>PAB00022214 ATGTCTGGATTCCGAAGCTTCACAAGCTTGACCTCTAGATCAAAAAACATTATTGTGGCAGGAGGATTGACTGGGTTTGTTGCAGCTGTATACATTTACACAATGCGAGCAGTTGGAAGCACTGATGAATTGCAAACTGCAATTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTGCAAACTGCAATTGAAACTTTTGAGAAGCAGAAGAGCCAGGAGTCTCTGCCTACAGTGGCAGAATCCACCAGAACCTGAACATGAACTGTTGAAAACTTTGAGGTGGTGCTAG >Pp3c9_12740 ATGGCGAGCGCAGGCAAGATCTTGGGTATGGACAAGTTGAGGGTGCAGAACCTGGTTGTTGCTGGTGGCCTCACCTCCTTCGTGGGAGCCGTCTACTTCTACACCATGAAAGCTGTTGGCGGCGGAGACGAACTTCAGGAAGCCGTCCAGGTTTTGGAGCAGCAGAAAGGGGAGAAAGCTGGAGTATCTGCTCCTTCCGCGGCCTCCTAG >Pbr033678.1.g ATGGCTGGGATGTCAGGATTTAGGAGCCTTGCACCTAAAACAAAGAATGCTATAGTTGCTGGGGGACTGTCAGCTTTTGTTTTCGGAGTATATTTCTACACCATGAGAGCTGTTGGAGGAACCGATGAATTACAAGTGGCTATAAACAAGTTCGAGGAGGAAAAAGGTCAGAAAGAGGCTGAAGCAAGCTTGTCATCAAAGGTTTGA >Pbr038948.1.g ATGGCTGGGATGTCAGGATTTAGGAGCCTTGCACCTAAAACAAAGAATGCTATAGTTGCTGGGGGACTGTCAGCTTTTGTTTTCGGAGTATATTTCTACACCATGAGAGCTGTTGGAGGAACCGATGAATTACAAGTGGCTATAAACAAGTTCGAGGAGGAAAAAGGTCAGAAAGAGGCTGAAGCAAGCTTGTCATCAAAGGTTTGA >Pbr038969.1.g ATGGCTGGGATGTCAGGATTTAGGAGCCTTGCACCTAAAACAAAGAATGCTATAGTTGCTGGGGGACTGTCAGCTTTTGTTTTCGGAGTATATTTCTACACCATGAGAGCTGTTGGAGGAACCGATGAATTACAAGTGGCTATAAACAAGTTCGAGGAGGAAAAAGGTCAGAAAGAGGCTGAAGCAAGCTTGTCATCAAAGGTTTGA >Carubv10024467m.g ATGGCAGGATTTCCAGGTTTTAGTCACCTTGGTCCAAAAAGCAAGAACGTGGTTGTAGCGGGTGGATTAACGGCTTTTGTTTTTGGGGTATACTTCTACACAATGAGGGCTGTTGGTGGCACGGACGAACTTCAGGTGGCCATTGACAAGTTTGAAGGCCAAAAACAGGTTGAGACCGATAACAAGGTTCCATCTAAGGTCTAA >Prupe.4G204500 ATGTCTGGGATTTCAGGATATAGGAGCCTTGCACCTAAAACGAAGAATGCTATAGTTGCTGGGGGGCTGTCAGCTTTTGTCTTTGGAGTATATTTCTACACCATGAGAGCTGTTGGAGGCACAGATGAATTGCAAGTGGCTATAAATAAGTTTGAGGAGGAAAAAGGTCAGAAGGAGGCTGAAGCAAGCATGCCATCAGAGGCTTGA >Manes.05G136900 ATGACTGGAATTCTGGGATTCATGAACCTTTCACCCAAGAATAAGAATTTGGTAGTTGCTGGTGGCTTGTCCGTATTTGTTTTTGGGGTATATTTTTACACTATGAGAGCTGTTGGTGGTACAGATGAGCTTCAGGTTGCTATAGATAAGTTTGAAGGGCAGAAAAGCAAGCAGGATGCTTGA >Manes.08G010900 