTATTGAAGGATGCTTCCGATGATTCTTTACCTATCGAAGTTGATCGTTCCAATGCTTTAGTGGAGATTAGCACCACAGCAGCAATCCTTTTTGTTGTGATTGCTTCATGCTTCTTGATTATGTTTTACAAACTCATGTCATTCTGGTTTGTGGAGATTCTGGTGGTTTTGTTTTGCATTGGCGGGATAGAGTCCCTTCTGTTTGCAGGGCCTGCAGACTTGCTTGGTGACTTTGCTATCATGTGTATCGCCGCATTTCATTTGCTTGGATCGGTCAAGATATCCTTGCATTACTGTATTTTATTTTGTAAGGCCTTTCAAGTCCATCACCCTTTGTCTGTGCTACATATGTGGGCAGATATCTGGAATTCTTACTTCTATACATGGCTTGGTATTGCACTGATAATCACAGTTCTTCAGCTTGTTCGTATACCGAATCTCAAGGTTGGAACAGTTCTTCTGAGTTGTGCGTTTTTATACGACATCTTCTGGTATGATTGGTTAGCAAATAAGAAGCTCCGAGCTGGTTACTTTTTGTGGGCTATGACTGCTTATGGTTTAGGTCTCCTTATCACATATGTGGCTTTAAACTTGATGGACGGCCATGGCCAACCAGCTTTGTTGTATATAGTTCCGTTCACACTTGGTAAGAAGCAAGCTTGGCTAATCTGCACTAACATCTATATTGCTATTGCTCACTGGAATGGAAATAGGTACCTTTTTGACTTTGGGACACATGAGAGGGGATCTCAAAGTTCTGTGGACAAGAGGAGAACCGGAGAGGCCATGCCCGCACGTCCATCTGCAACCCTCCTCTCAATAAACGAAACTAGGAAACAAAGGAGTAGTGTGGCAGATTAG >MDO.mRNA.g.7433.1 ATGGATTTACAGAGAGGTGTGTGGGTGGTGGTGGGAGTGCTGGTGGTTAGTCTAAGTCTCAGCTCAGCTGGGGACATTGTTCACCATGATGATATTGCTCCCAAGAGGCCTGGATGCAACAACAACTTCGTTCTGGTAAAGGTCCCAGCTTGGATCAACGGCATAGAAGACGCTGAGTATGTCGGTGTTGGTGCTCGATTTGGACCTACCTTGGAATCAAAGGAAAAATATGCCACCAACACTAAAGTGGTTCTTGCGGACCCCCCTGATTGTTGTACCCAACCCAAGAATAAGCTCACAAAAAGGTCATTTTGGTGCACCGAGGAAATTGCAGTTTCACAACCAAGGCAAATATGGCTGAAGCTGCTAACGCTTCAGCCATCCTCATTATAA >MDO.mRNA.g.7433.2 ATGCTTCCCCAAGATGTTGGTGCAATCTTCGAAACTGATTTGAAGAACAACTCCATGGCTGTACTCCCATTGCGTCCACTGGTAGATATTGCAGAAGTTTTTTTGTGGCTTATGGCCGTTGGTACCATCTTATTTGCTTCTTATTGGTCTGCGTGGAGTGCAAGGGAAGCAGCTATTGAGCATGAGAAGTTATTGAAGGATGCTTCCGATGATTCTTTACATATGGAAGTTGATCGTTCCAATGCTTTAGTGGAGATTAGCACCACAGCAGCAATCCTCTTTGTTGTGATTGCTTCATGCTTCTTGATTATGTTTTACAAACTTAGTTCATTCTGGTTTGTGGAGATTCTGGTGGTTTTGTTTTGCATTGGTGGGATAGAGGGCCTGCAGACTTGCTTGGTGACTTTTGTCATGTATGAAGCTGACAGAACCAAATATAGTTTCAGTCGGTTCAAACATGCTGGAGATTCATACGTTAGGCTGCCAATCTTTGGAGCTGTTTCATATCTGACACTAGCTGTTGCTCCCTTCTGCATAGCATTTGCTGTTTTGTGGGCAGTGTATCGCCGCATTTCATTTGCTTGGATCGGTCAAGATATCCTTGGTATTGCACTGATAATCACAGTTCTTCAGATTGTTCGTGTACCGAATCTCAAGGTGGCTCGTGGTGATAAAAGTGGAGAGGACGGTATACCAATGCTACTGAAAATCCCACGGATGTTTGATCCTTGGGGTGGCTACAGCATCATCGGATTTGGTGATATTATCTTACCTGGACTGGTTGTAGCCTTTTCACTAAGGTACGATTGGTTGGCGAATAAAAAGCTTCGAGCTGGTTACTTTGTGTGGGCAATGACCGCTTATGGTTTAGGTCTCCTTATCACATATGTGGCTTTGAACTTGATGGACGGCCATGGCCAACCCGCTTTGTTGTATATAGTTCCGTTCACACTTGGTACCTTTATAACTTTGGGACACATGAGAGGGGATCTGAAAGTTCTGTGGACGAGAGGAGAGAGGCCATGCCCGCACGTCATCTGCAACCGCAACCCTCCTCTCAATAAAAACTAG >Bo4g018560 ATGCCTTCGTCTGATCCGCCGCGCCACCGATGCTCCACCGCACTACTCTTCCTCCTCCTGCTAGGCTTCTCCTTTGCGGCGGCAGACGATGCCTCGTGGACCGAAGACTCAACCCTCGAGTCTCCCGGCTGTACCAATAAGTTTCAAATGGTTAAGATCTTGAACTGGGTTGATGGTGTTGAAAGCGACGACTTCTTCACCGGTTTAACCGCTCAATTCGGAGCAGCTTTGCCGTCTGACGCTGGTCAGGGCGTTAGATCTCCGGTTGCTTTTGTGCGTCCTTTGGACTCGTGTTCCAATCTCTCTTCCAGGTTAGATGGGAGTATTGCCTTGTCGATCCGTGGGAGCTGTGCTTTCACTGAGAAGGCTAAACATGCTGAGGCGGCTGGTGCTTCTGCTCTGCTTGTTATTAATGACAAAGAAGATCTTGATGAGATGGGGTGTATGGAAAAGGACACTTCTTTAAATGTGAGCATACCTGTGTTAATGATCTCTAAGTCAAGTGGAGATGCTCTCAACAAGTCTATGGTGGATAACAAGAGTGTTGAGCTTCTGTTGTACGCACCAACTCGTCCTGCTGTGGACCTCACGGCAGGGTTGTTGTTGCTCATGGCTGTTGGAACTGTTGTGGTTGCGTCACTGTGGTCAGACCTTACTGATCCTGACCAAGCTAATGAATCTTACAGCATATTAGCAAAGGAATTTACTGGTGCTAGAACCAGGAAAGATGATCCAGAGAAGGAGATCCTTGATATAAGTGTGACTGGAGCTGTGTTCTTTATAGTAACAGCCTCCATTTTTCTGCTGCTCCTTTTCTACTTCATGTCATCATGGTTTGTGTGGGTGCTCACCATATTCTTCTGCATCGGTGGCATGCAGGGTATGCATAGCATCATTACGGCAGTTTTATTGAGAAAGTGGAGACATCTTGGTCGGAGGTCTGTGAAGCTCCCTTTGCTTGGGACAATGTCATGGATGTCGCTTTTGGTGAATATCTTTTGTCTGGCGTTTGCTGTCTTCTGGTTTGTGAAACGGCACACTTCGTATGCTTGGGCTGGGCAAGACATCTTGGGCATCTGTTTGATGATCACAGCCTTGCAAGTGGTTCGATTACCTAACATCAAGGTTGCTACTGTGCTTCTCTGCTGCGCGTTTGTCTATGACATCTTCTGGGTCTTCATATCACCTTTGATATTCCACGAGAGTGTTATGATTGTGGTTGCACAAGGAGACAGCAGCAGCGGGGAGTCCATTCCTATGTTACTAAGGATTCCTCGGTTTTTCGATCCGTGGGGTGGCTATGACATGATTGGTTTCGGGGACATCCTCTTCCCCGGTCTGCTCATTTCCTTTGCTTCCAGATATGACAAGATCAAGAAGAGAGTAATCTCAAGTGGATACTTCCTTTGGTTGACTATTGGCTATGGAGTTGGTCTGTTACTAACATATCTAGGTCTGTATCTAATGGACGGACATGGCCAGCCTGCGCTACTATACATCGTCCCATGCACACTCGGTTTGGCTGTCATTCTAGGGTTGGTAAGAGGAGAGCTTAAAGAGCTATGGAACTACGGTATCGAAGAATCAGAGTCTAACACGCCGGAGGATCCTCTGCCTGTGGCTTAA >Bo4g192930 ATGTCGTCGTTTCACCGATGCTCTCCCGTAGTACTGCTTCTCCTCCTCCTCTGTTTCTCCGTTGCAGCTTCCGAAGATTCCTCTCCTCATGGCTGCTCCAATAAGTTTCAAACGTTCGGAGCTTCCTTACCTTCTAAAGCTCGTCAAAGCCGTAAACTTCACGCTTCTCTTGTAGATCCTTCGGACTCATGTTACATTCTCTCTTCAAGGTTAGATGGACGCATTGCATTGTCCTTCCGTGGGAACTGTGAGTTCACTGAGAAGGCAAAACACGCTGAAGCAGCTGGCGCTTCTGCTCTGTTGGTCATTAATGACAAAGAAGATATTGATGAGATGGGGTGTGTGGAGAAAGACGTCTCTTTGAACGTGACTATACCTGTGTTAATGATCTCTAAGTCAAGCGGGTATGCTCTCTACAAGTCTATGGTAGAACACAAGAGTGGGTTGCTGTTGCTCATGGCTGTTGGAACCGTTGTCGTTGGATCTCTGTGGTCTGAGCTCACAGATCCTGACCAAGCTGATGAATCTTACAGCATATCATCAAAGGAGAAGGAGATCCTTTATATAAGTGTCACAGGTGCTGTGTTCTTTATAGTAACAGCGTCCGTTTTTCTGCTGCTGCTTTTCTACTTCATGTCATCATGGTTAGTATTGGTGCTCATCATCTTCTTCTGCATTGTTGGCATGCAGGATATGCATAAGATCATTATGGCAGTTTTATTGAGAAAGTGGAAACATCTTGGTCGGAAAACTGTGAAGCTCCCTTTGATTGGGACAGTGTCATGGATGTCGGTTGCTCAAGGAGACAGGAGCAGCGGGGAGTCTATGCCCATGTTGCTCAGGATTCCTCGGTTTTTCGATCCTTGGGGTGGCTATCACATGATTGGTTTTGGGGACCTTTGCGTCCCTGGTATGCTCATTTGCTTTGCTTCCAGATATGACAAGTTCAAGAAGAGGGTAGTGTCAAGTGGGTACTTTCTTTGGTTGACTATTGGCTATGGAGTAGGTCTGTTACTGACATGTTTAGGTCTGTATCTAATGGACGGACATGGCCAGCCTGCGCTTCTCTACATTGTTCCCTGCACACTTGGTTTGGCTGTCATTAAGGGGTTGGTGAGAGGAGAGCTTAAAGAGCTATGGAACTACGGTATCGAAGAATCAGAGTCTCACACGCCAGAGGATCCTCTGCCTGTGGCATAA >Bo5g001040 ATGATCTGGGGAAGATCTTACAGCGGTTACTTGTTAGTGTTGGGGTGGTTGTACGTGTACAGTGCTAGTTTGGTTTCTGGTGGAGACATAGTTCACCACGATGACTCTCTTCCTAATAGACCTGGTTGCAACAACAATTTCGTCTTGGTCAAAGTCCCAACTCGAGTCAGTGGGAAAGAAAAAGAGGAGTATGTTGGTGTTGGTGCTAGGTTTGGTCCAACCTTGGAGTCTAAGGAGAAACATGCTACCCTCATCAATCTCGCTGTTGCTGACCCTCCTGACTGCTGCACCACTCCCAAATTTAAGCTTACTGGAGAGGTCATTCTTGTTCACCGTGGTAACTGCAGTTTTACCACCAAAACTAAGGTAGCTGAAGCAGCTGGTGCCTCTGCCATCATTATCATTAACAACAGCACTGATCTTTTCAAGATGGTATGTGAGAAGGGTGAAGACGTTTTAGATATCAATATTCCTGTTGTTATGCTCCCTCTTGATGCTGGTTCAAGTCTCCAAAAATTCGTCGACGCTAACGACACTGTTACTTTGCAGCTATATTCGCCGAAACGTCCAGCAGTTGATGTGGCTGAGGTCTTTCTCTGGCTTATGGCTGTTGGTACCATTCTTTGTGCTTCTTATTGGTCGGCCTGGACCGCTAGGGAAGAAGCCATTGAGCAAGACAAGCTGCTAAAGGATGGATCAGATGAACTTTTGCAGGTATCAACCACAAGCTCTAGAGGGGTTGTTGAGATCACCGTGATATCAGCAATTTTGTTCGTGGTGGTTGCTTCTTGTTTCCTCATCATGCTCTACAAGCTTATGTCATTCTGGTTTATAGAAGTGTTGGTCGTACTCTTTTGCATAGGTGGCGTAGAGGGGCTGCAAACCTGTTTGGTCGCTTTGCTCTCATGTTTCAGATGGTTCCGCAGCATTGGAGAATTTTATGTCAAAGTTCCATTCCTTGGTGCAGTCTCATATTTGACGCTGGCCATTTGTCCGTTTTGCATAGTATCTGCTGTTATATGGGCAGTTTACCGCCAATACTCGTTCGCTTGGATAGGGCAAGATATCCTTGGAATCTCGCTGATAATCACAGTTCTTCAAATCGTCAGGGTTCCAAATCTTAAGGTTGGAGTTGTTCTTCTCAGCTGCGCCTTTATGTATGATATCTTCTGGGTTTTTGTTTCAAAATGGTGGTTCCGTGAAAGCGTGATGATTGTGGTAGCCCGTGGAGACAAAAGCGGAGAGGACGGCATCCCAATGCTACTAAAGATCCCACGTATGTTTGATCCTTGGGGTGGCTACAGTATCATCGGTTTTGGCGATATCATCTTACCTGGACTTCTTGTCACCTTTGCACTAAGATACGACTGGCTGGCAAACAAGAAGCTCAAGTCAGGATACTTCCTTGGGGCAATGTCTGCTTATGGTCTAGGTCTCCTCATAACATATATTGCACTAAACTTGATGGATGGACACGGGCAACCAGCTTTGCTTTACATTGTTCCATTCATACTTGGTACTTTGATAGTGTTAGGTCACAAGAGAGGTGACCTGGAGACCCTGTGGACAACAGGGGAACCAGAGAGGCCATGTCCTCACGCTCGCCTTCAACCTCAATCTTAG >Bo8g005810 ATGTCGTTGCCTCCGTTTAGCTGCCGCATTCTCGCGGCAGCCGTGGCCCTCTATCTAACCGGTCTGCTATGCCTTGGTGCTGGTGAAGCTCCTTCTAAAGATGCCGCGGCTCCCAAGATTCCTGGCTGTTCCAACGAATATCAAATGGTCAAGGTTGAGAATTGGGTTAACGGAGAAAATGGTGAAGATTTTAGTGGCATGACTGCTCAGTTTGGTGCCGTGCTTCCGTCTGATAAAGACAAAGCTGTTAGACTTCCTGTTGTTCTTACCACTCCTTTGAACAGTTGCTCAAATTTAACCTCAAAGCTATCTGGTTCCATTGCGTTATCTGTACGTGGGGAATGTACATTCACAGCTAAGGCTCAGGTTGCACAGGCAGGAGGAGCTGCAGCTTTGGTTTTAATAAACGATAAAGAAGAGCTGGATGAGATGGCTTGTACTGAGGGAGAATCTCCCTTAACTCTTACTATACCTGTTTTGATGATTACTACATCATCTGGAGATGCCTTGAAGAAATCCCTTGTGGCAAATAAGAAAGTGGAGCTATTATTGTATGCTCCAAAAAGCCCAGTTGTGGATTATGCAGTGGCATTCCTCTGGCTAATGTCTGTTGGAACAGTATTCATTGCTTCTGTCTGGTCACATTGCACCGGTCCTAAGGAGAACGATGAGGAGTACAATGAATTATCACCAAAGTCTTCAGTTGATAGTGCTACCAAAGATGCTACTAAAGATGACGATGAGACACTTGATATCAGTGCTACTGGTGCTGTTATCTTTGTCATATCAGCGTCCACGTTCCTTGTGTTGCTCTTCTTCTTTATGTCATCATGGTTCATCTTAATCCTGACCGTCTTTTTCTGCATTGGTGGTATGCAGGGAATGCATAATATTATCTATACCCTCATAACAATGAGATGCAATAAATGTGGTCGGAAGACTGTGAAAGTCCCCTTGTTTGGGAATGTAACGATTCTATCACTCATGGTTCTGTTGTTCTGCTTTGTGGTTGCTGTCGTCTGGTTCATAAACCGCAAAACATCGTATGCATGGGCCGGACAAGATATTTTTGGTATTTGCTTGATGATAAATGTCTTGCAAGTGGCTCGGCTACCTAATATCAGGGTTGCAACCATTCTTCTATGTTGTGCATTTTTTTATGACATCTTTTGGGTGTTCTTGTCACCACTAATCTTCAAGCAAAGTGTAATGATTGCGGTTGCACGTGGGAGCAAAGACACAGGAGAATCTATTCCCATGCTACTGAGATTTCCAAGGCTTTCTGATCCATGGGGTGGTTACAACATGATTGGTTTTGGAGACATTCTATTCCCGGGTCTTCTCATATGCTTTATCTTCAGATACGACCGAGAAAACAACAAAGGAGTAGTGAAAGGCTATTTCCCATGGTTGATGTTTGGTTACGGACTTGGACTATTCTTGACATACTTGGGACTATATCTTATGAACGGACACGGTCAACCTGCACTGCTCTATCTCGTGCCTTGCACTCTTGGTATAACGGTTATACTAGGGTTGGTGAGGAAAGAACTCAGAGACTTGTGGAACTACGGGACTCAGGAGCCTTCAGTTTCAGATGTAAATCCATCTCCAGGAGCATAA >Bo8g118000 CTGCCTTTTCATCTCTCTCTCCCACCAGAGTTTTTTCCCTCTCTCTCTCTCTCTCTCTCTGGTTCCTTGTACCTTCCTCTCCAATCTCCATATCTCTTTTATCTTCGACCTAGTCTTCTTCTTCTCCTTGGTAGAGTGAAAAGTATGATCCAGCGGAGATCTTTCAGCTGTTTGTTGTATGTTTTGGGGATGTTGTTGTTGTACAGTGCTAGTTTGGTTTGTGGTGGAGACATAGTTCACCACGATGATTCGATTCCACAGAGACCTGGCTGCAACAACAATTTCGTACTGGTCAAAGTCCCAACTCGAGTAGATGGGAAAGAAAAAGAGGAGTTTGTTGGTGTCGGTGCTAGGTTTGGGCCTACCTTGGAATCTAAGGAGAAGCATGCTACCCTCATCAAACTCGCCCTTGCCGACCCTCCTCATTGCTGCACCACCCCCAAATCCAAGCTTACTGGAGAGGTCATTCTTGTTCACCGTGGTAATTGCAGTTTTACCACCAAAACTAAGGTAGCTGAAGCTGCTGGTGCCTCTGCCATCCTCATCATAAACAACAGCACTGATCTTTTTAAGATGGTATGTGAGAAGGGTGAAAACGTTTTAGATATCAATATCCCTGTTGTTATGCTACCTATTGATGCTGGTAGAAGCCTCGAGGAGACCGTTCAGAGTAACTCCATAGTTACCTTGCAGCTATATTCGCCGAAACGTCCAGCAGTTGATGTGGCTGAGGTCTTTCTATGGCTTATGGCTGTTGGTACCATCCTTTGTGCTTCTTATTGGTCTGCTTGGACCGCTAGGGAAGAAGCCATTGAGCAAGACAAGCTGCTAAAGGACGGATCAGATGAACTGTTGCAGGTATCAACCACAAGCTCTAGAGGGGTTGTTGAGATCACCGTGATATCAGCAATTTTGTTTGTGGTGGTTGCTTCTTGTTTCCTCATCATGCTCTACAAGCTCATGTCATTCTGGTTTATAGAAGTGTTGGTGGTCCTCTTTTGCATCGGTGGCGTAGAGGGGCTGCAAACCTGTTTGGTCGCTTTGCTCTCATGTTTCAGATGGTTCCGGCGAATAGGAGAATCATATGCGAAAGTTCCTTTGCTGGGGGCAGTCTCATACTTGACTCTGGCCGTTTGTCCCTTGTGCATAGTATCTGCTGTTATCTGGGCAGTTTACCGCCAATACCCTTTTGCTTGGATAGGCCAAGATATCCTTGGAATCTCGCTGATAATCACAGTTCTTCAAATCGTCCGGGTACCAAATCTTAAGGTTGGAGTTGTTCTTCTCAGCTGTGGCTTCATGTATGACATCTTCTGGGTTTTTGTTTCAAAATGGTGGTTCCGTGAAAGCGTGATGATTGTGGTAGCTCGTGGTGACAAAAGCGGAGAGGACGGCATCCCTATGCTACTAAAGATCCCACGTATGTTTGATCCTTGGGGTGGCTACAGTATCATCGGTTTTGGCGATATCATCTTACCTGGACTTCTTGTCACTTTTGCACTCAGATACGACTGGCTGGCAAACAAGAGGCTCAAGTCTGGATACTTCCTTTGGACAATGTCTGCTTATGGTCTAGGTCTTCTCATAACATATATTGCTTTAAACTTGATGGATGGACACGGGCAACCAGCTTTGCTTTACATCGTTCCATTCATACTTGGTACTTTGACAGTGTTAGGTCATAAGAGAGGTGATCTGAAGACCTTATGGACAACAGGGGAACCCGAGAGGCCATGTCCTCACGTTCGCCTTCAACATCAATCTTAA >Bo9g035410 ATGGATTCGCTCCGATTTCTCCGGATTCTTCTTGTTTCTGCTTCGATCTTACTCGTCTCTCTCCTGTATACAGTCACCGCCGGTGATATAGTTCATCAAGACGATTTAGCTCCGAAGAAGCCAGGTTGCGAAAACGACTTCGTTTTGGTTAAAGTTCAAACGTGGATTGATGGTACTGAAGATGCTGAGTTTGTTGGCGTTGGTGCTAGATTTGGGAGGCGGATTGTCTCCAAGGAGAAGAACGCTAACCAGACTCATGTTGTTTTTGCTAATCCTCGTGATTGTTGTTCACCTCTCAGGACCAAGCTTATTGGAGATGTTGTTATTGTGGACCGTGGCAACTGTCGGTTTACAGCTAAGGCTAATAATGCCGAAGCTGCTGGTGCCTCTGCTCTATTAATCATTAATAACCAGAAAGAACTTTACAAAATGGTTTGTGAACCGGATGAAACGGATTTAGACATTCAGATTCCTGCCGTCATGCTCCCACAAGACGCTGGTGCAACCTTGGAAAAAATGCTTATCAACAGTTCTAAAGTGTCGGTGCAGCTTTACTCCCCAAGACGACCAGCTGTTGATGTAGCCGAAGTCTTTTTGTGGTTAATGGCTATCGGTACCATTTTGTGTGCTTCTTATTGGTCCGCATGGAGTGCCCGAGAAGCAGCTATTGAACATGATAAGCTACTCAAGGATGCTATAGACGAAATCCCTAGCACAAATGATGGGGGTAGTGGTGTCGTGGAGATCAATACTCTTTCAGCTATTTGTTTCGTATTTCTTGCTTCGGGCTTCCTGGTTGTTCTTTACAAGCTTATGTCTTATTGGTTTGTGGAGCTTCTTGTGGTTGTTTTCTGCATTGGTGGTGTTGAGGGTTTGCAAACTTGCCTTGTCGCTTTGCTATCAAGATGGTTCCAACGTGCAGGAGATTCTTACATAAAAGTTCCTTTCCTTGGACCTATCTCTTATCTGACTCTTGCAGTTTCTCCTTTCTGCATTGTCTTTGCTGTTTTATGGGCTGTTTACCGAGAGCGTTCCTTAGCTTGGATTGGCCAAGATGTTCTTGGGATCGCATTGATCATCACAGTATTACAGATTGTTCATGTCCCAAATCTTAAGGTAGGGACAGTTCTACTCAGCTGTGCCTTCTTGTACGACATCTTCTGGGTGTTTGTCTCCAAGAAGTTGTTCCACGAAAGCGTAATGATTGTCGTAGCACGTGGGGATAAAAGCGGAGAAGATGGTATCCCTATGCTCCTGAAGATTCCACGCATGTTTGATCCATGGGGAGGCTACAGCATTATTGGATTCGGTGATATTCTTTTGCCCGGTTTGCTAATCGCATTTGCTCTCAGATATGACTGGTTAGCTAACAAGACTCTTCGAACCGGCTATTTTATATGGGCAATGGTTGCGTACGGATTAGGTCTTTTGATTACTTACGTGGCTCTAAATTTAATGGATGGGCATGGCCAACCAGCATTGCTCTACATTGTCCCTTTTACTCTCGGAACAATGTTAACACTAGCTCGAAAACGAGACGATCTTTGGATTCTATGGACGAAAGGAGAGCCAGAAAGGGCATGTCCTCACCACGTTAGGCTTGAACAGTGCTCTGAGTAA >Cpa.g.sc11.10 ATGGATATACAGAGAGTTTTTTATATAGTTTGTATTGCTCTGTTGTCTACTTCGAGGTTGGGGTCAGCTGGAGACATAGTTCACCAAGACGACGTCGCTCCCAAAAAGCCCGGCTGCGAGAACAACTTTGTTCTGGTAAAAGTCCCTACTTGGGTTGATCATATAGAAGACAAGGAGTACGTTGGTGTTGGTGCTCGTTTTGGACCTACCTTGGAATCAAAGGAGAAGCATGCCAACCAAACTAGACTTGCTCTGGCAGATCCTCCTGATTGCTGTAGCAAACCCAAAAATAAGCTTACAGGGGAGGTCATTCTTGTCCACCGAGGTAACTGTAGCTTCACTAGAAAGGCAAATATTGCTGAAGAGGCTGGTGCTTCAGCAATCCTCATAATAAACTATCGTACAGAACTTTTTAAGATGGTGTGCGAGGGGAATGAAACTGATTTAGAAATAGGCATACCTGCTGTTATGCTTCCTCAAGATGCCGGTGCCAGCTTGGAAAAGTATATTATGAACGGCTCCGTAGTTATGTTGGCACTATATTCACCAAAACGTCCAGTAGTTGATGTGGCTGAGGTGTTTCTGTGGCTCATGGCAGTCGGTACCATTTTATGTGCTTCTTATTGGTCTGCATGGACAGCCAGAGAAGCAGCCATTGAGCAAGACAAGCTGTTAAAGGATGCCTCTGAAGAATATCTACCTGCAGAAGGCACTCATTCTGGTGGTATTGTGGATATCAACATGACATCAGCGATCCTATTTGTTGTGGTTGCTTCCTGTTTCTTAGTCATGCTGTACAAACTCATGTCAAGGTGGTTTATTGAAGTTCTGGTGGTCTTATTCTGTATTGGAGGAGTAGAGGGATTGCAAACTTGTTTGGTGGCTTTGCTGTCATGTTTCAGATGCTTCCAGAATGCTGCAGAATCATTTGTGAAAGTACCCTTCTTTGGAGCTGTCTCCTATCTGACATTGGCTGTTTGTCCCTTCTGCATAGCATTTTCTGTTATCTGGGCAGTGTTTCGTCAGATCTCTTTTGCTTGGATAGGTCAAGATATCCTTGGCATTTCGCTGATAATCACAGTTCTTCAGATTGTTCGTGTGCCAAATCTCAAGGTTGGGACGGTTCTCCTCAGTTGTGCCTTCTTGTATGACATCTTCTGGGTATTTGTTTCTAAATGGTGGTTCCATGAGAGTGTGATGATAGTGGTAGCTCGTGGTGACAGAAGTGGTGAAGATGGAATTCCAATGCTACTGAAGATCCCACGGATGTTTGATCCCTGGGGTGGCTACAGTATCATAGGGTTTGGTGACATTATCTTACCAGGACTGCTTGTGGCATTTTCATTGAGGTATGATTGGCTGGCAAAGAAAAGTCTTCGAGCAGGATACTTTGTGTGGGCAATGACTGCCTATGGTCTAGGTCTCCTCATAACGTATGTGGCCCTCAACATGATGGATGGGCATGGTCAACCGGCTTTGCTGTACATTGTTCCATTTACCCTTGGGACCTTTTTGACTCTGGGAAAGAAGAGAGGAGACCTCCGAATTTTGTGGACAAGAGGAGAACCAGAGAGACCCTGCCCACATTTGGAGCTTCAATCTCCGCAATGA >Cpa.g.sc50.134 ATGATGTTTCCGTCGAACCGGTTCAGGGATTCGCGCCTTCTCATTCTCTACTTTCTCATTTCGTTTGCATTTGCGGCCGCCGATGATGCCGCACGGGACAGTACTTCTAGCCCGAAGACTCCTTCCTGTAACAACAAGTTACATTTGGTCAAAGTCAAGAATTGGGTTGATGGAGTCGAAGGTGAAAGCTTTTCCGGGTTAACTGCTAGGTTCGGGGCATCATTGCCTACTCGTGCTGAACAAGGTGTTAGATTGCCTGCTGTTTTCACGAATCCTTTAAACTGCTGTTCCACTTCCTCTATAAAGATATCTGGCTCTATTGCCTTGACAGAACGTGGCGATTGTGACTTCACGACTAAGGCAAAAATTGCACAATCTGGAGGAGCTGCTGCCCTTGTTGTGATAAATGACAAGGAAGAACTGTATGAGATGATGTGTCCTGGAAATGATACTTCTCTGGATATTTCAATACCTGTTGTGATGATTCCAAAGTCAGGAGGAGATGCTCTTAACAAGTCTATGGCAGGACAAAAGAAAGTGGAACTTCTATTATATGCACCAAATCGTCCAATAGTGGACTTTTCAGTGGTATTCTTGTGGACAATGGCTGTTGGAACGGTTGTTGCTGCCTCACTTTGGTCATTGTTAACTGATCCTGAGCAGACTGATGAGCGTTATAATGAATTATCACCCAAGGTTTATTAA >Cpa.g.sc74.6 ATGGATTTGCGAGGAGTCGGTTTGCTAATCTTTGCATCAGCTTTGATTTCACTGCTCTTTTTCTCTGCTCCCGTTACGCCTAGCGACATCGTCCACGACGACGATTCAGCTCCCAAGAAGCCTGGCTGCGAGAACGACTTCGTTTTGGTGAAAGTTCAAACATGGGTTAATGATACAGAGGATGCTGAATTTGTTGGTGTGGGCGCCAGATTTGGTACTGCCATAGTTGCAAAGGAGAAAAATGCAAACCGTACTCGCCTTACTCTTTCAGATCCACGTGACTGCTGTAGTCCACCAAAAAATAAGCTTGCAGGAGATGTCGTTATGGTACACCGAGGTCACTGCAAATTCACAACTAAGGCAAACAATGCAGAGGCTGCTGGTGCTTCAGCTGTTCTCATCATAAATAACCAGAAAGAACTTTACAAAATGATTTGTGAGCCTGATGAAACCGATCTAGACATAGACATACCTGCCGTCATGCTCCCACAAGATGCTGGTGCAAGTTTAGAAAAAATGCTAATGAATCGATCATCTGTCTCAGTGCAGCTTTACTCTCCACGCAGACCACTAGTTGACACAGCCGAAGTGTTCTTATGGTTAATAGCAGTTGGGACCATCGTGTGTGCATCTTATTGGTCTGCATGGAGCGCCCGAGAAGCAGCTGTTGAGCAGGACAAGTTATTGAAGGATGATGTGGACGAAGTTCCAAATACCGGAGCTTTAGGTGCTGGTGGTGTTGTAGATATCAACACAACATCAGCAATTCTGTTTGTCTTTGTTGCCTCGTGCTTCTTGGTTATACTTTACAAACTAATGTCATCTTGGTTCGTTGAGCTTCTAGTTGTTCTATTCTGCATAGGTGGTGTAGAGGGTTTGCAAACTTGCTTGGTTGCTTTATTGTCAAGGTGGTTCAAACGTTCCGGACGGTCATACATTAAAGTGCCTTTCTTTGGAGCTCTTTCATATCTTACTTTGGCTGTTTCTCCATTCTGCATTGCATTTGCTGCTGTTTGGGCCATTTATCGCAACCTTTCCTTTGCTTGGATAGGTCAAGATATTCTAGGAATTGCACTTATTATCACGGTGCTGCAGATTGTTCATGTGCCCAATCTTAAGGTAGGTACAGTTCTTCTCAGTTGTGCCTTCTTGTACGACATCTTTTGGGTGTTCCTTTCTAAGAAGTTGTTCGATGAAAGCGTGATGATTGTGGTAGCTCGTGGTGATAGGAGTGGAGAGGACGGTATTCCAATGCTATTGAAGATTCCACGCATGTTTGACCCTTGGGGTGGTTACAGCATTATAGGGTTCGGGGACATCCTTTTACCAGGGCTTGTTGTAGCATTTTCTCTCAGGTATGATTGGCTTGCAAATAAGACTCTTCGAGCTGGATACTTCCTGTGGGCTATATTTGCTTATGGACTAGGTCTTCTCGTTACGTATGTGGCTCTAAACTTAATGGACGGGCATGGACAACCAGCACTGCTTTACATTGTCCCGTTCACACTTGGAACCTTCTTAACTATGGGAAAGAAGAGGGGTGATCTCAAGGTTTTATGGAGCAGCGGAGAACCAGGAAGACCTTGCCGACATATCCAACTGCGACACCACCACGACTTAAATGAGGAGAAATAG >LOC_Os01g68620 ATGGCGTTCCCTGCACCCTCCTCCTCCTCCCCTCGCCGCCGCGGCCGCGGCCTCGCCTACCTCCTCGTCTCCGTCCTCCTGCTCGCGTCCCGCGTGCCGGGCGCCGCCGGCGCGGACTCGGAGTTCGAGGACGGCGTCTCGCCCAAGTTCCCCGGCTGCGACAACCCCTTCCAGAAGGTGAAGGTGACGTACTGGGTGGACGGCGACGAGAGGAGCAGCCTGACCGGGATCACGGCGAGGTTCGGCGAGGTGCTGCCGGCCACCGGCTCCGACGGCGACAAGCGGAAGGCCGTGGTCCCCGCCCCGAAGACCGGCTGCGCCAAGTCATCCGCGCCGCTTGCTAGCTCCATTGCCGTGGCGGAGCGCGGGGAGTGCACGTTCCTGGAGAAGGCCAAGACGGCGGAGTCCGGCGGCGCCGCCGCGCTGCTCCTCATCAACGACGAGGACGATTTGCAGAAGATGGTGTGCACCCAGAACGACACGGTCCCTAACATTGGCATCCCGGTCGTGATGGTATCCCAGTCTGCCGGTCGCAAGATCCTCTCCGGCATGGACGGTGGGGCAAAGGTTGACATTCTGATGTATGCGCCGGAGAAGCCGAGTTTCGATGGCGCTATACCTTTCCTCTGGCTGATGGCCGTCGGCAGCGTGGCCTGTGCGTCCGTTTGGTCCTTCGTCGTCGTCGGCGACGAGGATAAGAATGCTCCTACACTGGGTGGAGAAGAAGCTGCTGACTCTGAAATCGTGGAGCTGCAGACCAAAACCGCGCTCGTGTTCATCGTCACCGCGTCGCTTGTCCTGCTGTTCCTGTTCTTCTTCAAATCCACCTGGTCTGCATGGCTGCTGGTTGTGCTGTTCTGCCTCAGTGGTCTCCAGGGATTGCACTATGTTGCCTCGACTCTAATTGTAAGAACTTGTGATCGGTGCCGCGAAGCAAAAGTAGCTCTTCCTGTATTAGGGAACGTGACAGTGGTTACACTTGTCATCCTACCACTAGCTTTGATCTTCGTTGTCGTTTGGGCTGTACACCAGAATTCACCGTTTGCTTGGGTTGGTCAGGATCTTATGGGCATCTGCATGATGATTCTTGTATTGCAAGTGGTCCATCTGCCAAATATCAAAGTTGCAACAGCGCTTCTTGTGAGCGCTTTCATGTATGACATTTTTTGGGTGTTCATATCACCTTTCATATTCAAGAAAAGTGTCATGATCACAGTTGCTCGTGGTAGCGATGAGGGACCTAGCCTTCCCATGGTTCTGAAGATGCCAAAGGAGTTTGATACATGGAATGGCTATGACATGATCGGATTTGGGGACATTCTTTTCCCAGGACTACTTGTTGCTTTCAGTTTCAGGTATGACAGAGCAAATGGAAAGGACTTGACTGACGGCTATTTCCTCTGCCTAATGATCGGTTACGCCTTCGGTTTGTCATGCACATATGTTGGCCTGTACCTAATGAAGAGTGGACAGCCAGCTCTCCTCTACCTAGTCCCATCAACACTAGGAACTATTGTCACGCTAGGTGCGAAAAGAGGAGAGCTAAGTCAGCTCTGGAATGCTAAAGTATAG >LOC_Os02g57710 ATGGGCACCAGCTCGCCGGAGATGGCGGCCGCGCTCTTGCTGGTCATGGCGGCTCTGGCCGGGGTCGCGGCCGGCGGCGACATCGTCCACCAGGACGACGAGGCGCCCAAGATCCCCGGCTGCTCCAACGACTTCGTCCTCGTAAAAGTGCAAACCTGGGTCAATAACAGAGAGGATGGTGAGTTTGTTGGTGTTGGTGCTCGTTTTGGCCCCACTATAGAGTCAAAGGAAAAGCATGCCAATCGGACAGGACTATTGTTAGCAGATCCTATTGACTGTTGTGATCCCCCCACACAGAAGGTTGCTGGAGATGTTTTGTTAGTGCAAAGGGGAAACTGTAAGTTCACTAAAAAAGCTAAGAATGCTGAAGCTGCTGGGGCTTCTGCTATTATAATCATCAATCATGTCCATGAGCTATACAAGATGGTCTGCGACCGAAATGAAACAGATTTGGACATAAATATACCTGCAGTTCTTCTGCCAAAAGATGCAGGCAATGATTTACAGAAGCTTCTTACACGTGGTAAAGTTTCGGTGCAGCTATACTCTCCAGACCGTCCTCTGGTTGATACTGCAGAGGTGTTTTTGTGGCTTATGGCTGTTGGTACCATTCTTTGTGCATCATACTGGTCAGCATGGAGTGCTCGAGAAGCAGTTATTGAACAAGAGAAGCTTCTAAAGGATGGCCATGAAAGTTCACTAAACTTAGAGGCTGGTGGTTCTAGTGGCATGGTAGATATCAACATGACATCGGCAATACTGTTTGTTGTTATTGCATCTTGCTTCTTGATAATGCTCTACAAGCTTATGTCTCACTGGTTTGTGGAGCTTCTGGTGGTCATCTTTTGCATTGGTGGTGTAGAGGGTCTGCAAACTTGCTTGGTGGCTTTATTGTCAAGATGGTTTAAACCTGCTGCCGAATCTTTCGTGAAAGTGCCCTTCTTTGGAGCGGTTTCATACCTTACAATCGCAGTCTGTCCATTTTGCATTGTGTTTGCTGTTATATGGGCTGTTTATCGCCGGATGACCTATGCTTGGATTGGGCAAGATATTCTTGGTATTGCTCTGATTGTTACTGTAATCCAAATTGTTAGGATACCTAACCTCAAGGTCGGATCTGTTCTTCTCAGTTGTTCCTTCTTATATGACATCTTTTGGGTTTTTATCTCCAAGATGTGGTTTCATGAGAGTGTGATGATTGTGGTTGCCCGTGGTGATAAGACTGATGAAGACGGTGTGCCCATGCTGTTAAAAATCCCACGAATGTTTGATCCATGGGGTGGATTCAGTATCATTGGCTTTGGTGATATACTTCTTCCTGGGCTGTTGATTGCTTTTGCATTAAGGTATGATTGGGCTGCCAAAAAGACCTTGCAATCTGGTTACTTTTTGTGGTCAATGGTTGCTTATGGTTCTGGTCTTATGATCACGTATGTTGCCTTGAACCTTATGGATGGTCATGGTCAACCAGCTCTTCTTTACATTGTGCCTTTTACGCTTGGCACCTTCATAGCGCTCGGCAGGAAACGGGGTGAACTCAGGAACCTCTGGACAAGAGGACAGCCTGAGAGAGTCTGCACGCACATGCACATGCAACCTTCACCGAAGGACACCAATTGTGATGCTGTAAGCTCGTAA >LOC_Os06g51430 ATGGCCGCCGCCACCGCCGCGGTTTTTGCGCTGTTGATGGCGTCGGCGCTCGCTGGGGCTGCGGCCGGCGGCGACATCGTTCACCACGACGACGAGGCCCCCAAGATTCCAGGATGCTCCAACGACTTCATCCTGGTCAAAGTGCAAAGTTGGGTCAACGGCAAAGAGGATGATGAGTATGTTGGTGTTGGTGCTCGGTTTGGCCCGCAAATAGTGTCCAAGGAGAAACATGCAAATCGAACTAGACTTATGTTGGCAGATCCTATTGATTGTTGCACTTCTCCAAAAGAAAAGGTTTCTGGAGATATTCTTCTAGTCCAAAGAGGGAAATGCAAGTTCACGAAAAAAGCAAAGTTTGCAGAAGCTGCTGGTGCTTCTGGTATAATAATCATAAACCATGTCCATGAGCTGTACAAGATGGTCTGTGAAAAGAATGAAACAGATCTTGATATAAATATACCTGCAGTTCTTCTTCCAAGAGATGCTGGCTTCGCTTTACATACGGTTCTTACCAGTGGTAACTCAGTTTCTGTGCAGCAATACTCTCCAGATCGTCCTGTAGTTGATACTGCAGAGGTATTCCTTTGGCTTATGGCTGTTGGTACTGTCCTTTGTGCATCATACTGGTCCGCATGGAGTGCTAGAGAAGCACTTTGTGAACAAGAGAAGCTCCTCAAGGACGGACGTGAAGTTTTACTAAATGTTGAGAATGGAAGTTCTAGTGGCATGATAGATATCAATGTGGCATCAGCCATAATGTTTGTAGTGGTCGCGTCATGCTTCTTAATAATGCTTTACAAGATGATGTCTTCCTGGTTTGTGGAGCTACTGGTGGTAATTTTTTGCGTCGGTGGTGTTGAGGGCCTGCAAACATGCCTAGTGGCTCTATTATCAAGGTGGTTTAGAGCTGCTTCAGAATCCTTTTTTAAAGTGCCATTCTTTGGAGCTGTTTCATACCTTACTCTTGCAGTTTCCCCATTTTGCATTGTATTTGCTGTTCTTTGGGCTGTTCACCGTCATTTCACCTATGCCTGGATTGGACAAGATATCCTTGGTATTGCACTGATAATTACTGTTATCCAAATTGTTAGAGTACCTAACCTCAAGGTGGGTTCAGTTCTCCTCAGCTGTGCCTTCTTTTATGACATCTTCTGGGTGTTTGTCTCCAAGAGATGGTTTCATGAGAGCGTGATGATCGTGGTAGCTCGTGGTGACAAGACTGATGAAGACGGCGTCCCCATGTTACTAAAAATTCCACGAATGTTTGATCCATGGGGAGGATACAGCATCATTGGATTCGGTGACATCCTTCTACCTGGGCTGTTAGTTGCATTTGCATTAAGATATGATTGGGCTGCCAAGAAAAGCTTGCAAACTGGTTACTTTTTGTGGTCAATGGTGGCCTATGGTTCTGGACTCCTTATTACATATGTCGCCTTGAACCTTATGGACGGACATGGCCAACCTGCACTTCTCTACATAGTGCCCTTCACACTTGGTGCGCTGATATCACTTGGGTGGAAAAGAGGAGAACTGTGGAACCTATGGTCCAAAGGGGAGCCAGAGAGAGTATGCCCTCATCACATGCATATGCAGCCTCAGCCGAAGACGCCCCCACTAGTCCAGTAG >LOC_Os11g24540 ATGGCGACCCACCACGCCCGCCGCCTCCCCGCCGCCGCCGCCGTCCTCCTGCTCGTCCTCCTCGCCGGCGGCTCCGCGGCCGACGACGCCTCCAGCGACGACGACGCGGGCGTCCCGCCGTCGCCCGGCTGCTCCAACAAGTTCCAGCTGGTTAAGGTGAAGAATTGGGTAAATGGAACTGAAGGTACAATTGTTGTTGGGTTGAGTGCAAGATTTGGAGCCTCCGTGCCTCGAGATATTCATGAAGCTCAGAAAACATTTGCTGTCCTTGCAAATCCACTTGATTGTTGTTCCAATTCGACATCAAAGCTAACAAATTATATTGCTATAGCACAACGTGGAGAATGCGCTTTCACTGCTAAAGCAAAGATTGCACAGACTGGAGGTGCAGTTGGTTTACTAGTTATCAATGATAATGAAGAACTTTACAAGATGGTTTGCAGTGACAACGATACTTCCATTAATGTTACAATACCTGTTGTAATGATACCACAGTCAGCTGGAAAAAAGATGAAGGGCCTCTTGGATCAGGGAGCAAGGCTGGAGGTGCAGCTATATTCACCAAATCGACCAGTTGTAGACCTTTCAGCATGCTTCTTGTGGATAATGGCTATAGGAACCATAGTTTGTGCTTCACTCTGGACTGAATTTGTTGCATGCGAGCAAGTTGATGAGCGTTATAATCAGTTGACACGGAAGGATGGGCCTAATTCTGGAACAACCAACAGAGAAGATAAAGAAATCTTCGAGATCAGTGCCAAGGGGGCTATTGTTTTTATTTTAGTAGCTTCAGTTTTCCTCCTCCTCCTCTTCTACTTCATGTCTTCTTGGTTCGTCTGGCTGCTAATTGTATTATTCTGCATTGGTGGTATTGAGGGTATGCATGTTTGCTTGGTCACACTTCTCACTAGGATTTGCAAGGATTGTGGACAGAAGACTGTACAACTCCCCTTTTTTGGGGAGGTGTTGACCCTTTCTGTTCTGATTGTACCATTTTGCACTATCTTTGCAATTCTTTGGGCTGTCTATCGGCATGCTTCTTTTGCTTGGATAGGCCAAGACATCCTTGGAATCTGCCTGATGATAACTGTGCTTCAAATGGCACGCTTACCAAATATCAGGGTTGCATCAGCTCTTCTTAGTGCTGCATTTGTGTATGATGTTTTCTGGGTGTTCATTTCACCTCTTATATTCCATGAAAGTGTCATGATTGCAGTTGCTCGTGGTGATAACTCTGGGGAAGCAATTCCGATGCTCTTAAGAATACCTCGTTTCTTTGATCCATGGGGTGGCTATGACATGATAGGCTTTGGTGACATTATTTTCCCTGGATTGCTAGTTGCATTCAGCTACAGATTTGATAGAGCAAGCAAAAGGGGCCTCTTCAATGGGTATTTTCTATGGCTGACGGTGGGATATGCTGTTGGCCTTTTCCTTACCTATCTTGCGCTCTTCCTGATGGACGGGCATGGTCAACCTGCGCTGCTGTACCTTGTTCCATGTACATTAGGGCTTATTGTTATACTTGGTTGGTTTAGAGGTGAACTTCATGATCTATGGAATTATGGTAGAAGTCAAACAGAAAATTTAGTCGACGAACCATAG >Medtr1g116953 ATGCGGTGGTTTTCGCACTTGGTGGCAAACATTCTTATTCTCTCCTTCTTCATGTTCCCAACAACAAATGCCGATGACAACAACGCCGCATGCAATCACGAAACGCAATTGGTTAAAGTGAAGAATTGGGTTGATGGCAAAGAAGGCGACATGCTTAACGCTATGACCGCTAAATTTGGCTCTATTTTGCCTAAACTTGCCGATCAATCTCTCAAATCTCCTCTCATTTCTTCCATTCCCGCTGACTGTTGTTCTCCTTCAACTTCCAAGTTATCTGGATCAGTTGCTGTTTGTGTTCGTGGTAACTGCGACTACACAACTAAAGCTACATTATCACAGTCAGTGGGTGCTACTGCTGTGTTGATGATAAATGAGAAGCTTGTTGAGATGGACTGCCCCAAGGATACTACAGAAAAAATAAACATTTCAATTCCAGTTGTCGAAGTAACAGAGGAAGTGATAGATAATCTCAACAAAATTTTGAAGTCTGGAAAAAAAGTGGAAGTTCTACTATATGCTCCAACTCGTCCAACTATAGATTTCTCTGTTGGATGTTTGTGGTTGATGTCTGTCGGAACAGTTATATGTGCTTCGTTATGGTCAGACTTAACTGCTCGTGATCAGCTTGATGAACGCTATAATGAATTATCTCCCAAGGGATCTTCCACTGCTGAAAGAGTGACAAATGATTCTGAAAACGAAATTGTTAACATAGATACAAAGGGGGCTATCATCTTTGTCATTACGGCTTCTACGTTTCTTGTGCTATTATTTTTCTTCATGTCATCTTGGTTTATCTGGATATTGATTGTACTTTTCTGCATTGGTGGTGTTGAGGGGATGCATAATTGTATTGTAACTCTCACTTTAAGCAAACGTCCCAATTTTGGTCAGAAGACTGTGAATTTACCTATGTTTGGAGAGATTTCTATTTTCTCACTGGTGGTGTTGCTATTCTCTGTGGCATTTGCGATAATATGGGCTGCTACTCGACGAGAATCATTTTCATGGTTTGGCCAAGATGTTCTTGGTATATGTTTAATGATAACAGTGTTGCAATTAGCTCGTTTGCCTAATATTAAGGTCGCAACTGTACTCCTTTGTTGCGCATTTGTATATGACATCTTTTGGGTATTCATATCCCCGGTGATATTCCAGAAGAGTGTTATGATTACAGTTGCTCGTGGTGACAAAGCAGGTGGTGAAGCAATTCCCATGCTTTTGAGATTTCCACGTCCTTCTGATCCTTGGGGTGGCTATGACATGATTGGATTTGGAGATATTCTATTTCCTGGTTTGCTTGTCTCCTTTACTCGTAGATTCGACAAAGATAATAAGAAGGGGGTATTTGAAGGATATTTTATTTGGCTGGTAATTGGCTATGGCTTTGGCCTCTTTTTAACATATTTGGGATTATATATGATGAATGGTCATGGACAACCTGCCCTACTCTACCTTGTTCCATGTACGCTAGGAGTCACTGTGATATTGGGATGCATTAGAGGTGAGATGAAGTCTCTTTGGAATTGTAATGCAGACTCAAGTTCATCTAGCGAGCCTACAAAAGTTTGA >Medtr6g463340 ATGGCTCCAGAAAAATTTCTCTGGTTTATTATTACACTTTCTTCTCTAATTCTACTTCTCACTAAAGTTCCTTCAGTTCTAGCTGGTGACATAGTTCATGATGATTCAACTCCTAAGAAACCCGGTTGTGAGAATCAGTTTGTTTTGGTGAAAGTGCAAACCTGGGTCAACGGTGTAGAGGATGCAGAATTTGTTGGCGTGGGTGCAAGATTTGGCAGAACAATCGTGTCTAAGGAGAAAAATGCTCGACAGACACGGCTTGTTCTTTCAGATCCTCGAGATTGTTGCAGCCCTCCAATGAATAAGATTGTTGGAGATGTCATCATGGTGGATCGAGGCAACTGCACATTCACAAAAAAGGCAAATTCTGCACAAAATGCTAATGCTTCGGCTATCCTCATCATAAATAACCAGAAAGAGCTTTACAAGATGGTTTGTGATCCTGATGAAACTGATTTAAGCATACACATACCTGCTGTTATGCTCCCACTAGACGCAGGCACAAAACTGGAAAACATGCTGAAGAGTACTTCATCTGTGTCGGTTCAGCTATACTCCCCACAACGACCAACCGTTGACATAGCCGAAGTGTTTCTTTGGCTGATGGCTGTTCTCACCATATTGTGTGCATCATATTGGTCAGCGTGGAGGGCCCGAGAAGCAGCTGTTGAATATGATAAGTTATTAAGGGATGTTTCAGATGAAATCTCAAACACTAAAGATGTGGCCGTCAGTGGAGTTGTAAATATGAATGCAAAAGCTGCAGTTCTTTTTGTTTTAGTTGCTTCGTGCTTCCTGTTTATGCTTTACAAATTGATGTCGCCGTGGTTCATTGATGTTTTGGTTGTTCTCTTCTGTATTGGTGGGATAGAGGGATTGCAAACTTGCTTGGTTGCACTTTTGTCAAGGTGGTTCAAGCATGCTAGCGAATCATACGTTAAATTGCCCTTCGTAGGAGCTATCTCATACCTGACTTTGGCTGTTACTCCATTCTGTATAACATTTGCCGTTTTTTGGGCAGTTTATCGAGACAAATCATTTTCCTGGATTGGTCAAGATATACTTGGAATTACGCTGATTATTACAGTTCTGCAGATCGTACATGTGTCTAATCTCAAGGTTGGTACAGTTCTTCTCAGTTGTTCCCTCCTTTACGACTTATTTTGGGTGTTCGTGTCGAAGAAGTTTTTCAAGGAAAGCGTGATGATTGTGGTAGCCCGAGGTGATAGAAGTGGAGAAGATGGTATTCCAATGTTACTAAAGTTTCCGCGCATTTTGGACCCATGGGGTGGTTATAGTATTATCGGTTTTGGAGACATCCTTTTACCTGGAATGCTGGTCGCGTTCTCACTCAGGTATGATTGGCTGGCAAAGAAGACCCTTGTAAGTGGATACTTTTTGTGGGCAATGTTAGCATATGGCTTTGGTCTTCTAATCACTTACGTGGCGCTAAACTTGATGGACGGGCACGGACAACCAGCACTGCTATACATTGTTCCATTTACTCTAGGGACCATTATTGCATTGGCACAAAAGCGAGGAGAACTAAAGATTTTGTGGAAGAGTGGCGAACCAGAAAGATTCTGCCCTCATATCAGACTCCATAACAGTGGAGAATCAAGCCCCGAATGA >Medtr7g077800 ATGCCTTCTTTTACACCTATCTTCTTCTTCTCTGTGTTCATGCTTCTTCTCACTTTCTCTTTTGCTGGTGATATAGTTCATCATGATAGTATTGCTCCTAAGAAACCTGGATGTGACAACAACTTTGTTCTGGTTAAAGTTCCAATTTCGATTGATGGTGTGGAAAGCGGCGAGTATGTTGGTGTTGGTGCAAGATTTGGACCTACGTTGGAATCAAAAGAAAAACGTGCTAACCATACTAGAGTTGCCATTGCCGACCCGCCTGACTGTTGTAGCAAACCTAAGAATAAGCTCACGGGCGAGATCATTTTGGTGCACCGAGGACAATGTAGTTTCACAACCAAGGCAAATATAGCTGAAGAAGCTGGTGCTTCAGCCATCCTGATTATAAATAACGCTAAAGGACTTTTCAAGATGGTTTGTGAAAATGAAACCGATATTGATATTGGAATACCTGCTGTCATGCTTCCACAGGATGCCGGTGTAGCCTTGAAAAATTATATACAAAACAAGTCCATAGTGTCTGTGCAGTTATACTCTCCACGACGTCCACAAGTTGATGTCGCAGAAGTATTTTTATGGCTTATGGCTGTTGGTACCATTCTTTGTGCTTCTTATTGGTCTGCCTGGACTGCCAGAGAGGGTGTTATTGAGCAAGAGAAGCTATTAAAGGATGATTCAGATGAGCTTCTAAATATAGAGAATGCTGGTTCCAGTGCTTTTTTGGAAATAAGCACCACGGCAGCACTTTCATTTGTTGTGATTGCTTCTTGTTTCTTGTTTATGCTTTACAAACTAATGGGAAGATGGTTCATTGATGTTCTGGTGGTTCTGTTTTGTATTGGTGGTGTTGAGGGACTGCAAACTTGCTTAGTGGCTCTTTTATCACATTTCAGATGGTCTCAACATGCTGCACAAACATATGTGAAAGTACCCTTCTTCGGTGCTGTTTCATATCTCACTCTTGCTGTCACGCCCTTCTGCATAGCGTTCGCTGTGGTTTGGGGAGTTGAACGCCGTGTATCGTATGCTTGGATTGGTCAAGATATTCTTGGTATCGCTTTGATAATTACGGTTCTTCAGATTGTCCAAATACCAAACCTCAAGGTTGGAACTGTTCTTCTCAGCTGCGCCTTCCTATATGACATCTTCTGGGTGTTTGTCTCTAAACTTATTTTCCATGAGAGTGTGATGATAGTGGTAGCTCGCGGTGATAAGAGTGGAGAAGATGGTATCCCCATGCTGCTCAAGATACCACGTTTATTCGATCCTTGGGGTGGTTACAGTGTCATCGGTTTTGGGGACATAATCTTACCAGGGCTTCTAGTAGCATTTTCATTAAGGTATGATTGGTTAGCGAAGAGGAACCTTCGGTCAGGATACTTCTTGTGGACGATGAGTGCCTATGGTTTAGGTCTCCTTGTCACATACATAGCTTTGAATTTGATGGATGGGCATGGTCAACCAGCTTTGCTGTATATAGTCCCGTTTACACTCGGAACCTTTTTGTCATTGGGAAAGAAGAGAGGTGAACTTGAGATTTTATGGACAAGAGGGATGCCAAAAATGCCTTGCCCTCACATCCAAGAGAATCATCAACCCGTCGACGAGTAA >Medtr7g405780 ATGGCGTCTTCTTCTTCTTCTTCTCGTTTCGGATTGTGTTTCTCTCTGTCGGTGTTATTGCTGCTGCTTGCAACAACTGCTTTTGCCTCGAACGATGTGAAACGCGATGACGATAGAGCTCCCAAGTCCAAAACCTGCAATAACCCCTTCCAATTGGTTAAGGTGAAAAACTGGGCAGATGGTGAGGAAGGTGTTATTCAAAGCGGCATGACTGCAAGATTTGGTTCTTCCTTACCTGAAAAAGCTGAAAATAGCGTCAGAACTCGTGTTCTTTTTTCTAATCCTACTGATTGTTGTTCATCTTCAACTTCAAAGTTAGTTGACTCTGTTGCTCTATGTATTCGTGGGGGTTGTGATTTTCAACTTAAAGCTACAATTGCACAATCTGGAGGTGCTACTGGCGTTTTGATCATAAATAATGAAGAAGATCTTGTTGAGATGGTTTGCACTGATAGTACTGAGGCAAACATCACAATTCCAGTTGTGATGATAACAAAATCAGCAGGAGAAGCTCTCAACACATCTTTAACATCTGGAAAGAGAGTGGATGTTCTGTTATATGCACCACCTCGACCACTTGTAGACTTCTCAGTTGCATTTTTGTGGTTGGTGTCTGTTGGAACAATTGTGTGTGCTTCACTATGGTCAGATCTAACTACTCCGGAGAAGTCTGGTGAACGCTATAGTGAATTATATCCCAAGGAATCTCAAAATGTTGCCGCAGCAAGAGGCGGTTCTGATAAGCAAGTTCTTAACATTAATTCAAAGGCTGCTGTCGTATTTGTCATAACAGCATCTACCTTTCTTGTTCTGTTGTTCTTCTTCATGTCATCTTGGTTTATGTGGTTGCTCATTGTACTTTTCTGCATTGCTGGTATTGAGGGGATGCACAATTGTATTACAAGCCTTACTTTAAGGAAATGGCAAAATATTGGTCAAAAGACCGTGAATGTACCTCTATTTGGGGAGATTTCTATTTTCTCGCTGGCAGTGTTCTTATTCTGTCTGGCATTTGCTGTTTTCTGGGCTGCTACTCGACATGAATCTTATTCGTGGATTGGCCAAGACACTCTTGGAATCTGTTTGATGATAACAGTCTTGCAGTTGGCTCAATTACCCAATATTAAGGTTGCGACTGTGCTCCTTTCTTGTGCCTTTGCCTACGACATCTTTTGGGTGTTCATATCTCCACTGATATTCCACGAAAGTGTCATGATTGCAGTTGCTCGAGGTGACAAGGCTGGTGGTGAAGCAATTCCTATGCTTTTGAGATTTCCTCGTCTTTTTGATACATGGGGTGGTTATGACATGATTGGCTTTGGAGATATCATCTTTCCTGGTTTGCTTGTTTCCTTTGCTCATAGATTTGACAAAGATAATAAGAAGGGAGTATTAAATGGATATTTTCTTTGGTTGGTAATTGGCTATGGAATTGGCCTCGTTTTCACATATTTGGGACTATATCTGATGGACGGAAATGGACAACCTGCACTCCTCTACCTTGTTCCATGTACACTAGGTGTCTTTATCATACTGGGATGTGTAAGAGGTGAGCTGAAGAGCCTTTGGAATTATGGCACAGACCCGTCCTTGTCCACAGAGCCTTCAGATTCAGAAGTTTAA >Medtr8g030680 ATGGTTTCATTGGGAGTTATATATAGTAATATTGTAGCATATGTGTTTCTGTTTAGTGTGTCTTTGGTTTTGGCTGGTGATATAGTTCATCATGATGATGTTGCTCCTACAAGGCCTGGTTGTGAGAATAACTTTGTTCTGGTCAAAGTCCCAACTTGGATTGATGGTGTGGAAAACGCCGAATATGTTGGTGTCGGTGCAAGATTCGGTCCTACATTGGAATCAAAAGAAAAACATGCCAATCATACTAGAGTTGTCATGGCCGATCCTCCTGATTGTTGTAGCAAGCCAAAGAATAAGCTCACCAATGAGATCATTTTGGTGCACCGAGGAAAATGTAGTTTCACAACCAAGGCAAATATAGCTGATGAAGCCGGTGCTTCAGCCATTCTCATCATAAACTATCGTACAGAACTTTTTAAGATGGTTTGTGAGGAAAATGAAACTGATGTTGATATTGGAATACCTGCTGTTATGCTTCCACAAGATGCTGGATTAAACTTGGAAAGACACATACAAAATAACTCCATAGTGTCCATACAGTTATACTCTCCACTTCGTCCATTGGTTGATGTTGCGGAAGTGTTTTTGTGGCTTATGGCTGTTGGTACCATTTTATGTGCTTCTTATTGGTCTGCTTGGACTGCCAGAGAAGCTGCTATTGAGCAAGAGAAGCTCTTAAAGGATGCTTCAGATGAATATGTTGCAGAAAGTGTTGGTTCTCGTGGTTATGTGGAAATCAGTACTACAGCAGCAATTTTATTTGTCGTGCTTGCTTCTTGTTTCTTGGTTATGCTGTACAAATTAATGTCATTCTGGTTTCTTGAAGTTCTGGTGGTTCTTTTTTGCATTGGAGGAATAGAGGGTCTACAAACATGTCTGACGGCTCTATTATCATGTTTCAGATGGTTTCAGTATCCTGCACAAACATATGTGAAGATACCGTTCTTTGGAGCCGTTCCATATCTGACACTTGCTGTTACTCCCTTCTGCATAGTATTTGCGGTGGTTTGGGCGGTTAAACGACAAGCATCATATGCGTGGATTGGTCAAGATATTCTAGGTATTGCGTTGATCATTACAGTTCTTCAGATTGTTCGCATACCAAATCTCAAGGTTGGGACTGTTCTTCTCAGTTGTGCTTTCCTGTATGACATCTTATGGGTGTTCGTCTCTAAATGGTGGTTTCATGAGAGCGTGATGATAGTGGTAGCTCGAGGTGATAAGAGTGGAGAAGACGGTATTCCCATGCTTCTCAAGTTACCACGTTTGTTTGATCCTTGGGGTGGTTACAGCATCATTGGTTTCGGGGACATAATCTTACCGGGACTTGTAGTAGCATTTTCACTAAGGTATGATTGGTTGGCAAAGAAGAACCTCCGAGCTGGATACTTTGTGTGGGCAATGACTGCTTATGGTCTAGGTCTCCTCATCACATATGTCGCTTTAAACTTGATGGATGGACATGGCCAGCCAGCTTTGCTCTATATAGTCCCATTTACACTTGGCACCTTTCTGTCATTGGGAAAGAAGAGAGGTGATCTCAAGATTTTATGGACAAGAGGAGAACCAGAAAGGCATTGTCCTCATATTCAAGAAGTTAACCAATCAATTAACCAACATTGA >AT1G01650 ATGATCTTGTGGAAATCTCTCAGTTGTTTCTCGTTCGTCTTCGGGTTGTTGTTGTACAGTGCTAGTTTCGTTTGTGCTGGAGACATAGTTCACCACGACGATTCGCTTCCGCAGAGACCTGGTTGCAACAACAATTTCGTTCTGGTGAAAGTCCCAACTCGAGTCAATGGGTCGGAGTACACGGAGTATGTTGGTGTTGGTGCTAGGTTTGGCCCAACCTTGGAATCTAAGGAGAAACATGCTACCCTCATCAAACTTGCTATTGCTGACCCTCCTGATTGTTGCAGCACTCCCAAAAATAAGCTTACAGGAGAGGTCATTCTTGTTCATCGTGGTAAATGCAGTTTTACCACCAAAACTAAGGTTGCTGAAGCAGCTGGTGCCTCTGCCATCCTTATCATAAACAACAGTACAGATCTTTTCAAGATGGTCTGCGAGAAGGGTGAAAACGTTTTAGATATTACTATTCCTGTTGTTATGCTACCTGTTGATGCTGGTAGAAGTCTGGAGAACATAGTCAAAAGTAACGCTATAGTTACTCTGCAGCTCTACTCGCCGAAACGTCCAGCAGTTGATGTGGCTGAGGTCTTTCTTTGGCTTATGGCTGTCGGTACCATTTTATGTGCTTCTTATTGGTCTGCGTGGACCGTCAGGGAAGAAGCTATTGAGCAAGACAAGCTGCTAAAGGACGGATCAGATGAACTTTTGCAGTTATCAACCACCAGCTCTAGAGGTGTTGTTGAGGTCACCGTGATATCAGCAATTTTGTTTGTAGTGGTGGCTTCTTGTTTCCTGATCATGCTCTACAAGCTTATGTCATTCTGGTTTATAGAGGTGTTGGTGGTACTCTTTTGCATAGGTGGCGTAGAGGGGCTGCAAACTTGTTTGGTCTCTCTACTCTCATGTTTCAGATGGTTCCGCCGCTTTGGAGAATCATATGTCAAAGTTCCTTTCCTGGGTGCTGTCTCATACTTGACTCTGGCTATTTGTCCCTTTTGCATAGCATTTGCTGTATTTTGGGCGGTTAAACGTCAATACTCTTATGCTTGGATAGGGCAAGATATACTTGGAATCTCACTGATAATCACGGTTCTTCAAATTGTCCGCGTACCAAATCTTAAGGTCGGGTTTGTTCTTCTCAGCTGTGCCTTCATGTATGACATCTTCTGGGTTTTTGTTTCAAAATGGTGGTTCCGTGAAAGCGTGATGATTGTGGTAGCCCGTGGTGACAGAAGCGGAGAGGACGGAATTCCAATGCTACTAAAGATCCCACGAATGTTTGATCCTTGGGGTGGCTACAGCATAATTGGATTTGGTGACATTATCTTACCAGGACTGCTTGTAACTTTCGCACTGAGGTACGACTGGCTGGCGAACAAGAGGCTAAAGTCAGGGTACTTCCTTGGGACAATGTCTGCTTATGGTCTAGGTCTTCTCATAACATACATAGCTCTAAACTTGATGGACGGACATGGGCAACCGGCTCTGCTTTACATCGTCCCATTCATACTAGGTACTTTGTTCGTGTTGGGTCACAAGAGAGGTGACTTGAAGACGCTGTGGACAACAGGGGAACCCGACAGGCCATGCCCTCACGTTCGTCTTCAACCTCAATCGTCTTAA >AT1G05820 ATGTCTTTACCTCCGTTTACTTGCCGCCTTCTCGCGGCGGCGGCGGCTCTCTATCTGATAGGTCTGCTGTGCGTCGGAGCTGACACGAAAGATGTTACCGCTCCCAAAATTCCTGGTTGCTCCAATGAATTTCAAATGGTCAAAGTTGAGAATTGGGTCAACGGAGAAAACGGTGAGACTTTTACCGCCATGACTGCACAGTTTGGCACCATGCTCCCGTCTGATAAAGACAAAGCTGTTAAACTTCCGGTTGCTCTTACCACTCCTTTGGACAGTTGCTCCAATTTAACTTCAAAGCTATCTTGGTCTATAGCGTTATCTGTACGTGGCGAGTGTGCTTTCACAGTTAAGGCTCAAGTTGCACAGGCAGGAGGAGCTGCAGCTTTGGTGTTAATTAACGACAAAGAAGAGCTTGATGAGATGGTTTGTGGTGAGAAAGATACCTCCTTAAATGTTTCTATACCTATTTTGATGATTACAACGTCATCTGGAGATGCCCTGAAGAAATCCATTATGCAAAATAAGAAAGTGGAGCTTTTATTGTATGCTCCAAAGAGCCCAATTGTGGATTATGCAGTGGTCTTCCTCTGGCTAATGTCTGTTGGAACAGTTTTTGTTGCTTCTGTTTGGTCACATGTTACCAGTCCGAAGAAGAATGATGAGCAGTACGATGAATTATCACCCAAGAAATCTTCGAATGTTGACGCTACCAAAGGTGGTGCTGAAGAGGAAACTCTTGATATTAGTGCTATGGGTGCTGTTATCTTTGTCATATCAGCGTCCACATTCCTCGTTTTGCTCTTCTTCTTCATGTCATCGTGGTTTATCTTGATCCTGACCATATTTTTCGTCATTGGTGGTATGCAGGGAATGCATAATATTAACGTTACACTCATAACAAGGAGATGCAGTAAATGTGGCCAGAAGAATTTAAAACTACCTCTGCTTGGGAATACCTCGATTCTCTCACTCGTGGTTCTGTTATTCTGCTTTGTGGTTGCTATCCTCTGGTTTATGAATCGCAAAACTTCGCACGCATGGGCCGGGCAAGATATTTTTGGTATTTGCATGATGATTAATGTCTTGCAAGTAGCTCGGCTACCTAATATCAGGGTTGCTACCATTCTTCTCTGTTGTGCATTTTTCTATGACATCTTTTGGGTATTCATATCACCACTAATCTTCAAGCAAAGTGTAATGATTGCGGTTGCACGTGGGAGCAAAGACACTGGAGAATCTATTCCCATGCTTTTGAGAATTCCACGGCTTTCTGATCCATGGGGTGGTTACAACATGATCGGTTTTGGAGACATTCTTTTCCCGGGCCTTCTCATATGCTTTATTTTCAGATTTGACAAGGAAAATAACAAGGGGGTCTCGAATGGATATTTTCCGTGGTTGATGTTTGGCTACGGACTTGGCCTCTTCTTAACATACTTGGGATTGTATGTTATGAATGGACACGGTCAACCTGCATTGCTATATCTTGTCCCTTGCACGCTCGGAATCACGGTCATTCTAGGGTTGGTGAGGAAAGAACTCAGAGACTTGTGGAACTACGGGACTCAACAGCCTTCAGCTGCAGACGTAAATCCATCTCCAGAAGCATAA >AT1G63690 ATGGATTCGCTTCGATTTCTCCGGATTCTTCTTCTATCATCTTCGATTTTACTCTTATCTCTCCGTTCTACAGTCACCGCCGGTGATATTGTTCATCAAGACAATTTAGCTCCGAAGAAACCAGGTTGCGAGAATGACTTCGTTTTGGTGAAAGTTCAAACGTGGATTGATGGTGTTGAGAATGAGGAGTTTGTGGGGGTTGGCGCTAGATTTGGGAAGCGGATAGTTTCCAAGGAGAAGAATGCAAACCAGACTCACCTTGTTTTTGCAAATCCTCGTGATTCTTGTACACCGCTCAAGAACAAGCTTTCTGGAGATGTTGTTATTGTGGAACGGGGCAACTGTCGGTTCACAGCAAAGGCGAATAATGCAGAAGCTGCTGGTGCCTCTGCTCTGCTCATCATCAATAATCAGAAAGAACTTTACAAAATGGTTTGTGAACCGGATGAAACTGATTTAGATATACAGATTCCTGCCGTCATGCTCCCGCAAGATGCTGGTGCATCCTTGCAAAAGATGCTAGCCAACAGTTCTAAAGTGTCGGCGCAGCTTTACTCCCCAAGACGACCAGCTGTTGACGTAGCTGAAGTCTTTTTGTGGTTAATGGCAATTGGTACCATTTTATGTGCATCTTATTGGTCTGCATGGAGTGCCCGAGAAGCAGCTATTGAACATGATAAGCTACTGAAGGATGCTATAGATGAAATCCCTAACACAAATGATGGGGGTAGTGGTGTTGTAGAGATCAATTCTATTTCAGCTATTTTTTTCGTAGTTCTTGCTTCGGGATTCCTGGTGATTCTTTACAAGCTTATGTCTTATTGGTTTGTGGAGCTTCTTGTGGTCGTTTTCTGCATTGGTGGTGTTGAGGGTTTGCAAACTTGCCTCGTCGCGTTACTATCAAGATGGTTCCAACGTGCTGCAGATACTTATGTAAAAGTCCCTTTCCTTGGACCTATCTCTTACCTCACTCTTGCAGTTTCTCCTTTCTGCATTGTCTTTGCTGTTCTATGGGCTGTATACCGAGTTCACTCCTTTGCTTGGATTGGCCAAGATGTTCTTGGTATCGCATTGATCATAACTGTACTACAGATTGTTCATGTCCCAAATCTTAAGGTCGGGACAGTTCTTCTCAGCTGTGCCTTCTTGTACGATATCTTCTGGGTGTTTGTCTCCAAGAAGTTGTTCCACGAAAGCGTAATGATTGTCGTAGCTCGAGGTGATAAGAGTGGAGAAGATGGCATCCCGATGCTACTGAAGATTCCGCGGATGTTCGATCCGTGGGGAGGCTACAGCATTATTGGATTTGGTGATATTCTTTTGCCCGGTTTGCTAATCGCATTTGCTCTCAGATATGACTGGCTAGCTAACAAGACTCTTAGAACCGGCTATTTTATATGGGCAATGGTTGCCTATGGATTAGGTCTTTTAATTACTTACGTGGCTTTGAACCTAATGGATGGACACGGCCAACCAGCATTGCTATACATTGTCCCTTTCACACTTGGAACCATGTTAACGCTGGCTCGAAAAAGAGACGATCTTTGGATTCTATGGACCAAAGGAGAACCAGAAAGAGCTTGTCCTCACCATGTCCGGCTTGAACAGTGTTCTGAGAAATGA >AT2G43070 ATGTCGTCGTTTGATCCGCCGAATCACCGATATTCAGCCTTAGTACTTATTCTTCTCCTGCTTGGTTTTTCGGTAGCGGCGGCCGACGATGTATCGTGGACCGAAGATTCCAGCCTCGAGTCTCCTGGCTGTACCAATAAGTTTCAAATGGTAAAGGTCTTAAATTGGGTTGATGGTGTTGAAGGAGACTTCCTTACTGGCTTAACTGCTCAATTTGGAGCTGCCTTGCCTTCTGTTCCTGATCAAGCTCTTAGATTTCCTGCTGCTTTTGTAGATCCTTTGGACTCTTGTTCCCATCTCTCTTCCAGGTTAGATGGACATATTGCCTTGTCGATCCGTGGCAATTGTGCTTTCACTGAGAAGGCCAAACATGCTGAGGCAGCTGGTGCTTCTGCTCTCTTAGTCATTAATGACAAAGAAGATCTTGATGAGATGGGATGTATGGAAAAGGACACATCTCTAAATGTGAGCATACCTGTCTTAATGATCTCTAAGTCAAGCGGAGATGCTCTCAACAAGTCTATGGTTGACAATAAGAATGTTGAGCTTTTGTTGTATGCTCCAAAGCGTCCTGCCGTGGACCTCACAGCTGGATTGTTATTGCTCATGGCTGTGGGAACTGTTGTCGTTGCATCACTGTGGTCAGAGCTTACAGATCCTGACCAAGCTAATGAATCTTACAGCATACTAGCAAAGGATGTTTCTAGTGCTGGGACCAGAAAAGATGACCCAGAGAAGGAAATCCTTGATATAAGTGTCACTGGTGCTGTATTTTTTATTGTAACAGCCTCCATATTTCTGCTGCTCCTTTTCTACTTCATGTCATCATGGTTTGTATGGGTGCTCACCATATTTTTCTGCATTGGCGGCATGCAGGGTATGCACAACATCATTATGGCTGTTATATTGAGAAAATGCAGACATCTTGCTCGGAAATCTGTGAAGCTCCCTTTGCTTGGAACAATGTCAGTGTTGTCGCTTTTGGTGAATATTGTTTGTTTGGCGTTTGCTGTTTTCTGGTTTATAAAACGTCACACATCGTATTCTTGGGTTGGCCAAGACATTTTGGGCATATGTTTGATGATCACTGCCTTGCAAGTGGTTCGATTACCTAACATCAAGGTTGCGACTGTACTTCTTTGCTGCGCATTTGTCTATGACATTTTCTGGGTCTTCATATCTCCATTGATATTTCACGAGAGTGTTATGATTGTGGTTGCCCAAGGAGACAGCAGCACTGGGGAGTCCATTCCGATGCTACTAAGGATTCCTCGGTTCTTTGATCCTTGGGGTGGTTATGACATGATTGGTTTTGGGGACATCCTCTTCCCCGGTTTGCTCATTTCCTTTGCTTCCAGATATGACAAGATAAAAAAGAGGGTAATATCAAATGGGTACTTCCTCTGGTTGACTATCGGCTATGGAATAGGTCTATTACTGACATACCTAGGTCTGTATCTTATGGACGGACATGGCCAGCCGGCACTATTGTACATCGTACCCTGCACACTCGGTTTGGCCGTCATACTGGGGTTGGTAAGAGGAGAGCTTAAAGAACTATGGAATTACGGTATCGAAGAATCAGAGTCTCACACACCGGAGGATCCAATGCCTGTGGCATAA >COL.COLO4_10186 ATGTTGGTTCCGCCGGGGATTCGATGCCGCTTTTCGGCTTCTCTTCCTTTAGTGTTTCTCGTGGCCATATCATTTTCTGTTGCTGTCATCGCCGACGGTGGCTCCCAACAAGATGGCCCCAAGTTACCTGGCTGTAACAATCCTTTCCTTTCGGTCAAGGTGAAGATGTGGGTTAACGGCAAGGAAGATGCTGATTTATCTGGGATATCTGCGAGCTTTGGAGCATCATTGCCTGAGGAAGCCAACAAAAGTCCCAAATTGCCCGCTGTTTTCTCAGATCCGCTTAATGGCTGTTCTAGTTCTTCTTCAAAGCTATCTGGCTCTGTAGCCTTGTCTACCCGTGGTGATTGTGATTTCACAACTAAGGCTAAAGTTGCACAGTCAGGAGGTGCTGCAGCCTTGCTGGTGATAAATGACAAAGAAGAGATTGATGAGATGGTTTGTTCTGGGAATGATACTTCTTTAAATATTTCAATACCTGTTGTGATGATTCGAAAATCTACGGGAGACAAAGTCAGCAAATATATGGCAGGAAACAAAGTGGAATTTTTATTATATGCACCAAGTAGTCCTCTTGTGGATATCACGGTGATCGTTTTGTGGACAATGGCCGTTACTACAATTCTCACTGCTTCACTTTGGCAAGAGTTTGGCACTTCTGAGAATGCTGATGAACGCTATAATGAATTATCACCAAAGGAATCTTCCAATTCTGGAGGTGACGATGATAAGGAAATCCTTGATATTAGTGTAAAGGGTGCTGTTGTTTTTGTCATATCAGCATCCACTTTTCTGGTGCTACTTTACTTTTTCATGTCTTCTTGGTTTGTCTGGCTGCTTGTTGTACTCTTCTGCCTCGGTGGTGTTCAGGGTTTGCATAATTGCATCATGACACCTATATCAAGAAATTGTTCACAGAAGACACTGAAATTGCCTCTCTTTGGGGAGGTTACAATCATCTCACTCGTGGTTGCAATATTCTGTGTGATATTTGCTGCTGTGTGGGCTGTCAATCGGCAAGGAGAAGGAGCATTTTCATGGGTGGGCCAAGATATTCTTGGTATCTGTTTGATGATAACGGTCTTACAGTTGGCTCGACTACCTAATATCAAGGTTGCTACAGTGCTTCTCTGTTGTGCATTTGTGTATGACATCTTCTGGGTCTTCCTTTCACCACTTATATTCCATGAGAGTGTAATGATTGCAGTCGCTCGAGGCGACGGTATTGGTGGAGATTCAATTCCCATGCTCTTGAGAGTTCCTAGACTCATGGATCCGTGGGGTGGTTATAATATGCTTGGATTTGGAGACATTCTCTTTCCTGGTTTGCTTGTTTCATTCGCTTACAGATATGATAAGGACAACAAGAAGCGTCTTGTCAATGGATATTTTCTATGGTTGATAATTGGCTACGGATTTGGCCTCTTCTTGACATACGTAGCGTTATATCTGATGGATGGGCACGGTCAACCTGCGCTTCTCTATCTTGTTCCTTGTACACTAGGGGTTACTGTCGTATTAGGTTTGGTGAGAGGAGAACTGAAAGGACTTTGGAATTACAGCCCAGAGTCATCGTCTTCCGCGACAAATCCCTCCGGTGAAGCTTGA >COL.COLO4_12719 