ATGACTGGAATTCTGGGATTCATGAACCTTTCACCCAAGAATAAGAATTTGGTAGTTGCTGGTGGCTTGTCCGTATTTGTTTTTGGGGTATATTTTTACACTATGAGAGCTGTTGGTGGTACAGATGAGCTTCAGGTTGCTATAGATAAGTTTGAAGGGCAGAAAAGCAAGCAGGATGCTTGA >FVE18033 ATGGCTGGGATTCCGGGATTTAGCAGCTTTGCACCTAAAACAAAGAATGTCATAGTTGCTGGGGGCTTGACATCTTTTGTCTTTGGTGTGTACTTCTACACCATGAGAGCTGTTGGAGGTACAGATGAACTACAAGTGGCTATAGATAAGTTTGAGGGAGACAAAGTCCAGAAACAGGCTGAAGGAAGCATGCCCTCAAAGAGGAATGTACCTTTCAATTTATACCTTACTGATCAAGGAAAACAGATCTCTGAAGCTTCCTCTCAAGATTCCAAACTCTCAGCCTTCGATTTAACAACTTTCTCTGATCAAGGAAAACATGTTGTAATCTTCTTGTGCTGCACGATGGCTTTCGAGGTTATAGATACTGGCAAGTATAATCTGATACTGCGAAGTAGCCATCTGATCTGGGAGTTGCAGCTGACTAGGTCCTGGGTTGAGAGTGGTAATGTATTAGCAATAGGCAGCAGAGGCACTAAAATGTTGATTCTCTGCGTTTTGACTATCACCCAACAATCGTGCAGATCCAAATCGTTGTCGGTAGATTGTAGTGTCAATAATACCTCTCGGGGTATTTTTGTTGTGCAAAGGGATTTGCCACCAGATGTCTTTGCCTTTCCTTTGCCATCAGCTGACAATCTGTTTGTGAAATTAACACTTTCATCAGATCAAAACCAATGCGCTCATTCCTAA >Mapoly0044s0040 ATGTCGGGGGCAGGAGGGAAGCTGATCATGGGAATGAATGAGGTGAAGGTGAAGAATTTCGTTGTCGCAGGGGGCCTCTCTGCGTTCGTGGCTACCGTGTATGTGTACACGATGAAGGCCGTCGGCGGAACTGATGAATTGCAGGCTGCGGTCGAGACTTTTGAGAGAGAGAAGGCCACCAAGGCTCAAGCTCCAACCTCTACTTGA >TCA.TCM_019853 ATGGCTGGGCTTTTGGGATATAACAGCCTTGCACCAAAGACTAAGAATCTGGTAGTTGCCGGGGGCTTGACGGCATTTGTATTTGGGGTATATTTCTACACCATGAGAGCTGTTGGTGGTACGGATGAGCTTCAGGTGGCTATTGATAAGTTTGAGGAGCACAAAAAGCAAGAGGCTCGAGCAAGCATGGCATCAAAGGCTTGA >AUR62002411 ATGCCTTTTCTGATTGAATCGAAAACCTCTCTAAACAAAGATGACGATGACGATGTCTTTGCGGTGCAGTGGTTGGTGATACGGTGCGATTTGCGACTGGTGATGCGGTGGTTGGTGGGTTCGGCTGGTGATGCGGTGGTTGGTGATTTGCGGCTGGGATGCGGTTGTTGGTGGGTTCGGCTGGGATGCGATGATTTGCGGCTCACTTTCTTCTCTGCTGCCGCCTTCACCACCGCTTATCTGGGTAGTGTGCCACTGATGAAGGAAATTGGTTGTCCAAATGGTGCTGGGGCAGCTGTGGAAACGGGAAATAGGTTGTCCAAATGGCTAGTGAATAGTGATGGGATAGATGGTGGTGGAAAAATTTCTAGGCAGATGTTGTATGTTGATCCATCTGCTGCATCTGCTTGCCCCATCACAACTGTACAGGGATTTGGCGCTCTTGCACCCAAAACAAAGAATATAATTGTTGCTGGGGGGCTGACATCATTTGTTTTTGGAGTGTACTTCTACACCATGCGAGCTGTTGGGGGTACTGATGAACTTCAGGTAGCCATCGACAAGTTTGAAGACAAGAAGCACCAAGATGAGGCCAAAGCAAACTAG >Cla022952.g ATGGCTGGAATTTTGGGATATAGGGGCCTTGGAGCCAAGACAAAGAATATTGTTGTTGCCGGAGGTTTAACTGCCTTCGTTTTCGGGGTATATTTCTACACGATGAGAGCTGTTGGAGGTTCAGATGAACTGCAAGTAGCCATAGACCAATTTGAAGCACAGAAAAGCAACAAAGATTAG >Gorai.011G134700 ATGGCTGGACTATTTGCTTATTATGGCAGCCTTGCACCAAAGACTAAGAATATGGTAGTCGCGGGGGGTTTGACAGCATTCGTATTTGGTGTATATTTCTATACTATGAGAGCTGTTGGAGGTACAGATGAGCTTCAGGTGGCTATAGATAAGTTGGAGGAGCTGAAAAAGCAAGAGGGGAAGTGA >ZJU.LOC107407403 ATGGCTGGAATATCAGGATACAGTCGCCTTGCACCTAAGACAAAGAATCTTGTAGTGGCTGGCGGACTGACTGCCTTTGTTTTTGGGGTATATTACTACACTATGAGGGCTGTTGGAGGTACAGATGAGCTACAAATAGCTATAGATAAGTTTGAGGAGCAAAAAACCAAGAAAGAGACTGAAGCAAGCATGCCATCAAAAGTTTAA >Tp4g25850 ATGTCTGGATTTCCAGGTTTGAGTTTTCTAGGCCCAAAAAGCAAGAACGTGGTTGTAGCGGGAGGCTTGACAGCTTTTGTTTTTGGGGTATACTTCTACACAATGAGGGCTGTTGGTGGCACGGACGAGCTTCAAATGGCTATAGACAAGTTTGAAGATCAAAAGCAGGTTGAGACCGACCCCAAGGTTCCATCAAAGGCCTGA >Ca_18229.g ATGGCTGGAGTATTAGGATATAGGAGTCTAGCGCCCAAGACAAAGAATTTCATAGTTGCTGGGGGTTTGACAACTTTTGTCTTTGGGGCATACTTCTACACCATGAGAGCTGTTGGAGGTACTGATGAACTACAGGTAGCAATAGATAAGTTTGAAGCAGACAAGAGCACTAAAGAGGGTGATGCAAGCATACCATCAAAAGTCTAA >Ca_07222.g ATGGCTGGAGTATTAGGATATAGGAGCCTAGCGCCCAAGACAAAGAATTTCATAGTTGCTGGGGGTTTGACAACCTTTGTCTTTGGGGCATACTTCTACACCATGAGAGCTGTTGGAGGTACCGATGAACTACAGGTAGCAATAGATAAGTTTGAAGCAGACAAGAGCACTAAAGAGGGTGATGCAAGCATACCAACAAAAGTCTAA >Peaxi162Scf00579g00018 ATGGCTGGACTTCCAGGATACAGTGGCCTTGCACCCAAGACTAAGAATCTGGTTATGGCTGGAGGTTTGTCGGCATTTGTTTTTGGTGTGTATTACTACACTATGAGAGCTGTCGGAGGCTCAGATGAACTTCAGGTAGCCATTGATAAGTTTGAAGACGCGAAACGCAACACTGAGGCTGAAGCAAGTTTGGCACCTAAGCCATGA >HBR1337G013 ATGACTGGAATCTTGGGATTCAGGAACCTTTCACCGAAGACTAAGAATTTGGTAGTTGCTGGTGGCTTGTCAGCATTTGTCTTGGGGGTATATTTTTACACTATGAGAGCTGTTGGTGGTACAGATGAGCTTCAGGTTGCTATAGATAAGTTTGAAGGACAGAAAAGCAAGCAGGATGCTTGA >Potri.019G096500 