ATGGCTGTCATTAAACCTGAGATGATGAAGTCTTATATTTGGCTTCAAACTGCCGATGGCTCAATCCAACAAGTCGAACAAGAGGTTGCAATGTTTTGCCCCCTGATATGTCATGAAGTGATACAAAAGGGCATGGGATCCTCCAAGAATTATGCTATATCTCTTCCGCAGCGAGTCAATCCTGCTATGTTAAGTCTAATTCTTGATTATTGCCGGTTTCATCAAGTGCCTGGTCGCTCTAACAAGGAACGCAAGTCTTTTGATGAAAAGTTCATTCGAATGGACACAAAGAGGCTCTGTGAGTTGACATCTGCTGCTGACAGCCTTCAGTTAAAGCCTCTGGTTGACCTTACTAGTCGTGCCCTGGCACGAATTATTGAGGGGAAGACCCCTGAGGAGATACGTGAGATATTTCATTTGCCTGATGATCTTACTGAGGAAGAAAAATTGGAGCCTTTGAAAAACACAACTGATGACCCACGCATTAGACTTTTGAATAGATTGTATGCAAAAAAAAGGAAGGAACTAAAAGAGAGAGAAAAACTAAAGAATGTTGAGGTTGAAGAAGAGCGCGTGGACGATCGTTCAGTTGATGATCTCTTGTCATTTATAAATGGAGGCAATGGAGATTCTAAAGGGATTAAATCTTCAAAGAGTAAAAAGAAGAACCGAAAAAGAAAAGATCAGCAGAAGAGTGCGTCTGCCAATGAAGGAACTAAAAACCATGATAAGGAGGCGAATGGTCTCAACTCTGTATGCCATAGTGCCGAAGGAGGTCAGAAAATTCGGCCCAGTATTGGTGCTACCTCAAACATACAGGATGTTGAAGATGATATATTTGCCAATAAGAATGAGTTTGATGATGGTGATATTGATGACGAGATTGATCCAGCGTTGAAGGAAAAAATAGACAGGGAGGTGGAAGATTTTGCCCGTAGATTAAATTCAGATTGGCCGGAAAGAATGCAAGAAATTCTCTCTTTGGGTCAAGAAAGGAAACCGGTGCATTTTTCGCTTAATGGAAATGGTTCGGATGCAATTTTGATTGTGAGGGCAACACCTCTTTGTATTTTCATCATAATAGAAAGAAATAAGAAGGGAACTGTGTTTTGGGGTGTATTTATAGTAATCTTAATAGTTGTTTTGAGTGCTGGTTTGGGGTCAGCTGGGGACATAGTTCATCAAGACAACGTTGCTCCCAAGAGACCTGGTTGTTCTAATAACTTTGTTCTGGTAAAAGTCCCAATATGGATTAATGGTATAGAAGAAATTGAGTATGTTGGTGTTGGTGCTCGCTTTGGACCTACACTGGAATCAAAGGAAAAACATGCGAACCATACAAAACTTGCTCTTGCAGATCCTCCTGATTGTTGCAGCACACCTAGGAATCAGCTTACAGGGGAGATCATTCTGGTACATCGTGGTAACTGTAGTTTCACAGAGAAGGCAAATGTTGCTGAAGAAGCTGGTGCTTCTGCTATCCTCATAATAAACAACCAAACAGAACTGTTCAAGATGGTTTGTGAATCCGATGCTGATGTAGATATAAAAATACCAGCTGTCATGCTCCCTCAAGATGCTGGTGCAAATTTGGAAAAATATATAAATAACAATACCAGGGTTTCCGTTGCGCTTTACTCTCCAAAGCGTCCGGCAGTTGATATTGCCGAAGTTTTTCTGTGGCTGATGGCTGTTGGTACCATTTTGTGTGCTTCTTATTGGTCTGCGTGGACAGCAAGAGAAGTTGCTATTGAGCAAGACAAGCTTCTGAAGGATGCCTCGGAAGAATTTTTACAATCAGGATCTGTAGGTTCGAGTGGTTATGTTGACATAAATACAATGTCAGCAATTCTCTTTGTTGTGATTGCTTCATGTTTCTTGGTCATGCTTTACAAGCTTATGTCATTCTGGTTTGTTGAGATTCTGGTGGTTCTGTTTTGCATCGGTGGAGTAGAGGGCCTGCAAACGTGCTTGGTGGCTTTATTATCATGTTTCAGGTGGTTTCAACGCTTTGCAGAATCATTCATTAAAATACCCTTCTTTGGAGCTGTTTCGCATCTAACACTGGCTGTTTGCCCCTTCTGCATAGCATTTGCTGTTGTTTGGGCAATCTATCGCCGTATCTCCTTTGCCTGGATAGGTCAAGATATTCTTGGTATTGCACTTATAGTCACAGTTCTTCAGATAGTTCGTGTACCAAATCTCAAGGTTGGAACAGTTCTTCTGGGTTGTGCATTCATGTATGATATCTTCTGGGTGTTTGTTTCCAAATGGTGGTTTCATGAAAGCGTGATGATAGTAGTAGCCCGTGGTGATAAGAGTGGAGAGGATGGCATACCGATGCTACTAAAAATTCCACGGATGTATGATCCTTGGGGTGGCTACAGTGTTATTGGCTTTGGAGACATAATCTTACCTGGATTGCTTGTGGCATTTTCACTAAGATATGATTGGCTGGCAAAGAAGAGTCTTCGAGCTGGGTACTTTGTATGGGCGATGACTGCTTACGGTTTAGGTCTTCTCGTCACGTATATCGCCTTGAACATGATGGATGGACATGGCCAACCAGCTTTGCTTTACATTGTTCCTTTCACACTTGGAACCTTCATTACATTGGGAAAGAAGAGAGGTGATCTCAAAATTCTCTGGACCAGAGGAGAACCAGAAAGGCCTTGTCCGCACGTTCAACTTCAACCCTTACAACAAAAAGAATAA >COL.COLO4_34477 ATGGATTTGCAGAGTCTATGCAGAGTAATCTTTGTATCGGCTCTGATTTCACTTGTCTGTCACCCATGTTCTGTCACCGCCGGTGATATAGTACACGACGATAATTTAGCTCCAAAGAAGCCCGGTTGTGAGAACGACTTCGTTCTGGTCAAAGTTCAAACTTGGGTTAATGGCATAGAGGATGCTGAGTTTGTTGGTGTAGGTGCTAGATTTGGTACTACTATAGTGTCAAAGGAGAAAAATGCAAACCAAAGACGCCTTGTTCTTTCTGACCCTCGTGATTGTTGTAGTCCACCAAAGAATAAGCTTGCTAATGATGTCATTATGGTGGACCGAGGCCGCTGCAAATTCACAACAAAGGCAAATAATGCAGAGGCAGCTCATGCTTCAGCTGTCCTCATTATAAATAACCAGAAAGAACTCTACAAGATGGTATGTGAGCCTGATGAGACTGATCTAGATATACACATACCTGCTGTCATGCTCCCACAAGATGCTGGTACAAGCTTGGAGAAGATGCTGATTAGTAATTCATCAGTGTCCGTACAGCTTTACTCTCCCAAGCGACCACTAGTTGACATAGCCGAAGTGTTTCTATGGTTGATGGCAGTTGGCACCATATTGTGTGCTTCGTATTGGTCTGCATGGACTGCAAGAGAGGCTGCTATTGAACAGGACAAACTGTTGAAGGATGCATTGGATGAAATCCCGGATACCAGACATGTAGGTTCTGGTGGTATTGTAGACATCAACACCACATCGGCCATCTTATTTGTTGTCATAGCTTCTTGCTTCCTGGTTATGCTTTACAAACTTATGTCATTCTGGTTTGTTGAGCTCTTGGTGGTTCTTTTCTGCATAGGTGGTGTGGAGGGCCTTCAAACTTGCTTGGTCGCCTTATTGTCCAGGTGGTTCAAGCGCGCTGGAGAATCATACATCAAAGTGCCTTTCTTTGGAGCTATCTCTTACCTTACATTGGCCGTTTCACCTTTCTGCATAACATTTGCTGTTGTTTGGGCTGTTTACCGCAATGTCTCCTTTGCTTGGATAGGTCAAGATATACTCGGAATTGCGTTGATAATCACAGTTCTGCAAATTGTCCGTGTACCTAATCTCAAGGTGGGAACAGTTCTCCTCAGTTGTGCCTTCTTATATGACATCTTTTGGGTGTTTGTTTCTAAGAAGTTGTTCCACGAAAGTGTGATGATTGTGGTAGCTCGTGGTGATAAAAGTGGAGAGGATGGCATTCCCATGCTATTGAAGATCCCACGCTTGTTTGATCCATGGGGTGGTTATAGCATAATAGGATTTGGCGACATTCTTTTACCTGGACTGCTGATAGCATTTTCACTCAGGTATGATTGGCTGACAAACAAGACACTTCGAGCTGGATACTTCCTGTGGGCAATGTTTGCTTATGGGTTAGGTCTTCTCATTACGTACGTGGCACTAAATTTAATGGACGGACATGGTCAACCAGCACTCCTTTACATTGTACCTTTTACACTAGGAACCTTTTTGACATTGGGACGAAAGAGAGGCGATCTACGAGTTCTCTGGACAAAAGGAGAACCAGACAGACCTTGCCCACATATCCGACTCGAACACCAACATAGTGGTGAGTTGAGTGAGGATTAG >Vradi04g11540 ATGATTTTCTTTATTGACTGGCTGCCTACCTGCCTGCAGGTGAAGGTGGAGAACTGGATTGATGGTGTGGAAGGACGTATTTATAATGGCGTCACTGCCAGATTTGGCTCTCTTTTGCCTGAGAAACCTGAAAACAGTGTCAGAACTCCTGCAATTTTCTCTAATCCTGTAGACTGCTGTTCCAATTCAACTTCAAAGTTGTCTGGATCAGTTGCTCTCTGTATACGTGGGGGTTGTGACTTTACAGTCAAAGCTGAATTTGCACAGTCTGGAGGTGCTACTGGCATGTTGGTAATAAATGACGCAGAAGATCTCTTTGAGATGGTTTGCTCCAATAGCAGTGAGGCAAACATTTCAATTCCAGTTGTAATGATAACAAAGTCAGCAGGAGAAGGTCTCAACAACTCTTTAATATCTGGGAGGAAAGTGGAAATTTTGTTATATGCTCCACCTCGCCCACTTGTTGACTTCTCAGTTGCATTTTTGTGGTTGATGTCTGTCGGAACAATTGTATGTGCTTCTCTATGGTCGGATTTTACTTCTCCAGAGAAGACTGATGAACGCTATAATGAATTATGTCCCAAGGAATCGTCCATTGCTGAAACAGCCAGAGATGATTTTGACAAGGAAATTGTTCATATCGATTCAAAGGGTGCCATCATATTTGTCATAGCAGCGTCTAGCTTTCTTGTGCTATTGTTTTTCTTCATGTCATCTTGGTTTGTCTGGGTGCTGATTGTACTTTTCTGCATAGGTGGTATTGAGGGTATGCACAATTGTATCGTAAGCCTGACTGTAAGAAAAGGCCGAAGTTGTGGTCAGAAGACAGTGAGCGTGCCTCTATTTGGGGAGACTTCTATTTTCTCACTGGTAGTATTGTTATTTTGTGTGGCATTTGCAATTTTCTGGGCTGCTACAAGACAGGAGTCATATTCATGGATTGGCCAAGATATTCTTGGCATCTGTTTGATGATAACAGTCTTGCAGTTGGCTCGATTACCTAATATTAAGGTAAAAGTATGTACTTTTGGGAAAGTAATTGATTTGTGTGGATGCTCTTTGGATGGACGAAACCTTGCAGAGGTGATACATGCTTATTTGCTGGAGCATGAATGGAGGGAAATGGTAGATGGTTGGTACATGATGGTGAGTTCTGCAACTGGTTTGGGATGCAATTCTGAAGTTGTTGCTCGAGGTGATAAGGCAGGTGGAGAGGCAATTCCAATGCTTTTAAGATTTCCTCGTCTTTTTGATCCCTGGGGAGGTTATGACATGATTGGATTTGGGGATATTCTCTTTCCTGGGTTGCTTGTTTCCTTTGCTCATAGATTTGACAAAGATAATGGGAGGGGAGCATCAAATGGATATTTTCTTTGGCTGGTAATTGGATATGGCATTGGCCTCGTTTTCACATATTTGGGGCTATATCTTATGAACGGAAATGGACAACCTGCTCTTCTCTACCTTGTTCCTTGTACACTAGGTGTCACTGTCATATTGGGATGTATAAGAGGTGAGTTGAAGAACCTTTGGAATTATGGCACTGACCCATCATTGTCAACAGATCATTCTGAAGTTTAA >Vradi08g23290 ATGCTCTCCTCTTCTTTGCCGGCGGCAATCCTCCTTCTCTTCTTCTCCGTCGCCGCGGCCGCCGCCGACGAAGACCCTTGCAATCGCGTATCGCAATTGGTTAAGATACAGAGCTGGATTGATGGGAAGGAAGATGAAGAGTACAATGGTATGAGTGCAAGATTTGGCTCTTATTTGCCTGTCGAAGCTGTTCAAACTGCCAAACTTCCCGCTGTTTTTGCCGATCCTATGGACTGCTGTTCCGCTTCAACCGTAAAGTTATCTGGATCAGCAGCTCTCTGCGTACGAGGAACTTGTGACTTCTCAGCTAAAGCTGTAGTTGCACAGACCGGAGGTGCTGCTGCCGTGTTTATTATAAACGACGCAGATGAACTCTTTGAGATGAACTGCGCCAGTGACCAAAGCGTAAATATTTCAATTCCAGTTGTGCAGACAACAAAGTCAGTAGGAGACGCTCTCAACAAACTTTTAACATCTAAAAAGAAAGTGGAGGTTTTGCCGTATGCTCCAACTCGCCCAGTTGTAGACTACTCGGTTGCATTTTTGTGGCTGATGGCTGTTGCAACAGTTATATGTGCTTCATTATGGGCAGATATAACTACTCCAGATCAAATCGATGAACGCTACAACGAGTTGTCTCCCAAGAGCGCTATGTCGGAGGCAGGGAAAGACGATTCTGAGGAAATAGTTAACATAGATACAAAGGGTGCTGTCGTGTTTGTCATTACGGCATCTACTTTTCTCGTGCTACTGTTCTTCTTCATGTCGTCTTGGTTTATCTGGGTGCTGATTATACTTTTCTGCATTGGTGGTATTGAGGGGATGCACAACTGTATTGTAAGCCTCGGTTTAAGGAAACGTCCAACTTGTGCTCAGAAGAATGTGAATTTACCTTTCTTTGGAGAGGTTTCTATTTTCTCGCTGATAACGCTGCTATTCAGCGTGACATTTGCCGTTTTATGGGTTGTATTTCGGCACGAATCATTTTCATGGTTTGGCCAAGATCTTCTTGGCATCTGTTTGATGATAACAGTATTACAGATGGCTCGGTTGCCTAATATTAAGGTTGCAACGGTCCTACTTTGTTGTGCATTTGTATACGACATTTTTTGGGTATTCATATCTCCAGTGATATTCCAAAAGAGTGTCATGATTACAGTAAGTCTTTGTTTATACTGGTATAGTTCTTTAACTTGGATTGGTGCGTTGCAGTTTGGACCTCCAATATCCCTAATCGTATACCCAAACCATCCTGTTCTTTCATTTCCGGTTGCTCGTGGTGACAAAGCTGGTGGTGAAGCAATTCCTATGCTTTTGAGATTCCCTCGTCTAAGTGATCCTTGGGGTGGCTATGATATGATTGGATTTGGAGATATTCTCTTTCCCGGTTTGCTTGTATCCTTTTCTCGTAGATTCGACAAAGATCTTAAGAAGGGGGTCGTAAGCGGATATTTTCTTTGGTTGGTAATTGGCTATGCCTTTGGGCTGTTCTTCACATATCTGGGGCTATATTTGATGAACGGCCATGGACAACCTGCACTCCTCTACCTTGTTCCGTGCACACTAGGAGTCGCTGTGGTATTGGGATGCAAAAGAGGTGAGCTAAGTGTCCTTTGGAATTATGAAGCAGACTCGTCTTCGTCTTCCTCCAACTCCAACAATACCTCCACGCCCGACACCAAACAGCCTCCCCAGGTTTAG >Vradi09g04460 ATGGTTTCAGTTGGAGCTGTTCATAGTGTGGTGTACGTGCTCCTGCTTTCAGTCACTTTGGTTTTGGGTGGGGACATAGTTCACCATGATGATGTTGCCCCCATAAGGCCTGGTTGTGACAACAACTTTGTTTTGGTAAAAGTCCCAACTTGGATTGATGGTGTGGAAAAAAGTGAGTATGTTGGTGTTGGTGCAAGATTTGGCCCTACGTTGGAATCAAAAGAAAAACGTGCCAATCTTACCAGAGTTGTCATGGCTGATCCTCCTGATTGTTGTACAAAGCCTAAGAATAAACTCACGAGTGAGATAATTTTGGTGCACCGAGGAAAGTGCAGTTTTACTACAAAGGCGAATATTGCTGATGAAGCTGGTGCTTCAGCCATCCTCATTATAAACTACCGTACAGAACTTTTCAAGATGGTTTGTGAAGAAAATGAAACTGATGTTGATATAGGAATACCTGCTGTCATGCTTCCCCAAGATGCTGGATTGACTTTGGAAAGGCATATTAAAAATAACTCCAATGTGTCCATACAGTTATACTCTCCATTGCGTCCATTGGTTGATGTTGCGGAAGTGTTTTTGTGGCTTATGGCTGTTGGTACCATTTTATGTGCTTCATATTGGTCTGCCTGGAGTGCTAGAGAAGCAGCTATTGAGCAAGAGAAGCTTTTAAAGGATGCTTCGGATGACTATACTAATACAGAAAATGTTGGTTCCAGTGGTTATGTGGAAATTAGTACCATAGCAGCAGTCTTATTCGTCGTGATTGCTTCATGTTTCTTGGTTATGCTGTATAAATTAATGTCATTCTGGTTTGTTGAAGTTCTGGTGGTTCTGTTTTGCATTGGCGGGGTAGAGGGACTGCAAACTTGTTTGGTGGCCCTATTATCATGTTTTAGATGGTTTCGCCAACCTGCCCAGACATTTGTGAAGATACCCTTCTTTGGAGCTGTCTCATATCTGACACTTGCTGTTACTCCATTCTGCATAGTGTTCGCTGTGGTTTGGGCGGTTTGTCGCCGTGCATCATGGGCTTGGATTGGTCAAGATATCCTTGGTATCACATTGATAATTACAGTTCTTCAGATTGTTCGCATACCAAATCTAAAGGTTGGGACTGTTCTTCTCAGTTGTGCATTCCTATATGACATCTTCTGGGTGTTTGTCTCTAAATGGTGGTTCCATGAGAGTGTGATGATAGTGGTAGCTCGTGGTGATAAGAGTGGAGAAGATGGCATTCCCATGCTTCTCAAGATACCTCGTCTATTTGACCCTTGGGGTGGTTACAGTATCATTGGATTTGGGGACATAATCTTACCAGGACTTATAGTGGCATTTTCACTAAGGTATGATTGGTTGGCAAAGAAGAACCTTCGTGCCGGATACTTCTTATGGGCAATGACTGCTTATGGTTTAGGTCTCCTCATCACGTATGTGGCCTTGAACTTGATGGATGGGCATGGTCAGCCAGCTTTACTTTATATAGTTCCATTTACACTTGGCACCTTTTTGTCATTGGGAAAAAAGAGAGGTGAGCTCAAGATTTTATGGACAAGAGGGGAACCAGAAAGGCCTTGCTGTCATATCCAAGAGGATAATCAATCAATTAACAGTCACCATTGA >Vradi11g02120 ATGGTTTGCGATCCTGATGAAACTGATTTGAACATACATATACCTGCAGTCATGCTTCCACTAGATGCGGGTGCAAGACTAGAAAAAATGCTGACAAGTACTTCATCTGTGTCGGTGCAGCTATACTCACCACGTAGACCACCTGTTGACATAGCAGAAGTATTTCTTTGGATGATGGCAGTTCTTACCATATTGTGTGCATCATATTGGTCAGCTTGGACAGCCCGAGAAGCAGCTATTGAACAGGATAAGCTCCTAAAGGATGCTTCAGATGAAATCCCTAACACTAAATATGCTAGTGTTAGTGGAGTTGTAAATATGAACGTGAAAGCTGCAGTCCTTTTTGTTGTATTTGCTTCATGTTTCCTGTTTATGCTTTACAAACTGATGTCGTCGTGGTTCATTGATGTTTTGGTTGTTCTCTTCTGCATTGGTGGGATTGAGGGATTACAAACTTGCTTGGTTGCTCTTTTGTCCAGGTGGTTCAAGCATGCTGGAGAGGCATACATCAAAGTACCTTTCTTGGGATCTATCTCATACCTGACTTTGGCTGTTTCTCCATTCTGTACAACATTTGCCGTTCTTTGGGCAGTTTATCGTAACAATTCCTTTGCCTGGATTTGTCAAGATATACTTGGAATTGCACTGATTATAACAGTTCTACAGATTGTACATGTACCAAATCTCAAGGTTGGTACTGTTCTTCTCGGCTGTGCTTTCATCTACGACATCTTTTGGGTGTTTGTCTCAAAGAAGTTCTTCAAGGAAAGTGTCATGATTGTGGTAGCCCGAGGTGATCGAACTGGAGAAGATGGAATTCCAATGTTACTAAAGTTCCCACGTATTTTTGATCCATGGGGTGGCTACAGCATCATAGGTTTTGGAGACATCCTTTTACCTGGAATGCTGGTGGCATTCTCACTCAGGTACGATTGGCTGGCAAACAAGAGCCTTAGAGGTGGATATTTCTTGTGGGCAATGTTTGCATATGGCTTTGGTCTTTTAGTTACGTATGTGGCACTAAACTTGATGGACGGACATGGCCAACCAGCACTACTATACATCGTTCCATTTACCCTTGGAACCTTGATGACATTGGGGAAGAAGCGAGGAGATTTGAAAGGTTTGTGGAGAAATGGAGAACCTCAAAAACACTGCCCACATTTAAGACTCCAAAACAGTGAAGAATTAAGCCCTGAATGA >UGI.Scf00036.4084 ATGGGAATTGATTCATGGGGCTCTACTTGGGTTTTCTGGTCTGTGCCGGGATGTTTTGTTCTTCTCCTACTTGAAAGCTGTGTGGTGTTTGCCAGCGACATAGTTCACCCGGATGAGAATGGCCCGAAGAGGCCTGGGTGTGATAACAACTTCGTACTGGTAAAAGTGCCAATCTGGATCGATGGGAAAGAGGAAATGGAGTTTGTTGGAGTTGGAGCTAGATTTGGTCCCACTTTGGAATCAAAGGAAAGGCGAGCAAACCAAACAACTGTTGCGTTTGCTGAACCACTTGATTGCTGCAGTAAGCCAAGGAATAAGTTGACAGGTGAGGCTATCTTGGTGTACCGAGGAAACTGCAGTTTTGTTACAAAAGCAAATGTTGCAGAAGATGCTGGTGCTTCAGCTCTAATCATTATAAACAACCAGACAGAACTCTTGAAGATGGTTTGTGATGAAAATGAGACTGATTTGACGATTGGTATACCTGTTGTCATGCTTCCACAAGATGCTGGCCAGAGCTTGAATCAGAGCATGTCTACAAACTCACATGTATCCATCCAAATTTACTCCCCAAAGCGCCCATTGGTTGACGTTGCTGAAGTTTTTCTTTGGCTAATGGCTGTTTCTACCGTCTTATGTGCTTCTTATTGGTCTGCATGGAGCGCCAGAGAAGCAGCCACTGAGCTAGAGAAGCTCCTGAAGGATGATACTGATGGGTACTCTACAAGAGTGGAACGTCATTCAAGTGCTGTTATAGACATCAGTACAACCTCCACAATTGCTTTTGTGGTGATCGCATCATGTTTCTTGGTTATGCTCTACAAGCTGATGTCCCATGTCTTCATTGAGATACTCGTTGTTGTATTCTGCCTTGGTGGCTTTGAGGGTTTGCTAACTTGTCTAGTGGCTTTGCTATCACGTTTCCGATTGTTCGAACGTCTTGCCGAATCTTATGTCGAAGTACCATTGCTTGGGCCTGTATCTTATCTTACAGTAGCCACTGCCCCATTTTGTGCCATAGCAGCAGGTTTATGGGGAGTGTTCCATACATTTCCTTACGCATGGATCGGCCAGGACATACTTGGGATTGCATTGATAACCACCGTGCTCCAGATCGTGCGAGTCCCAAACCTTAAGGTGGGAACACTCCTGCTCTCCTGTGCATTGTTGTATGACATATTCTGGGTGTTCGTATCGAAATGGTGGTTCCACAGGAGTGTGATGATAGTGGTAAGTCTCCATTCCCAGACCATGGATTGGGAGCTCATTGATCCTCGCTTCCACCCCTTCATTTCCCTTGTCCCGCAGGTGGCTCGTGGCGACGGAAGCGGGGAAGACGGCATCCCGATGCTCCTCAAGATCCCCCGGTTGTTCGACCCCTGGGGTGGCTACAGCATCATTGGATTTGGCGATATCATCTTGCCTGGACTGGTAGTTGCATTTTCACTGAGGCACGATTTTCTTTCTCGTAGAGGTTTGAAATCTGGGTACTTCCTCTGGGCGATGCTCGCCTACGGTTTCGGTCTTCTGGTTACATACGTGGCCCTGAATCTGATGGACGGCCATGGCCAGCCGGCGTTGCTGTACATCGTTCCGTTCACTCTAGGCACGCTGATCACGTTGGCGAACAAGAGAGGGGAGCTGAGTCATCTATGGAGCATGCGAGGAGCCGGCGGGGGTGTCGCCGCCGGTGGCCGGTGCCCACACGTCCGGCTTCAGCAGGAGGAAGAAGGCAGCAAAGTGAAGTCCTAG >UGI.Scf00038.4240 ATGGGGTTGTACTTGGGTTTTCTGGTCTGTATTCAGCTGCTCGGTTGTGGTTTTGTGGTGTTGTTAGAGGGGTTTGAGGTAGGGTTATGTGGGTGTGCTGAAATCTGTGTTGATTCGTCCCGGCGATGTGCGTGTTTCATGTATCCTGCCTTGCCCTTTTTGAGTTGGATCAATTACTTCGTAGGGTGTATTGGGATTCTGATACTGCAAAGCGGTGTGGTGTTCGCTGGCGACATAGTTCACCAAGATGAAAATGGCCCGAGGAGGCCTGGATGTGATAACAATTTTGTGCTGGTAAAAGTGCCAATCTGGATCGATGGCAAAGAGGTAATGGAATTTGTTGGAGTTGGAGCTAGATTTGGACCGACTTTGGAATCCAAGGAAAAGCGAGCGAACCGAACAACGGTTGCTTTTGCTGAGCCACTCGATTGCTGCAGTAAGCCAAGGAATAAGTTGACTGGTGAAGCTATTTTGGTGTACCGAGGAAATTGCAGTTTTGTTACAAAAGCAAATGTCGCAGAAGATGCTGGTGCTTCGGCTTTAATCATTATAAACAATCAGACAGAACTCCTGAAGATGGTTTGTGATGAAAATGAGACTGACTTAACGATTGGTATACCTGTTGTCATGCTTCCACAAGATGCTGGTCAGAGCTTGTATCAGAGCATGTCTGCAGACTCACATGTATCCATTCAAATTTACTCTCCGAAGCGCCCATTGGTTGATGTTGCCGAAGTTTTTCTTTGGCTAATGGCTGTTTGTACCATCTTATGCGCTTCTTATTGGTCAGCATGGAGTGCCAGAGAAGCAGCCACTGAGCTGGAGAGGCTCCTAAAGGATGACTCCGATAGATACTTTACGAAAGAGGAGCGCTATTCAAATGCTGTTGTAGACATCAGTACAGCCTCCACACTTGCTTTTGTGGTGATTGCATCTTGTTTCTTGGTCATGCTATACAAGCTGATGTCTCATGTTTTCATGGAGATCCTTGTGATTGTATTCTGCCTGGGAGGCTTTGAGGGCTTGCTCACTTGTCTAGTAGCTTTACTGTCACGTTTCCGATGGTTCGAATCTGCTGCCGAATCATATGTTGAAGCACCTTTTCTTGGTCCGGTATCACATCTTTCATTAGCCATTGCTCCATTTTGTGCCGCTGCAGCAGTTCTATGGGCAGTGTTCCGTACGTCTCCTTTGGCATGGATCGGTCAGGACATACTTGGGATTGCACTGATAACCACCGTCCTCCAGATTGTACGAGTCCCGAACCTCAAGGTGGGAACACTCCTGCTCTCCTGTGCATTGCTGTATGACATATTCTGGGTGTTCGTGACGAAGTGGTGGTTCCATAAGAGTGTGATGATAGTGGTTGCTCGCGGCGACGGAAGTGGGGAAGATGGCATTCCGATGCTCCTCAAGATCCCCCGTTTGTTCGACCCTTGGGGCGGATACAGCATAATTGGATTTGGAGACATCATCTTGCCTGGATTAGTAGTTGCATTCTCCCTCCGGCATGATTTCCTGTCTCGTAAAGGGTTGAAGGCCGGGTATTTCCTTTGGGCGATGCTCGCTTACGGCTTCGGTCTGCTAGTTACGTATGTGGCTCTGAATCTGATGGATGGCCACGGCCAGCCGGCGTTGCTGTACATCGTTCCGTTCACTCTAGGCACGCTGATCACGTTGGCGAACAAGAGAGGCGAGCTGAATCATCTATGGAACATGCGAGGATGCGGCGGTGTCGTCGCCGGCGGTCCTTGCCCACACGTCCGGCTTGAGCAGGAGGAAGCAAGAAAGACGTAG >UGI.Scf00040.4374 ATGGCTGTGTCTTCGGCCTTGCGGTTGTCTTTTGGATTAGCTCTCGTGCTGCACCTGGGACTTGCCTTGTTTTTTCTGTCATCGGCAGTGGCTGCGAATGAGGTGTCGCGTCCTGCTCCAAACGGGGAGTCTGATGTCTGCCGAAATGATTTCCGATTGGTTAAGGTGAAAAGATGGGTAAATGGGGTTCGAAAAAAGTCATTTGTGGGTCTGAGTGCGGATTTTGGCTCCATATTGCCCTCTCAAGCTAATGACGCTCATAGAATGCCAGCTACTTTTTCGAAACCCTTGAACAGTTGTTCAGCCTCTTCTTCCAAGCTAACAGGCTCTATTGCTTTGGCTTCACGTGGTGATTGTGCCTTTACAACTAAAGCAGAAGTTGCACAGGCTGGAGGGGCTGTTGGATTGTTGGTTATAAATGATGAAGACGATATTGTGCAGATGGGTTGTGGAAAGGAAACTGCTTTAAATATTTCAATACCTGTTGTCATCGCCTCAAAGTTGGTAGGAGAGAAACTGAAGAACTTAATGGATGAAGGGTTGAAAGTGGAACTTCTTCTATACTCTCCGGATAGACCTATTATGGACTACTCAGTCATATTTATCTGGCTGATGGCTGTCGTAACTGTAGTTTATGCATCACTTTGGCCTGAAATCGCTGGAATGGGGAGTATCGTAGAGGAACACAGCGAAGTTTTAGAAAGGGATTTTTATTCTCTTCCCGATGATGGAGAGAAGGCAATCTACCATATCAATACAAAAAGTGCTATTTTTTTTGTCATTGTTGCGTCAAGTTTCCTGCTATTACTCTACTTCTTTATGTCACCATGGTTTGTCTGGTTGCTCATCGTACTTTTCTGCATCGGGGGCATTGAGGGAATGCATTTTTGCATTATGTCATTGGTGTTGAGCAGCCAATACAGAGGTTGTGCACAGAAGAAGTTGAACGTGCCTCTCGTCGGAGAAATTTCAGTTCTGTCTCTAGTTGTTCTCATAGCCTGCATAGTTTTAACCGTCATTTGGGCTGCCAACCGTAAATCATCGAACTCTTGGATGGGCCAAGACATTCTTGGTATATGTTTGATGATAACTGTTCTGCAATTCGCTCAGCTACCAAACATCAAGGTTTCAACTGTGCTTCTGTGTTGTGCATTTGCATACGACATCTTTTGGGTCTTCTTATCTCCTCTTATATTCCATGACAGCGTAATGATTGCGGTTGCACAAGGTGATAAGAGCGGTGGAGAGTCCATACCCATGCTCCTGAGGGTTCCTCGGATTGGTGACCCTTACAATGGTTATGACATGATTGGCTTTGGGGACATCTTGTTCCCTGGTTTGCTGGTGTCCTTCGCCCGCAGATTTGACAAATCCTGCAAGAAGAGCATATTCAATGGGTACTTCCTGTGGTTGTCAATTGGCTATGGAGTGGGCCTTGTGTTTACTTACTTGGGGCTGTATTTGATGAATGGCCATGGTCAACCTGCTCTTCTATACTTGGTGCCATGCACTCTGGGAACTTGCATCATACTAGGGTTGATAAGAGGAGAGCTGAAGCAACTTTGGAGCCACGGTGACAACTCCAGACAAGTCTCCGTTCCCCCCCATGGGGAGCTTGATGCACCACTCAGCCTGGACTCCAACCACACACGAGCGTGA >UGI.Scf00196.11204 ATGAGACCACAGATAGTTTTGTTCGGAGACTCAATAACACAGCAGTCATTCGCACCAGGGGGTTGGGGTGCAGCACTTTCTGACATTTACTCCAGAAAGGGAACAGGTTCACCTCCTCTTGCAGTGACTATATTTTTTGGGGCTAATGATGCTGCTCTTGTGGAGGGTACAGGAAAAAGGCAGCATGTGTCTTTAAAAGACTACAAGGAAAATTTGAGAAGCATTGTTCAACATATCAAGGGTCGTTCCTCAAAGACACTTATCATTTTAATAACTCCACCTCCAATTGATCGTGAGGGGCGCCTAGAATATGCAAGGCATGAGCAGCATCAATTGTTTCGTTTGCTTATGCAAGTGCCCGATCGCACGAATGATGTGACAGGAGCATATGCAAAGGAGTGTACTGCTCTAGCAAACGAGCTCGGTGTGCAGTGCATAAATTTATGGTCTCAAATGCAGAAAACCGAGGGTTGGGAGAAGAAGTACTTGAGTGATGGGCTACACCTGACCCCGGAAGGAAATGCATTTGTCTTTGAAGAACTCAGAGCGATCTTCGATAGAGCTGGCATAGCAGACCTTCCCTATGACTTCCCTCCGTATTCTGATATTGATGAAGAAAACCCTGAAAGATCATTCGGTCCAAAACCACCCGCGTCACATGCCAACTTCAAAGCGACAGGGAAAGAGGATCGGTCGTTTGCGATGGCTGTCGTTCCTAATTTTCTAACTTCTGGTGGATTGCACATTGGGTTAACCTTGTTGTTCTTCTCATCCTTCGCCACCGCAGCTCCCACCACCTGCAGACGTGATTTCCCTTTGATGAAGGTGAATGTCTGGGTAAATAGAGAGGAAAAGGAGCCAATTGTCGGATTATGCGCAGGATTTGGTTCTCTATTGCCCCAGGATGATGAAAATGCCCAAAGATTGCCGGCTTCATTCACAAAACCCTTGAATAGCTGTTCCGTGCTATCAAACAAGATGCCAGGCATGATTGCTTTAGCTGTACGTGGTGAATGTGAGTTCACGGATAAGGCATTAGTTGCTCAAGAAGGGGGAGCAGCTGCGTTAGTGGTGATCAATACTGATGAAGGTCTTCTAGAAATGGGTTGTGGAAACAAGACTGATTTGAACGTTGTAATTCCTGTTATTACATTATCCAAGTCAGGAGGAGAGGAACTTAACAAATCCTTAGTGCAGGGGAATAAAGTGGAACTTCTGCTCTATGCACCAATTCGACCAATTGTTGACTATTCAGTGGTATTCTTGTGGATGATGTCTGTTGGAACGGTGATTTCTGCTTCAGTTTGGTCTGAGATTGTTGTACCACAGCAACGTAATGGATACCTCAACGATTTATCACCAAAGGGATCTTCCTCTGGTGTAGCCAAGGACAATGAGGAGCAGGAAATCCTTTCTATTAGCACAAAAAGTGCTGTATTCTTTGTTATCAGTGCTTCAACTTTTCTACTTTTACTTTATTTCCTTATGTCGGTATGGTTTGTGTGGGTGCTGATTACCCTTTTCTGCCTTGGGGGAGTAGAGGTAAGGTGCGGAAGATGTAAGGGGCTTGCCGAAAAGGAACTTAATTTATGGATTTTAGGAAATGTTTCGGTTCTCTCCCTGGCAGTTTTGATATTCTGTGTAATGTTTGCAATCATCTGGGCAGTAACGAGAAAAGCATCGTTTTCTTGGATTGGCCAAGATATCCTTGTTGCAACAGTACTCCTTTGTTGTGCATTTGTATATGACATCTTTTGGGTTTTCCTATCCCCACTGATCTTCCGTGATAGTGTTATGATTGCGGTTGCACGGGGTGATAAAAGTGGTGGAGAATCAATTCCCATGCTTCTAAGAACTCCTCGGCTTTTCGATCCTTATTATGGCTATAATATGATAGGCTTTGGTGACATTCTCTTCCCTGGTTTGCTAGTCTCCTTTTCTTTTAGGTTTGATAAAGCACAGAAAAAGGGAATGCTCAATGGATATTTTCTCTGGTTAATTATTGGCTATGGAACTGGTCTCTTCCTGACTTACCTAGGCTTGTACTTGATGAATGGGCATGGCCAGCCAGCTCTTCTATACCTGGTTCCATGTACATTAGGGACTTGCGTTTTGTTGGGACTGGTGAGGGGAGAACTGAAGCAACTCTGGGGCTATTCAGCCGAATCGAGTGAGGCAACTGCTCACAGCGAAGCTATCTAA >UGI.Scf00326.21246 CAGGTTAAAGTACCAGTTTTCGTTGATGGTAAACAAGTGAAGGAGTTTGTAGGTATTGGCGCTCGTTTTGGACTTACCTTGGAGGCAACGTATAGAAGTTCAAACCAAGCTACAGTTCAGCTGATAGACCCTTCTGACGGTTGCTCTACACCTTTGAATCAGATTGCAGGAGATATTGCCATGGTGCACCGAGGGAATTGCAGCTTTGTCACGAAAGCAGAATTCGCAGAGGATGCTGGTGCTTTGGGTATACTGATCATAAACAACCAAAGAGAACTCTTCAAGATGACTTGTGGATCAAATGAAACTAATGTGAACGTTACAATACCTGTGGTCATGCTTCCAGTAGATGCAGGCGAAATACTGCTAGAGATCATGCAAAACAGCACACAAGTTTCCGTTCAAATGTACTCTCCTCAGCGCCCCATGGTTGATCTTGCTGAAGTTTTTTTATGGCTGATGGCCATTTCCACCATCATATGCGCATCTTATTGGTCTGCCTGGAGTACAAGAGAAGCAGCTGAAGAACAGGAAAAGCTTCTAAAGGATGGCTCCAATGAATTCATCAGCAAGTATGCGCACAGTTTCAACAGCACCTTAGACATCACAGTCACCACTGCTATTCTCTTTGTCGTGATCGCATCTTGTTTCTTGCTTTTGCTCTACAAATGGATGTCGAACTGGTTCATTGACATTCTTGTGGCTGTTTTTGCCATTGGTGGTTTCGAGGTTGCTCAAGGTGTTGGCAGTGGCGAAGATGGGATTCCGATGCTTCTAAAATTGCCTCGTGTACATGATCCATGGGGCGGATACAGCATCATAGGCTTCGGGGACATCATTCTACCAGGACTACTTGTTGCCTTTTCACTAAGGTATGATTGGCTCTCTAAAAACACCCTCAGGACCGGCTACTTCATCTGGGCGATGATTGCATACAGTTTAGGTCTTCTAGTAACATATCTGGTTCTAACCTTGACCAATGGGAAGGGGCAACCAGCACTGCTGTATATTGTCCCATGCACATTAGGCACGCTAATGACATTAGCAAAGAAGAAAGGCGAACTGGGACGTTTATGGACACAGGGAGAGCCAGACCGGTATTGTCCACACATTAAGCTTCAGCCGGATGAGCAATGA >PGSC0003DMG401012338 ATGGATTTTCTGAGAATTACTTCTCTAATTTTCATCTGTGGAGTTCTACTGAACTTTCCTGCTATAGTTACAGCTGGTGATATTGTTCATGATGATGACTTAGCTCCCAAGAAGCCTGGTTGTGAGAATGATTTTGTGCTGGTGAAAGTTCAAACTTGGATTAATGGGGAAGAGGATGCAGAATTTGTTGGTGTTGGTGCTAGATTTGGCACTACTATTGTGTCAAAGGAGAAAAATGCACAACAAACTCCGCTTACTCTTTCTGACCCTCGGGATTGTTGCAAGCCTCCAAGGAAAAAGCTTTCTGGAGAAGTCGTCATGGTAGATCGCGGCCATTGCAAATTCACAACGAAGGCTAATAATGCTGAAGCAGCAGGGGCTTCGGCAATCCTGATAGTAAATAATGAAAAAGAACTCTACAAGATGGTTTGTGATCCTGGAGAAACTGACCTAGATATACACATACCTGCTGTTATGCTACCTCAGGATGCTGGAATAACGCTTAATAAAATGCTTTTAAATGGCTCATCAGTTACCGTGCAACTCTATTCTCCAAAACGACCAGTAGTGGACATTGCAGAAGTATTTTTGTGGCTGATGGCTGTTGGTACAATCTTGTGTGGTTCTTATTGGTCTGCTGGGAGTGCTAGAGAAGCAGCTATAGAGCAGGACAAGCTGTTGAAGGATGCTTCAGAGAAAGAGCTTCCAAATTTTGGAACTGGTGATTCAAGCACCGTGATGGATATAAACATGATATCAGCAGTCTTATTTGTTGTTGTTGCTTCTTGCTTCTTGATTGTTTTGTATAAGTTAATGAGGTTCACATGGTTCTTTGAAATTTTAGTGGTTCTCTTCTGCATCGGTGGTGTGGAGGGGCTACAAACTTGCTTAGTTGCCTTGCTAGCAAGGTGGTTTAAGCGTACGGGACAGTTATACATTAAAGTACCCATTTTTGGTGCAGTTTCTTATCTTACTTTGGCTGTTTCGCCATTCTGCATAACTTTTGCAGTGGTTTGGGCAGTGTACAGAAATTCTTCTTTTGGCTGGATAGGTCAAGACATACTTGGTATCGCACTTATAATTACAGTTCTGCAAATTGTGCGGATACCTAATCTCAAGGTTGGTTCAGTTCTTTTGGGTTGTGCCTTCATCTACGACATATTTTGGGTATTTGCTTCTCAGAGTCTCTTCCATGAAAGTGTGATGATTGTGGTAGCTCGTGGTGATAAAAGTGGAGAGGATGGTATTCCAATGCTGCTGAAGATTCCACGACTATTTGATCCATGGGGTGGTTACAGCATAATCGGCTTTGGTGACATCCTATTGCCTGGCCTGCTAGTAGCATTTTCACTTAGGTATGATTGGCTTGCAAAGAAGAATCTTCGAGCTGGTTACTTCTTGTGGGCGATGATTGCATATGGATTAGGTCTTCTTATAACATATGTAGCATTGAACTTAATGGATGGTCATGGCCAACCTGCACTTCTTTACATCGTCCCATTTACCCTCGGGACCTTTTTGATGCTGGGGAGAAAGAGAGGTGACCTGAAAATTCTTTGGACAAAGGGTGAACCAGAAAGGGTGTGCCCACATGTTTGTCTCATATCAATCGAAGAATCGAATCGAGAAGGATAA >PGSC0003DMG400011905 ATGACCGTCAAGGAGGAGGATGACAGTGAAATTCTGCACATTACTGCATGGACTGCTATTGGATTTGTCATCTCAGCATCCACATTTCTGGTGCTGCTTTACTTTTTCATGTCCACGTGGTTTGTCTGGCTGCTGATATTGCTTTTCTGTATCGGTGGAATCGAGGGACTGCATAACTGTATAGTGACGCTCATACTAAGCAAATTTAGAGGTTGTGGAAAGAAAACATTGAATTTGCCGCTTGTTGGGGAGGTCACTATTCTGTCTCTAGTTGTCCTAACACTTTGTGTGGGATTCGCCATCTTCTGGGCAGTAAACAGAAAAGAATCATACTCTTGGGTTGGCCAAGACATTCTTGGGATTGCTTTGATGATCACTGTTCTGCAGTTGGCTCAATTGCCTAATATAAAGGTTGCTACAGTGCTCCTCTGCTGCGCGTTTGTCTATGACATCTTCTGGGTTTTCCTATCTCCTGCTATATTCCATGACAGTGTTATGATTTCAGTTGCTAAAGGTAAGAAAGCTGGTGGAGAATCAATCCCGATGCTTCTGAGAGTTCCTAAATTAACAGATCCTTATAAAGGATTTGATATGCTTGGCTTTGGGGATATTCTCTTCCCTGGTTTGCTAATTTGCTTTACATACAGATTTGATGAAGCTAAAAAGAAGGGGGTACTAAATGGATACTTCCTTTGGCTGATGATTGGTTATGGGATTGGTCTTTGCATTACTTATGTGGGCTTGTTTTTGATGAATGGACATGGTCAACCTGCTCTCCTGTATCTCGTGCCATGCACATTAGGAACTTGTGTGGTACTGGGGGCAGTGAGACGCGAATTGAAAGACCTTTGGACCAATTGCGATGAATCAAAACAAATGGCTGAAGCGCGTCTAGGAAGTGCTTGA >PGSC0003DMG400004582 ATGGCATTTTCACGTCGGTTAATCGGAGTAAGCATTCTCAGTTGTCTTCTTCTGTTATCATCAACCGCTACCGGCGATGATGATATCTCACGCGCCGCCCCTGCTAATGCATCGAGGTCCTGTAACAATCCTTATCGAATGGTTCTGGTGAAGTTATGGATTGATGGTGCTGAGCATGAATCAATAGGTGGCTTAAGTGCGGCATTTGGATCTCTTTTATCCACTGATACTAAAAATTCCCCTAGATTGCCTGCTACTTATACAAAACCCTTGAATGGCTGTTCCAGCTCCTCTTTTAAGTTAACAGGCTCCATTGCACTAGCTCTTCGCGGTCAATGTGATTTTCTAACGAAGGCTATGGTTGCACAAGCAGGAGGTGCTGCAGGGATTGTGCTGATAAATGATCAAGAAGATCTTGTGGAGATGGCTTGTCCTAACAATTCTACGGTATCAAACGTAACAATTCCTGTTGTAACCATTTCAAAAGCCGGAGGAGATGTCATAGACAAGTATATCTCTGCTGGAAAGAAAGTGGAGATTATGCTTTATTCGCCAGATCGCCCCATTGTGGACTACTCAGCAATGTTCATATGGATGATGGCTGTTGGCACAATATTTTGTGCATCTTTTTGGTCGGAGTTTACTACATCTAAGGAAAACGATTTCAATGAACAGTCACCAGAGGTGATTGCTGGAGGTTCCAGGGAAGAAGATGACAAGGAAATTCTAAATATCACTACAAAGAGTGCTTTTGTATTTGTCATCACAGCGTCTACGTTTCTGTTGCTACTTTACTTTTTCATGTCTTCTTGGTTTGTCTGGCTGCTGATAATACTTTTCGCTATTGGTGGAGTTGAGGGAATGCATAGCTGTATAATATCCCTGGTATCGAGCAAATGTAAAGGTTGTGGAAGGAAGAAGTTGAATTTGCCGCTTCTTGGGGAGATTTCTGTTCTTTCTCTTGTGGTCTTGATATTATGTGTGGCATTTGCAATATCCTGGGCAGCAACTAGGAAAGCATCATACTCTTGGATCGGTCAAGATATTCTGGGAATTTGTTTGATGATAACTGTTCTGCAGTTGGCTCAGTTGCCTAATATAAAGGTTGCTACGGTGCTTCTGTGTTGTGCATTTCTATACGACATCTTTTGGGTTTTCCTTTCGCCTGCTATATTCCATGACAGTGTAATGATTGCAGTTGCCCGCGGTGACAAAGCTGGCGGAGAATCCATCCCAATGCTTCTGAGAATTCCTCGAGTATCAGATCCTTACGGTGGCTATGATATGATTGGTTTTGGGGATATTCTCTTTCCTGGTTTACTGGTTTGTTTTGCTTTCAGATTTGACAAAGCTAGAAAGAAGAATGTACTAAATGGATACTACATCTGGATGATAGTTGGTTATGGAATTGGTCTTTTATTCACATTCTTGGGGATGTACCTAATGAACGGTCATGGTCAACCTGCTCTCCTATATCTTGTGCCCTGCACGCTAGGAGTTTATGTGTTGCTGGGATTGCTGAGAGGCGAACTTAAAGACCTATGGAACTATGATAGCGAATCAACAAGAGTTGCAGACTCACTATTGGAAGACGCCTGA >MCO14G286 ATGGTTCGCAGGACCGCGATTTGTGCCATCGCTGCGATCGTTGTTCTCGCCACGGTCACGACGGTGAGCGGCCAGACCGTAGATGCCTGCCAGACGCGTTCGACACCCATCGGCGTGTCCATCACGGAGACGACTGCGGATGGGGAGTCGAACACCTTCCTCGGCTTGCTCGCGTTCTTCGGCGGTGCCGTCGGCGAGAGCGAAACTGCTCCGATGCATCTTGCGGTAGCTTCAGATAAGTACGGGTGCAAACCGATAGCACAGACTACGGACAAGGCGGTGCTCGTTTGGAGAGGGGGCTGCACGTTTGGCGAGAAGGCTGCCGCGGTGGAAGCGGCTGGTGGGGCTGCGATGATCGTTGTCACTGACGAAGCCGAGCTCACGCCGATGTCTTGCGTCGGCAACTCGACCGTCTCCATCCCCGTCATGCAGGTTCTCGCGCAGGATGGTGATCAACTGAAATCCGGCGCAGCCAAAGGGGCGAGCGTCACCTTCAAAGAGCTCAAGCTCAAGGGATCCGTGGATCTGGTCGCATCGTTTGCGCTGCTAGCGATGGCGTCACTGACCATCGTGTTTGGTGCCATATGGTCTCTTTCGGATCAAGGATTTCTGTTTAAACCAAAGTCAGACGATGATGCAAGTCAAGGCAGTGGCGGCGGACGCGAAGGTTCCGGAGGTGGGATCGAGGGACTTGAGATCACCGAGATGAGCGCGGCATACTTTGTCGTTTTCGCGTCCATCGTGCTCCTCGTGATTTTCTTCACGATGCAGCACTGGGTGTTCCTCATCATCAAGGGTGTTTTCTGCTTCGCTGCGGTGCAGGGGTTGCAAGCTCTTTTCTTCGCCGTGTTTGAATCGGGTTTCAAGGCGCTCTCGAAAGACATTGATATCCCCGTCTTTGGAACTGTGAACCAACTCTCTGTGCCGAGTGTTGCCTGTGCTGTTGTGGTGGTGCTCGTGTGGCTACTCAACCAGGATGCAACCTGGGCCTGGATGCTTCAAGATATCATGGGTATGTCGTTTCTGGTCAATGTTCTACGACTCGTTCACCTGCCAAACCTCAAGGTCGGCGCTCTCCTTCTTGTGGGTGCAATGTGCTACGATATCTTCTGGGTTTACATCCAACCTCATTTATTTGGCCGTGAGAGCGTCATGGTGAAGGTTGCAAAGGGAGGTGAGCAACACGAGTCGTTGCCGATGTTGTTCCTCTTTCCGAGGCTAGGAGGAAACGTCGGCGACTTCTCGATGCTCGGCTACGGTGACGTTATTCTGCCGGGTCTGTTGATTGTTCACAACCACCTCTTTGATAACCGGTACAACGAGTCGAGCAAGCCTCGCCTGGCGTACCTGGTGCCATCTATTGTGGCGTACGTCGCTGGTCTGCTGCTGACGTTCCTGGCGCTGCATCTGCAGGTCGGTGGTCAGGGAGGACAGCCTGCTCTTTGCTATCTGGTGCCGACCGTGCTCGGAGGCACCGTGGCTTATGCTCACTTCAGGGGAGACCTGAAAGAGATGTGGGTCGGATCGCAAGATGATGGCAACGACCCGGACGGTGAGGGGGAGCGGCTCATCGGGACCGGATCCACGAACAGCAGTGCCGTGTGA >Migut.N00438 ATGGCTGATCCTTCAGCTTATCAATTGTCCATTGTCTTAGTGGGGATTTTCTTTCTTGTCCTGCCATCAATCACCGCCGCGGACGACGCTTCTGCCCCTACTGGCGAAATCGCCAACTGCACCAACGATTTCCGATTGGTTAAGATCAACAGATGGGTAGATGGTGTTGAAAAAGAGCCAATAGGTGGGTTAACTGCTGATTTTGGCGCTATATTGCCTGCTCTCGCGAAACAAGGCAACAGATTGCCAGCTACTTTTTCAGCACCTCTAGATAGCTGTTCACTCTCCACGACTAAGCTATCAGGCTCTATTGCAATTGCTGTACGTGGTGAGTGTATCTTTACCGCCAAGGCTCAAATTGCACAAGCAGGAGGAGCGGCAGCATTAGTGATGATAAATGACGATGAAGGTCTTCTTCAGATGGGTTGTGGGAATGAGACTAATTTGAACATTACAATTCCTGTTATTACAATTTCTAAGTCAGGAGGAGAGGAACTAAAGAAATCCATGGATGGTGGAGCGAAAGTGGAACTTCTGCTATACGCTCCCAATCGACCAATTTTAGACTATTCAGTGATATTCTTGTGGATGATGGCTGTTGGAACCGTAGTTACCGCTTCACTTTGGTCGGAGATCACTGGATCGGAGAATAGTGATGAGCGCTATAATGAATTGTCACCGAAGGAATCTGATGCTGCAGCAGCAAAGCAGGAGGAAGACAAGGAAATCCTCCATATTAACACGAAAAGTGCTGTAGTTTTTGTTATAACGGCATCAACTTTTCTGCTGCTACTTTACTTTTTCATGTCTTCGTGGTTTGTCTGGGTGCTAATTGTACTTTTCTGCATTGGTGGTATTGAGGGAATGCATAATTGTATCGTTTCATTGGTGATGAGCAAATGCAAAGGTTGTCAAAAGAAGACGGTAAATCTGCCACTTCTTGGGGAGATGACCATTCTCTCTTTAGTTGTGTTGATATGCTGTCTGGTATTTGCCGTTGTCTGGGCTGCTAATCGGAAGGCATCTTACTCTTGGATTGGACAAGATGTTCTTGGAATTTGTATGATGTTAACCGTATTGCAATTGGCTCAATTACCAAATATAAAGGTCGCCACAGTACTTCTGTGTTGCGCATTCTTATACGACATATTTTGGGTTTTTCTATCTCCATATATATTCCATGACAGCGTTATGATTGCGGTTGCTAGAGGCGACAAAAGCGGTGGAGAATCGATCCCCATGCTTCTGAGAGTTCCTCGAATTGCCGATCCTTATGAGGGTTATAACATGATAGGCTTTGGGGATATTCTGTTCCCTGGTTTGCTAGTGTCCTTTTCTTTTAGATTCGACAAAGCTAATAAGAAGAGGATACTAAATGGGTACTTTCTATTTTTGACAATTGGCTATGGACTTGGTCTAGCATTTACGTACTTAGGGTTGTATTTGATGGACGGACATGGTCAACCTGCTCTCCTATACCTAGTCCCTTGTACATTGGGAACTTGTGTCGTGTTGGGTTGGATAAGAGGGGAGCTGAAACAACTCTGGAGCTACGGCACTTCTTCGGCAGATGCTACTGCTTCTGGAGAAGCTTGA >Migut.N01450 ATGGGGCTGATGAGCAGAGTTCTCTACACTACTTTCTGTGCTTTTCTGTGCAGTTCTGTCGTGTTTGCTGGTGATATTGTTCACCAAGATGATACCTCTCCCAAGAGACCTGGCTGCGAGAACAATTTCGTCCTGAGAAGATTAATTGAAGGAAAATTATATCAATTTCCTGCTTGGTTACTTCTTTCGATTCAAATTTACTCTCCAAATCGCCCGTTAGTCGATGTTGCCGAAGTGTTTTTATGGCTAATGGCTGTTGGGACTATTTTATTTGCGTCGTATTGGTCTGCATGGAGTGCTAGAGAAGTAGCTATTGAGCATGAAAAGCTCTTAAAGGATGGTTTCGACGAACGCCACCTCAGCAACGAGACGAGTAGTAACAGTAGCTTTGTGGATATTAATACAACCTCGGCGATTCTGTTTGTTGTGATCGCCTCGTGTTTCTTGGTTATGCTTTACAAGTTTATGTCTTATTGGTTCATCGAGATTCTCGTGGTTTTGTTTTGCATAGGCGGTGTGGAGGGTTTGCAAACTTGTCTAGTGGCATTATTGTCATGTTTCAGATGGTGTGAAGATGCTGCAGAATCATTTGTTAAGATTCCTGTTTTGGGAGAAGTGTCGTATTTGACAATAGCTGTTTCGCCTTTTTGCATAGTGTTTGCCGTTTTATGGGCGGTTTACCGCACTGTCTCGTTTGCTTGGATTGGTCAAGATATACTGGGCATTGCACTGATAATCACAGTTCTCCAGATAGTACGAGTTCCGAATCTCAAGGTGGGAACAGTTCTACTGAGCTGTGCATTCTTGTACGACATATTTTGGGTTTTCGTTTCGAAATGGTGGTTCCACAAGAGTGTGATGATAGTGGTAGCGCGTGGTGATGGAAGTGGAGAAGATGGGATTCCGATGCTTCTGAAAATTCCTAGGATGTTTGATCCGTGGGGCGGATACAGCATCATCGGATTCGGCGACATCATCTTACCGGGACTCATTGTCGCCTTTTCATTAAGGTACGATTTCTTGTGCAAGAGAAGTGTAAGATCCGGATATTTCTTGTGGGCAATGATTGCTTACGGTTTAGGTCTGTTAGTTACATATGTGGCTTTGAACTTGATGGATGGGCATGGCCAACCAGCTTTGCTTTACATAGTGCCATTCACATTAGGCACTCTGATAACGTTGGCGAATACGAGAGGCGATTTAAAGCAGTTATGGCACCGGGGTTTGCCTCGTACACCTTGTCCACATGTTCGTCTTCAACAAGACCAACAATGA >Migut.B01760 ATGGACAGAGTTGTCTACAGTTCTTTCTATGCGGTTACTCTGTTGTTTTGCTGCTCTATTGCGTTTGCAGATGATATAGTTCACCAAGATGATATTGCTCCAAAGAGGCCTGGTTGTGACAATGATTTTGTTCTGGTTAAAGTACCGGTTTGGGTAAATGGTAAAGAAATAATGGAATTTGTGGGCGTCGGCGCAAGATTCGGCCCCAATTTGGTATCGAAAGAGAAACGTGCTAACCAGACAAAAGTTACTCTCGCAGACCCTCCCGATTGTTGTAGTAAACCAAAAAATAAGCTGGTGGGGGATGTTATATTGGTTCACCGAGGCAATTGCAGTTTCGTCACCAAAGGAAATATTGCGGAAGCTGCTGGCGCTTCTGCTTTACTCATCATAAACAGCGAAAAAGAGCTCTTTAAGATGGTTTGTGAAGCGAACGAAACCGACGTAAGTATACGTATACCTGTTGTAATGCTCCCAAAAGATGCTGGTGTGAGTTTGAAACAAAACATGGCGAACACTTCGAACGTTTCAATTCAGATTTACTCACCGCAGCGCCCCGAAGTTGATGTGGCAGAAGTGTTTTTATGGCTAATGGCAGTCGGTACGATTTTGTGCGCGTCTTATTGGTCGGCTTGGAGTGCCAGAGAGGCAGCTATAGAGCAAGACAAACTATTAAAGGATGGTTGTGAAGAATACGTATGTGAAGAAAATTGTCACTCGAGCGGATTTGTGGACATCAATACAACCTCAGCTATCCTATTTGTTGTGGTCGCCTCGTGTTTCTTGCTTATGTTATACAAGTTAATGTCTTATTGGTTCATCGAGATTCTCGTCGTTGTCTTTTGCATAGGTGGCGTAGAGGGTCTCCAAACTTGTGTAGTGGCTCTATTATCATGTTTCAGATGGTTTGAGAATGCAGCAGAAACATTTGTTAAAGTACCTTGTGTGGGAGCTGTCTCACATTTGACGCTCGCTGTTTCTCCTTTCTGCATATCGTTTGCCGTTTTATGGGCACTTTTTCGCCACGTGTCCTTTGCATGGATTGGTCAAGATATACTCGGCATTGCATTGATAATCACTGTTCTCCAGATAATACGAGTTCCTAATCTGAAGGTGGGAGCAGTTCTGCTCGGTTGTGCGTTCTTGTACGATATATTTTGGGTATTTATCTCGAAATTGTGGTTCCACAAGAGTGTGATGATAGTGGTTGCTAGAGGTGACGGAAGCGGAGAAGATGGAATTCCGATGCTATTGAAAATCCCTCGAATGTTCGATCCTTGGGGTGGATATAGCATTATTGGATTTGGCGATATTATTTTACCGGGATTGCTCGTAGCATTTTCCCTCAGGTATGATTGGTTGTCCAATAAAAGCCTCAAAAATGGATATTTTCTCTGGGCAATGATTGCTTATGGTTTAGGTCTTCTGGTTACATATATTGCTCTAAACATGATGGATGGACACGGGCAACCGGCTTTGCTTTATATCGTTCCGTTCACGCTAGGTACATTGATAACGTTAGCGAAGAAAAGAGGTGATTTGAAGCATTTGTGGACGCGGGGAGAGCCCGATAGACCTTGTCCTCATGTACAACTTCGTCAAGACGAACAATGA >Migut.E01088 ATGATGGATTTGAAGGGGGTTTTCGGTTTAATTTTCTTATGGGCCGGTTTGCTGATTTTGTTAAGTAATACCGGCCGAGTTTACGCCGGTGACATAGTTCACGATGACAATTTGGCTCCCAAGAAACCCGGTTGTGAGAATGATTTTGTCCTGGTAAAAGTTCAAACTTGGGTAGACGGAATAGAAGATGAGGAATTTGTGGGTGTCGGTGCTCGATTCGGAACTACCATAGTATCCAAGGAGAAAAACGCTAACCAAACACACCTTTTCCTTTCAGACCCTAGAGACTGTTGTGGTCCTGCAAACAAGAAGTTTGATGGAGATATTTTAATGGTGGACCGAGGCAACTGCAAATTCACCACAAAGGCGAACTTTGCCCAAGCTGCGGGTGCTTCAGCTGTGCTCATCATAAACAACGAGAAAGAACTATATAAAATGGTGTGTGAGCCCGATGAAACCGATCTCGATATACACATTCCAGCTGTCATGCTCCCTCAAGATGCCGGTGCAACACTCGAAAAAATGTTGTCAAATGTCTCTGTGCAGCTTTACTCTCCGAGGAGACCAGTGGTCGATATAGCCGAAGTATTTCTTTGGTTAATGGCAGTTGGAACTATCTTGTGTGCCTCGTATTGGTCCGCATGGAGTGCCAGAGAAGCCGCCATCGAGCAAGATAAGTTTTTGAAGGACGCGCCAGATGAACTACCGAACATTAAAGGCAACAGTGGAAGCAGTGTGGTGGATATTAACACAACATCTGCAATCTTGTTTGTCGTCGTTGCTTCGTGTTTCTTGATTCTGATTTACAAACTGATGTCTTATTGGTTCATTGAGCTCTTGGTGGTTCTCTTTTGCATCGGCGGTGTAGAGGGCTTGCAGACTTGCTTAGTTGCCTTTCTATCAAGGTGGTTCAAGCAAGCTGGAGAATCGTTTATTAAAGTGCCCGTTTTCGGTGCCGTTTCGTACCTTACTTTGGCCGTTGCCCCTTTCTGCATAGCTTTTGCTGTGGTTTGGGCTGTGTACAGAGATGTCTCGTTTGCATGGATTGGCCAAGATATACTTGGAATTGCGCTGATAATTACGGTTCTTCAGATTGTGCGAATTCCTAATCTCAAGGTGGGTACGGTCCTATTAAGCTGTGCTTTCATCTACGACATATTTTGGGTGTTCGTTTCTAAGAAACTGTTCAAAGAAAGTGTGATGATTGTGGTAGCTCGTGGAGATAGAAGTGGTGAGGATGGTATACCGATGCTTCTGAAGATTCCACGGTTATTCGATCCGTGGGGTGGTTACAGTATCATTGGCTTTGGAGATATTCTCTTGCCTGGACTGCTTGTAGCATTTTCTCTTCGGTACGATTGGCTAGCAAACAAGAGCCTACGAGCTGGATACTTTTTGTGGGCAATGTTCGCTTATGGATTAGGTCTTCTTATTACGTACGTAGCACTGAACTTGATGGATGGTCATGGCCAACCCGCTTTGCTGTACATTGTCCCTTTTACCCTCGGGACGTTTTTGGCACTCGGGAGAAAGAGAGGTGATCTGAAGATTCTGTGGACAAGAGGTGAGCCGGATAGGGTTTGCCCACACGTTCGTCTTGAATCCACTCAAGAATCTCTCTGA >AL1G10720 ATGATCTTGTGGAAATCTCTCAGCTGTTTCTCGTTCGTCTTCGGCTTGTTGTTGTACAGTGCTAGTTTCGTTTCTGCTGGAGACATAGTTCACCACGACGATTCGCTTCCCCAGAGACCTGGTTGCAACAACAATTTCGTACTGGTGAAAGTCCCGACTCGAGTTAATGGGTCCGAATACACGGAGTTTGTTGGTGTTGGTGCTAGGTTTGGCCCAACCTTGGAATCTAAGGAGAAACATGCTACCCTCATCAAACTTGCTATTGCAGACCCTCCTGATTGTTGCAGCACTCCCAAAAATAAGCTTACAGGAGAGGTCATTCTTGTTCATCGTGGTAAATGCAGTTTTACCACTAAAACAAAGGTTGCTGAAGCAGCTGGTGCCTCCGCCATCCTTATCATAAACAACAGTACAGATCTTTTCAAGATGGTCTGCGAGAAGGGTGAAAACGTCTTAGATATAACTATTCCTGTTGTTATGCTACCCGTTGATGCTGGTAGAAGTCTGGAGGACATAGTCAAAAGTAACTCTCTAGTTACTTTGCAGCTATACTCACCGAAACGTCCAGCAGTTGATGTGGCTGAGGTCTTTCTCTGGCTTATGGCTGTCGGTACCATTTTATGTGCTTCTTATTGGTCTGCGTGGACCGTCAGGGAAGAAGCTATTGAGCAAGACAAGCTGCTAAAGGACGGATCAGATGAACTTTTGCAGTTATCAACCACCAGCTCTAGAGGTGTTGTTGAGGTCACCGTGATATCAGCAATTTTGTTTGTAGTGGTTGCTTCTTGTTTCTTGATCATGCTCTACAAGCTTATGTCATTCTGGTTTATAGAGGTGTTGGTGGTACTCTTTTGCATAGGTGGCGTAGAGGGGCTGCAAACCTGTTTGGTCGCCTTACTCTCATGTTTCAGATGGTTCCGCCGCTTTGGAGAATCATATCTCAAAGTTCCTATCCTGGGTGCTGTCTCATACTTGACTCTGGCTATATGTCCCTTTTGCATAGCATTTGCTGTATTTTGGGCAGTTAAACGCCAATACTCTTATGCTTGGATAGGGCAAGATATACTTGGAATCTCACTGATAATCACGGTTCTTCAAATTGTCCGCGTACCAAATCTTAAGGTCGGGTTTGTTCTTCTCAGCTGTGCCTTCATGTATGACATCTTCTGGGTTTTTGTTTCAAAATGGTGGTTCCGTGAAAGCGTGATGATTGTGGTAGCCCGTGGTGACAGAAGCGGAGAGGACGGAATTCCAATGCTACTAAAGATCCCACGAATGTTTGATCCTTGGGGTGGCTACAGCATAATTGGATTTGGTGACATCATCTTACCAGGACTGCTTGTAACTTTCGCACTGAGGTACGACTGGCTGGCGAACAAGAGGCTAAAGTCAGGATACTTCCTTGGGACAATGTCTGCTTATGGTCTAGGCCTGCTCATAACATACATAGCTCTAAACTTGATGGACGGACATGGACAACCGGCTCTGCTTTACATCGTCCCATTCATACTCGGTACTTTGTTCGTGTTGGGTCACAAGAGAGGTGACCTGAAGACGCTGTGGACAACAGGGGAACCCGACAGGCCATGCCCTCACGTTCGTCTTCAACCTCAATCGTCTTAA >AL1G15750 ATGTCATTACCTCCGTTTAGCTGCCGCTTTCTCGCGGCGGCCGTGACCCTCTATCTGATAGGTCTGTTGTGCGTTGGGGCTGACACGAAAGATGTTACCGTTCCCAACATTCCAGGTTGCTCCAATGAATTTCAAATGGTCAAAGTCGAGAATTGGGTCAATGGAGAAAACGGTGAGACTTTTACAGCCATGACTGCACAGTTTGGCACCATGCTCCCGTCTGATAAAGACAAAGCTGTTAAACTTCCGGTTGCTCTTACCACTCCTTTGGACAGTTGCTCCAATTTGACTTCAAAGCTATCTGGTTCTATAGCGTTATCTCTACGTGGCGAATGTGCTTTCACAGCTAAGGCTGAAGTTGCACAGGCAGGAGGAGCTGCAGCTTTGGTGTTAATAAACGACAAAGAAGAGCTTGATGAGATGGTTTGTGGTGAGAAAGACACCTCCTTAAATATTTCTATACCTATTTTGATGATTACAACATCATCTGGAGATGCCCTGAAGAAATCCATTATGCAAAATAAGAAAGTGGAGCTTTTATTGTATGCTCCAAAGAGCCCAATTTTGGATTATGCAGTGGTCTTCCTCTGGCTAATGTCTGTTGGAACAGTTTTCGTTGCTTCTGTTTGGTCACATTTTACCAGTCCGAAGAAGAATGATGAGCAGTACGATGAATTATCACCCAAGAAATCTTCAAATGATGACGCTACCAAAGGTGGTGCTGAAGAGGAAACTCTTGATATCAGTGCTATGGGTGCTGTTATCTTTGTCATATCAGCGTCCACATTCCTCGTTTTGCTCTTCTTCTTCATGTCATCGTGGTTTATCTTGATCCTGACCATATTTTTTTGCATTGGTGGTATGCAGGGAATGCATAATATTATCACTACACTCATAACAAGGAGATGCAATAAATGTGGCCAGAAAAATGTAAAACTCCCTCTGCTTGGGAATACCTCAATTCTCTCACTCGTGGTTCTGTTATTCTGCTTTGTGGTTGCTATCCTCTGGTTTATGAAGCGCAAAACTTCGTATGCATGGGCCGGCCAAGATATTTTTGGTATTTGCATGATGATTAATGTCTTGCAAGTGGCTCGGCTACCTAATATCAGGGTTGCTACCATTCTTCTCTGTTGTGCATTCTTCTATGACATCTTTTGGGTATTCCTATCACCACTAATCTTCAAGCAAAGTGTAATGATTGCGGTTGCACGTGGGAGCAAAGACACTGGAGAATCTATTCCCATGCTTTTGAGAATTCCACGGCTTTCTGATCCATGGGGTGGTTACAACATGATCGGTTTTGGAGACATTCTTTTCCCGGGCCTTCTCATATGCTTTATTTTCAGATATGACAAGGAAAACAACAAAGGAGTCTCGAATGGATATTTTCCGTGGTTGATGTTTGGCTACGGACTTGGCCTTTTCTTAACATACTTGGGATTGTATGTGATGAACGGACACGGTCAACCTGCATTGCTCTATCTTGTCCCTTGCACGCTCGGAATCACGGTCATTCTCGGGTTGGTTAGGAGAGAACTCAGAGACTTGTGGAACTATGGGACTCAACAGCCTTCAGCTGCAGATGTAAATCCATCTCCAGAAGCATAA >AL2G11540 ATGGATTCGCTTCGATTTCTCCGGATTCTTCTTCTATCATCTTCGATTTTACTCTTATCTCTCCGTTCTACAGTCACCGCCGGTGATATTGTTCATCAAGACAATCTAGCTCCGAAGAAACCAGGTTGCGAGAATGACTTCGTTTTGGTGAAAGTTCAAACGTGGATTGATGGTGTTGAGAATGAGGAGTTTGTGGGGGTTGGGGCTAGATTTGGGAGGCGGATAGTTTCCAAGGAGAAGAACGCAAACCAGACTCACCTTGTTTTTGCTAATCCTCGTGATTCTTGTACACCGCTCAAGAACAAGCTTTCTGGAGAGGTTGTTATTGTGGAACGTGGCAACTGTCGGTTCACAGCAAAGGCGAATAATGCAGAAGCTGCTGGTTCCTCTGCTCTGCTCATCATCAATAATCAGAAAGAACTTTACAAAATGGTTTGTGAACCGGATGAAACGGATTTAGATATACAGATTCCTGCCGTCATGCTCCCTCAAGATGCTGGTGCATCCTTGCAAAAGATGCTAGCCAACAGTTCAAAAGTGTCGGCTCAGCTTTACTCCCCAAGACGACCAGCTGTTGACGTAGCTGAAGTCTTTTTGTGGTTAATGGCTATTGGTACCATTTTGTGTGCATCTTATTGGTCTGCATGGAGTGCCCGAGAGGCAGCTATTGAACATGATAAGCTACTGAAGGATGCAATAGATGAAATCCCTAACACAAATGATGGGGGTAGTGGTGTTGTAGAGATCAATACTATTTCAGCTATTTTTTTCGTAGTTCTTGCTTCGGGATTCCTGGTGATTCTTTACAAGCTTATGTCTTATTGGTTTGTGGAGCTTCTTGTGGTTGTTTTCTGCATTGGTGGTGTTGAGGGTTTGCAAACTTGCCTCGTCGCGTTACTATCAAGATGGTTCCAACGTGCTGCAGATGCTTATGTAAAAGTCCCTTTCCTTGGACCTATCTCTTACCTGACTCTTGCAGTTTCTCCTTTCTGCATTGTCTTTGCTGTTCTCTGGGCTGTTTACCGAGTTCACTCCTTTGCTTGGATTGGCCAAGATGTTCTTGGTATCGCATTGATCATCACTGTACTACAGATTGTTCATGTTCCAAATCTTAAGGTCGGTACAGTTCTTCTCAGCTGTGCCTTCTTGTACGATATCTTCTGGGTGTTTGTCTCGAAGAAGTTGTTCCACGAAAGCGTAATGATTGTTGTAGCTCGTGGTGATAAGAGTGGAGAAGATGGCATCCCGATGCTACTGAAGATTCCGCGCATGTTTGATCCGTGGGGAGGCTACAGCATTATTGGATTTGGTGATATTCTTTTGCCCGGTTTGCTAATCGCATTTGCTCTCAGATATGACTGGTTAGCTAACAAGACTCTTAGAACCGGCTATTTTATATGGGCAATGGTTGCCTACGGATTAGGTCTTTTAATTACTTACGTGGCTTTAAACCTAATGGATGGACACGGCCAACCAGCATTGCTCTACATTGTCCCTTTCACTCTTGGAACAATGGTAACGCTGGCTCGAAAACGAGGCGATCTTTGGATTCTATGGACAAAAGGAGAACCAGAAAGGGCTTGTCCTCACCATGTCCGGCTTGAACCGTGTTCTGAGAAATGA >AL4G41720 ATGTCGTCGTTTGATCCGCCGAATCACCGATACTCTTCCCTAGTATTGATTCTTCTTCTGCTTGGTTTCTCGGTAGCGGCGGCCGAGGATGTATCATCGTGGACCGAGGATTCCAGCCTCGAGTCTCCTGGCTGTACCAATAAGTTTCAAATGGTAAAGGTCTTAAATTGGGTTGATGGGGTTGAAGGAGACTATCTTACTGGCCTAACTGCTCAATTTGGAGCAGCCTTGCCTTCTGATGCTGATCAAAGTCTTCGATTTCCTGCTGCTTTTGTAGATCCTTTGGACTCTTGTTCCAATCTCTCTTCCAGGTTAGATGGACGTATTGCCTTGTCGATCCGTGGCAATTGTGCTTTCACAGAGAAGGCAAAACATGCTGAGGCAGCTGGTGCTTCTGCTCTCTTGGTTATTAATGACAAAGAAGATCTTGATGAGATGGGATGTATGGAAAAGGACACATCTCTAAATGTGAGCATACCTGTCTTAATGATCTCCAAGTCAAGCGGGGATGCTCTCAACAAGTCTATGGTAGACAATAAGAGTGTTGAGCTTTTGTTGTATGCTCCAAAGCGTCCTGTTGTGGACCTCACAGCTGGATTGTTATTGCTCATGGCTGTGGGAACTGTTGTCGTTGCATCACTGTGGTCAGAGCTTACAGATCCTGACCAAGCTAATGAATCTTACAGCATATTAGCAAAGGAATTTCCTAGTGCTGGGACCAGAAAAGATGACCCAGAGAAGGAAATCCTTGATATAAGTGTCACTGGTGCTGTATTTTTTATTGTAACAGCCTCCATATTTCTGCTACTCCTTTTCTACTTCATGTCATCATGGTTTGTATGGGTGCTCACCATATTTTTCTGCATTGGCGGCATGCAGGGTATGCATAACATCATTATGGCAGTTATATTGAGAAAATGCAGACATCTGGGTCGGAAATCTGTGAAGCTCCCTTTGCTTGGAACAATGTCAGTGTTGTCGCTTTTGGTGAATATTGTTTGTTTGGCGTTTGCTGTTTTCTGGTTTATAGAACGGCACACATCGTATTCTTGGGTTGGCCAAGACATTTTGGGCATATGTTTGATGATCACTGCCTTGCAAGTGGTTCGATTACCTAACATCAAGGTTGCTTCTGTACTTCTTTGTTGCGCGTTTGTCTATGACATTTTCTGGGTCTTCATATCACCATTGATATTTCACGAGAGTGTTATGATTGTGGTTGCCCAAGGAGACAGCAGCAGCGGAGAGTCCATTCCGATGCTACTAAGGATTCCTCGGTTCTTTGATCCTTGGGGTGGTTATGACATGATTGGTTTTGGGGACATCCTCTTTCCCGGTTTGCTCATTTCCTTTGCTTCCAGATATGACAAGATAAAAAAGAGGGTAATATCAAATGGGTACTTCCTCTGGTTGACTATCGGCTATGGAATAGGTCTGTTACTGACATATGTAGGTCTGTATCTTATGGACGGACATGGCCAGCCTGCGCTATTATACGTCGTACCCTGCACACTCGGTTTGGCCGTCATACTGGGGTTGGTAAGAGGAGAGCTTAAAGAACTATGGAATCACGGTAGTGAAGAATCAGAGTCTCACACAACGGAGGATCCAATGCCTGTGGCATAA >GSVIVG01031676001 ATGGCGTCTCTCCGCCTCCTCGCGATCCCTCTTCTCTTCCTTCTTGTCGCCCTGCCATTGGCTGCCGCCGACGATGCCTCCGACCAGGACGATTCCGGCCCTAAATCCCCCTTCTGCAACAACACCTTCCAATTGGTCAAGGTTAAGAACTGGGTTGATGGCAAGGAACATGAAAGTTTAGTTGGGTTAACTGCAAGATTTGGTGCTTCTTTGCCTACTGAAGCTCATGATCATCTCAGACTACCTGCTGTTTTTTCAAATCCCATGAACTGCTGTTCTGATTCTTCTTCAGAGCTTTCGGGCTCTATTGCTTTGTCCACACGTGGGGATTGTTCCTTCATGGCTAAGGCAAAAGTTGCACAGTCAGGAGATGCTGCAGCCTTGTTGGTGATAAATGACAAAGAAGATATTTACAAGATGGTTTGTTCTGAAAATGATACCATTGTAAACATTACAATTCCTGTCGTGATGATTCCAAAGTCGGGAGGAGATACACTCAGCAAATCTATAGCAGATGGAAAGAAAGTGGAACTGCTATTATATGCGCCAACTCGTCCAGTCGTAGATTCTGCGGTAGTATTCTTATGGATGATGGCTGTTGGAACTGTTGTCTGTGCTTCACTTTGGTCAGAGTATATTGCATGTGAGCAGAATGATGAGCGCTATAATGAATTGTCACCAAAGGCTTCTGAAGCTGGGGCAACGAAAGATGATCCAGAGAAGGAAGTTCTTGATATTAGTGCAAAGGGTGCTGTAGGTTTTGTCATAACAGCATCCACTTTTCTGGTGCTGCTTTACTTTTTTATGTCATCATGGTTTGTTTGGGTGCTGATTGTACTCTTTTGCATCGGTGGTGTTGAGGGAATGCATGCTTGTATAGTTACTCTGATACTAAGAGGATGCAAAAATAGTGAGCGGAAGACCGTGAATTTGCCTCTTTTTGGAGAAGTTACTGTTCTTTCTCTTGGGGTGCTATTGTTCTGTCTGTCATTTGCTATCGCCTGGGCGATAACTCGTAAGGCATCATTTTCGTGGATCGGACAAGATGTGCTTGGTATTAGTTTAATGATAACAGTTTTGCAGATAGCTCGATTGCCTAATATCAAGGTTGCTTCTGTACTTCTTTGTTGTGCATTTGTTTATGACATCTTCTGGGTCTTCATATCACCAGTAATATTCAAAGACAGTGTTATGATAGCAGTTGCTCGTGGTGACAACAGTGGTGGAGAATCCATTCCCATGCTGTTGAGAGTTCCTCGTTTCTTTGATCCTTGGGGTGGTTATGATATGATTGGCTTTGGGGACATTCTCTTCCCTGGTTTGCTCATTTCATTTGCTTTCAGATTTGACAAAACAAATAAAAGGGGCATGACAAATGGATATTTCCTTTGGTTGGCAATTGGCTATGGATGTGGTCTCTTGTTTACCTACCTAGGCTTATATCTGATGAATGGGCATGGTCAACCTGCACTCCTCTATCTTGTTCCATGTACTCTAGGTGTCACTATTATTTTGGGTCTGATGAGGGGTGAGCTAGGTCATCTATGGGAACATGGCACGTCTGTGCCTATACCCATATTGGGAAGACCTGGAGAAGCTTAG >GSVIVG01019744001 ATGGATTTGCAGAGGCTTTGTTGCGTTATTCTTGCATTTGCTGTGGTTCTGTTCGTCTGTTTCTCTTCTTCCGTGACAGCTGGGGACATCGTGCACGATGACGACGACGCCCCCAAGAAGCCTGGGTGTGAGAACGATTTTGTTTTGGTAAAAGTTCAAACTTGGGTTGATGGTGTAGAAGATGCTGAATTTGTTGGTGTTGGGGCTAGATTTGGTCCTAAAATTGTGTCAAAGGAGAAAAATGCACATCAATCTCACCTTACTCTTTCAGATCCCCCTGATTGTTGCACTGCACCGAGGAAACAGCTTGCTAGAGATGTCATTATGGTGCACCGAGGCAACTGTAGATTCACAACTAAGGCAAATGTTGCAGAAGCTGCTGGTGCTTCAGCTGTTCTCATTATAAACAACCAGAAAGAACTTTACAAGATGGTTTGTGAGCCTGATGAAACTGATCTTGATATAAAAATACCTGCTGTCATGCTTCCACAAGAAGCTGGTGCAAGCTTGGAAAAAATGTTGAGGAATAGCTCATCAGTGTCTGTGCAGCTATACTCTCCACGAAGACCATTAGTTGACATAGCCGAAGTTTTCCTATGGCTGATGGCAGTTGGTACTATCTTGTGTGCATCTTATTGGTCTGCATGGAGTGCCAGAGAGGCAGCTATTGAACAGGACAAGCTACTAAAGGATGCTTCAGATGAGCTTACAAATGCCAAAGATGGTGGTGCTAGTGGTGTGGTAGACATCAACACAACATCAGCTGTCTTGTTTGTTGTTATTGCTTCATGCTTTTTGGTTATGCTTTACAAACTTATGTCCTACTGGTTCGTTGAGCTTTTGGTGGTTCTATTTTGCATAGGTGGTGTCGAGGGCTTGCAAACTTGTCTGGTTGCTTTGTTGTCGAGGTGGTTCAAACGTGCTGGAGAAGCATTCATTAAAGTACCTTTCTTTGGAGCTGTCTCATACCTTACTTTGGCTGTTTCTCCATTCTGCATAACATTTGCTGTTGTTTGGGCAGTCTATCGTGATGTCTCCTTTGCCTGGATAGGTCAAGACATACTTGGAATTGCACTAATTATCACAGTTCTTCAGATCGTACATATACCTAATCTCAAGGTGGGTACAGTTCTTCTTAGTTGTGCCTTTTTGTACGACATCTTTTGGGTGTTCGTTTCTAAAAAGCTGTTCCATGAAAGTGTGATGATTGTGGTAGCTCGTGGTGATAGAAGTGGACAGGATGGTATTCCTATGCTACTGAAGATCCCCCGCATGTTTGATCCATGGGGTGGTTACAGTATCATTGGCTTTGGTGACATCCTATTACCAGGACTGCTAATAGCATTTTCACTTAGGTATGATTGGCTGGCAAAGAAGAATATCCAAACTGGATACTTTTTGTGGGCAATGTTTGCTTATGGATTAGGTCTTCTCATCACATATGTGGCACTGAACTTGATGGATGGGCATGGCCAACCGGCACTCCTATACATCGTGCCATTCACACTGGGAACCTTTTTGACACTGGGGAGGAAGAGAGGCGATCTCAAGAACCTATGGACAAGAGGAGTTCCAGAAAGACCCTGCCCCCATGTCCAACACGAACACAGTCAAGAATTCGCTCAAGAATTTAATGAGGAGAAGTAA >GSVIVG01026938001 ATGGATTCTCCCAGAAATTTGCTCCTTCTGTTTGTTCTTCTTGTCTGCACTCTTACTGTGGCCTTCGCCGGAGACATAGTTCACCAGGATGACATCGCTCCGAAGAAGCCTGGCTGCGAGAACAACTTCGTTCTGGTAAAAGTACCAACTTGGGTTGATCATGAAGAAGGGAATGAATATGTTGGTGTTGGTGCTCGATTCGGTCCTACCTTGGAATCAAAAGAGAAACATGCTAACCAAACAACACTCACTCTTGCAGATCCTCCTGATTGTTGCAGTACACCCAAAAACAAGCTAACAGGTGAAGTCATCTTGGTATACCGAGGTAACTGCAGTTTCACAAACAAGGCAAAGGTTGCAGAAAATGCTGGTGCTTCTGCAGTTCTCATTGTAAACAACCAGACAGAACTTTTCAAAATGGTTTGTGAAGCTAATGAAACTGCTATAAATATAAGCATTCCGGTTGTCATGCTTCCACAAGATGCTGGTGCCAGCTTGGAAAAAAGTTTAAAGAACAACTCTTCAGTTGCTGTTCAGCTATACTCTCCAAAGCGTCCACTTGTTGACATAGCTGAGGTGTTTTTGTGGCTCATGGCCGTTGGTACCATTTTATCTGCATCTTACTGGTCTGCATGGAGTGCCAGAGAAGCAGCTAATGAGCAGGACAAGCTATTAAAGGATGCTTCAGATGAGTTTCTAAGTACAGAGGGCACTGGTTCTAGTGGTATGGTGGATATCAACACGACATCAGCAGTTCTTTTTGTTGTGATCGCTTCATGTTTCTTGGTTATGCTTTATAAACTTATGTCGTTCTGGTTTGTTGAGGTTCTGGTGGTTCTGTTTTGCATTGGTGGGGTAGAGGGCCTTCAGACTTGCTTGGTGGCTTTGTTATCTTGTTTCAGATGGTTTGAACAAGCTGCAGAATCATTTGTTAAGGTGCCATTCTTTGGAGCCGTCTCATATCTGACTTTGGCTGTGTCTCCATTCTGCATAGCATTTGCTGTTGTTTGGGCAGTTTTTCGCCGCATCAACTTTGCTTGGATTGGACAAGATATCCTTGGTATTGCACTCATCATCACAGTTCTTCAGATCGTTCGTGTTCCTAATCTCAAGGTTGGAACTGTTCTTCTCAGTTGTGCGTTCTTGTACGACATCTTTTGGGTTTTTGTTTCTAAATGGTGGTTCAATGAGAGTGTGATGATTGTGGTAGCTCGTGGTGATAGGAGTGGGGAGGATGGTATTCCGATGCTACTGAAGATCCCGCGAATGTTTGATCCTTGGGGTGGCTACAGCATCATTGGATTTGGTGATATTATCTTACCGGGACTGCTTGTGGCATTCTCACTAAGGTATGATTGGTTGGCAAAGAAGAGTCTCCGAGCAGGATACTTTGTGTGGGCCATGACTGCTTATGGTCTAGGACTCCTCATCACATATGTGGCCTTGAACTTGATGGATGGGCATGGCCAACCAGCTCTACTCTACATTGTTCCATTCACACTCGGCACCTTTCTGGCATTGGGAAAGAAGAGAGGCGATCTCAAGACTCTATGGACAAAAGGAGAACCCGAAAGGCCATGCCCGCACATCCAACCTTCTCAATAG >TPR.G8890 ATGCCGTGGTTTTCGTATTCTTGTTCTTCCCAATTGGCGGCGACCATTCTTCTTCTGATTCTCTCTTCCGTGTTCGCGACAACATATGCTTATGACAATGCCTCATGCGGTCATGACACGCAATTGGTGAAGGTGAAGAATTGGGTTGATGGTAAAGAAGGTGACATGCTTAATGCTATGACTGCAAGATTTGGGTCTGTTATACCTAAGGACGCCGATCAATCTATCAAAACTCCTCTTGTTTCTTCTATTCCTGAAGACTGTTGTTCCCTTTCAACTTCAAAGTTATCTGGTTCAGTTGCTGTTTGCGTTCGTGGTACTTGTGACTTCACAACTAAAGCTACATTCGCACAGTCAGCCGGTGCTACTGCCATGTTGATGATAACTGACCAGCTCCTTGAGATGGATTGCCCCACTGATACTACCGAAAAGATAACCATTTCAATTCCGGTTGTTGAAATAACACTCACACTGGTAGATACTCTTTACAATTCTTTGAAGTCTGGAAAGAAAGTGGAAGTTCTACTATATGCTCCAGTTCGTCCACTTATAGATTTCTCTGTTGGATTTTTGTGGTTGATGTCCGTCGGAACAGTAATATGCGCTGCATTATGGGCTGACATCACTGCACCTGATAAGTTAGATGAACGCTATAATGAACTGTCTCCCAAGGGATCTTCCACTGCTGAAAAAGCAACAGATGATTCTGAAAATGAAATTGTTAATATAGATACAAAGGGCGCTGTCATTTTTGTCATTACGGCTTCCACGTTTCTTGTGTTGTTGTTCTTCTTCATGTCATCTTGGTTTATCTGGATTCTGATTGTACTTTTTTGCATCGGTGGTGTGGAGGGGATGCATAATTGTATTGTAACCCTCGCTTTAAGAATACATCCCAATTTTGGTAAGAAGACTGTGAAATTACCTTTGTTTGGGGAGAATTCTATTTTCTCACTAGCAGTATTGATATTCTCTGTGACATTTGCGGTATTATGGGCTGCTACACGACGAGAATCATTTTCATGGTTTGGCCAAGATGTTCTTGGTATCTGTTTAATGATAACAGTATTGCAATTGGCTCGCTTGCCTAATATTAAGGTTGCAACTGTACTCCTTTGTTGTGCATTTGTATATGACATATTTTGGGTATTCATATCCCCGGTGATATTCCAAAAGAGTGTTATGATCACAGTTGCTCGTGGCGACAAGGCAGGTGGTGAAGCAATTCCTATGCTTTTGAGATGTCCCCGTCCTAGAGATCCTTGGGGTGGATATGATATGATTGGATTTGGAGATATTCTATTTCCTGGTTTGCTTGTTTGCTTTACTCGCAGATTCGACAAAGATAATAAGAAGGGGATCTTTAATGGATACTTTTTTTGGTTGATAATTGGCTATGGCTTTGGCCTATTCTTTACATATTTGGGACTATATATGATGAATGGTCATGGACAACCTGCACTTCTCTACCTTGTTCCATGTACACTAGGAGTCGCTGTAACTTTGGGATGTATAAGAGGTGAACTTAAGATTCTTTGGAATTACAATGCAGATTCTTCTTCATCGAGAGAGCCATCGGACTTTGGGGAGATGGAAACAAATCATATGATTTTGAACAAGATTCTTTGCTGTCCACGTCAACCTTGGATTCCTGTGTCTCTGTTACAACACGCATCACAAAGAGATTTCAGAAAATTTTCAGATTTTGTTACCCCTTGTTACATATTGATGGATGCCTCTTCTAGAATTTCTAAGATATGTAGCAGTGAACGTGAGAGACTCCGTGGTCCTCAATGGATAAAGACATTGCAGGGAGCATTGCTCAGCTGTACATACACTGTACTTGACTATGCACAAACTGGTTTGATTGCAGCAGTGTTCTTCTTTAAACTTGACTTCTTGTTCTGTCCAAGGGTCCTAATTATGCCTGTCTATGAGATGATGGAATGGTGGTATCAGTCTGCTGAGGAAAGAATGTCAGCTCCAACGGTATATCCTCCTCCACCGAAGGTAGCCAAAGAAGGGGTACAGTTACCGCCAGATAGAACAATTTGCCCCTTGTGCTTGCAGAAACGCGTAAATCCATCTGTAATTACAGTTTCAGGCTTCGTCTTCTGCTATGCTTGTATATTCAAGTTTGTTACTCAGTATAAGCGCTGCCCAGCAACGACAATGCCTGCAACAGTTGACCAGATAAGGAGACTCTTTCATGATGTATAG >TPR.G15618 ATGCCATCTCCTTCTCGCGGCCGCCGTTTCTTTCTGTCGGTGCTGTTGGTGCTACTCTTCTTTGTAACTGCATCCGCCTCTGACGATGTCAAACGCGATGATGACAGGGCACCGAAGTCCAAATCCTGCAATAACCCCTTCCAATTGGTTAAGGTCAAAAACTGGGTCGACGGTGACGAAGCTATTACTCATAGCGGCATGACCGCTAGATTCGGTTCTTCCTTGCCAGAAAAGGCAGACAATAGTGTCAGAACTCGTGTTCTTTTCTCTAATCCAACTGATTGTTGTTCTCCTTCAACTTCTCAGTTATCTGACTCTGTTGCTTTATGTGTTCGTGGGGGTTGTGATTTCCAAATCAAAGCTACAATTGCGCAGTCTGGGGGCGCTACTGCTGTCTTGATCATAAATGACCAAGAGGATCTCGTTGAGATGGTTTGCTCAGATACCACCGAGGCAAATATTTCAATTCCAGTTGTGATGATAACAAAATCAGCAGGAGAAGCTCTTAACGCATCTTTAACAACTGGGAAGAGAGTGGAAGTTTTGTTGTATGCACCGCCTCGACCACTTGTAGACTTCTCAGTTGCATTTTTGTGGTTGGTGTCTGTTGGAACAATTGTATGTGCTTCACTATGGTCAGACATAACTACTCCAGAGAAGTCTGGTGAACGCTATAATGAATTGTATCCCAAGGAATCTCAAAATGCTGCAGCAGCAAGAGGTGGTTCTGATAAGCAAGTTGTTAACATTAATTCAAAGGCTGCTGTCATATTTATCATATCAGCATCTACCTTTCTTGTTCTCCTGTTCTTCTTCATGTCATCTTGGTTTTTGTGGTTGCTCATTGTACTTTTCTGCATTGCTGGTATTGAGGGGATGCACAATTGTATTACAACCCTCACTTTAAGGAAATGGGAAAATTGTGGTGAGAAGACTGTGAATGTACCTCTATTCGGAGAGACTTCTATTTTCTCGCTGGTAGTGTGTTTATTCTGTTTTGCATTTGCGGTTTTCTGGGCTTCTACTCGACATGCATCTTATTCGTGGATTTTCCAAGACACTCTTGGAATCTGTTTGATAATAACAGTCTTGCAGGTGGCTCAATTACCCAATATTAAGGTTGCGACTGTACTCCTTTCTTGTGCTTTTGCCTACGACATCTTTTGGGTGTTTATATCTCCGTTGATATTCCATGAAAGCGTCATGATTGCAGTTGCTAGAGGTGACAAGGCTGGTGGTGAAGCACTTCCTATGCTTTTGAGATTTCCTCGTTTTTTTGATACATGGGGTGGTTACGAGATGATTGGGTTTGGAGATATTATCTTTCCTGGTTTGCTTGTTTCCTTTGCTCATAGACTTGACAAAGATAATAAGAAGGGGGCATTAAATGGATATTTTCTTTGGTTGGTAATTGGCTATGGCGTCGGCCTCATTTTCACATATTTGGGGCTATATCTGATGGACGGAAATGGACAACCTGCACTCCTCTACCTTGTTCCATGCACACTAGGTGTCATTATCATACTGGGATTTGCAAGAGGTGAGCTGAAAAGCCTTTGGAATTATGGCACAGATTCGTCCTTGTCCACAGAGCCTGCAGATTCAGAAGTTTAA >TPR.G37824 TTGTATTTCTCTCACTACACACAAACAACGATTTCCTCTTCTTCCTTTTACATCCTGATAAATATGCTCCTAAGAAACCTGGTTGTGACAACAACTTTGTTCTGGTGTGACTTTTGTATTGCAAGGAACTTTTTGATTGAAAGTGAAGGTGGCGAGAAAATGAGAATGAATGAAAAAAAACTTTGTGGATATGTTGGTGTTGGTGCAAGATTTGGACCTACATTGGAGTCAAAAGAAAAGCGGGCAAACCATACTAGAGTTGCCATTGCAGATCCTCCTGATTGTTGTAGCAAGCCTAAGAATAAGCTTACCGGCGAGGTCATTTTGGTGCACCGAGGACAATGTAGTTTCACAACCAAGGCAAATATAGCTGAAGAAGCTGGTGCTTCAGCCATCCTGATTATAAATAACCGTGCAGGACTCTTCAAGATGGTCTGTGAAGATAACGAAACCGATACTGATATTGGAATACCTGCTGTCATGCTTCCACAAGATGCCGGTGAAACCTTGCAAAATTATATACAAAACAAGTCCACAGTGTCTGTGCAGTTATACTCTCCAAAACGTCCACAGGTCGATGTCGCAGAAGTATTTTTATGGCTTATGGCTGTTGGTACCATTCTCTGTGCTTCTTACTGGTCTGCCTGGACTGCCAGAGAAGGTGCTATCGAGCGAGAGAAGCTATTAAAGGATGATTCAAATGAGTATCTAAATACAGAGAATGCTGGTTCCAGTGGTTATGTGGAAATAAGTACAGTAGCAGCAGTTTCATTTGTTGTGATCGCTTCTTGTTTCTTGTTTATGCTTTACAAACTAATGTCGTACTGGTTTGTTGAAATTCTGGTGGTTCTTTTTTGCATTGGTGGGGTTGAGGGACTGCAAACTTGCTTGGTGGCTCTTTTATCATGTTTCAGCTGGTCTCAACATGCTGCACAAACATATGTGAAAATACCCTTCTTTGGTGCTGTATCATATCTCACGCTTGCTGTTACTCCCTTCTGCATAGTGTTTGCTGTGGTTTGGGGAGTTAAACGTCGTGTATCGTATGCTTGGATTGGTCAAGATATTCTTGGTATCGCTTTGATAATTACGGTTCTCCAGATTGTCCACATACCAAATCTCAAGGTTGGAACTGTTCTACTCGGCTGTTCCTTCGTATATGACATCGTCTGGGTGTTTATGTCTAAACTTGTGTTCCATGAGAGTGTGATGATAGTGGTAGCTCGTGGTGACAGAAGTGGAGAAGACGGCATCCCCATGCTGCTCAAGATACCGCGTTTATTCGATCCTTGGGGTGGTTACAGTATCATCGGTTTCGGGGACATAATCTTACCAGGCCTTCTAGTAGCATTTTCATTAAGGTATGATTGGTTAGCAAAGAGGAACCTTCGAGCAGGATACTTTTTGTGGGCAATGAGTGCTTATGGTTTAGGTTTGCTTGTCACATACTTAGCTTTGAATTTGATGGATGGGCATGGTCAACCAGCTTTGCTGTATATAGTTCCATTTACACTTGGAACCTTTTTGTCACTGGGAAAGAAGAGAGGTGAACTCGAAATCTTATGGACAAGAGGGCAACCAAAAATGCCTTGCCCTCACATTCGAGAGGATCATCAACCAGTGGATCAGTGA >TPR.G39972 CTGTATCAGGTTGGGACTGTTCTTCTCAGTTGTGCTTTCCTATATGACATATTATGGGTGTTCGTCTCTAAATGGTGGTTCCATGAGAGTGTGATGATAGTGGTAGCTCGAGGTGATAAGAGTGGAGAAGACGGTATTCCCATGCTTCTCAAGTTACCACGTTTGTTTGATCCTTGGGGTGGCTACAGCATCATCGGTTTTGGGGATATAATCTTACCAGGACTTCTAGTAGCATTTTCACTAAGGTTTGGTATTCGATGTGTTTATCATATATGA >TPR.G27716 ATGAAATCTTCAATGGCTTCAGAAAAGATTTTATGGATTTTTGCATTTTCTGCTGTAATTGTTCATCTTCATCTCTGTAAAGTTCCATCAGTACTAGCTGGTGACATAGTTCATGATGATTCAACTCCTAAGAAGCCTGGTTGCGAGAATCAGTTTGTTCTGGTCAAAGTGCAAACTTGGGTCAACGGTGTAGAAGATGCTGAGTTTGTTGGTGTCGGTGCTAGGTTTGGAAGAACGATTGTATCTAAAGAGAAAAATGCTAGGCATACACGTCTTATTCTTTCAGATCCTCGAGATTGTTGCAGTCCTCCAAAGAATAAGATTGTTGGAGATGTCATCATGGTGGATCGAGGCAACTGCACATTCACAAAAAAGGCCAATTCTGCACAAAATGCTAATGCTTCAGCTATCCTCATCATAAATAACCAGAAAGAGCTTTACAAGATGGTTTGTGATCCTGATGAAACTGATTTAAACATACACATACCTGCTGTTATGCTCCCACAAGACGCAGGCACAAGGCTGGAAACAATGCTGATGAGTACTTCATCTGTGTCGGTACAGCTATACTCACCACGTCGACCAGCTGTCGACGTAGCAGAAGTGTTTCTTTGGTTGATGGCGGTTCTTACCATATTGTGTGCGTCATATTGGTCAGCATGGAGGGCCCGAGAAGCAGCCGTTGAACAAGATAAGTTATTAAAGGATGCTTCCGATGATATCCCAAACATTAAAGATGAGGGCGTTAGTGGAATTGTAAATATGAATGCAAAAGCTGCAGTCCTTTTTGTTCTTGTTGCTTCATGCTTCTTGTTTATGCTTTACAAATTGATGTCGTCATGGTTCATTGAGCTTTTGGTTGTTCTCTTCTGTATTGGTGGAATAGAGGGCTTACAAACTTGCTTGGTTGCAGTTTTGTCAAGGTGGTTCAAGAATGCTAGCGAATCATACATTAAATTACCTTTCATAGGAGCTGTCTCGTATCTGACTTTGGCCGTTACTCCATTCTGTATTACATTTGCCGTTTTTTGGGCAGTTTATCGTGACAAATCATTTGCCTGGATTGGTCAAGATATACTTGGAATTGCATTGATAATTACAGTTCTGCAGATTGTACATGTGCCTAATCTCAAGGTTGGTACAGTTCTTCTCAGTTGTTCCCTCCTTTATGACTTATTTTGGGTGTTTGTCTCGAAGAGGTTTTTCAACGAAAGCGTGATGATTGTGGTAGCTCGAGGCGATAGAAGTGGAGAAGATGGTATTCCAATGTTACTAAAGTTTCCGCGCCTTTATGATCCATGGGGTGGTTACAGTATTATAGGTTTTGGAGACATCCTTCTACCAGGAATGCTGGTGGCATTCTCACTCAGGTATGATTGGCTGGCAAAGAAGAGCCTTGTAAGTGGATACTTTTTGTGGGCAATGTTTGCCTATGGCTTTGGTCTTTTGATCACGTACGTGGCGCTAAACTTGATGGATGGGCACGGACAACCAGCACTACTATACATTGTTCCATTTACTCTCGGGACCATTCTGGCATTGGGGCGAAAGCGAGGAGAGCTGAAGATTTTGTGGACAAATGGCGAACCAGAAAGATTCTGCCCACATGTCAGACTCCAACATAGTGAAGAATCAAGTCCCGAATGA >ATR0609G032 ATGGCAAGAATTAGGGTTCGCCTCGTCTTCTTCTCGACATGGTTGCTGCTAATCTCTCTCTCTTTTGCGGACGATGTCAGCCGTGACGACGATTTCACCCCTAAATCTCCGGGGTGCGACAACAAATTCCAATTGGTTAAGGTTAAAAATTGGGTGAATGGTGTTGAAGATACAAGCATTGTTGGATTAAGTGCAAGATTTGGTTCTTCACTACCAAGTCATGCCAGTGAAGCACGAAAAAGACCAGCCGTTTTGGCAAATCCAGTGAATTGTTGTACTAATTCCTCTTCAAAGTTAGTGAATTCCATGGCTTTGTCCAAGCGTGGGGATTGTGCCTTCACCACGAAAGCACAAGTTGCTCAGTACGAGGGTGCAGCAGGCTTGCTTATTATGAATGATGAGGAAGATCTCTACAAAATGGTTTGCACTGAAAACGACACTTCTCTTAATATTACAATCCCTATTATAATGATTCCCAAATCAGCAGGAGATAATCTTCAAGGGCATTTGGCTGCTGGACATAAGGTGGATATTTTATTGTATTCTCCAAATCGCCCTATAGTGGACTTCTCAGAGATCTTCCTGTGGATGATGGCTGTTGGCACTATAGTGTGTGCTTCCTTGTGGTCTGAATTTGTTACATGTGAACAAACTGATGAGCGCTACAATGAACTTACAAGAAAGGATGCCCCTAATGCTGGACCTATCAATAAAGACGATTCTTTGAAGGAAGTTCTGGATATCAATTTGAAGGGGGCTGTTATATTTATTTTCGCAGCATCTGCCTTTCTATTGTTGCTGTACTTTTTTATGTCGTCGTGGTTTATTTGGCTGCTGATTGTGTTATTCTGCATTGGTGGTAGTGAGAAAGTGTTCACATTTTCTAGTGGTGGCCAGTCGTGCCCCTTTAAAAGTTAA >ATR0609G084 ATGCACGAATGCCTGGTTGCTCTAATTTCAAGATTCTTTGGAGACTGCGGGCAGAAAATCCTAAATTTTCCATTTCTTGGGGAGATCCCACTTCTCTCAGCTGTGATTTTACCACTCTGTATGGTATTTTCCATTTTTTGGGCTGCAAATCAGCATGCATCATATGCATGGATTGGTCAAGATATTCTAGGTATTTCTTTGATGACAACGGTCCTGCAAATGGCTCGCTTACCAAATATCAAGATTGCCTCTGTGTTTTTGAGCTGCGCATTTGTCTATGATATCTTTTGGGTCTTCATTTCACCACTTATATTCCATGAAAGTGTTATGATTGTGGTTGCTCGTGGTGACAGCAGTGGCGAAAGCATTCCAATGCTTTTAAAGATTCCGAGATTTTTTGACCCTTGGGGTGGTTATGACATGATTGGATTTGGAGACATCCTCTTTCCTGGACTTCTTATTTCATTTGCATTCAGATATGACAGATACAAGAAGAAGGGTATCTTAAATGGCTACTTTCTTTGGCTTGTCATTGGATATGGAATTGGTCTCTTCATCACTTATGTTGCCCTATATTTGATGGATGGGCACGGGCAACCTGCATTGCTGTACCTTGTTCCATGCACATTAGGTCTTATCATTGTACTTGGCTGGCTTAAAAAAGAACTTGAAGATCTGTGGGATTTTGGAGCAAGCCGACCTGAGCATTCTCCTGGAGAAGCATAA >ATR0680G029 ATGGGTTTGAACAAGTGTTGGGTCTCTCTGGCTTTTGTAGTTTTTGCAATTCCTTCATTTATACAGTGTGGAGACATCGTTCATGATGATGAAGATGCCCCAAAGCAACCTGGTTGCGAGAACAAATTTGTTCTGGTAAAAGTGCAAACTTGGGTAAATAATAAGACAGGTAATGAGTTCGTAGGTGTTAGCGCGAGGTTTGGCACCCCTATGGAATCTAAGGAGAAACATGCCAACCAAACTCATCTTTCCTTATCAGACCCCCGTGATAGCTGTAGCACACCCAAGAATAAGCTTACTGGAGATGCTGTCTTGGTACATCGTGGTAATTGCACATTTACAATGAAGGCAAAAGTTGCACAAGCTGCTGGTGCTGCAGCTATTCTTGTTGTGAACGATAAGGAAGAACTTTACAAGATGGTTTGTCAGGACAATGAAACAAATTTGCACATAAGTATTCCTGCTGTCATGCTGCCAAGCAAGGCAGGTTTAAGCTTGGAAAAGAGTTTAAGTTCTGGTGCATCAGTGACTGTACAGCTGTACTCTCCAGATCGTCCTGTGGTGGATACTGCAGAGGTTTTTCTTTGGCTTATGGCTGTGGGAACTATATTATGTGCATCTTATTGGTCTGGATGGAGTGCCAAGGAAGCAGCTATTGAGCATGATAAGCTCTTAAAGGATGCTCCTGAAAGTCTCCATGACATGGATACTGCTGGTCCTAGTGGTGTAGTTGACATCAACACAACATCAGCAATCTTATTTGTTGTGATAGCATCATGCTTCCTCATCCTACTTTACAAGCTCATGTCATCATGGTTCTTGGAGCTTCTGGTGATTCTCTTTTGCATCGGTGGAGTTGAGGGCCTGCAAACTTGCTTGGTGGCTTTGTTGTCAAGGTGGTTTAAGCGAGCTGGACATTCATACATAAAAGTGCCCTTCTTTGGAGCAATTTCATACCTTACATTGGCCATTTCTCCATTCTGCATAGCCTTTGCTGTAATATGGGCAGTTTATCGGCGTATCTCCTTTGCTTGGATAGGCCAGGACATACTTGGTATTGCACTGATCACTACGGTTCTTCAGATTGTCCGCATACCTAACCTCAAGGTGGCTACTGTGCTACTCAGTTGTGCCTTCCTATATGATATATTTTGGGTGTTTGTGTCCCCCAGGTGGTTTCATGAAAGTGTTATGATTGTGGTTGCTCGTGGGGACAAGAGTGGAGAAGATGGCATACCCATGCTACTGAAAATTCCACGTATGTTTGATCCATGGGGTGGTTTCAGCATCATTGGATTTGGTGACATCCTTTTACCAGGACTGCTCATAGCCTTTACACTGAGGTATGATTGGGCAGCTAAGAAAAATCTGCGAGCTGGGTACTTCTTGTGGTCAATGATTGCTTATGGTTTTGGCCTTCTTGTTACCTATATCGCTTTGAATTTAATGGATGGAAATGGGCAGCCCGCACTTCTCTACATTGTTCCTTTCACGCTCGGTACTGTTTTAAGTCTGGGTAGAAAGAGGGGTGAGCTGCAAAATCTATGGACCAAAGGAGAACCAGATAGGGTGTGCCCACATATCCAACCCAACTGA >Zm00001d004702 ATGGCGAGCGATAACCGCGCGTCGGTCTTCCCCTTCGCCGCCGCCGTCCTTGTGGTGCTCCTCGCTGGCGGCGCCGCGGCGGACGACGCCTCCAGCGACGACGACGCTGGGACTTCACGGACACCCGGCTGCTCCAACAAGTTCCAGCTGGTCAAGGTGAAGAATTGGGTGAATGGGACTGAAGGTACAACTTTTGTTGGCCTAAGTGCAAAATTTGGAGCTCCCTTGCCAAGAGATATTCATGAAGCAAAAAAGTCATTTGCTGTCCTCTCAAATCCAATTGACTGTTGCTCCAACTTGACATCAAAGTTAACAAGTTCAGTTGCTATAGCAACACGTGGGGAATGTGCTTTCACGGAAAAAGCAAATATTGCTCAGGCCAGTGGTTCGACCGGTTTACTAGTTATCAATGATAATGAAGTGGAAGTGCAGCTATATTCACCAAATCGACCAACTGTGGACCTTTCAGCATGCTTCTTATGGATAATGGCTGTAGGCACCATAGTCTGTGCTTCACTCTGGACTGAATTTGTTACATGTGAACAGGTTGATGAGCGTTATAATCAGCTGACCAGAAAGGATGGACCTGACACGGGAACAAAATACAGAGAAGATAAAGAGGTCTTCGAGATCAGCGCGAAGGGTGCTTTTATTTTTATTATAGTAGCTTCAGTTTTCCTCCTCCTCCTGTTCTACTTCATGTCATCTTGGTTCGTTTGGGTGCTAATTGTACTATTCTGCATTGGTGGTATTGAGGGTATGCATGCTTGCTTGGTCACGCTTCTAGCTAGGATTTTTAAGGACTGTGGACAAAAGACTGTACAACTCCCTGTTTTGGGGGAGGTCTTGATCTTATCTGTTGGAATTGTACCATTTTGTGCGGTGTTTGCAATTCTCTGGGCTGTGTATCGCCATGCTTCATTTGCTTGGATAGGCCAAGACGTTCTGGGTATCTGTTTGATGATAACTGTGCTTCAGATGGCACGTTTACCAAATATCAAGGTTGCATCGGCACTTCTTAGTGCTGCATTTGTGTATGACATCTTTTGGGTGTTCATTTCACCTCTTATATTCCATGAAAGCGTCATGATTGCAGTTGCTCGTGGTGATAACACTGGGGAATCAATTCCTATGCTCCTAAGGATACCCCGCTTCTTTGATCCATGGGGTGGTTATGATATGATAGGCTTTGGTGACATTATCTTCCCTGGATTGCTTGTTGGATTCAGCTATAGATTTGACAGAGCAAACAGAAAGGGTGTCTTGAGTGGATATTTTCTCTGGCTAATTGTGGGATATGCAGTTGGCCTTTTCATTACGTATCTTGCGCTGTTCTTGATGGACGGGCATGGTCAACCTGCGTTGTTGTACCTTGTGCCATGTACATTGGGGGTTATTGTTATTCTTGGTTGGTTAAGAGGTGAGCTTTATGAATTATGGAACTTCGGAAAAAGTCCAGGAGAAAATTTTGTCAATGAACCATGA >Zm00001d042378 ATGGCGCTCCGGACCTTCCCTCCCCGCGTCCTCCTCCTCTCCGTCGTCCTCCTCGCTGCCCCCGCCGCCGGCGCCGGCACTGGTTCGGAGTTCGACGACGGCACCTCGCCCAAGTTCCCCGGATGCGACAACACGCTGCAGAAGGTGAAAGTGACGTACTGGGTGGACGGCGACGAGCGGAGCAGCCTTACGGGGATCAGCGCGAGGTTCGGCGCGGTCCTGCCGGACGCGGCGCCCGACGACGAGAAGCAGCGGGCCGCCGTGCCCAGCCCCGAGAGCGGCTGCGCCAAGTCGTCGACGCCGCTCGCGGGCTCCGTCGCCGTGGCTGTGCGCGGGGAGTGCACGTTCATCGAGAAGGCCAAGGCGGCCGAGGCCGGCGGCGCCGTGGCGTTGCTCCTCGTCAACGACGAGGACGACCTGCAGAGGATGGTCTGCTCCGACAAGGACTCGCCGCCCAACATCGGCATCCCCGTCGTCATGGTGTCCAAGTCCGCCGGCGACAAGGTGCAGTCGGCCATCGGGGACGGGTCCAAGGTCGACATTCTCATGTACGCGCCGCTGAAGCCGTCCTTCGATGGCGCCATACCTTTCCTCTGGATGATGGCCGTCGGCACGGTGGCCTGCGCTTCCGTGTGGACTGTCGTCGTCGTCGGAGAAGAGCCTACCAAGCAGGGCGACGTCTCCCTGGGTGGGGAGGAGAACCCCGACGCCGAGGTCGTGGAGCTGCAAGCCAATACGGCGCTCGTGTTCATCGTCACGTCCTCGCTCGTCCTTCTCTTCCTCTTCTTCTTCAACTCCAACTGGTCCGCCTGGCTCCTGGTTTGCCTCTTCTGCCTCGGGAGTCTCCAGGGTATGGAATTCGTGGTATCTTCTCTCGTTGTCAGACTATGCCAGCGGTGTCGCGAGGCCAAAGTGAAGCTTCCTGCTCTAGGAAACGTGAAGGTGGTCACGCTAGTGGTCCTGCCGCTGGCCTTCATCTTCGCCGTCACCTGGGCTGCACACCAGGACTCGCCGGTTGCTTGGGTTGGTCAGAACCTCATGGGCATCTGCATGATGATTCTAGTACTGCAAGTGGTGCACATGCCAAATATAAAAGTTGCGTCGGCGCTCCTTGTCTCGGCCTTTTTCTACGACATTTTCTGGGTCTTCATATCACCCCTCATATTCAAGAAAAGCGTCATGATCACAGTTGCTCGTGGCAGCGATGACGGGCCGAGCCTCCCCATGGTACTGAAGATGCCGAAGGAGTTCGATTCGTGGAATGGGTACGACATGATTGGGTTCGGGGACATTCTCTTCCCCGGACTGCTTGTTGCTTTCAGTTTCAGATATGACAGAACACACGGCAAGGACTTGACAGATGGATACTTCCTCTGCTTAATGATTGGTTATGCCTTCGGTACGTAG >Zm00001d051873 ATGTGTGCACAGGAGGCAGGCACCGTGCAACCATGCGAGGTGTTGGGAGATAAGGGAGCACTTGTTGGGCTGGGTCATATTTCAGAGGCTGATAGTATTTCCACATCTGCGGGCCATTATGTCTACCTAGCTAATGTGGTTCTCAGGGTAAAAGTGCAGACCTGGATCAACAAAAAAGATAAAGATGAGTTTGTTGGTGTTGGTGCTCGATTTGGCCCCAAGATAGAGTCAAAGGAAAAGCATGCCAACTGGACAAACTTGCTGTTAGCAGACCCTTCTGATTGCTGCACCCCTCCAAGAGAGAAGGTTGCTGGAGATATTTTGTTAGTGGAGAGGGGAAACTGTAAGTTCACTACAAAAGCTAAGGTGGCTGAATCTGCTGGTGCTTCTGCGATTATAATTATCAATGATAAGCACGAGTTATACAAGATGGTATGTGAGACCAATGAAACAAATTTAGATATTGGCATACATGCTGTTCTTCTGCCAAAAGATGCAGGCTCTTCTTTACAAAGGTCTCTCTCTAGTGGTGAAGTCTTAGTGGAGCTGTACTCTCCAGATCGTCCTCTGGTTGATACTGCAGAGGTGTTTCTGTGGCTTATGGCAGTTGGTACCATTCTTTGTGCATCATACTGGTCAGCATGGAGTGCCCGAGAAGCAGATATTGAACAAGAGAAGCTTCTGAAGGATGGTCGTGAAGTAGCACCAAACTTTGAGCCTGGAGGTTCTAGTGGTATGGTAGATATCAACATGGTATCCGCAATACTGTTTGTGGTGATTGCATCATGCTTCTTGATAACACTCTACAAGCTGATGTCCCATTGGTTTGTGGAGCTTCTGGTGGTTATCTTTTGCATAGGTGGTGTGGAGGGTCTGCAAACATGCTTGGTGGCCTTACTGTCAATGTCAAGGCGGTTTAAACCTGCTGCAGAATCGTATGTGAAAGTGCCATTTTTTGGAGCTGTTTCATACCTTACATTGGCAGTTTGTCCGTTTTGCATTCTGTTTGCTGTTCTGTGGGGTGTTTATCGTCGGTTGCCTTATGCTTGGATTGGGCAAGATATTCTTGGTATTACCTTGATCGTTACAGTCATCCAAATTGTTAGAATACCTAACCTTAAGGTGGGTTCAGCCCTCCTGGGTTGTGCCTTCTTATATGACATCTTCTGGGTTTTTATCTCCAAGATGTTGTTCCATGAAAGTGTGATGATTGTGGTTGCACGTGGTGACAAGACTGATGAGGATGGTGTACCCATGCTGTTAAAGATTCCTCGGATGTTTGATCCATGGGGTGGATACAGCATCATAGGCTTTGGTGATATCCTTCTTCCTGGGCTGTTGGTTGCTTTTGCATTAAGGTATGATTGGGCTGCCAAGAAGACCTTGCAATCTGGCTACTTTTTGTGGTCAATGGTGGCATATGGTTCCGGTCTCCTAATTACATACGTTGCCTTGAACCTTATGGATGGCCATGGCCAGCCGGCTCTCCTTTACATCGTGCCTTTCACAATCGGCACCTTCTTAGCACTGGGCATGAAGAGAGGCGAGCTCAGAAACCTGTGGACAAAAGGACAGCCCGAGAGAGTGTGCACGCACATGCACCCATCCCCCAAGGATTCGCCTGTTGCGGTCAGCTCGCTGTCGTAG >Zm00001d014901 ATGGCCGCGGCGGCGGTGTTGGTGGTGCTCACGGTGTCAGCGCTGGCGGGGGCAGCGGCCGGCGGTGATATCGTCCACCACGATGACGAGGCACCCAAGATCCCTGGATGCTCCAACGATTTTATCCTGGTAAAAGTGCAAAGCTGGGTCAATGGCAAAGAGGGTGGCGAGTTTGTTGGCGTCGGTGCTCGGTTTGGTCCAAAAATCGTTCCTGGAGATGTTCTTTTAGTTCAAAGGGGAAAGTGCAAATTCACAAAGAAAGCAAAGTTTGCTGAAGCTGCTGGTGCTTCTGCTATAGTAATCATAAACCATGTCCACGAATTGTACAAGATGGTCTGCGAAAAGAATGAAACCGACCTTGACATAAATATACCTGCAGTTCTCCTACCAAAAGATGCAGGTTCTGCTTTACATACACTTCTTACAAATGGTAACACAGTTTCTGTGCAGCTTTACTCTCCAGATCGACCTGTAGTTGACACTGCAGAGGTGTTTCTATGGCTTATGGCTGTTGGCACAGTACTTGGTGCTTCCTACTGGTCAGCATGGAGTGCTAGAGAAGCAGTTATTGAACAAGAGAAGCTCCTCAAGGATGGCCATGAAGACCTACTGAATGTTGAGGCCAGAGGTTCTAGTGGCATGGTAGATATCAATGTGGCATCAGCGATAATGTTTGTGGTGGTTGCGTCATGCTTCTTAATAATGCTTTACAAACTGATGTCTTACTGGTTTGTGGAGCTACTGGTGGTAATCTTCTGCATTGGCGGTGTAGAGCCTTTGTTTTTGTTTATGCAGGGTCTACAAACATGCTTGGTGGCTCTGTTATCAAGATGGTTTAAACCTGCTGCAGAATCTTTTGTGAAAGTACCGTTCCTTGGAGCCGTTTCGCATCTTACTCTGGCAGTTTGCCCATTTTGCGTTGCATTTGCTGTTGTGTGGGCTGTTTTTCGCCAGCTCCCCTTTGCTTGGATTGGGCAAGACATTCTGGGTATTGCATTGATAGTTACAGTCATCCAAATTGTGAGAGTACCTAACCTCAAGGTGGGTTCGGTTCTTCTCGGCTGTGCCTTCCTGTATGATATCTTCTGGGTGTTTATCTCCAAGAGATGGTTTCATGAGAGCGTGATGATTGTGGTTGCGCGTGGCGACAAGACCGACGAGGATGGTGTGCCCATGCTGCTAAAAATCCCGCGAATGTTTGATCCATGGGGTGGATACAGCATCATTGGCTTTGGTGATATCCTTCTTCCTGGTCTTTTAGTTGCTTTCTCGCTAAGATACGATTTTTCTGCAAAGAAGGGCTTACGGTCTGGTTACTTTTTGTGGGCAATGGTGGCCTATGGCTCTGGACTTCTAATCACATATGTTGCGCTGAACCTGATGGATGGGCATGGACAACCTGCCCTTTTGTACATCGTGCCCTTCACTCTTGGCACCTTGATCGCGCTTGGATGGAAGAGAGGGGAGCTGCAGAACCTGTGGGCGAGGGGAGAGCCAGAGAGAGTGTGCACGCATATGCATATGCCGCTGCTGCCGACGACCCCAAACTAA >AH009678 