ATGCCAAATAAGGGATACGAACAACTTAAAGGTGACTTAATCTATCTACCACACTTCGTGTTGAACTATAACACATTTTCTGCTATAAGTTTCGGTTACAAGATGGCTGGATTCAGTAGCCTTGCACCTAAGACCAAGAATCTGGTAGTTGCTGGAGGCTTGTCAGCATTTGTTTTTGGGGTTTATTTCTACACCATGAGAGCTGTTGGAGGGACAGACGAACTTCAGACTGCTATTGATAAGTTTGAACAGCAGAAAAGCAAGGAAGAGTCTGAGGCAACCATCCCATCTAAGCCTTGA >Potri.019G113000 ATGGCTGGATTCAGTAGCCTTGCACCTAAGACCAGGAATCTGGTAGTTGCTGGAGGCTTGTCAGCATTTGTTTTTGGGGTTTATTTCAACACCATGAGAGCTGTTGGAGGGACAAATGAACTTCAGACCGCGATTCATAAGTTTGAACAGCAGAAAAGCAAGCAAGAGTCTGAGGCAACCATCCCATCTAAGCCTTGA >Potri.019G096700 ATGGCTGGATTCAGTAGCCTTGCACCTAAGACCAAGAATCTGGTAGTTGCTGGAGGCTTGTCAGCATTTGTTTTTGGGGTTTATTTCTACACCATGAGAGCTGTTGGAGGGACAGACGAACTTCAGACTGCTATTGATAAGTTTGAACAGCAGAAAAGCAAGGAAGAGTCTGAGGCAACCATCCCATCTAAGGCTTGA >Potri.019G096200 ATGGAAGCATGTTTTGTACTTCTGCAATTTTGGCAGTATAACACATTTTCTGCTACAAGTTTCGGTTACAAGATGGCTGGATTCAGTAGCCTTGCACCTAAGACCAAGAATCTGGTAGTAGCTGGAAGCTTGTCAGCATTTGTTTTTGGGGATTATTTCAACACCATGAGAGCTGTTGGAGGGACAAACAAACTTTCAGACCGCGATTCATAA >Araip.1G1P1 ATGGCATATCGTGATGCCATAGTGTGTTTATTAAACAAGAATAAGAACATAGAAGTGCACTTCCTCCTAAAAAGGCAGGGCTTCAACGTTTCTTCTTGCGGCACGGGTGTGCACATTAAGCTCCGTGGTCCCTCCCTCAGAGAACTCAATGTCTACGATTTCGAGGTACGAGTTGTCGTGAGTGAGCTGCTTGCAGAGGAGGATGGCGGACATGAATTGAGCCTCCTGGTGAGGAGAGGAGAAAATGAGGTGTGCGAACTTCAAGAAGAAGGTGCGAGATTAGGGTCTCGAATAGGGATGGAGATGGATCGGCGCCCAACACGGCGGCTAGTTCCGATTGCTACAATTGAGTTGGCTCGGGATCCATTTCTCTCCACTTTGCCTGTGTTCTGCTATTTGGACAAACTTGACCCTCTGGACTTGGCACCTAAATTGAGGGATTTCACTTTGATGAGTGACAAATCAGGGAAATTACAGTTGATAGCATTCTCACTTGCCGGATTCTCCACTCATCAACATGAGATCTCTACTATGGCTGGACTCTCAGGATTTAGGAGCCTTCCTCCCAAAGCTAAGAATTTGGTGGTTGCCGGGGGTTTGACAGCATTTGTCTTCGGAACGTACTACTACACAATGAGAGCTGTTGGAGGTACAGATGAACTGCAAGTAGCAATAGATAAATTTGAAGCAGAGAAGAGCAAGACAGAGGGTGATGGTACTAGCATGCCATCAAAGGTTTAA >RCO.g.48822.000001 ATGACTGGAAGTTCAGGATATAGGAACCTTGCACCTAAGACCAAGAATTTGATAGTTGCTGGCGGCTTGACAGCATTTGTATTTGGGGTTTATTTCTACACTATGAGAGCTGTTGGAGGTACAGATGAACTTCAGGTTGCTATAGACAAGTATGAAGGGCAGAAAAGCAAGCAAGAGGCTTAA >Ciclev10023247m.g