ATGAATTTTTGGAGTTTTTTGATACTTCTATTATTTTGTTGTTTTCTTGGGTGGTTTACATCTGAGGTTTATGGAGGTGATATAGTTCATGAAGATGATAAAGCTCCCAAAAAACCTGGTTGTGAAAACAATTTTGTATTGGTAAAAGTGCCAACTTGGGTTGATGGGTTTGAGGACAATGAATATGTGGGAGTCGGTGCTCGGTTTGGCCCCACACTTGAGTCTAAGGAGAAACATGCCAACCAAACAAGACTCGCTCTTGCAGACCCTCCTGATTGTTGCAGTCCTCCCAAAAATAAGCTTACTGGTGAAGTTATTCTAGTATACCGTGGTAATTGCAGTTTCACTACAAAGACAAATATTGCAGAGGATGCTGGTGCTTCAGCTATCCTTATCGTGAATAACAGCACTGAACTCTTCAAAATGGTGTGTGAGGATGATGCCGATACAAATATACGCATTCCTGCTGTAATGCTACCAATTGATGCTGGTGAAACCTTGGAAGATTTATTGTTCAACAATTCCAAGGTTAATGTGCAGCTTTACTCCCCAAGGCGTCCAGCTGTTGATGTGGCAGAAGTTTTTCTGTGGCTCATGGCGGGTTGGTACAATTTTATGTGCATCCTATTGGATGCTTCAGAGGATGTTGCGGTTCCCGAAGAAACTGGTTCGGCTGGTTTTGTAGATATCAGTACCAGATCAGCACTTCTTTTTGTCGTGGTTGCTTCTTTATTTTTGGTTATGCTGTACAAACTCATGTCAGTCTGGTTTATCGATGTTCTGGTGGTTCTATTTTGCATTGGTGGGGCAGAGGGTTTGCAAACTTGTTTGGTGGCATTGTTATCATGGTGGAGTAAACATGCTGCCGGAACATTTGTTAAGCTGCCCATATTTGGAGCAGTCTCATATCTAGCAATGGCTGTTTCTCCATTCTGTATACTTTGTGCTGTTCTTTGGGGCGTTTATCGCCGTGAACCCTATGCATGGATTGGTCAAGACATCCTTGGTATTGCGTTGATTCTCACAGTACTTCAGATCGTACGCGTACCCAATCTCAAGGTCGGGACAGTTCTTCTCAGTTGCGCATTCTTTTATGACATATTTTGGGTCTTTATCTCCAAGTGGCTCTTCCATGAGAGTGTTATGATTGTGGTTGCACGTGGTGATAATAGTGGAGAAGATGGAATTCCAATGCTACTAAAGATACCGAGGATGTTTGACCCTTGGGGTGGTTACAGTGTCATTGGATTTGGGGACATTATCTTACCTGGACTAGTGATAGCCTTCTCATTACGATATGATTGGCTAGGAAACAAGAAGATTCAAGCTGGATTCTTTTTGTGGGGAATGATTGCTTATGGTTTAGGTCTCCTTGTAACATATGTGGCACTAAACTTGATGGATGGACATGGACAACCAGCTCTCCTCTACATTGTACCTTTTACACTCGGCACATTTTTGTCGCTTGGAATCAAAAGAGGCGAGCTTAAGAATCTATGGACAAGAGGCGAACCCGAGTGGCCTTGTCCTCATGTTCGACTTCATTCATCTCAATGA >NNU_08668 ATGGATTTACAGAGAGTTTTCTTCTGGGTGACTTGCTTCTCTGCAGTGGTTCTGCTTTGGACTCCTGCTTCGGTAATTGCAGGGGATATCGTGCATCAAGACGATGAGGCGCCCAAGAAGCCCGGTTGCTCGAACAATTTCGTTCTGGTGAAAGTCCAAACTTGGGTGGATGGAAAGGAAGGAAATGAGTTTGTCGGAGTTGGTGCTCGGTTTGGCACTACCATGGAGTCAAAGGAGAAACATGCTAACCAGACTAAGCTTTCCCTTTCTGACCCTCCTGATTGTTGCAGCCAACCCAAAAATAAGCTTATTGGAGATGTCATCCTTGTGCACCGAGGTAATTGCACATTCACAAAAAAGGCAAATGTTGCACAAGCTGCTGGTGCTTCAGCCATCCTTATCATAAATAACAAAAAAGAGCTATTCAAGATGGTTTGTGATCCCAAAGAAACAGACCTTGATATACACATTCCTGCAGTCATGCTCCCACAAGATGCTGGTGTAATACTGGAAACAAGTTTTAAGAAGAATTCCTCAGTTGCTGTGCAGTTGTATTCTCCACAACGTCCACTGGTGGATATAGCAGAAGTATTTTTATGGCTGATGGCAGTTGGAACCATCTTGTGTGCGTCATATTGGTCTGCATGGAGTGCCAGAGAAGCAGCTATTGAACAAGACAAATTGTTAAAGGATGCTTCAGATGAATTTGTAAATGTAGAAGCCCCAGGTGCTAGTGGTGTGGTGGATATCAACACAACATCAGCCGTCCTTTTTGTTGTGATTGCTTCTTGCTTCTTAGTTTTACTTTACAGACTTATGTCTTTCTGGTTTGTTGAGCTATTGGTGGTCCTATTTTGCATCGGTGGAGTAGAGGGCCTGCAAACTTGCTTGGTGGCTTTATTGTCAAGGTGGTTCAAACATGCTGGAGAATCATTTGTTAAAGTACCCTTCTTTGGAGCTGTTTCTTACCTTACAATAGCTGTTTGTCCATTCTGCATAGCATTTGCTGTTGTTTGGGCTGTGTATCGGCGCATCTCCTTTGCATGGATAGGCCAAGATATTCTTGGTATTGCATTGATAATTACAGTTCTTCAAATTGTCCGTGTACCTAACCTCAAGGTGGGCACAGTGCTTCTAAGTTGTGCATTCATGTATGATATTTTCTGGGTGTTTGTTTCTAAGAAGTGGTTCCATGAAAGTGTAATGATAGTGGTAGCCCGGGGTGACAAAAGTGGTGAAGATGGTATTCCAATGTTACTGAAAATTCCTCGAATGTTCGATCCTTGGGGTGGTTACAGCATTATCGGATTTGGTGACATTCTCTTACCAGGATTGCTAATAGCTTTTTCATTGAGGTATGATTGGTTAGCAAAGAAGAATCTTCGAACTGGATACTTCCTTTGGGCGATGGTGGCTTATGGTTTAGGTCTCCTTATCACGTATGTTGCTTTAAACTTGATGGATGGACATGGCCAGCCAGCTCTACTTTACATTGTTCCTTTCACACTTGGCACATTTTTCACTCTGGGGAAGAAGAGAGGTGAATTTAAGAATTTATGGACAAATGGAGAGCCATATAGACCCTGCCCACACGTCCAACTCCAACCCACTCAGTGA >NNU_21255 ATGGATGGGCATGGTCAACCTGCCCTTCTATACCTTGTTCCGTGTACACTAGGGGTTATTATTGTATTGGGTTGGTTGAGGGGTGAGCTGAAGCACCTGTGGAACTATGGAACTGACGAATCATCAAGCAATGAACCTTCTGCCGAAAGAAGCGAGAAGGAAGTTAGAATGAGAGAAGATGATTTACAGAAAATGGAGCCTTATTACTGGCCCAGTATCCCATCTGTTCTAATCTAC >Glyma.01G220400 ATGGCTTCGGAGAAGATTTGCTCGATTCTCTTGTTTTGTGCTGTAATTTTGCTTCTCCGTGATGCTCCTTCTGCCATAGCTGGGGACATAGTTCACGACGACGATTCAACTCCCAAGAAGCCGGGTTGCGAGAACCAGTTCGTTCTGGTAAAAGTGCAAACATGGGTCAATGGTGTAGAGGATGTTGAATTTGTTGGTGTGGGTGCCAGATTTGGCAGAGCCATTGTGTCCAAAGAGAAAAATGCAAAGCACACGCGCCTTATTCTTTCAGATCCTCGTGATTGTTGCATTCCGCCAAAGAATAAGATTGTGGGAGATGTCATCATGGTGGATCGAGGCAACTGCACGTTCACAAAAAAGGCAAATATTGCACAGAATGCTAATGCTTCAGCCATCCTCATCATAAATAACCAAAAAGAACTGTACAAGATGGTTTGCGAACCTGATGAAACTGATTTGAACATACACATACCTGCTGTCATGCTTCCACTAGATGCAGGTACAAGGCTGGAAAAAATGCTGACAACTACTTCATCTGTGTCTGTGCAGCTGTACTCGCCACTTCGACCAGCTGTTGACGTAGCAGAAGTATTTCTTTGGATGATGGCAGTTCTTACCATATTGTGTGCATCATATTGGTCAGCTTGGACGACCCGAGAAGCAGCTATTGAACAGGATAAGTTGCTAAAGGATGCTTCAGATGAACTCCCAAACACTAAATATGCTAGTGTTAGTGGAGTTGTAAATATGAATGTGAAAGCTGCAGTCCTTTTTGTTGTATTTGCTTCGTGTTTCCTGTTTATGCTTTACAAACTGATGTCGTCGTGGTTCATTGATGTTTTGGTTGTTCTCTTCTGTATTGGTGGTATTGAGGGCTTGCAAACATGCTTGGTTGCTCTTTTGTCCAGGTGGTTCAAGCATGCCGGAGAGTCATACATCAAAGTACCTTTCTTAGGAGCTATCTCATACCTGACTTTGGCTGTTTCTCCATTCTGTATAACATTTTCCATTCTCTGGGCAGTTTATCGCAACGAATCCTTTGCCTGGATTGGTCAAGATATACTTGGAATAACACTGATAATCACAGTTCTACAGATTGTACATGTACCAAATCTCAAGGTTGGTACAGTACTTCTTGGCTGTGCCTTCATTTACGACATCTTTTGGGTATTTGTCTCAAAGAAGTTTTTCAAGGAAAGCGTCATGATTGTGGTGGCCCGAGGCGATCGAAGTGGAGAAGATGGAATTCCCATGTTACTGAAGTTCCCTCGGATTTTTGATCCATGGGGTGGTTACAGCATCATAGGTTTTGGAGACATCCTTTTACCAGGAATGCTGGTGGCATTCTCACTCAGGTACGATTGGCTGGCAAACAAGAGCCTTAGAAGTGGATATTTCTTGTGGGCAATGTTTGCATATGGCTTTGGTCTTTTAGTTACGTACGTGGCACTAAACTTGATGGACGGGCATGGCCAACCAGCACTACTATACATCGTTCCATTTACCCTTGGGACCCTGATGACATTGGGGCGGAAGCGAGGAGATTTGAGGGTTTTGTGGACTAGTGGAGAACCTGAAAGACCCTGTCCACATATAAGACTCCTACACAGTGGAGAACTAAACTGTGAATGA >Glyma.03G008600 ATGGTTTCACTTGGAGCTATATATAGTGTGATCTATGTGTTCCTGTTTGGAGCTGTTACTTTGGTTTTGGGTGGGGATATAGTTCACCATGATGATGTTGCCCCAAGAAGACCTGGTTGTGAGAACAACTTTGTTTTGGTAAAAGTCCCCACTTGGATTGATGGTGTGGAAAACAGTGAGTATGTTGGTGTTGGTGCAAGATTTGGCCCTACATTGGAATCAAAAGAAAAACGGGCCAATCTTTCTAGAGTTGTCATGGCTGATCCTCCTGATTGTTGTACAAAGCCTAAGAATATGCTCACCAACGAGATCATTTTGGTGCACCGAGGAAAATGTAGTTTCACAACCAAGGCAAATATAGCTGATGAAGCTGGTGCTTCAGCCATCCTCATTATAAACTACCGTACAGAACTTTTCAAGATGGTTTGTGAAGAAAATGAAACTGATGTTGATATTGGAATACCTGCTGTCATGCTTCCACAAGATGCTGGATTGACCTTGGAAAGGCATATAGAAAATAAATCCAATGTGTCAATCCAGTTATACTCTCCACTGCGTCCATTGGTTGATGTTGCGGAAGTGTTTTTGTGGCTTATGGCTGTTGGTACCATTTTAATTGCTTCTTATTGGTCTGCCTGGAGTGCTAGAGAAGCAGCAATTGAGCAAGAGAAGCTTTTAAAGGATGCTTCAGAGGACTACGTTAATACAGAAAATGTTGGCTCCAGTGGTTATGTGGAAATCAGTACTGTAGCAGCAATTTTATTTGTTGTGATTGCTTCTTGCTTCTTGGTTATGCTGTATAAATTAATGTCATTCTGGTTTGTTGAAGTTCTGGTGGTTCTCTTTTGCATTGGTGGGATAGAGGGTCTACAAACTTGTTTGGTGGCTCTGTTATCATGTTTCAGATGGTTTCAACAACCTGCTCAAACATTTGTGAAGATACCCTTCTTTGGAGCTGTCTCATATCTGACAGTTGCTGTTACTCCATTCTGCATAGTGTTTGCTGTGGTTTGGGCAGTTTATCGCCATGCATCGTTTGCTTGGATTGGTCAGGATATCCTTGGTATCACATTGATAATTACAGTTCTTCAGATTGTTCGCATACCAAATCTCAAGGTTGGAACTGTTCTTCTCAGTTGTGCCTTCCTATATGACATTTTTTGGGTGTTTGTCTCTAAACGGTGGTTCCATGAGAGTGTGATGATAGTGGTAGCTCGAGGTGATAAGAGTGGAGAAGATGGTATCCCCATGCTTCTCAAGATACCACGTCTATTTGATCCTTGGGGTGGTTACAGTATCATCGGATTTGGGGACATAATCTTACCAGGACTTATAGTGGCATTTTCACTAAGGTATGATTGGTTGGCAAAGAAGAACCTTCGGGCTGGATACTTCTTGTGGGCAATGACTGCCTACGGTTTAGGTCTCCTCATCACATATGTGGCTTTGAACTTGATGGATGGGCATGGTCAGCCAGCTTTGCTTTATATAGTCCCATTTACACTTGGCACCTTTTTGTCATTGGGAAAAAAGAGAGGGGAGCTCAAGATTTTATGGACAAGAGGGGAACCAGAAAGGCATTGCCCTCATATCCAAGAGGATAACCAATCAATTGACAGCCACCATTAA >Glyma.03G112500 ATGGGAGAAAAACAAGATGAGCCTACTAAAATCAACTGCGACAACAAATCAGCAATTACAATGGAGCATGCATCTGATAGAATTGTTAGAGATATGGATTTACAGCTTTTGCAGGCACATGTGTCTGTGCAGCTGTACTCACCATTTCGACCAGCTGTTGACATAGCAGAAGTATTTCTTTGGATGATGGCAGTTCTTACAATATTGTGTGCATCATATTGGTCAGCTAGGACAACCCGAGAAGCAGTTATTGAACAGGATAAGCTACTAAAGGATGCTTTAGATGAAATCCCAAACACTAAATATGCTAGTGTTAGTGGAGTTGTAAACATGAATGTGAAAGCTGCAGTGCTTTTTGTTGTATTTGCTTTGTGTTTCCTGTTTATGCTTTACAAACTGATGTCGTCATGGTTCATTGACGTTTTGGTTGTTCTCTTCTGTATTGGTGGTATTGAGGGCTTGCAAACATGCTTGGTTGCTCTTTTGTCCAGGTGGTTCAAGCATGCTGAAAAGTCATACATCAAAGATAGTCACTGTCCGTTTAATCATAATTTCTTTTTCATTGGTTGTTCCAACAGGGAATTGCACTGA >Glyma.06G191600 ATGGTTTGTGAACCTGATGAAACTGATTTGAACATGCACATACCTGCTGTCATGCTTCCACTAGATGCAGGTACAAGGCTGGAAAAAATGCTGACAACTACTTCATCTGTGTCTGTGCAACTACACTCGCCACTTCGACCAGCTGTTGACGTAGCAGAAGTATTTCTTTGGATGATGGCAGTTCTTACCATATTGTGTGCATCATATTGGTCAGCTTGGACGACCCGAGAAGCAGCTATTGAACAGGATAAGTTGCTAAAGGATGCTTCAGATGAACTCCCAAACACTAAATATGCTAGTGTTAGTGGAGTTGTAAATATGAATGTGAAAGCTGCAGTCCTTTTTGTTGTATTTGCTTCGTGTTTCCTGTTTATGCTTTACAAACTGATGTCGTCGTGGTTCATTGATGTTTTGGTTGTTCTCTTCTGTATTGGTGGTATTGAGGGCTTGCAAACATGCTTGGTTGCTCTTTTGTCCAGGTGGTTCAAGCATGCTGGAGAGTCATACATCAAAGTACCTTTCTTAGGAGCTATCTCATTGGAGTATATGCCATTCTTGCTTTCTTTTTTCTTCTTTTTAAACGGTGGCGTTTGGTTGTTGTATGTTGTTCTTGTTCGTGATGTTATCCTCGGGGGAATAGCACTGATAATCACAGTTCTACAGATTGTACATGTACCAAATCTCAAGTTGTTTCAGCTTCTTCTAAAGTGGCAATCAGCGTGCCTATGCCTGACATTACTAAAAAGGAGACAAGTTTCTTAG >Glyma.07G069900 ATGGTTTCACTTGGAGCTATATATAGTGTGGCCTATGTGTTCATGCTTGCTGCTACTTTGGTCTTGGGTGGGGATATAGTTCACCATGATGATGTTGCCCCCAGAAGACCTGGTTGTGAGAACAACTTTGTTTTGGTAAAAGTCCCCACTTGGATTGATGGTGTGGAAAACAGTGAGTACGTTGGTGTTGGTGCAAGATTTGGCCCTACATTGGAATCAAAAGAAAAACGGGCCAATCTTTCTAGAGTTGTCATGGCTGATCCGCCTGATTGCTGTACAAAGCCTAAGAATAAGCTCACCAACGAGATCATTTTGGTGCACCGAGGAAAATGTAGTTTCACAACCAAGGCAAATATAGCTGATGAAGCTGGTGCTTCAGCCATCCTCATTATAAACTACCGTACAGAACTTTTCAAGATGGTTTGTGAAGAAAATGAAACTGATGTTGATATTGGAATACCTGCTGTCATGCTTCCACAAGATGCTGGATTGAACTTGGAAAGGCATATAAAAAATAACTCCAATGTGTCCATCCAGTTATACTCTCCATTGCGTCCATTGGTTGATGTTGCGGAAGTGTTTCTGTGGCTTATGGCTGTTGGTACCATTTTAATTGCTTCTTATTGGTCTGCCTGGAGTGCTAGAGAAGCAGCAATTGAACAAGAGAAGCTTTTAAAGGATGCTTCAGATGACTATGCTAATACAGAAAATGTTGGTTCCAGTGGTTATGTGGAAATCAGTACTGTAGCAGCAATTTTATTTGTTGTGATTGCTTCTTGCTTCTTGGTTATGCTGTATAAATTAATGTCATTCTGGTTTGTTGAAGTTCTGGTGGTTCTCTTTTGCATAGGTGGGATAGAGGGTCTGCAAACTTGTTTGGTGGCTCTGTTATCATGTTTCAGATGGTTTCAACAACCCGCTCAAACATTTGTGAAGATACCCTTCTTTGGAGCTGTCTCATATCTGACAGTTGCTGTTACTCCATTCTGCATAGTGTTTGCCGTGGTTTGGGCAGTTTATCGCCGTGCATCGTTTGCTTGGATTGGTCAAGATATCCTTGGTATCACATTGATAATTACAGTTCTTCAGATTGTTCGCATACCAAATCTCAAGGTTGGAACTGTTCTTCTCAGTTGTGCCTTCCTATATGACATCTTCTGGGTGTTTGTCTCTAAACGGTGGTTCCATGAGAGTGTGATGATAGTGGTAGCTCGAGGTGATAAGAGTGGAGAAGATGGTATCCCCATGCTTCTCAAGATACCACGTCTGTTTGATCCTTGGGGTGGTTACAGTATCATCGGATTTGGGGACATAATCTTACCAGGACTTATAGTGGCATTTTCACTAAGGTATGATTGGTTGGCAAAGAAGAACCTTCGGGCTGGATACTTCTTGTGGGCAATGTCTGCCTATGGTTTAGGTCTCCTCATCACATATGTGGCTTTGAACTTGATGGATGGGCATGGTCAGCCAGCTTTGCTTTATATAGTCCCATTTACACTAGGCACCTTTTTGTCATTGGGAAAAAAGAGAGGGGAGCTCAAGATTTTATGGACAAGAGGGGAACCAGAAAGGCATTGTCCTCATATCCAAGAGGATAACCAATCAATTGACAGCCACCATTGA >Glyma.08G360900 ATGGCGTTTCGTGGTCTCGGTGTGTTGTTGGTGTTGTTGTTTGTGATTGGCGCGGGCGCCGACGATGCCAAACGCGACGACGACAGGGCTCCCAAGTCGGAATCCTGCAATAACCCCTTCCAACTGGTGAAGGTGGAGAACTGGGTGGATGGTGAGGAAGGGCATATTTATAATGGCGTCAGTGCTAGATTTGGGTCTGTGTTGCCGGAGAAACCTGACAACAGTGTGAAAACTCCAGCAATATTCGCTGATCCCTTAGACTGCTGTTCCAATTCAACTTCAAGGTTATCTGGCTCAGTTGCTCTCTGTGTGCGTGGGGGTTGTGACTTCACAGTTAAAGCTGATTTTGCACAGTCTGTAGGTGCTACTGCCATGTTGGTCATCAACGACGCACAAGATCTCTTTGAGATGGTTTGCTCCAATAGCACTGAAGCTAATATTTCAATTCCAGTAGTCATGATAACAAAGTCAGCCGGACAAAGTCTCAACAAGTCTTTGACATCTGGAAGCAAAGTGGAAATTTTGTTATATGCTCCACCTCGGCCACTTGTAGACTTCTCAGTTGCATTTTTGTGGTTGATGTCTATTGGAACAATTGTATGTGCTTCACTATGGTCAGATCTAACTACCCCAGAGAAGTCTGATGAACGCTATAATGAATTGTGTCCCAAGGAATCTTCTAATGCGGAAACAGCAAAAGATGATTTGGACAAGGAAATTGTTAACATTGATTCAAAGGGTGCTGTCATATTTGTCATAGCAGCGTCTACCTTTCTTGTGCTATTGTTCTTCTTTATGTCATCTTGGTTTGTCTGGGTGCTGATTGTACTTTTCTGCATTGGTGGTATTGAGGGTATGCACAATTGTATTGTAAGCCTCACTTTAAGAAAATGCCAAAATTGTGGTCAGAAGACAGTGAGCTTACCTCTATTTGGGGAGATCTCTATTTTCTCACTGGCAGTATTGTTATTCTGTGTGGCATTTGCAATTTTCTGGGCTGCTACTCGACAGGAATCATATTCATGGATTGGCCAAGATATCCTTGGCATCTGTTTGATGATAACAGTCTTGCAGTTGGCTCGATTACCTAATATTAAGGTTGCAACTGTACTCCTTTGTTGTGCCTTTGTCTATGACATTTTTTGGGTATTCATATCTCCAGTGATTTTCCACGAGAGTGTTATGATTGCCGTTGCTCGAGGTGACAAGGCTGGTGGAGAAGCAATTCCTATGCTTTTGAGATTTCCTCGTCTTTTTGATCCCTGGGGAGGTTATGACATGATTGGATTTGGAGATATTCTGTTTCCTGGTTTGCTTATTTCCTTTGCTCATAGATTTGACAAAGATAATAGGAGGGGAGCATCAAATGGATATTTTCTTTGGTTGGTAGTTGGCTATGGCATTGGCCTCGTTTTGACATATATGGGACTATATCTGATGAATGGAAATGGACAACCTGCACTTCTCTACCTTGTTCCATGCACACTAGGTGTCACAGTCATATTGGGATGTATAAGAGGTGAGTTGAAGAGCCTTTGGAATTATGGCACAGACTCATCGTTGTCCACAGAGCCCTCTGGCTCTGAAGTTTAA >Glyma.09G259000 ATGGTTTCACTCGGAGCTACCTGTGCTTTGTGCTGTTCTGTGTTGATTGTGTTTGTCACTTTGAGTTCGGCTGGGGACATAGTGCACCCTGATAGTATTGCTCCCAGAAGGCCTGGCTGTGACAACAACTTTGTCCTGGTTAAAGTCCCTACTTGGATTGATGGTGTGGAAAGCTTTGAGTATGTTGGCGTTGGTGCAAGATTTGGCCCTACATTAGAATCAAAAGAAAAACATGCTAACCATACTAGAGTTGCGATTGCGGACCCTCCTGATTGTTGTAGCAAGCCTAATAATAAGCTCACTGGCGAGATCATTTTGGTGCACCGAGGACAGTGTAGTTTCACAATCAAGGCAAATATAGCTGAAGAAGCTGGTGCTTCAGCCATCCTCATTATAAATTATCGTACAGAACTTTTCAAGATGGTTTGTGAAGCAAATGAAACCGATGTTGATATTGGAATACCTGCTGTCATGCTTCCACAAGATGCTGGTGAAAACTTGAAAAATCACATACTAAACAATTCAGTAGTGTCGGTGCAGTTGTATTCTCCATTGCGTCCATTGGTTGATGTTGCAGAAGTGTTTTTATGGCTTATGGCTGTTGGTACCATTCTCTGTGCTTCTTACTGGTCTGCCTGGTCAGCAAGAGAGTCTGCCATTGAGCAGGAGAAGCTATTAAAGGATGCTTCAGATGAATACGTAAATGCAGAGAATGCTGGTTCTAGTGCATATGTGGAAATCAGTACTGCAGCAGCAATATCATTTGTTGTGATTGCTTCTTGTTTCTTGGTTATGCTTTACAAATTAATGGCATATTGGTTTGTTGAAGTTCTGGTGGTTCTATTTTGCATTGGTGGGGTTGAGGGACTACAAACTTGCTTGGTGGCTCTGTTGTCATGTTTCAAATGGTTCCAGCATGCTGCACAAACATTTGTTAAAGTACCCTTCTTCGGTGCTGTATCATATCTGACAGTTGCTGTTACTCCCTTCTGCATTGTGTTTGCTGTGCTTTGGGGAATTTATCGCCGTGTATCATTTGCTTGGATTGGTCAAGATATTCTTGGCATCACATTGATAATCACAGTTCTTCAGATTGTGCGGATACCAAATCTCAAGGTTGGAACTGTTCTTCTCAGTTGTGCCTTCCTATACGACATCTTCTGGGTGTTTGTCTCTAAATGGTGGTTCCATGAGAGTGTGATGATAGTGGTAGCTCGAGGTGATAGGAGTGGAGAAGATGGTATCCCTATGCTACTCAAGATACCACGTATGTTTGATCCTTGGGGTGGTTACAGCATCATTGGTTTTGGGGACATCATCTTACCAGGGCTTCTAGTAGCATTTTCACTAAGGTATGATTGGTTGGCAAAGAAGAACCTTCGAGATGGGTACTTCTTGTGGGCAATGACCGCTTATGGTTTAGGTCTCCTTATCACATACGTGGCTTTGAACTTAATGGATGGACATGGTCAACCAGCTTTGCTTTATATAGTCCCATTTACACTTGGAACCTTTCTGTCATTGGGAAAGAAGAGAGGTGAACTCAAGGTTTTATGGACAAGAGGGGAACCAAAAATACCTTGCCCTCACATCCAAGAGGATCAATCAACAAACCAGTAA >Glyma.10G297400 ATGGCGTCCTCCCCTTCTTTGGCGGTGGCCGTCGTCGTCCTTCTATTGTTCGCAGCAGCAGCGGCCGCCGATGACGCCTCCTGCCATCATTCCTTGCAATTGACCAAGATAAAAAGCTGGATCGATGGGAATAAAGATGTGGACTATAATGGTATGACTGCAAAATTCGGCTCTTATTTGCCTGAAGATGCCGATCAAGCTGCCAAAACTCCTGCTCTTTTTTCTGATCCTATAGACTGCTGTTCCGCTTCAGCTTCAAAGTTATCCGGATCAGTTGCTCTCTGTGTACGGGGCACTTGTGACTTCACAACCAAAGCTGCATTTGCACAGTCCGCCGGTGCTACTGCCGCCTTGATGATCAACGACGCCGATGAACTCTTTGAGATGGAGTGCTCCAATGACACTAGCGTAAATATTTCAATTCCAGTTGTTGAGATAACTAAGTCAACAGGAGACGCTCTCAACAAACTTTTGACGTCTAAAAGGAAAGTGGAGGTTTTGTTATATGCTCCAACTCGCCCAGTTGTAGACTACTCAGTTGCCTTTTTGTGGTTGATGGCTGTTGGAACAGTTATATGTGCTTCACTATGGTCGGATATAACTGCTCCTGATCAAAATGATGAACGCTACAATGAATTGTCTCCCAAGAGCTCTATGTCTGAAGCAGGGAAAGACGATTCTGAGGACTTGGTTAACATAGATACAAAGGGTGCTATCATCTTCGTCATCACTGCATCTACTTTTCTTGTACTACTGTTCTTCTTCATGTCGTCTTGGTTTATCTGGGTGCTGATTATACTTTTCTGCATTGGTGGTATTGAGGGGATGCACAATTGTATTGTAAGCCTCGCTTTAAGAAAGCGTCCAAAATGTGGTCAGAAGACTCTGAATTTACCTATGTTTGGGGAGGTTTCTATTTTCTCGCTGGTAGTGTTACTATTCTGCGTGATATTTGCGGTTGTATGGGTTGCTACTCGGCGTGAATCATTTTCATGGTTTGGCCAAGATGCTCTTGGCATCGGTTTGATGATAACAGTCCTACAGTTGGCTCGGTTGCCTAATATTAAGGTTGCAACTGTACTCCTATGTTGTGCATTTGTATACGACATCTTTTGGGTATTCATATCTCCTGTGATATTCCAGAAGAGTGTTATGATTACAGTTGCTCGTGGTGACAAGGCCGGTGGTGAAGCAATTCCTATGCTTTTGAGATTTCCTCGTCTTTCTGATCCTTGGGGTGGCTATGATATGATTGGATTTGGAGATATTCTCTTTCCTGGTTTGCTTGTTTCCTTTACTCGTAGATTCGACAAAGCTAATAAGAAGGGGGTCGTAAGCGGATATTTTCTTTGGTTGGTAGTTGGCTATGGTTTTGGCCTCTTCTTCACATATCTGGGGCTATATATGATGAACGGTCATGGACAACCTGCACTGCTCTACCTGGTTCCATGTACACTAGGAGTAACTGTGGTATTGGGATGCAAAAGAGGTGAGCTAAAGTACCTTTGGAGCTATGATGCAGACTCCTCCTCGTCTTCGTCCAAAGAGCCTTCTCGAGTTTAG >Glyma.11G023300 ATGGCTTCGGAGAAGATTTCCTCGATTCTCTTGTTTTCTGCTGTAATTTTGCTTGTCCGTGATGCTCCTTCTGCCATAGCTGGGGACATAGTTCACGACGACGATTCAACTCCCAAAAAGCCCGGTTGCGAGAACCAGTTCGTTCTGGTAAAAGTGCAAACTTGGGTCAATGGTGTCGAGGATGTTGAATTTGTTGGTGTGGGTGCCAGATTTGGCAGAGCTATTGTGTCCAAAGAGAAAAATGCAAAGCACACGCGCCTTATTCTTTCAGATCCTCGGGATTGTTGTATTCCGCCAAAGAATAAGATTGTGGGAGATGTCATCATGGTGGATCGAGGCAACTGCACATTCACAAAAAAAGCAAATATTGCACAGAATGCTAATGCTTCGGCCATCCTCATCATAAATAACCAAAAAGAACTGTACAAGATGGTTTGCGAACCTGATGAAACTGATTTGAACATACACATACCTGCTGTCATGCTTCCATTAGATGCAGGTACAAGGCTGGAAAAAATGCTGACGACTACTTCATCTGTGTCTGTGCAGCTGTACTCACCATTTCGACCAGCTGTTGACATAGCAGAAGTATTTCTTTGGATGATGGCAGTTCTTACAATATTGTGTGCATCATATTGGTCAGCTTGGACAACCCGAGAAGCAGCTATTGAACAGGATAAGCTACTAAAGGATGCTTCAGATGAAATCCCAAACACTAAATATGCTAGTGTTAGCGGAGTTGTAAACATGAATGTGAAAGCTGCAGTGCTTTTTGTTGTATTTGCTTCATGTTTCCTGTTTATGCTTTACAAATTGATGTCGTCGTGGTTCATTGATGTCTTGGTTGTTCTCTTCTGTATTGGTGGTATTGAGGGCTTGCAAACATGCTTGGTTGCTCTTTTGTCCAGGTGGTTCAAGCATGCTGGAGAGTCATACATCAAAGTACCTTTCTTAGGAGCCATTTCATACCTGACTTTGGCTGTTTCTCCATTCTGTATAACATTTGCCGTTCTCTGGGCAGTTTATCGCAACGTATCCTTTGCCTGGATTGGTCAAGATATACTTGGAATTGCACTGATAATCACAGTTCTACAGATTGTACATGTACCAAATCTCAAGGTTGGTACAGTACTTCTCGGCTGTGCCTTCATTTACGACATCTTTTGGGTGTTTGTCTCAAAGAAGTTTTTCAAGGAAAGTGTCATGATTGTGGTAGCCCGAGGTGATCGAAGTGGAGAAGATGGAATTCCCATGTTACTGAAGTTCCCTCGTATTTTTGATCCATGGGGTGGTTACAGCATCATAGGTTTTGGAGACATCCTTTTACCAGGAATGCTGGTGGCATTCTCACTCAGGTACGATTGGCTGGCAAATAAGAGCCTTAGAAGTGGATATTTCTTGTGGGCAATGGTTGCATATGGCTTTGGCCTTTTAATTACGTACGTGGCACTAAACTTGATGGACGGGCATGGCCAACCGGCACTACTATACATCGTTCCATTTACCCTTGGGACCCTGATGACATTGGGGCGGAAGCGAGGAGATTTGAGGGTTTTGTGGACAAGTGGAGAACCTGAAACACCCTGCCCACATATAAGACTCCAACACAGTGGAGAATTAAGCCTTGAATGA >Glyma.18G233600 ATGGTTTCACTTGGAGCTACCTGTGCTCTGTGCTGTTCTATGTTCATGGTGTTTGTCACTTTGAGTTTGGCTGGGGACATAGTACACCCTGATAGTATTGCTCCCAGAAGGCCTGGCTGTGACAACAACTTTGTCCTGGTTAAAGTCCCTACTTGGATTGATGGTGTGGAAAGCTGTGAGTATGTTGGCGTTGGTGCAAGATTTGGCCCTACATTAGAATCAAAAGAAAAACATGCTAACCATACTAGAGTTGCGATAGCGGACCCTCCTGATTGTTGTAGCAAGCCTAAGAATAAGCTCACTGGCGAGATCATTTTGGTGCACCGAGGACAATGTAGTTTCACAACCAAGGCAAATATAGCTGAAGAAGCTGGTGCTTCAGCCATCCTCATTATAAATTATCGTACAGAACTTTTCAAGATGGTTTGTGAAGCGAATGAAACTGATGTTGATATTGGAATACCTGCTGTCATGCTTCCACAAGATGCTGGTGAAAACTTGAAAAATCACATACTAAACAATTCAGTAGTGTCGGTGCAGTTGTATTCTCCACTGCGTCCATTGGTTGATGTTGCAGAAGTGTTTTTATGGCTTATGGCTGTCGGTACCATTCTCTGTGCTTCTTACTGGTCTGCCTGGACTGCAAGAGAGTCTGCCATTGAGCAGGAGAAGCTATTAAAGGATGCTTCAGATGAATACATAAATGCAGAGAATGCTGGTTCTAGTGCATATGTGGAAATCAGTACTGCAGCGGCAATATCATTTGTTGTGATTGCTTCTTGTTTCTTGGTTATGCTTTACAAATTAATGGCATATTGGTTTGTTGAAGTTCTGGTGGTTTTATTTTGCATTGGTGGGGTTGAGGGACTACAAACTTGCTTGGTGGCTCTGTTATCATGTTTCAAATGGTTCCAGCATGCTGCACAAACATTTGTGAAAGTACCTTTCTTTGGTGCTGTATCATATCTGACAGTTGCTGTTACTCCCTTCTGCATTGTGTTTGCTGTGCTTTGGGGAGTTTATCGCCGTGTATCATTTGCTTGGATTGGTCAAGATATTCTTGGCATCACATTGATAATTACAGTTCTTCAGATTGTGCGGATACCAAATCTCAAGGTCGGAACTGTTCTTCTCAGTTGTGCCTTCCTATACGACATCTTCTGGGTGTTTGTCTCTAAATGGTGGTTCCATGAGAGTGTGATGATAGTGGTAGCTCGAGGTGATAGGAGTGGAGAAGATGGTATCCCTATGCTACTCAAGATACCACGTATGTTTGATCCCTGGGGTGGTTACAGCATCATTGGTTTTGGGGACATCATCTTACCAGGGCTTCTAGTAGCATTTTCACTAAGGTATGATTGGTTGGCAAAGAAGAACCTTCGAGATGGGTACTTCTTGTGGGCAATGACTGCTTATGGTTTAGGTCTCCTTATCACATACGTGGCTTTGAACTTAATGGATGGACATGGTCAACCAGCTTTGCTTTATATAGTCCCATTTACACTTGGAACCTTTTTGTCATTGGGAAAGAAGAGAGGTGAACTCAAGGTTTTATGGACAAGAGGGGAACCAAAAATACCTTGCCCTCACATCCAAGAGAATCAATCAACAAACCAGTAA >Glyma.18G300700 ATGACGTTTCGTGTGTTGCTGTTACTGGTGGTGTTGTTGTTTGTGATTGGCGCGGGCGCCGACGATGCCAAACGCGACGACGACAGGGCTCCCAAGTCGGAATCCTGCAATAACCCCTTCCAATTGGTGAAGGTGGAGAGCTGGGTGGACGGTGAGGAAGGGCATGTCCACAATGGCGTCAGTGCCAGATTTGGGTCTGTGTTGCCGGACAAACCTGACAAGAGTGTCAGAACTCCCGCAATATTCGCTAATCCCATAGACTGCTGTTCCAATTCAACTTCAAAGTTATCTGGCTCAGTTGCTCTCTGTGTCCGTGGGGGCTGTGACTTCACTGTTAAAGCTTATTTTGCTCAATCTGGAGCTGCTACTGCCATCTTGGTCATTAACGACTCACAAGATCTCTTTGAGATGGTTTGCTCCAATAGCAGTGAAGCAAATATTTCAATTCCAGTAGTCATGATAGCAAAGTCAGCAGGACAATCTCTCAACAAGTCTTTCACATCTGGAAGCAAAGTGGAAATTTTGTTATATGCTCCGCCTCGGCCACTTGTGGACTTCTCAGTTGCATTTTTGTGGTTGATGTCTGTTGGAACTATTGTATGTGCTTCACTATGGTCCGATCTGACTACCCCAGAGAAGTCTGATGAACGCTATAACAAATTGTGCCCCAAGGAATCTTCTAATGCTGAAACAGAAAAAGATGATTTGGACAAGGAAATTGTTAACATTGATTCAAAGGGTGCTGTCATATTTGTCATAGCAGCGTCTACCTTTCTTGTGCTATTGTTCTTCTTCATGTCAACTTGGTTTGTCTGGGTGCTGATTGTACTTTTCTGCATTGGTGGTATTGAGGGTATGCACAATTGTATTGTAAGCCTCACTTTAAGAAAATGCCAAAATTGTGGTCAGAAGACAGTGAGCTTACCTCTATTTGGGGAGATTTCTATTTTCTCCCTGGCAGTATTGTTATTCTGTGTGGCATTTGCAATTTTCTGGGCTGCTACTCGACAGGAATCATATTCATGGACTGGCCAAGATATCCTTGGCATCTGTTTGATGATAACAGTCTTGCAGTTGGCTCGATTACCTAATATTAAGGTTGCAACTGTACTCCTTTGTTGTGCTTTTGTCTATGACATTTTTTGGGTATTCATATCTCCAGTGATTTTCCATGAGAGTGTTATGATTGCAGTTGCTCGAGGTGACAAGGCTGGTGGGGAAGCAATTCCTATGCTTTTGAGATTTCCTCGTCTTTTTGATCCCTGGGGAGGTTATGACATGATTGGATTTGGAGATATTCTGTTTCCTGGTTTGCTTATTTCCTTTGCTCATAGATTCGACAAAGATAATGGAAGGGGAGCATCAAATGGATATTTTCTTTGGTTGGTAGTTGGCTATGGCATCGGCCTCGTTTTGACATATTTGGGACTATACCTGATGAACGGAAATGGACAACCTGCACTTCTCTACCTTGTTCCATGTACACTAGGTGTCACAGTCATACTGGGATGTATAAGAGGTGAGTTGGAGAGCCTTTGGAATTATGGCACAGACTCATCGTTGTCCACAGAGCCCCCTGGCTCTGAAGTTTAA >Glyma.20G248600 ATGGCGTCGTCCCCTTCTTTGGCGGTGGCCGTCGTCGTCCTTCTATTATTGGCGTTGTTCGCAGCAGCGGCCGCCGATGACGCCTCCTGCCATCATGACCTGCAATTGGTGAAGATAAAGAGCTGGATCGATGGGAAGAAAGATGTTGACTATAACGGTATGACTGCTAGATTCAGCTCTTATTTGCCTGAAGATGCCGATCAAGCTTCCAAAACTCCTGCTCTTTTTTCTGATCCTATTGACTGCTGTTCCTCTTCAACTTCAAAGTTATCCGGATCAGTTGCTCTCTGTGTACGGGGTACTTGTGACTTCACAACTAAAGCTACATTTGCACAGTCCGCAGGTGCCACTGCCACCTTGATGATAAACAACGCCGATGAACTCTTTGAGATGGAGTGCTCCAATTACACCAGGATAAATATTTCAATTCCAGTTGTGGAGATAACTAAGTCAACAGGAGACACTCTCAACAAACTTTTGACGTCTAAAAGTAAAGTGGAGATTTTGTTATATGCTCCAACTCGCCCAGTTGTAGACTACTCAGTTGCATTTTTGTGGTTGATGGCTGTTGGAACAGTTATATGTGCTTCACTATGGTCAGATATAACTGCTCCTGATCAAACTGATGAACGCTATAATGAATTGTCTCCCAAGAGCTTGTCTGAAGCAGGGAAAGATGATTCTGAGGACTTGGTTAACATAGATACAAAGGGTGCTATCGTCTTCGTCATTACGGCATCTACTTTTCTTGTGCTACTGTTCTTCTTCATGTCGTCTTGGTTTATCTGGGTGCTGATTATACTTTTCTGCATTGGTGGTATTGAGGGGATGCACAATTGTATTGTAAGCCTCGCTTTAAGAAAGCGTCCAAAATGTGGTCAGAAGACTCAGAATTTACCTATGTTTGGAGAGGTTTCTATTTTCTCGCTGGTAGTGTTACTATTCTGCGTGATATTTGCGGTTGTGTGGGTTGCTACTCGGCATGAATCATTTTCATGGTTTGGCCAAGATACTCTTGGCATTGGTTTGATGATAACAGTCTTACAGTTGGCTCGGTTGCCTAATATTAAGGTTGCAACTGTACTCCTTTGTTGTGCATTTGTATACGACATCTTTTGGGTATTCATATCTCCAGTGATATTCCAGAAGAGTGTTATGATTACAGTTGCTCGTGGTGACAAGGCCGGTGGTGAAGCAATTCCTATGCTTTTGAGATTTCCTCGTCTTTCTGATCCTTGGGGTGGCTATGATATGATTGGATTTGGAGATATTCTCTTTCCTGGTTTGCTTGTTTCCTTTGCTCGTAGATTCGACAAAGCTAATAAGAAGGGGGTCGCAAGCGGATATTTTCTTTGGTTGGTAATTGGCTATGGTTTTGGCCTCTTCTTCACATATCTGGGGCTATATATGATGAACGGTCATGGACAACCTGCACTGCTGTACCTGGTTCCATGTACACTAGGAGTGACTGTGGTATTGGGATGCAAAAGAGGTGAGCTAAAGTACCTTTGGAGCTATGATGCAGACTCCTCCTCCTCGTCTTAG >MELO3C005684 ATGGATTTTCAGAGGCATTTTCTTGGTGGGTTTTTCATATCCGCTTTGGTTTTGCTGCTGATGTTTCCCTCTCACGTGACTTCTGGGGATATAGTTCATCATGACGATTTGACTCCCAAAAAGCCTGGCTGTGAGAACGACTTCATTCTGGTTAAAGTTCAAACTTGGATTGATGGCAAAGAAGCTAGTGAATTTGTCGGTGTTGGTGCCAGATTTGGCGCTACCATTGTGTCAAAGGAGAAAAATGCAAACCAAACACGCCTGGTTCTTGCAAATCCCCGTGATTGTTGCAGTGTGCCAAAGAACAAGCTTTCTGGAGATATAATCATGGTTGATCGAGGTCACTGCAAATTTACTACAAAAGCAAATATTGCAGAAGCTGCAGGTGCTTCAGCTATACTTATAGTAAATAATCAAAAAGAACTTTACAAGATGGTTTGTGATCCCGATGAGACTGATCTCAATATACATATACCTGCTGTCATGCTTCCACAAGATGCAGGAACTAGCTTGGAGAAGATGCTAATCAGTAATTCATCTGTGTCTGTTCAGCTCTACTCTCCACTACGACCACCAGTTGACATAGCTGAAGTATTCTTATGGTTGATGGCTGTTGGTACGATCTTGTGCTCATCTTTTTGGTCTGCCTGGAGTGCCAGGGAAGCAGCTATCGAGCAGGACAAGCTGCTAAAGGATGGTGCAGATGATATTCAAAATCCTGAAGACGTAGGCAGCCCTGGTGTTGTATATATTAACATGGCATCAGCAGTTTTATTTGTCGTCGTTGCTTCATGCTTTTTGATTTTGCTTTACAAACTCATGTCATACTGGTTCATCGAGCTTTTGGTAGTTCTTTTCTGCATAGGAGGTGCAGAGGGTTTGCAAACTTGTTTGGTTGCTTTATTGTCAAGATGCTTTAAGCAAGTTGGAGAATCATACATCAAAGTTCCATTCTTTGGAGCTGTTTCTTACCTCACGGTTGCTGTTTCTCCATTCTGCATAGCATTTGCTGTCGTTTGGGCTGTTTATCGGAATGTGTCATTTGCCTGGATCGGTCAAGACGTACTTGGGATTGCACTGATAATTACAGTACTTCAAATAGTTCACATACCGAATCTTAAGGTTGGAACAGTGCTCCTCAGTTGTGCATTCCTCTATGATATCTTTTGGGTATTTGTTTCTTAA >MELO3C021207 ATGAATTCGCGGGGAGATGTGATTACTACGGTGCTTTTGGGTTTGATGCTGAGTTTGAGCTTGGTTTCAGCTGGGGATATAGTTCATCAGGACAGTGTCGCACCTACACGTCCTGGTTGTGAGAATAATTTCGTTTTGGTGAAAGTCCCTACTTGGGTCAATGGTGTAGAAGCCACTGAATATGTTGGTGTTGGTGCACGATTTGGCCCATCCTTAGAATCAAAGGAGAAACATGCCACCCGCACTAGAGTTGCTCTGGCAGATCCTCCTGATTGTTGCAGTATGCCCAGGAATAAGCTGACTGGAGAGGTCATTTTAGTACTCCGTGGAAATTGTAGTTTCACAAATAAGGCAAATATTGCAGAGGCCGCTAATGCATCAGCCATCCTTATCATTAATAACAGTAAAGAACTTTTCAAGATGGTCTGTGAGGAGAATGAAACTGATGTAACCATAGGCATACCTGCTGTTATGCTCCCTCAAGATGCTGGTGAAAGCTTACAGAAGGATTTGAAAAGCAATATCTCAGTATCTGTGCAACTTTATTCCCCGCTTCGACCAGTAGTAGATGTTGCAGAAGTATTTTTATGGCTTATGGCTGTTGGTACTGTCTTGTTGGCCTCTTATTGGTCTGCATGGACTGCAAGAGAAGTGGCTATTGAGCAAGACAAGCTGTTGAAGGATGGTTCAGATGAGTTGCTGCAGATGGAAGCAACTGGTTCCAGTGGTTACATAGATATTAACACTACAGCAGCAATTCTATTTGTCGTGATTGCTTCATGTTTCTTGGTTATGCTCTACAAACTAATGTCTGCCTGGTTCCTTGATGTTCTGGTGGTTCTGTTTTGCATTGGTGGTGCAGAGGGACTACAAACTTGCTTGGTGGCTTTGTTATCATGTTTCAGATGGTTTGAACATGCTGCTGAGTCATATATCAAAGTACCCTTCTTTGGAGCGGTGTCACATCTTACGTTGGCAGTTTCTCCTTTCTGCATATCATTTGCTGTTCTTTGGGCTTGTTACCGCAAAAAATCTTTTGCTTGGATAGGCCAAGATATCCTTGGTATTGCGCTCATAGTTACAGTCCTCCAGATCGTTCGAGTTCCTAATCTCAAGGTTGGGACGGTGCTCCTTAGCTGTGCCTTCTTATACGACATTTTTTGGGTATTTGTATCAAAATGGTGGTTCCACGAGAGTGTTATGATAGTGGTTGCTCGCGGAGATAAGAGTGGGGAAGATGGTATTCCCATGTTGCTAAAGATTCCACGGATGTTTGATCCTTGGGGAGGGTACAGCATTATCGGATTTGGTGATATTATCTTGCCAGGACTTTTAGTTGCATTCTCACTAAGATATGATTGGCTTGCAAAAAAGAAACTCCGAGCAGGTTACTTTGTTTGGGCAATGACTGCTTATGGCACAGGCCTACTCATCACTTACGTAGCTTTGAATTTAATGGATGGACATGGGCAACCAGCTTTGTTATACATTGTTCCTTTCACCCTTGGCACATTTTTGACTCTGGGAAAGCAAAGAAGGGATCTTAAGATTCTTTGGACAAGAGGAGAACCAGAAAGGCCTTGTCCACACATCCAACTCCAACCCTCATCTCAACATTAA >MELO3C026131 ATGGCGTTCTCTTCTTCTCCGACGACACCTTCAATCATCCCTCTCTTATCACTCCTCTTTCTCATTTTTCTCTTCCGCATCTCCTCTGTTTTTGCCGACGATGTCTCTCTCGATGACGATTCCGCTCCCAAGTCCGGAAATTGCAACAATCCCTTCGAATTGGTCAAAGTTAAGAGCTGGGTTAATGATGCTGAAGATGAAATCTTCGTGGGTTTAAGTGCAAGATTTGGGACTTTAGTGCCTTCTCAGGCTGAAGATGATCTCAAATTGCCAGCTGTTTATATGAATCCTACAAATGGCTGTTCTAGTTCTTCTTCAAAGCTATCTGGGTCAATTGCCTTGTCTATACGTGGTGAATGTGACTTCACAATTAAGGCAGAAATTGCACAGGCTGGGGGTGCTGCAGCCCTGTTGGTGATAAATGACAAAGAAGATCTTTACAAGATGGTCTGCTCTGAAAAAGACACTGCTCTCAATATTTCAATTCCTGTTGTAATGCTTCCCAAGTCCAGCGGAGATGCTCTTAACAAACTAATAACTGACGGAAAGAGTGTGAAACTTCTATTATATGCTCCAAAACGTCCGGTTGTGGACTTCTCTGTTGTGTTTTTGTGGATGATGGCTGTTGGAACAGTTGCATGTGCTACACTTTGGTCAGAGATCACTGCAGTGCAGACTGAGGAGCGCTATAATGAATTATCACCAAAGGAATCTTCCAATCCTGGAGGAGCCAAAGATGACTCTGAGGATGAAACCCTTGATATTAATGTTAAGAGTGCCATTGTATTTGTCATTACGGCATCTAGTTTCTTGGTGCTGCTCTATTTCTTTATGTCTTCTTGGTTCGTTTGGCTGTTGATTGTAATGTTCTGCATCGGTGGTGTTGAGGGTATGCATTCCTGTATATTAGGACTGATATTAAGAAAAGGCCAAAGTTGCGGGAAGAGGACTCTGGATTTGCCTGTAGTAGGGGAGGTCTCCATTCTTTCACTTGTTGTGCTGCTTTGTTGTATAACTTTTGCGGTCTTCTGGGCTCTAAATCGACGTGCATCATATTCTTGGATTGGGCAAAATATTCTTGGTATTTGCCTGATGATAACAGTCTTGCAGATGGCCCGATTACCTAATATTAAGGTAGCAACAGTACTTCTTTGCTGTGCATTTATCTATGACATCTTCTGGGTGTTCATATCACCTGTAATATTCCACGAGAGTGTAATGATTGCGGTTGCCCGAGGAGACAATAGTGGTGGAGAATCCATTCCAATGCTCTTAAGGGTTCCTCGAACTTTTGATCCTTGGGGTGGTTTTGACATGATTGGATTTGGGGATATACTCTTCCCTGGTCTGCTTGTTTCGTTTACTCACAGATTTGACAAAGCGCAAAAGAAAAGCAAGTGTAATGCATATTTTCCGTGGTTGCTTGTTGGTTACGCCACTGGTCTCTTCTTAACATATTTGGGCTTATATTTTATGAATGGACATGGTCAACCTGCACTCCTTTATCTTGTCCCATGCACCTTAGGTGTTACCGTTGTTTTGGGTTTGATCCGAGGGGAGCTTAAGCTACTTTGGAGTTATGGGACAGAAAATCCGGTGCATAGGGAACCTTCTGGAGAAGCTTAA >Eucgr.D01835 ATGGAGCTCCGGGGAGTCTGGTGGCGGGCGATCTCCGTCGCCGCCGTGATCTGGCTGGCGGCGTGCGGCCCCCGCCCCGCGGCGGCCGGCGACATCGCCCAAGACGACGAGAACGCTCCCAAGAAGCCCGGCTGCAACAACCAATTCGTCCTGGTTAAAGTCCAAACCTGGGTTAATGGATTGGAGAGCAGAGAATTTGTTGGTGTTAGTGCTAGATTCGGTGTACCAATTGTGTCAAAGGAGAAAAATGCAGACCAATCGCCCCTTACTCTATCAGATCCTCGCGATTGTTGCCGCCCGCCAAATAAGCTCACTGGTGATGTCATCATGGTGGATCGAGGCAACTGCACATTTACTACAAAAGCAAATAATGCAGAACTTGCTGATGCATCAGCCATCCTAATTGTAAACAACCAAAAAGAACTATACAAGATGGTTTGTGATCCCGAAGAAACTGATCTGGATATAAAAATACCGGCGGTCATGCTCCCGCAGGATGCTGGTTCAAGCCTCGTGAAAATGCTGATGAATGGTTCATCAGTGTCTGTGCAGCTATATTCTCCTACACGTCCTTTAGTTGACATCGCTGAAGTATTTCTATGGCTAATGGCTGTTGGTACCATCCTCTGTGCCTCATACTGGTCTGCATGGAGTGCTAGAGAAGCAGCTCTCGAGCAGGACAAGCTAACAAAGGATGCTGTGGATGAACTTACAGACGACAAGCATGTAAAGGCAACTGGTGTTGTAGAAATCAGCACAACTTCAGCCGTCCTCTTTGTCATCATTGCTTCGGGCTTCTTGATCGTTCTTTACAAACTTATGTCTACCTGGTTCATAGAACTGTTGGTGGTTCTTTTCTGCATAGGTGGTGTAGAGGGCTTACAAACTTGCTTGGTTGCTTTATTGTCAAGATGGTTCAGAAATTTCGGGGATTCATACACCAAAGTACCGTTCTTTGGAGCTGTGTCGTACCTGACCTTGGCTGTTTCTCCATTCTGCATAGCATTTGCTGTTGTTTGGGCTGTTTATCGAAATACTAACTTCGCCTGGATTGGTCAAGATATACTTGGGATTGCTCTGATAATCACCGTTCTTCAAATTGTTCGAATTCCAAATCTCAAGGTGGGAACAGTTCTTCTAAGCTGTGCTTTCTTGTATGACATTTTCTGGGTGTTCGTTTCAAAGAAGCTGTTCAAAGAAAGTGTGATGATTGTGGTTGCTCGAGGTGATAGAAGTGGAGAGGATGGAATTCCAATGCTGTTAAAGATCCCCAGAATGTTCGATCCATGGGGTGGTTATAGCATTATAGGATTTGGGGACATTCTTTTGCCAGGACTGGTGGTAGCATTTTCGCTCAGATATGATTGGCTGGCAAATAAGAATCTTCGAGCTGGATACTTCTTGTGGGCAATGCTTGCTTATGGATTAGGTCTTCTTGTAACTTATGTGGCATTGAATTTGATGGATGGGCATGGGCAACCTGCCTTGCTTTACATTGTTCCATTTACGCTCGGAACCTTTTTAGCATTGGGAAGGAGGCGAGGTGATCTAAAGGTACTATGGACCAGAGGAGAACCAGAGAGACCCTGTCCACACGTGCGACTACATTCTAGCGAGGAAGTGGATCAAGATTATTGA >Eucgr.D02301 ATGAAGGGGAGGGAGGTCGCAATCCGCCGCGCGGCGTGGCTTCTGGTCGCGTGCTTGAGCCTCCGGCCGGTCTTTTCCGGCGACATAGTGCACCAAGACGACGTCGCGCCGAAGAGGGCCGGCTGCGAGAACAACTTCGTCCTGGTGAAAGTACCTACTTGGCTGAATGGTGTTGAAGACATTGAGTATGTTGGTGTGGGTGCTCGATTTGGCCTTACACTAGAATCAAAAGAGAAACATGCCAACAATACTAAAGTTGTGATCGCAGATCCTCCTGATTTTTGTACAAGGCCCAAGGAAAAGCTTAAAGGGGAGGTCGTTGTGGTGCAAAGAGGTAACTGCAGTTTCACAACTAAGTCAAATATTGCCGAAGATGCTAATGCAACTGCAATACTCATCATAAATAACGGTACAGAACTCTTCAAGATGGTTTGCGAAGTGAATCAAACAGATGTCAAGATTGGCATTCCGGCTGTCATGCTCCCACAAGATGCTGGCGCAAACTTGGAGAAGCTTATAAAAACGTATACGAATGTCTCAGTGCAGTTATACTCCCCACAGCGTCCATTAGTGGATGTTGCAGAAGTGTTCTTATGGCTTATGGCCGTTGGGACCATCTTATGTGCTTCTTATTGGTCTGCAAGGAGTGCTAGAGAAGCAGCTATCGAGCATGAGAAATTGCTGAAGGATGCCTCTGATGAGTTGGGCGAAATCGAAGGCATTGGTTCCAGTGGTGTTGTGGACATAAACACGACATCTGCTGTTCTCTTTGTTGTAGTTGCTTCATGTTTCTTGGTCATGCTGTACAAACTGATGTCTTACTGGTTTATTGAGGTTCTGGTGGTTCTGTTTTGCATTGGTGGAGTAGAGGGTCTGCAAACTTGTTTGGTGGCTTTTCTCTCGTGTTTCAGATGGTTTGAGAATTCTGCGCAATCATTCGTGAAGTTACCCATCTTTGGAGCCGTTTCACACCTAACTTTGGCTCTTTCTCCATTCTGCATAGCCTTTGCTGTCCTTTGGGCAGTTTTCCGCCGTGTTTCCTACGCGTGGATAGGTCAAGATATACTTGGAATTGCTTTGATAATCACGGTTCTTCAGATAATTCGCCTACCAAATCTCAAGGTTGGAACAGTGCTTCTTAGCTGTGCTTTCTTGTATGACATCTTCTGGGTATTTGTTTCCAAATGGTGGTTCCATGAAAGTGTGATGATAGTGGTTGCACGTGGCGATAAGAGTGGAGAAGATGGGATCCCCATGCTACTGAAAATTCCACGACTCTTTGACCCTTGGGGTGGATATAGCATCATTGGGTTTGGAGATATCATCTTACCCGGTCTGCTAGTGGTGTTCTCATTAAGGTATGATATGTTGGCAAAAAAGAAGATTCGAGAAGGATACTTCTTGTGGGCAATGATTGCTTATGGTCTAGGACTGCTCATCACTTATGTGGCTTTGAATTTGATGGATGGACATGGGCAACCTGCTTTGCTTTATATTGTTCCCTTCACGCTCGGGACCTTTTTGACATTGGGAAAACAGAGAGGCGATCTCATGACTTTGTGGACAAGAGGCGAGCCAGAGAGACCATGCCCGCACATCCGACTTCAACCCTCTCAATGA >Eucgr.H02617 ATGGCGTCCCCGCCTCCGATCCTCCTCCCCCTCCTCCTCCTCCTCCTCCTCCTCCTCGCCGGAGCACCTCCGCTCGCCGCCGCGTCGGACACCTCGTACGACGACAAGGACGCCCCGTCCTCCGCCTCCTGCCGCAACGATTTCCAATTGGTAAAAGTTAAAAGTTGGGTTAATGGCAGCAAAGGTAAAACTTTAAATGGTCTAAGTGCAAGATTTGGGGCCTTGCTGCCTTCTGATGCTGAAAAAGGAGTCAAACTATCTCTTGTCTTGTCAAATCCTGCAAACTGCTGCTCAAATTCCTCCACAGAGCTAAAGGGATCTATTGCTTTAGCCACACGTGGAGATTGTGACTTCACAGCCAAGGCAGAAATTGCACAACTAGAAAGTGCTGCAGGCCTTTTGGTGATAAATGACGATGATGAACTTTTTGAGATGGTTTGCCCTAAAAATGGTACTGCTATCAACATATCAATTCCTGTCATAATGATAACGAAGTCTGCTGGAAGTACTCTGAAATCTATGCTAGTTGATGGACGAGTGGAGATACTATTACACTCCCCAAATCGCCCACTAGTTGACTTCTCTGTTGTCTTTCTATGGATGATGGCTGTCGGAACGATTGTCTGTGCTTCACTTTGGTCTGATTTCACAGCTGCTGAGCAGACTGATGAGCGCTATAATGAACTGTCACCAAAGGTGCCTACAGATGCTGGAATAGCCAAAGATGATTCTGAGAAGGAAGTCTTGGATATAAGTGTAACGGGTGCTGTTTGTTTTGTCATTACGGCATCGATATTTCTCGTGCTACTCTATTTCTTCATGTCATCATGGGTCTTATGGGTGCTGATAGTTCTCTTCTGCATTGGTGGTATTGAGGGCATGCATTCTATTATATTAGGTTTAATCTCAAGCAGAAAATCCAGAAACCGTAGCCAGAAGATGGTGAGCATGCCTCTGATAGGAGAGGTGTCGTGGATCTCTGTTATCGTGCTACTTCTTTGCATGGCATTTGCCATTTTCTGGGCTGTAAATCAGGAGGCTTCCTGGGCTTGGATTGGACAAGATATTCTTGGAATTTGCATGATGATAACAGTATTGCAGATTGCTCGCCTTCCAAATATTAAGGTGGCATCGGTTCTACTATGTTGCGCATTTCTTTATGATATCTTCTGGGTCTTCCTCTCACCTCTTCTTTTCAAAGAAAGCGTTATGGTTGTGGTTGCTCGAGGTGACAATAGTGGTGGAGCTTCCATTCCTATGCTGTTGAGAGTCCCTCGGGTCTTTGACCCCTGGGGTGGTTATGATATGATTGGGTTTGGGGACATTCTTTTTCCTGGTCTTCTTGTTTCACTTCTTTGCAGATTTGACAAAGATAATAAGAGAGGTTTACTAAATGGATATTTTCTCTGGAGTACAGTTGGATATGGAGTTGGCCTCTGTCTTACATACCTAGGCTTGTACCTTATGAATGGTCATGGCCAACCCGCTCTTCTTTACCTTGTTCCTTGTACATTAGGGCTCTCTATAGTTTTGGCTTTGACAAGAAGAGAATTGAAACACCTCTTGAACTATGGTAACGAGCCATCGTCCTCAGATGATCATGCTGAGGAAGCTTGA >DCAR_004092 ATGGCGGCATCATACACGATACTCTTCTTCTTATTATGTTCACTCTCCACTGCTTTTTGTGCCGCTTCCGATTCTTCTTCTGCTTGCCGCACCGCTGCACAAGAGGTCATAATTAGGATTTGGGTTAATGGAACTGAAGGCGAGAATATTCAAGGCCTAGGTGCATTATTTGGTGGCACATTACCTGTACATGAGAAAGAAGGGATTAGACTACCTGCTATTATTCCGCAACCCGTAGACTGCTGTTCCAACCTTTCTTCAGAGTTATCTGGATCTATTGCAGTATGTCAACGCGGGGTCTGTGATTTCTCAACAAAAGCTGAAGTGGCACAATCAGGAGGTGCATCTGGAATGTTGGTGATAAATAGTGAAGCAGATGGGCTACCTGTGATGGATTGTCCCCACACTAAAACCCTTAATATCAGTATTCCATCTGTGGTCGTCACAAAGTCGGATGGGGAGGTTCTAAGCAAGGCTTTGGCTGGTGGAAGCAGTGTGGAATTACTACTTTATGCACCTGTTCGTCCAGTGCTGGATATGTCAGTGCTATTTTTATGGTTTATGGCTGTTGGGACCGTAACTTGTGCTTCACTTTGGAAAGGCTTAACAGTATGCGATAAAATTGAGGGGAGCTATAGCCAACTGTCACAGAAGGAATCCTCAGAGACCGATGAAGATGATGAAGAAGTTGTTGAAATTAATGTGATGAGTGCCGTTGTTTTCGTCATCACAGCATCCACATTTCTGCTTCTGCTGTATTATTTTATGTCATCTTGGTTTGTGTGGTTGCTGATTGTACTTTTCTGCATTGGTGGTATCCAGGGAATGCATAATTGTGTAGTATCTCTTGTGTTAAGTAAATGGAGAAACTTGGGGAAAAGAAAAGTGAATGTTCCGGTATTCGGAAATGTCTCTATTTTCTCTTTAATTGTTTTGGTCTGCTGCTTTGCATTTACGGTTTTCTGGGCTGCACATCGGAAGGCATCATATTCTTGGATTGGACAAGACATTCTTAAAGTAGGGCGCGCCACTTACCCATCGCACCACGCACCGGCTACGTTTGGGTACGGGGACGCAGCCAAATACGTACGTGTTAAGTTAATTCAGGCTTGCATTAATCTGAAGAGACGACTGAGAAAGGAAGGAGAATCGCCATTCTATCTCCTTTTCTGTTACCGATTACCAGTTCTCGTTGCCGATGTATTGATTAAGATGTGTACTGGTATCTTTTTGATCATAACAGTTCTGCAATTGGCTCAGTTACCAAATATAAAGGTCGCTACTGTGCTTCTTTGCTGTGCTTTCCTTTATGACATCTTTTGGGTTTTTCTGTCTCCTGAAATATTCGGCAACAGTGTTATGATTGCAGTTGCTGAAGGTGATAATAGTGGCGGGGAATCTATTCCAATGCTTTTGAGAGTCCCTCGGTTTTTTGATCCTTTTGGTGGATATAACATGATTGGATTTGGGGACCTTGTGTTCCCCGGTTTGCTTGTTGCATTTTCTCTGAGGTATGACAATGAAAAGAAGAAAGGTCTGGCAAATGGATATTTTCTATGGTTGATTGCTGGCTATGGACTAGGCCTTCTTTTCACTTACCTAGCTTTGTATTTAATGAACGGCCAAGGCCAACCAGCTCTTTTGTATCTCGTTCCATGTACTCTAGGAACGATTGTGATATTGGGTTGGGTAAGAGGTGAATTAAAAGACCTCTGGAATTACAACGTAGAGGATCAGTCGCCAACTAATAATAGTTCGGGAAGAAGCTCGACAGATAAGGTTGATGGTGTCTCTGAGACGAATGATATCGAGGTGCAGAGTCCTTTATCTATGTAA >DCAR_005534 ATGCCGCTCCCATTTGTCGCAAGTCTGAAGATGTTCGAGAGGTATTGGATTAATGATGAGAAAGTTGATCAAGTTGTGGGTTTGGATGCAAAATTTGGTGCTGACTTACCCCAAGAAAAGGAACATGCTACTAAACTACCTGCAAAAAATCCTAATCCCTCGGATTGTTGTTCTACTCTAAGCGAAAAGTTATCTGGCTCAATTGCCGTGTGCCCACGTGGTACTTGTGAGTTCTCGGTGAAGGCTGAAGTCGCAGAATCTGGAGGTGCAGCTATTTTGCTATTGATTAATGATGATCCAGATGAGCTTCCTGTGATTGATTGTCCGAGCAATAAATCTGTAGATATTAAAATTCCCGTTGTCATTATCACAAAGTCTGATGGAGACCGTTTCACCAATTCCATGGGAGGTAAAAACAACGTGGAATTACTACTATATGCGCCAGAGCGCTCGATCGTTGACCCGTCTGTGGTATTCCTGTGGTTTATGACTGTTGGGACTGTAGCATGTGCTGCAGTTTGGTCAGAGTTTACTGCAAGCAAACAAAGTGAGGAGAGCTCTGATGAATTTTCACCAAAGAAATCTTCGAAGGTTGGAGCAGATGATGATGAGGATGAAATCGTAGAAGTTAACCTAATGAGTGCGGTTACATTTGTCATAACCGCATCTGTTTTTCTGCTACTGCTATATTTTTTCATGTCGGCATCGTTTGTCTGGGTGTTGATTATACTTTTCTGCATTGGGGGTGTTCAGGGTATCTGTTTGATGATAACAGTTTTGCAGCTGGCTCAATTACCTAATATTAAGGTTGCTACTGCACTTCTTTCTTGTGCTTTCTGTTATGACATCTTTTGGGTTTTCATTTCTCCTTATATATTCGGTAGCAGCGTTATGATTTCGGTTGCCAAAGGTGATAATAGTGGCGGAGAATCCATTCCGATGCTATTAAGATCCCCAAAATTTCACGATCCCTTTGGTGGTTATAACATGATTGGTTTCGGAGACATCCTGTTCCCAGGGTTGCTCGTTGCGTATGCTTTTAGGTACTTTTTATTGTTTAAATCTTTTTTACTGTTAACAAATAACATGTTTGATTCCCTTACCCTTATTGTTATATATAGGCATAACTTTCTCATTGTTCTACAATAA >DCAR_006933 ATGGAGCTCAAGAGAGCTTGGTTTGCTTTAGTTTTTGTGGTGGGTTTATTGTCTTCTTCACAGGTGTTTGCTGGTGATATTGTTCATCAAGATGATGTGGCTCCAAAGAAGCCTGGTTGTGAGAACAATTTTGTTCTGGTAAAAGTACCCACATGGATTGATGGTCAAGAAGAAGATGAGTTTGTCGGTGTTGGTGCTCGATTTGGTCCCACCTTAGAATCAAAGGAGAGGAAAGCAAGCCAGACTAGAGTTGCATTTGCCGACCCTCCTGATTGTTGCAGTAAACCTAAGAATAAGCTTACAGGTGAAGTCATTCTTGTACATCGAGGTAACTGCAGTTTCACATTCAAGGCTAATGTTGCTGAAGCTGCTGGTGCATCAGCTATCCTCATCATAAACAACCATACCGAACTTTTTAAAATGGTGTGTGAAGCCAATGAAACTTATATTGAGATTGGCATTCCTGCTGTTATGCTCCCACAAGATGCTGGAGCAAGCCTGGTAGAAAGTATTAAGAATAACCATAATGTTTCCGTGCAGCTTTATTCTCCACAGCGCCCACTGGTTGATGTGGCTGAAGTATTTTTATGGCTAATGGCTGTTGGCACGATCTTATGTGCATCTTATTGGTCTGCATGGAGTGCCAGAGAAGAAGCCCATGAGCAGGAAAAGCTGCTAAAGGATTCTTCAGATGACTTTGTTAGCATGGAGGGGGAAGGGAACAATTTCAGTGGTGTGGTTGATATTACCACAACATCAGCAATTCTGTTTGTTGTGGTTGCATCCTGCTTCTTGGTTTTGCTTTACAAATTAATGTCGTATTGGTTCATCGAGATTTTAGTGGTTCTCTTTTGCATTGGTGGTGTGGAGTTGAACAAGCGCTTGCTGTTGTCACCTAGTTGTAAACTAGTGCCTTTGGCTCCAGAATTAGTGGAAGGGTCTGCAAACTTGTTTGGTGGCATTGTTATCATGGGTATTGCACTGATCATAACAGTCCTTCAAATTATTCGAGTGCCTAATCTGAAGGTCGGAACAGTCCTTCTCAGTTGTGCATTCTTGTACGACATTTTCTGGGTGTTTGTTTCCAAGTGGTGGTTCCATGAGAGTGTTATGATAGTAGTAGCTCGTGGTGATAATAGTGGAGAAGATGGCATCCCGATGCTTCTGAAGATTCCACGGATGTTTGATCCCTGGGGCGGCTACAGTATCATTGGGTTTGGTGATATTATTCTACCAGGACTGCTGGTAGCATTTTCTTTAAGGTTTGATTGGCTATCCAAAAGAAAAATGCGCAATGGATACTTTATTTGGGCGATGGTGGCTTATGGTTTAGGACTCCTTGTAACTTATGTTGCACTGAACCTGATGGACGGACATGGTCAACCAGCTTTGCTTTACATTGTACCATTCATGCTTGGTACACTGCTGACCATGGGGAAAAAAAGGGGTGACCTCGAGAACTTATGGACCAAAGGAGGACCGGAGAGGCGGTGCCCACATGTCCATCAAGAGTCCCACCAGTAA >DCAR_008389 ATGGAATTGAGGGGACTAATGTGTTGGGCTATTGTGGTATCTGTTGCTGTGTTAGTAATCTTGAACTCTGCTGCTTCCGTTAGAGCTAGTGATATTGTTCATGATGATACATCTGCTCCCAAGAAGCCGGGTTGTGAGAATAATTTTGTGCTGGTGAAAGTTCAAACTTGGGTAGATGGAGTAGAAAGCACTAAGTTTGTCGGGGTTGGTGCTAGATTTGGCACCACTATTGTATCGAAGCAAAAATATGCGAACATTAGTCGCCTTACTTTATCAGATCCCCGGGACTGTTGTAAGCCACTAAAGAAGAAGCTTACTGGAGAGGTCATCATAGTGGATCGAGGAAACTGCAAATTTACGCGAAAAGCAAATGTCGCACAAGCTGCTGGGGCTTCAGCTGTTCTTATTATAAATAACCAAAAAGAACTCTACAAGATGGTTTGTGAGCCAGATGAAACTGATCTGGATATACACATACCTGCTGTGATGCTGCCACAAGATGCTGGATCAAGCTTAGAGAAATTGTTAAATGAAAGGACAAAAGTTTCTGTGCAGTTATATTCTCCACACAGACCTGTAGTTGATGTAGCTGAAGTCTTTTTATGGTTGATGGCTGTTGGTACCATTGTTTGTGCCTCTTATTGGTCAGCATGGAGTGCTAACGAAGCATCAATTGAGCATGACAAACTGCTAAAGGATGCTTGCGATGAAGATTCATCCATAAAGACTCTTGGAGTGAGCAGTGTGGTGGAAGTGAACACGTTGTCGGCAGTATTATTTATCATCATTGCATCATGTTTCTTACTGATCTTTTACAAGCTAATGTCGTTCTGGTTTATAGAAATTCTAGTGGTTCTATTTTGCATTGGTGGTATAGAGGGACTGCAAACTTGCTTAGTGGCCTTCTTATCGAGGTGGTTTAAAAAGTTTGCGGAGTCGTTCATTAAAGTACCTTTATTGGGAGCTGTCTCATACCTCACGCTGGCTGTAACTCCATTCTGTGTAATTTTTGCTGTCGTGTGGGCTATTTACCGGGATGCTCCCTATGCTTGGATAGGGCAAGATATTCTTGGTATAGCATTAATTGTTACGGTGCTTCAAATTGTCCATGTTCCTAATCTCAAGGTGGGTGCTGTTCTCTTATGTCTTGCCTTTTTGTACGACATATTTTGGGTTTTCGTTTCCAAAAAGTTATTCCATGAAAGTGTGATGATTGTGGTGGCTCGGGGGGATAGGAGTGGAGAAGATGGTATTCCTATGCTGCTTAAAATCCCGCGCATGTTTGATCAGTGGGGTGGATATAGCATCATTGGCTTTGGTGACATTCTCTTACCTGGATTGCTGATTACATTTTCACTAAGGTATGATTGGCTGGCAAAGAAGAGTCTTCGATCCGGGTCTCCTGATCACATATGTTGCCTTAAACCTGATGGATGGCCATGGTCAACCAGCTCTTCTGTATATCGTCCCCTTCACACTCGGCACATTCGTAGTGCTGGGAAAGAAGAGAGGGGATTTGAACATCTTGTGGGCAAGGGGTGA >DCAR_015966 ATGTTAGCATCAATTAAAGAGCTTGCAAGACTTAATTTAGCTGCAGTTTTGGTAATTGTTGCTACTTTGTTATTTTCTTCTTCACTTGTGTTTGCTAGTGATGTAGTTCATCAAGATAACATTGCTCCAAAGAAGCCAGGCTGTGACAATGACTTTGTTCTGGTAAAAGTTCCAACATTCATTGATAGTCAAAAGAAAGATGTGTTTGTTGGTGTTGGTGCTCGATTTGGTCCCACCTTACCATCAAAGCAGAAAGATGCTATAAAAGGTCGAGTTGTCCTGGCAGACCCTCCTGATTGTTGCAGTAAACCAAAAAATAAGCTTACAGGTGAGGTCATCCTAGTGCACCGCGGTAACTGCAGTTTCACATCAAAGACCAATATTGCTGAAGCTGCTGGTGCATCGGCCATTCTCGTTATAAACGACCAGAAAGAGCTTTTCAAAATGGTATGTGAAGTAAATGAAACATTCATGGAAATCAGCATACCCGCAGTTATGCTCCCACAAGATGTCGGTGCAACTTTGGAAGAAAGTATAAACAGAGATCTTAACGTTACCGTACAACTATACTCTCCTGATCGCCCATCAATTGATGTGGCTGAAGTGTTCTTATGGATTATGGCTGTTGGAACCATTTTATGTGCGTCTTATTGGTCAGCATGGAGTGACAACGAAGCAATTAATGAACAGGAGAAGCTCTTAAAGGACGCGCCAGATGATTATTTGAGGCCAGATGAAAATTCTTACAGTAGCGTGGTGGACATTACCACAACATCCGCGATTCTGTTTATTTTGATAGCATCTTGTTTCTTGGTCCTGCTTTACAAGTTCATGTCATACAAGTTTATTGAAATTTTGGTGGTGGTTTTCTGCATTGGCGGCGTTGAGGGTTTGCAAACTTGTCTGGTGGCTTGGTTATCATGTTTCAGGTTCTTTGACCATGCTCGTGAATCAAATGTTAAACTCCCCCTTCTGGGTGCTGTCTCATACTTAACTCTGGGTGTTACTCCATTCTGCATAGCTTTTGCTGTCGTTTGGGCAGCCTATCGCCGTGTTTCCCTTGCTTGGATAGGTCAAGACGTCCTTGGTGTTGCGTTGATAATAACAGTTCTTCAAATTGTACGAGTTCCAAATCTCAAGGTTGGAACAGTTCTTCTCAGTTGTGCTTTCTTGTATGACATTTTCTGGGTCTTCGTCTCCAAATGGCTATTCCATAAAAGTGTTATGATAGTGGTAGCTCGGGGTGATAATAGCGGCGAAGATGGCATTCCGATGCTGTTAAAAATTCCACGGATGTTTGACACCTGGGGTGGCTACAGCATTATTGGGTTTGGTGATATTATCTTACCAGGATTGCTAGTAGTATTTTCCCTAAGGTATGACTGGCTAGCAAAGAAAAAGCTTCGAGGTGGATACTTTCTTTGGACTATAATAGCTTATGGTTTAGGTCTTCTCGTCACATATCTGGCCTTGAATTTGATGGATGGGCATGGTCAGCCAGCTTTACTCTACATTGTACCTTTTATGCTAGGCACATTCCTGACGCTGGCAAACAGCCGAGGGGAACTCGACAACTTGTGGAACAAAGGAGAACCAGAGAGGATATGCCAGCATGAGCCGTCGAATTAA >DCAR_029928 ATGAGCCCCATCACCACCATTCTCTTATCTGGCACAATCGCTGTGTGCCCACGTGGTACTTGTGAGTTCGCGGTGAAGGCTGATGTTGCACAATCTGGTGGTGCAACTAATTTGTTGTTGATTAACAATGACGAAGATGGGCTTCCTCTGATTGATTGTCCTAGCAATGACAGTTTAAGTATTACAATTCCTACCGTCATTATTACGAAGTCTGATGGAGAGCATTTAACCAATTTCATGGTAGGCAAGAAAAAAGTGGAACTACTACTATATGCACCCCCTCGCGCCATTGTGGACTCGTCTGTGGTATTCTTATGGATAATGACTGTTGGGACTGTAGCTTGTGCTGCACTTTGGTCAGAGTTTACTGCAAAAGGAAATGAACGGAGCTATGATGAACTTTCACCAAAGAAATCTGCCGAGGCTGGAGCAGATGACGAAGACGAAATTGTAGAAATTAACCTGATGAGTGCTGTTACTTTTGTCATAACAGCATCAGGTTTTCTGTTGCTGCTATATTTTTTCATGTCTGCTTGGTTCGTCTGGGTGTTGATTATACTATTCTCCATTGGTGGTGTTCAGGGCTTGCATAATTGTATAACATCTCTTGTGTCAAGCAAATGGAAGAAGCAGAAAGTCGGATTGCCAGCAATCGGAGAGGTCTCAGTTTTCTCTCTGGTGACTTTGATATTGTGCATTGCATTTGCCATTTTCTGGGCCATTACACGGAGAGCATCATATTCTTGGATTGGCCAAGACATTCTTGGTATCTGTTTAATGATAACAGTTTTGCAGCTGGCTCAATTACCTAATATAAAGGTGGCTACTGCACTTCTTTGCTGTGCATTCTGTTATGACATCTTTTGGGTTTTTTTATCTCCTGCAATATTCGGTAACAGCGTTATGATTTCGGTTGCCAAAGGAGATCATAGTGGTGGTGAATCCATTCCGATGCTACTGAGAACCCCTAAATTTTTTGATCCCTTTGGTGGTTATAACATGATTGGGTTTGGAGACATTCTCTTCCCTGGTTTGCTTGTTGCATACTCGTTTAGATTTGACAAAGCAAAGATGAAGGGTGTGCGAGATGGATACTTTTTATGGCTAATGATCGGCTATTCTGTCGGCCTCTTGAGTACTTACCTGGGTTTGTACTTAATGAAGGGACATGGCCAACCAGCTCTCTTGTATCTTGTTCCGTCTACACTAGGGACAATTGTCGTATTAGGTTTAGTAAGAGGCGAGCTGAAAGACCTATGGAGCTCTACCCTGGAGGACATTTCAAAAGCTAAGAAGTCATCTGGAGAAGCTTGA >THA.LOC104817964 