ATGGCTGGGCTTGCAGGATTTAATACCCTTGCTCCAAGGACCAAGAATCTGGTTGTTGCTGGGGGCTTGACAGCATTTGTCTTTGGAGTTTATTACTACACTATGAGAGCCGTTGGAGGCACGGATGAACTGCAGGCAGCTATAGATAAGTTTGAAGAGCAGAAAAACAAGCAAGATTCTTGA >Bv3_058710_jyzx ATGACTGGGACTTCAAGATTTGGTGCCCTTGCACCCAGAACTAAGAATGTGATAGTTGCTGGGGGGCTGACAACTTTTGTCTTTGGAGTGTACTTCTACACCATGCGAGCTGTTGGAGGTACTGATGAACTTCAGGTAGCCATTGATAAGTTTGAAGAAAAGAAACACCATGATGAGGCCAAAGCAAACTAG >MDO.mRNA.g.4651.3 ATGGCTGGGATTTCAGGATTTAGGAGCCTTGCACCTAAAACAAAGAATGCTATCGTTGCAGGGGGCTTGTCAGCTTTTGTTTTCGGAGTATATTTCTACACCATGAGAGCTGTTGGAGGAGGCACAGATGAACTACAGGTGGCTATAAACAAATTTGAGGAGGAAAAAGTTCAGAAAAGGGCTGAAGCAAACGTGGCATCAAAGGTTTGA >MDO.mRNA.g.7768.3 ATGGCTGGGATTTCAGGATTTAGGAGCCTTGCACCTAAAACAAAGAATGCTATCGTTGCAGGGGGCTTGTCAGCTTTTGTTTTCGGAGTATATTTCTACACCATGAGAGCTGTTGGAGGCACAGATGAACTACAAGTGGCTATAAACAAATTTGAGGAGGAAAAAGTTCAGAAAGAGGCTGAAGCAAACGTGGCATCAAAGGTTTGA >Bo3g036820 ATGATTGTCTCTCAGTGGGATTTGCTGTCTGTTAGTGTTCTGTTTAGCTGGAACCTTAAGTTGCTATCTCGCATGCTCTTGGTTAGAGAGTTTGAAACAATGTCGGGATTTCCAGGTTTGAGTTTTCTAGGCCCAAAAAGCAAGAACGCTGTTGTAGCCGGAGGCTTGACAGCATTTGTTTTTGGGGTGTATTTCTACACGATGAAGGCTGTTGGTGGCACAGACGAGCTTCAAATGGCTATAGACAAGTTTGAAGACCAGAAACAGGTCGAGACCGACCCCAAGGTTACAGCGAAAGTCTGA >Bo4g021030 ATGAATATCGAACACAGAGGCGGCTCAGGGGCGGATCTACAGTACCATGAGCGGGGGCACGTGCCCCCGACTACTCTTCAAATATTATATTGTAGCTTGGTGACTATTAATTTTGTTGGAACCATTGGTTTTACAAAGACTTTGAAAAGAATGTCAGGATTCCCAGGTCTGAGTTTTCTAGGCCCAAAAAGCAAGAACGCTGTTGTAGCGGGAGGCTTGACAGCCTTTGTGTTTGGAGTATACTTCTACACGATGAAGGCCGTTGGTGGCACTGACGAGCTTCAGATGGCTATAGACAAGTTTGAAGACCAGAAACATGTTGAGACCGACCCCAAGGTTCCTCCATCAAAGGCCTGA >Cpa.g.sc9.378 ATGGCTGGGTTTTTGGGATTCACTAACCTTTCACCAAAGACCAAGAATCTGGTAGTCGCTGGAGGCTTGACAGCATTTGTGTTTGGAGTCTATTTCTACACTATGAGAGCAGTTGGAGGAACAGATGAGCTTCAGGTAGCCATAGATAAATTCGAACAGCAGAAAAAGTATGAGGATGAGCGGAACTTGCCATCAAAAGCTTGA >LOC_Os05g01330 