ATGGATTTGCGGGGATTTCTCCGGGTTCTTCTCTTCTCCGCCGAGATTTTACTTCTCTGTCGTCTTTCTCCGGTCTCCGCCGGTGATATTATCCACGAGGACAATTTGGCTCCGAAGAAGCCCGGTTGCGAGAACGACTTCGTTTTGGTTAAAGTTCAAACGTGGGTTGATGGTATTGAGGATGAAGAATTCGTGGGTGTTGGTGCCAGATTTGGGAAACCGATAGTATCCAAGGAGAAGAACGCGAATCAGATACACCTTGTTCTTTCAGATCCCCGTGATTGTTGTAGTCCGACAAATAACAAGCTTTCTGGAGACGTTGTTATGGTGGACCGAGGCAATTGTAAGTTCACAGCTAAGGCAAACAACGCAGAAGCTGCCGGTGCATCTGCTGTTCTTATCATTAATAATCAGAAAGAACTTTACAAGATGGTTTGTGAACCGGATGAAAATGATTTAGATATCAAAATACCTGCTGTCCTCCTTCCTCAAGATGCTGGTTCAACCTTGGAAAAAATGCTCACCAATAGTTCAAAAGTGTCGGTGCAGCTTTACTCCCCAAAGCGACCGGCAGTTGATATAGCAGAAGTGTTTTTGTGGTTGATGGCTGTTGGTACCATTTTGTGCGCCTCTTATTGGTCTGCACAGAGTGCCCGAGAAGCTGCTATTGAACATGACAAACTACTCAAGGATGCTGTGGATGAAATCCCAAGTGGCAATGATGTAGGTAGTGGCGTTGTAGACATAAATACAACGTCGGCTATTCTTTTCGTTGTTCTTGCTTCATGCTTCCTGGTTGTGCTTTACAAGCTTATGTCTTATTGGTTTGTGGAGCTTCTTGTTGTTCTTTTCTGCATTGGTGGTGTCGAGGGTTTGCAAACTTGCCTGGTCGCTTTTCTATCAAGATGGTTCAAACGTGCTGGAGAATCATACATAAAAGTACCTCTCCTCGGAGCTATCTCGTACCTCACTCTGGCAATTTCCCCTTTCTGCATTGTTTTTTCCGTTCTTTGGGCTATTTACCGAGATGTCTCCTTTGCTTGGATTGGCCAAAATATTCTTGGTATTGCATTGATTATCACGGTACTGCAAATTGTCCATGTCCCTAATCTTAAGGTTGGGACAGTTCTTCTAAGTTGTGCCTTCTTGTACGACATCTTCTGGGTATTTATTTCCAAGAAGTTGTTCCACGAAAGCGTGATGATTGTTGTAGCTCGCGGTGACAGAAGCGGGGAAGATGGAATCCCGATGCTACTGAAGATTCCACGGATGTTTGATCCTTGGGGAGGATACAGCATCATCGGATTTGGTGATATACTTTTGCCCGGTTTGCTAATTGCCTTCTCTCTCAGGTATGACTGGCTGGCTAACAAGACTCTCCGGACCGGCTACTTCATTTGGGCAGTCACTGCCTATGGATTAGGTCTTTTGATAACTTACGTGGCTCTTAACCTAATGGATGGACATGGCCAACCCGCATTGCTCTACATCGTCCCCTTCACACTCGGAACCCTAATAACATTAAGCCGGAAGAGAGGAGATTTCAATGTTCTGTGGACAAAGGGAGAGCCAGAGAGACCATGCCCTCATATCAGGCTTGAGCAGCAGAGCCCTCTTCCACACCATTTCCACGACTGA >THA.LOC104803438 ATGATTTCCTCGGTGACTTCCATGGCTTCGTTTCGTTTCCCGGGCCACCGCATCCGCCGCAATTCCACGGCCATAACTTTTCTCCTACTGATTTCTATATCTGCGATGGCGGCCGAAGATTCCGGTGCCGAGATTCCTGGTTGTACGAATAAGTTTCAGATGGTCAAGGTCTTAAACTGGGTTGATGGGGTAAAACGTGACTTTCTTACTGGCTTAACTGCTAATTTTGGAGCACAATTGCCTTCCCATGCTGAAGAAAGCATAAAGTCGCCTGCTGCTTTCACAGATCCTTCAGACTCATGTTTCAATCTCTCTTCCAGGTTAAATGGTCATATTGCTTTGTCTATCCGAGGCAACTGTGCTTTCACAGCTAAGGCAAAACATGCAGAAGCAGCTGGTGCTGCTGCTCTTGTGGTGATAAATGACAAAGAAGATATTGATGAGATGGGATGTATGGACAAGGACGTGCCTCTAAATATCAGCATACCTGTCTTAATGATCTCTAAATCAAGCGGGGATGCTCTCAACAGGTCTCTGGTCGGTGGTAAGACAGTTGAGCTTTTGTTATATGCACCAAACCGTCCTGCCGTGGACTTCACAGCAGTATTATTACTGTTGATGGCTGTTGGAACAGTTGTTATTGCATCAAGTTGGTCAGAGCTTACAAATTCTGAACAGGCAAATGGATCTTACAGTGCATTATCAAAGGAATCTTCTAGCACTGGAACTGACAAAGATGACTTGGAGAAGGAAATCCTTGATATAAGTGCTACTGGTGCTGTATTTTTTATTGTGACCGCCTCCATTTTTCTGCTGCTGCTCTTCTTCTTCATGTCATCGTGGTTTGTATGGGTGCTCACCATATTTTTCTGCATCGGTGGTATGCAGGGTATGCACAATGTCATTATGACACCTATGTTAAGAAAATGCAAACATCTTGGTCAGAAATCTGTCAAGCTTCCTCTGCTTGGGAGAATTTCAGTCCTGTCACTAGTGGTCTATTTGTTCTGTATGTCATTTGCTGTCTTCTGGTTTGTAAAACGGCAAACATCATATTCTTGGGTTGGCCAAGACATTCTGGGCATCTGTTTGATGATCACGGCATTGCAAGTGGTTCGATTACCTAACATCAAGGTTGCTACTGTACTTCTTTGCTGTGCTTTTGTCTATGACATCTTCTGGGTCTTCTTGTCACCATTGATATTTCACCAGAGTGTCATGATAGTGGTTGCACAAGGTGACAGCAGCAGCGGGGAATCCATTCCCATGCTACTAAGGATTCCTCGCTTTTTCGATCCATGGGGTGGTTATGACATGATTGGTTTTGGGGATATCCTTTTCCCCGGTTTGCTCATTTGCTTTGCCTCCAGATATGACAAAGTTAAAAAGAAGGTACTATCAAAGGGGTACTTCCTGTGGTTGACAGTAGGCTATGCCATAGGACTGTTACTGACATATCTGGGGTTATATCTCATGAACGGGCATGGTCAACCGGCGTTACTATACATCGTACCCTGCACACTCGGTCTTGCTGTCATTCTCGGATTGGTGAGAGGAGAACTCAAAGAACTATGGAATTATGGTACAGAAGAAGAATCATACGCGTCGGAAGATCCTCGAGTCGACGAGGCGTGA >THA.LOC104817025 ATGAGTCCACGAAGAGATCTCTTCTGTTTATGGTATCCCCTCGCGCTGCTCTACAGTGCCAGTTGGGCTTCAGCTGGAGATATAGTTCACCACGACGACACGCTTCCGAAGAGACCTGGCTGCGACAACAATTTTGTGCTGGTCAAAGTACCAACTCGAGTTAATGGCGTAGAAGCTGTGGAGTATGTTGGTGTTGGGGCTAGGTTTGGCCCAACTTTGGAATCGAAGGAGAAACATGCTACTCTTACCCGACTTGCTATTGCAGATCCCCCTGATTGCTGCAGCAGACCAAAAAATAAGCTCACTGGAGAGATCATTCTTGTCCATCGTGGTAACTGTAGCTTCACTACCAAGGCGAACATTGCAGAATCAGCTGGTGCCTCGGCCATGCTTATCATAAACAACAGTACAGAGCTTTTCAAGATGGTCTGTGAAGATAATGAAACTAACTTGGACATACACATTCCTGTTGTTATGCTGCCTTTTGATGCCGGCCGAAATCTGAAGAGCTATATGAACAATAACGATTCAGTTACTTTGCAACTGTACTCACCAAAACGCCCAGCGGTTGATGTGGCTGAGGTGTTTCTATGGCTTATGGCTGTCGGTACGATCTTATGTGCTTCTTATTGGTCAGCATGGACCGCCAGGGAAGCAGCTATTGAGCAGGATAAGTTGCTAAAGGATGGCTCAGACGAACTTTTGCAGTCAGCAACCACCAGCTCTAGAGGTGTTGTTGATGTCACCGTGATATCAGCAATTTTGTTTGTAGTGGTTGCTTCGGGTTTCCTGATCATGCTTTACAAGCTGATGTCCTTCTGGTTTATCGAAGTATTGGTGGTACTCTTCTGCATTGGTGGTGTAGAGGGCCTGCAAACTTGTTTGATTGCTTTGCTCTCATGTCTCAGATGGTTTCGCCGCATCGGAGAATCATATGTCAAAGTTCCGCTCCTGGGGGCAGTGTCATACTTGACTTTGGCTGTCTGTCCCTTTTGCATAACTTTTGCTGTGGTATGGGCAGTTTACCGCGACGTCTCTTTTGCTTGGATAGGACAAGATATCCTTGGAATCTCATTGATAATCACGGTCCTTCAAATTGTTCGTGTGCCTAATCTAAAGGTTGGGTTTGTTCTTCTCAGCTGTGCCTTCATGTATGACATCTTCTGGGTCTTTGTTTCGAAATGGTGGTTCCGTGAGAGCGTGATGATAGTTGTAGCCCGTGGTGACAGAAGTGGAGAGGATGGTATCCCGATGCTTCTGAAGATCCCACGCATGTTTGATCCATGGGGTGGCTACAGCATCATTGGATTTGGCGACATCATCTTACCCGGACTGCTTGTAACCTTTGCTTTGAGATATGACTGGCTGGCGAATAAGAGTCTGAAATCAGGGTACTTCGTGGGAGCAATGACAGCTTATGGTTTCGGTCTCCTCGTCACATATGTTGCGTTGAACTTGATGGACGGACATGGGCAGCCGGCTTTGCTTTACATCGTCCCATTTACGCTTGGTACTCTCATTTTATTAGGGCACAAAAGAGGGGATCTCAAAACTCTCTGGACAATAGGGGAGCCTGACAGACCGTGCCCTCATGTTCGGCTCCAACCGTCCCAATCATAA >THA.LOC104826187 ATGTCACCACCTCCGTGGAGCCACCGCCTCTTTGTGGCTTCGGCGACAGCTGTCCTCTTCCTGATCGGCCGGTCATCTGTACGAGCTGATAATGTCTCTCTGAAAGACACCACCGCTCCGAAATTCTCCGGCTGCAGTAATGAATTCCACATGGTCAAGGTCAAGAACTGGGTTGATGGGGTAAATGGCGAATTTTTCTCTGGCATGACTGCTCAGTTTGGCGGACAGCTGCCTTCTGATGAAGATGAAGCTGTTAGGCTGCAGGCTGTTTTAACAAGTCCTATAAATTGCTGCTCCGCTTTAGCCTCCAAGGTATCTGGTTCTATTGCCTTATGTTTGCGTGGTGATTGTCCTTTCACGACTAAGGCAGAAGTTGCACAGTCAGGAGGGGCTGCGGCTATGGTGTTAATCAACGACAAAGAAGGTCTAGAGGAGATGATTTGTACGCAAAATGATACCTCCTTAAATGTTTCTATTCCTGTTTTGATGATTGCAAAGTCAAATGGAGAAGCCCTTCAAATTTCCATTGAGCAAAAAAAGAAAGTGGAACTTTTGCTGTATGCTCCAAAACGCCCAATTGTAGATTATGCAGTGGCATTCCTGTGGATGATGTCTGTTGGAACAGTTTTCTTCGCCGCTGTTTGGCCACAAATCGCCAATAGTGAGCAAAACAATGATCGGTACAATGGATTATCACCAAAGGGATCTACAAATGCTGAAGCTACCAAAGATGATGGTGACGAGGATACTCTTGATATCAGTGCAAAGGGTGCTATTATGTTTGTGATATCAGCATCAACTTTCCTGGTTTTGCTCTTCTTCTTCATGTCGTCATGGTTTATAGTGCTGCTGACAATATTTTTCTGCATTGGTGGTGTACAGGGAATGTATAATATTATCACGGCACTCATAACAAGGAAATGCAGAAATTGTGGCCAGAAAACCATGAAACTCCCTCTAGTTGGGGATGTTTCATTTTTCTCAGTTGCAGTCCTATTGTTCTGCCTTTTATTTGCTATCATCTGGTTTCTGAAGCGACGAGCATCATATGCATGGGTTGGCCAAGATATTCTTGGTATTTGCATGATGATATCAGTCTTGCAAGTAGCTCGATTACCTAATATCAGGGTTGCTACCGTCCTTCTTTGCTGTGCATTCGTCTATGACATCTTCTGGGTCTTCCTATCACCGCTAATCTTTCATCAAAGTGTTATGATTGCGGTTGCACATGGGAGCGCCAGTACTGGAGAATCTATTCCCATGCTTTTGAGAATTCCTCGACTTTTTGACCCCTGGGGTGGTTACAACATGATTGGTTTCGGAGACATTCTTTTCCCGGGTTTGCTTATATGTTTTACTTTCAGATATGACAAGGAGAATAACAAGGGCATTTTAAAGGGATATTTCCCTTGGCTGATGTTTGGCTACGGACTTGGTCTTTTCTTGACATACCTGGGGTTGTATATTATGAACGGGCATGGTCAACCTGCATTACTCTACCTTGTTCCTTGTACTCTAGGAGTTGCGGTGATACTGGGACTGTTGAGGAGAGAACTGAGCGACCTCTGGAACTATGGAACACAATCGCCTTCAGCTGTGAATCCAACCCCATATGCATGA >Brara.D02607 ATGGACGCATTTGCAGTGTCCTTCCGTGGGAACTGTGAGAAGGCCAAACACGCTGAAGCAGCTGGTGCTTCTGCTCTATTGGTCATTAATGACAAAGAAGATCCTGATGAGATGGTGTGTGTGGAGAAAGACATGTCTTTGAATGTGACTATACCTGTGTTAATGATCTCTAAGTCAAGCGGGTATGCTCTCTACAAGTCTATGCTAGAAAACAAGAGTGGTGCTGTGTTCTTTATAGTAACAGCCTCCGTTTTTCTGCTGCTGCTTTTCTACTTCATGTCATCATGGTTAGTATTGGTGCTCATCATCTTCTTCTGCATTTTTGGCATGCAAGATATGCATAAGATCATTATGGCAGTTTTATTGAGAAAGTGGAGACATCTTGGTCGGAAAACTGTGAAGCTCCCTTTGATTGGGACAGTGTCATGGATGTCGGTTCTGGTGATTATTATCTGTCTGGCGTTTACTGTATTCTGGTTTGTGAAACGACACACATATTATTCATGGGTTGGACAAGACATATTGGGGATCTGTTTGATGATCACATCCTTGCAAGTGGTTCGATTACCTAACATCAAGGTTGCTACTGTGCTTCTCTGCTGCGCCTTTGTATATGACATTTTCTGGGTGTTCATATCACCGTTGATATTCCACGAGAGTGTTATGATTGTGCTACCAATGATTGGTTTTGGGGACATTTGCGTCCCTGGTATGCTTATTTGCTTTGCTTCCAGATATGACAAGTTCAAGAAGAGGGTAGTGTCAAGTGGGTACTTTCTTTGCTTGACTATTGGTTATGGTGTAGGTCTGTTACTGACATGTCTAGGTCTGTATCTAATGGACGGACATGGCCAGCCTGCGCTACTCTACATCGTTCCCTGCACACTTGGTTTGGCTGTCGTTATGGGGTTGGTAAGAGGAGAGCTTAAAGAGCTATGGAACTACGGTATAGAAGCAACAGAGTCTTACACGCCAGAGGATCCTCTGCCTGTGGCATAA >Brara.E00334 ATGCCTTCGTCTGATCCGCCGCGCCACCGATGCTCCACCGCACTACTCTTCCTCCTCCTGCTAGGCTTCTCCTTTGCGGCGGCAGACGATGCCTCGTGGACCGAAGACTCAACCCTCGAGTCTCCCGGCTGTACCAATAAGTTCCAAATGGTTAAGATCTTGAACTGGGTTGATGGTGTTGAAAGCAACGACTTCTTAACCGGCTTAACCGCTCAATTCGGAGAGTCGTTGCCGTCTGATGCTGGTCAGGGCGTTAGATCTCCGGTTGCTTTTGTGCGTCCTTTGGACTCGTGCTCCAATCTCTCTTCCAGGTTAGATGGAAGTATTGCCTTGTCGATCCGTGGGAACTGTGCTTTCACTGAGAAGGCAAAGCATGCTGAGGCAGCTGGCGCTTCTGCTCTGCTTGTTATTAATGACAAAGAAGATCTTGATGAGATGGGATGTATGGAAAAGGACACTTCTTTGAATGTTAGCATACCTGTGTTAATGATCTCTAAGTCAAGCGGAGATGCTCTCAACAAGTCTATGGTGGATAACAAGAGTGTTGAGCTTCTGTTGTATGCGCCAAGTCGTCCTGCTGTGGACCTCACGGCAGGTTTGTTGTTGCTCATGGCTGTTGGAACTGTTGTCGTTGCATCTCTGTGGTCAGATCTTACTGATCCTGACCAAGCTAATGAATCTTACAGCATATTAGCAAAGGAATTTAGTGGTGCTGGAACCAGGAAAGATGATCCAGAGAAGGAGATCCTTGATATAAGTGTCACTGGTGCTGTGTTCTTTATAGTAACAGCCTCCATTTTTCTGCTGCTCCTTTTCTACTTTATGTCATCATGGTTTGTGTGGGTGCTCACCATATTCTTCTGCATCGGTGGCATGCAGGGTATGCATAACATCATTACGGCAGTTTTATTGAGAAAGTGGAGACATCTTGGTCGGAGATCTGTGAAGCTCCCTTTGCTTGGGACAATGTCATGGATGTCACTTTTGGTGAATATCTTTTGTCTGGCGTTTGCTGTCTTCTGGTTTGTGAAACGGCACACATCGTATGCTTGGGCTGGACAAGACATCTTGGGCATCTGTTTGATGATCACAGCCTTGCAAGTGGTTCGATTACCTAACATCAAGGTTGCTACTGTTCTTCTCTGCTGCGCGTTTGTCTATGACATCTTCTGGGTCTTCATATCACCATTGATATTCCACGAGAGTGTTATGATTGTGGTTGCACAAGGAGACAGCAGCAGCGGGGAGTCCATTCCTATGTTACTAAGGATTCCTCGGTTTTTCGATCCTTGGGGTGGCTATGATATGATTGGTTTTGGAGACATCCTCTTCCCCGGTCTGCTCATTTCCTTTGCTTCCAGATATGACAAGATCAAGAAGAGAGTAATCTCAAGTGGATACTTCCTTTGGTTGACTATTGGCTATGGAGTTGGTCTGTTACTAACATATCTAGGTCTGTATCTAATGGACGGACATGGTCAGCCTGCGCTACTCTACATCGTACCATGCACACTCGGTTTGGCTGTCATTCTAGGGTTGGTAAGAGGAGAGCTTAAAGAGCTATGGAACTACGGTATTGAAGAATCAGAGTCTAACACGCCGGAGGATACTCTGCCTGTGGCATAA >Brara.H02987 ATGTCATTACCTCCGTTTAGCTGCCGCATTCTCGCGGCGGCCGTGGCCTTCTATCTAACCGGTCTGCTATGCCTTGGTGCTGGTGAAGCTCCTTCTAAAGATGCCGCGGCTCCCAAGATTCCTGGCTGTTCCAACGAATATCAAATGGTCAAGGTTGAGAATTGGGTGAACGGAGAAAATGGTGAAGATTTTAGTGGCATGACTGCTCAGTTTGGTGCCGTGCTTCCATTTGATAAAGACAAAGCTGTTAGACTTCCTGTTGTTCTTACCACTCCTTTGAACAGTTGCGCCAATTTAACCTCAAAGCTATCTGGTTCTATTGCGTTATCTGTACGTGGGGAATGTACATTCACAGCTAAGGCTCAGGTTGCACAGGCAGGAGGAGCTGCAGCTTTGGTTTTAATAAACGACAAAGAAGAGCTGGATGAGATGGCTTGTACTGAGGGAGAAGCTCCCTTAACTCTTACTATACCTGTTTTGATGATTACTACATCATCTGGAGATGCCTTGAAGAAATCCCTTATGGCAAATAAGAAAGTGGAGCTATTATTGTATGCTCCAAAAAGCCCAGTTGTGGACTATGCAGTGGCATTCCTCTGGCTTATGTCTGTTGGAACAGTTTTCATTGCTTCTGTTTGGTCACATTGCACCGGTCCTAAGGAGAACGATGATGAGTACAATGAATTATCACCAAAGAAGTCTTCAGTTGATGGTGCTACCAAAGATGCTACTAAAGATGACGATGAGACACTTGATATCAGTGCTACCGGTGCTGTTATATTTGTCATATCCGCGTCCACGTTCCTTGTGTTGCTCTTCTTCTTTATGTCATCATGGTTCATCTTGATCCTCACCGTCTTTTTCTGCATTGGTGGTATGCAGGGAATGCATAATATTATCTATACCCTCATAACAATGAGATGCAATAAATGTGATCGGAAGACTGTGAAAGTCCCTTTGTTTGGGAATGTAACGATTCTCTCACTCATGGTTCTGTTGTTCTGCTTTGTGGTTGCTGTCGTCTGGTTCATAAACCGCAAAACATCGTATGCATGGGCCGGCCAAGATATTTTCGGTATTTGCTTGATGATAAATGTCTTGCAAGTGGCTCGGCTACCTAATATCAGGGTTGCAACCATTCTTCTATGTTGTGCATTTTTCTATGACATCTTTTGGGTGTTCCTGTCACCACTAATCTTCAAGCAAAGTGTGATGATTGCGGTTGCACGTGGGAGCAAAGACACAGGAGAATCTATTCCCATGCTACTGAGATTTCCAAGGCTTTCTGATCCATGGGGTGGTTACAACATGATCGGTTTTGGAGACATTCTATTCCCGGGTCTTCTCATATGCTTTATCTTCAGATATGACAGGGAAAACAACAAAGGAGTAGTGAAAGGCTACTTCCCATGGTTGATGTTTGGTTACGGACTTGGACTATTCTTAACATACTTGGGACTATATCTTATGAACGGACACGGTCAACCTGCATTGCTCTATCTAGTGCCATGCACTCTCGGTATAACGGTTATACTAGGGTTGGTGAGGAAAGAACTCAGAGACTTGTGGAACTACGGGACTCAGGAGCCTTCAGCTTCAGATGTAAATCCATCTCCAGGAGCATAA >Brara.I01385 ATGGATTCCCTCCGATTTCTCCGGATTCTTCTCCTTTCCGCTTCGATCTTACTCGCCTCTCTCCTTTCTACTGTCACCGCCGGTGATATAGTTCATCAAGACGATTTAGCTCCAAAGAAGCCTGGCTGCGAAAACGACTTCGTTTTGGTTAAAGTTCAAACGTGGATTGATGGTACTGAAGATGCTGAGTTTGTTGGCGTTGGTGCTAGATTTGGGAGGCGGATTGTCTCCAAGGAGAAGAACGCTAACCAGACTCACGTTGTCTTTGCTAATCCTCGTGATTGTTGTTCACCTCTCAAGACTAAGCTTATTGGAGATGTTGTTATTGTGGACCGGGGCAACTGTCGGTTTACAGCTAAGGCTAATAATGCGGAAGCTGCTGGTGCCTCTGCTCTATTAATCATTAATAACCAGAAAGAACTTTACAAAATGGTTTGTGAACCGGATGAAACGGATTTAGACATACAGATTCCTGCCGTCATGCTCCCACAAGACGCTGGTGCGACCTTGGAAAAAATGCTTATCAACAGTTCTAAAGTGTCGGTGCAGCTTTACTCCCCAAGACGACCAGCTGTTGATGTAGCCGAAGTCTTTTTGTGGTTAATGGCTATTGGGACCATTTTGTGTGCATCTTATTGGTCCGCATGGAGTGCACGAGAAGCAGCTATTGAACATGATAAGCTACTCAAGGATGCTATAGACGAAATCCCTAGCACGAATGATGGGGGTAGTGGTGTCGTAGAGATCAATACTCTTTCAGCTATTTGTTTCGTATTTCTTGCTTCGGGCTTCCTGGTTGTTCTTTACAAGCTTATGTCTTATTGGTTTGTGGAGCTTCTTGTGGTTGTTTTCTGCATTGGTGGTGTTGAGGGTTTGCAAACTTGCCTTGTGGCTTTGCTATCAAGATGGTTCCAGCGTGCAGGAGATTCTTACGTAAAAGTCCCTTTCCTTGGACCTATCTCTTATCTGACTCTTGCAGTTTCTCCTTTCTGCATTGTCTTTGCTGTTATATGGGCTGTTTACCGAGAGCGTTCCTTAGCTTGGATTGGCCAAGATGTTCTTGGGATCGCATTGATCATCACAGTATTACAGATTGTTCATGTCCCAAATCTTAAGGTAGGGACAGTTCTACTCAGCTGTGCCTTCTTGTACGACATCTTCTGGGTGTTCGTCTCCAAGAAGTTGTTCCACGAAAGCGTAATGATTGTCGTAGCACGTGGGGATAAAAGCGGAGAAGATGGTATCCCTATGCTCCTGAAGATTCCACGCATGTTTGATCCGTGGGGAGGCTATAGCATTATTGGATTCGGTGATATTCTTTTGCCCGGTTTGCTAATCGCATTTGCTCTCAGATATGACTGGTTAGCTAACAAGACTCTTCGAACCGGCTATTTTATATGGGCAATGGTTGCCTACGGATTAGGTCTTTTGATTACTTACGTGGCTCTAAACCTAATGGATGGACACGGCCAACCAGCATTGCTCTACATTGTCCCTTTTACTCTCGGAACAATGTTAACACTAGCTCGAAAACGAGATGATCTTTGGATTCTATGGACGAAAGGAGAGCCAGAAAGGGCATGTCCTCACCACGTCAGGCTTGAACAGTGCTCTGAGTGA >Brara.I05635 ATGATCCAGCGGAGATCTTTCAGCTGTTTGTTGTATGTTTTGGGGCTGTTGTTGTACAGTGCTAGTTTGGTTTGCGGTGGAGACATAGTTCACCACGATGACTCGATTCCACAGAGACCTGGTTGCAACAACAATTTCGTACTGGTCAAAGTCCCAACTCGAGTAGATGGGAAAGAAAAAGAGGAGTTTGTTGGTGTCGGTGCTAGGTTTGGGCCTACCTTGGAATCTAAGGAGAAGCATGCTACCCTCATCAAACTCGCCCTTGCCGACCCTCCTCATTGCTGCACCACCCCCAAATCCAAGCTTACTGGAGAGGTCATTCTTGTTCACCGTGGTAATTGCAGTTTTACCACCAAAACTAAGGTAGCTGAAGCTGCTGGTGCCTCTGCCATCCTCATCATAAACAACAGCACTGATCTTTTTAAGATGGTATGTGAGAAGGGTGAAAACGTTTTAGATATCAATATCCCTGTTGTTATGCTCCCTATTGATGCTGGTAGAAGCCTCGAGGAGACCGTTCAGAGTAACTCCATAGTTACTTTGCAGCTATATTCGCCGAAACGTCCAGCAGACGGCATCCCAATGCTACTAAAGATCCCACGTATGTTCGATCCTTGGGGTGGCTACAGTATCATCGGTTTTGGCGATATCATCTTACCAGGACTTCTTGTCACTTTTGCACTCAGATACGACTGGCTGGCAAACAAGAGGCTCAAGTCAGGATACTTCCTTGGGACAATGTCTGCTTATGGTCTAGGTCTTCTCATAACATATATTGCTTTAAACTTGATGGATGGACACGGGCAACCAGCTTTGCTTTACATCGTTCCATTCATACTTGGTACTTTGACAGTGTTAGGTCATAAGAGAGGTGATCTGAAGACCTTATGGACAACAGGGGAACCCGAGAGGCCATGTCCTCACGTTCGCCTACAACATCAATCTTAA >Brara.J00031 ATGATGTGGGGGAGATCTTACAGCGGTTACTTGTTAGTATTGGGGTGGTTGTACGTGTACAGTGCTAGTTTGGTTTCTGGTGGAGACATAGTTCACCACGATGACTCTCTTCCTAATAGACCTGGTTGCAACAACAATTTCGTCTTGGTCAAAGTCCCAACTCGAGTCAATGGGAAAGAAAAAGAGGAGTATGTTGGTGTTGGTGCTAGGTTTGGTCCAACCTTGGAGTCTAAGGAGAAACATGCTACCCTCATCAAACTCGCCGTTGCTGACCCTTCTGACTCCTGCACCACTCCCAAATTTAAGCTTACTGGTGAGGTCATTCTTGTTCACCGTGGTAACTGCAGTTTTACCACAAAAACAAAGGTAGCTGAAGCAGCTGGTGCCTCTGCCATCATTATCATTAACAACAGCACTGATCTCTTCAAGATGGTGTGTGAGAAGGGTGAAGACGTTTTAGATATCAATATTCCCGTTGTTATGCTCCCTCTTGATGCTGGTTCAAGTCTCCAAAAATTCGTTGACGGTAACGACACTGTTACTTTGCAGCTATATTCGCCGAAACGTCCAGCAGTTGATGTGGCTGAGGTCTTTCTCTGGCTTATGGCTGTTGGTACCATTCTTTGTGCTTCTTATTGGTCTGCCTGGACCGCTAGGGAAGAAGCCATTGAGCAAGACAAGCTGCTAAAGGACGGATCAGATGAACTGTTGCAGGTATCAACCACCAGCTCAAGAGGTGTTGTTGAGATCACCGTGATATCAGCAATTTTGTTTGTGGTGGTTGCTTCTTGTTTCCTCATCATGCTCTACAAGCTTATGTCATTCTGGTTTATAGAAGTGTTGGTGGTGCTCTTTTGTATAGGTGGCGTAGAGGGGCTGCAAACCTGTTTGGTCGCTTTGCTCTCATGTTTCAGATGGTTCCGCAGCATTGGAGAATTTTATGTCAAAGTTCCATTCCTGGGGGCAGTCTCATATTTGACTCTGGCCATTTGTCCGTTTTGCATAGTATCTGCTGTTATATGGGCAGTTTACCGCCAATACTCGTTTGCTTGGATAGGGCAAGATATCCTTGGAATCTCGCTGATTATAACAGTTCTTCAAATCGTCAGGGTACCAAATCTTAAGGTTGGAGTTGTTCTTCTCAGCTGTGCCTTCATGTATGATATCTTCTGGGTTTTTGTTTCAAAATGGTGGTTCCGTGAAAGTGTGATGATTGTGGTAGCCCGTGGAGACAAAAGCGGAGAGGACGGCATCCCAATGCTACTAAAGATCCCACGTATGTTTGATCCTTGGGGTGGCTACAGTATCATCGGTTTTGGCGATATCATCTTACCTGGACTTCTTGTAACTTTTGCACTCAGATACGACTGGCTGGCAAACAAGAAGCTCAAGTCAGGATACTTCCTTGGGGCAATGTCTGCTTATGGTCTAGGTCTACTCATAACATATATTGCACTAAACTTGATGGATGGACACGGGCAACCAGCTTTGCTTTACATTGTTCCATTCATACTTGGTACTTTGATAGTGTTAGGTCACAAGAGAGGTGACCTGGAGACCCTATGGACAACAGGGGAACCAGAGAGGCCATGTCCTCACGTTCGCCTTCAACCTCAATCTTAG >Cucsa.135560 ATGAATTCGCGGGGAGATGTGATTACTACGGTACTTTTGGGTTTGATGCTGAGTTTGAGCTTGGTTTCAGCTGGGGATATAGTTCATCAGGACAGTGTTGCACCTACACGTCCTGGTTGTGAGAATAACTTCGTTCTGGTGAAAGTCCCTACTTGGGTCAATGGTGTAGAAGCCACTGAATATGTTGGTGTTGGTGCACGATTTGGCCCATCCTTAGAATCAAAGGAGAAACATGCCACCCGCACTAGAGTTGCTCTGGCGGATCCTCCTGATTGTTGCAGTATGCCCAGAAATAAGCTGGCTGGAGAGGTGATTTTGGTACTTCGTGGAAATTGTAGTTTCACAAGTAAGGCAAATATTGCAGAGGGTGCTAATGCTTCAGCCATCCTTATCATTAATAACAGTAAAGAACTTTTCAAGATGGTCTGTGAGGAGAATGAAACTGATGTAACCATAGGCATACCTGCTGTTATGCTCCCTCAAGATGCTGGTGAAAGCTTACAGAAGGATTTGAAGAGCAATATCTCAGTATCTGTGCAACTTTATTCCCCGCTTCGACCAGTAGTAGATGTTGCAGAAGTATTTTTATGGCTTATGGCTGTTGGTACTGTCTTGTTGGCCTCTTATTGGTCTGCATGGACTGCAAGAGAAGTGGCTATCGAGCAAGATAAGCTGTTGAAGGATGGTTCAGATGAATTGCTGCAGATGGAAGCAACTGGTTCCAGTGGTTACATAGATATTAACACTACAGCAGCAATTCTATTTGTCGTGATTGCTTCATGTTTCTTGGTTATGCTCTACAAACTAATGTCTGCCTGGTTTCTTGATGTTCTGGTGGTTCTGTTTTGCATTGGCGGTGCAGAGGGACTACAAACTTGCTTGGTGGCTTTGTTATCATGTTTCAGATGGTTTGAACATGCTGCTGAGTCATATATCAAAGTACCCTTCTTTGGAGCGGTGTCACATCTTACGTTGGCAGTTTCTCCTTTCTGCATATCATTCGCTGTTCTTTGGGCTTGTTACCGCAAAAGATCTTTTGCTTGGATAGGCCAAGATATCCTTGGTATTGCGCTCATAGTTACAGTCCTCCAGATTGTTCGAGTTCCTAATCTCAAGGTTGGGACGGTGCTCCTCAGCTGTGCCTTCTTATATGACATATTTTGGGTATTTGTATCAAAATGGTGGTTCCACGAAAGTGTTATGATAGTGGTTGCTCGTGGAGATAAGAGTGGAGAAGATGGTATTCCCATGTTGCTAAAGATTCCACGGATGTTTGATCCTTGGGGAGGGTACAGCATTATCGGATTTGGTGATATTATCTTGCCAGGACTTTTAGTTGCATTTTCACTAAGATATGATTGGCTTGCAAAAAAGAAACTCCGGGCAGGTTACTTCGTCTGGGCAATGACTGCTTATGGCACAGGCCTACTCATCACTTATGTAGCTTTGAATTTAATGGATGGACATGGGCAACCAGCTTTGTTATACATTGTTCCTTTCACCCTTGGCACATTTTTGACTCTGGGAAAGCAAAGAAGGGATCTTAAGATTCTTTGGACAAGAGGAGAACCAGAAAGGCCTTGTCCACACATCCAACTCCAACCCTCATCTCAACATTAA >Cucsa.303240 ATGGATTTTCAGAGGCATTTTCTAGGTGGGTTTTCCATATGCGCTTTGGTTTTGCTGCTGATTTTTCCTTCTCACGTGACTGCTGGGGATATAGTTCATCATGACGATTTGACTCCCAAAAAGCCTGGCTGTGAGAACGACTTCATTCTGGTTAAAGTTCAAACTTGGATTGATGGCAAAGAAGCTAGTGAATTTGTCGGTGTTGGTGCTAGATTTGGCGCTACCATTGTGTCAAAGGAGAAAAATGCAAACCAAACACGCCTGGTTCTTGCAAATCCCCGTGATTGTTGCAGTGTGCCAAAGAACAAGCTTTCTGGAGATATAATCATGGTTGATCGAGGTCACTGCAAATTTACTACAAAAGCGAATATTGCAGAAGCTGCAGGTGCTTCAGCTATACTCATAGTAAATAACCAAAAAGAACTTTACAAGATGGTTTGTGATCCTGATGAGACGGATCTTAATATACATATACCTGCTGTCATGCTTCCACAAGATGCAGGAACTAGCTTGGAGAAGATGCTAATCAGTAATTCATCAGTGTCTGTTCAGCTCTACTCTCCACTACGACCACCAGTTGACATAGCTGAAGTATTCTTATGGTTGATGGCTGTTGGTACGATCTTGTGCTCATCTTTTTGGTCTGCCTGGAGTGCCAGGGAAGCAGCTATCGAGCAGGACAAGCTGCTAAAGGATGGTGCAGATGATATTCAAAATGCTGAAGACATAGGCAGCCCTGGTGTTGTATATATTAACATGGCATCAGCAGTTCTATTTGTCGTCGTTGCTTCTTGCTTTTTGATTTTGCTTTACAAACTCATGTCGTACTGGTTCATCGAGCTTTTGGTAGTTCTTTTCTGCATAGGAGGTGCAGAGGGTTTGCAAACTTGTTTGGTTGCGTTATTGTCAAGATGCTTTAAGCAAATTGGAGAATCATACGTCAAAGTGCCATTCTTTGGAGCTGTTTCTTACCTCACAGTAGCTGTTTCTCCATTCTGCATAGCATTTGCTGTCGTTTGGGCTGTTTATCGGAATGTGTCGTTTGCCTGGATTGGTCAAGACGTACTTGGAATTGCACTGATAATTACAGTTCTTCAAATAGTTCATATACCGAATCTTAAGGTTGGAACAGTGCTCCTCAGTTGTGCCTTCCTCTATGATATCTTTTGGGTATTTGTTTCTAAGAAGGTGTTCAATGAAAGTGTGATGATTGTGGTGGCTCGTGGCGATAAAAGTGGTGAAGATGGCATCCCAATGCTGCTAAAGATTCCTCGCATGTTTGATCCATGGGGTGGTTATAGCATTATCGGATTTGGTGACATCCTTTTACCTGGACTTGTAGTAGCATTTTCTCTCAGGTATGACTGGTTGGCGAACAAGAGCCTTCGGGTTGGTTACTTCTTACCAGCAATGCTTGCTTATGGATCAGGTCTTCTGATTACCTATGTGGCTTTGAACCTGATGGATGGTCATGGCCAGCCCGCGCTGCTTTACATCGTCCCATTCACTCTCGGAACCCTTTTGACACTGGGGAAAAAGAGAGGAGATTTGGGGATTCTGTGGACAAAAGGAGAACCACAAAGAGTCTGCCCTCATGCACATCTTCTCATCAATGATGATTTAAGTGATGAAAAATGA >Cucsa.365670 ATGGCTTTCTCTTCTTCTCCGGCGACACCTTCAATCATCCCTCTCTTATCACTTCTCTTTCTCATTTTTCTCTTCCGCATCTCCTCTGTTTTTGCCGACGATGTCTCTCTCGATGACGATTCCGCTCCCAAGTCCGGAAATTGCAACAATCCCTTCGAATTGGTCAAAGTTAAGAGCTGGGTTAATGATGCTGAGGATGAAATCCTTGTGGGTTTAAGTGCAAGATTTGGGACTTTATTGCCTTCTCAGGCTGAAGATGATCTCAAATTGCCAGCTGTTTATATGAATCCTATAAATGGCTGTTCTAGTTCTTCTTCAAAGCTATCTGGGTCAATTGCCTTGTCTACACGTGGTGAATGTGACTTCACAATTAAGGCAGAAATTGCACAGGCTGGTGGTGCTGCAGCCCTGTTGGTGATAAATGACAAAGAAGATCTTTACAAGATGGTCTGCTCTGAAAAAGACACTGCTCTCAATATTTCAATTCCTGTAGTAATGCTTCCCAAGTCCAGCGGAGATGCTCTTAGTAAATTAATAACCGACGGAAAGAGTGTGAAACTTCTATTATATGCTCCAAAACGTCCGGTTGTGGACTTCTCTGTTGTGTTTTTGTGGATGATGTCTGTTGGAACAGTTGCATGTGCTACACTTTGGTCAGAGATCACTGCCGAGCAGACTGAGGAGCGCTATAATGAATTATCGCCGAAGGAATCTTCCAATCCTGGAGCAGCCAAAGATGACTCTGAGAATGAAACCCTTGATATTAATGTTAAGAGTGCCATTGTATTTGTCATTACGGCATCTAGTTTCTTGGTGCTGCTCTATTTCTTTATGTCTTCTTGGTTCGTTTGGCTGTTGATTGTAATGTTCTGCATCGGTGGTGTTGAGGGTATGCATTCTTGTATATTAGGACTGATATTAAGAAAAGGCCAAAGTTGCGGGAAGAAGACTCTGGATTTACCTGTATTAGGGGAGGTCTCTATTCTTTCACTTGTTGTGCTGCTTTGTTGTATAACTTTTGCGGTCGTCTGGGCTCTAAATCGACATGCATCATATTCTTGGATTGGGCAAAATATTCTTGGTATTTGCCTGATGATCACAGTCTTGCAGATGACCCGATTACCTAATATTAAGGTAGCAACAGTACTTCTTTGCTGTGCATTTATCTATGACATCTTCTGGGTGTTCATATCACCTGTAATATTCCATGAGAGTGTAATGATTGCGGTTGCCCGAGGAGACAATAGTGGTGGAGAATCCATTCCAATGCTCTTAAGAGTTCCTCGCACTTTTGATCCTTGGGGTGGATTTGACATGATTGGATTTGGGGATATACTCTTCCCTGGTCTGCTTGTTTCGTTTACTCGCAGATTTGACAAAGCGCAAAAGAAAAGCAAGTGTAATGCATATTTTCCATGGTTGCTTGTTGGTTACGGCACTGGTCTCTTCTTAACATATTTGGGCTTATATTTTATGAATGGACATGGTCAACCTGCACTCCTTTATCTTGTCCCATGCACCTTAGGTGTTACTGTTGTTTTGGGTTTTATCCGAGGCGAGCTTAAGCAACTTTGGAATTATGGGACAGAAAATCCCGTGCATAGGGAACCTTCTGGAGAAGCTTAA