ATGGACGACGACGACCATGACCACCACGGCAACGGCAACACCCCCTTCTCCTTGGCCTTGGCGCGCTCCTGCGGTGAAGTTCATCTCATCGGGCCGGCTTGCAGTTTAGCCCAGCCCAGCAAGGCCCATTGGCCCACTGGGAGTGGGAGGAACAGGAAACCGACCTCCTCATCCTCGAAGACGAAGACCTCTCTCTCTCGCTCGCCTGGCGCCGCCTTCCTCCACCCCACTCTCTCCTCCTCCGCCGCCGCATCCTCACCAACCCCCAACAGCCCTCCCTCCCTCCTCGCCAAAGGCTATGTTCTGGTATGGTTCAATCCCCTCCCCACTGCTAATTTCTGCAACAACCGGTGCAAACTAAAGATGGCGGGATTCGGCAGCCTGGCACCCAAGACCAAGAACTTTGTGGTGGCTGGAGGACTGTCTGCTTTCGTCCTCGGCGTGTATTACTACACCATGAGAGCGGTGGGAGGCACAGATGAGCTGCAGGTCGCCATTGATAAGTTTGAAGACATGAAGAAAAATGATGCTGGGAACTCATCCACCGCGGGATCCTAA >LOC_Os12g41760 ATGGCGGATGAGTCTGGAGTAGAGGAGGAAGAAGGATCAACGTCCTCTGTTCCTCCCACTCCCACTCCTAGTGGGCCAACGTCACCAATAGGCCGTGCTGGGCTAGACTCAACTGAGTGGGAGTGGGAGGAACAGAGGACGCTGATCCTTCTTCCTCCTTCACTCCAGACTCCTCCACCACCGCCGCGCACCCCCCAACAACTCTCCCTCCACGCCAAAGGTAAACTTATCTGGAGACTTGCTCATCGTTATCTATCTTTTGGAGATTTCTACATCTCATTCTCATTCTCATGTATGGTTTTCTGCAGCAACCGGTGCAAACTAAAGATGGCGGGATTCGGCAGCCTGGCACCCAAGACCAAGAACATAGTGGTGGCTGGAGGACTCTCTGCTTTCGTCCTTGGCGTGTATTACTACACCATGAGAGCGGTGGGAGGCACAGATGAGCTGCAGGTCGCCATTGATAAGTTTGAAGGCATGAAGAAAAAGGATGCTGGGAACTCATCCGCCGCGGGATCCTAA >Medtr7g091060 ATGGCTGGAGTATTAGGATATAGTGGCCTGGCGCCTAAGACAAAGAACTTCATAGTTGCCGGGGGTTTGACAACTTTTGTTTTTGGGGCATACTTCTACACCATGAGAGCAGTTGGAGGTACTGATGAACTGCAAGTAGCAATAGATAAGTTTGAAGCCGACAAGAGCACCAAAGAAGGTGAATCAAGCATTCCATCAAAGGCCTAG >AT2G43780 ATGGCGGGATTTCCAGGTTTTAGTTACCTAGGCCCAAAAGGCAAGAACACGGTTGTAGCTGGTGGCTTGACAGCTTTTGTTTTTGGGGTATACTTCTACACAATGAGGGCGGTTGGTGGCACAGACGAGCTTCAAGTGGCTATAGACAAGTTCGAAGGCCAAAAACAGGTGGACACTGACACCAAGGTTCCATCTAAGGTCTAA >COL.COLO4_38114 ATGGCTGGGTTTTCTGGATATAACAGCCTTGCACCAAAGACTAAGAATCTGGTCGTTGCCGGGGGCTTAGCAGCATTTGTCTTTGGGGTCTATTTCTACACCATGAGAGCTGTTGGCGGCACGGATGAGCTTCAGGTGGCCATAGATAAGTTTGAGGAGAAGAAGAGGCAAGAGGCCAAGTAA >PGSC0003DMG400016297 ATGGCTGGATTTCCAGGATACAGTGCCCTTGCTCCCAAGACTAAGAATCTGGTTATGGCAGGAGGTTTGACAGGATTTGTTTTTGGTGTGTACTACTACACTATGAGAGCTGTTGGAGGTTCAGATGAACTTCAAGTAGCCATTGATAAGTTTGAAGATGCAAAACGCAGCAGTGAGGCTGAAGCAAGTTTGGCACCCAAGCAATAA >Migut.N03059 ATGTCGGGGCTTATTGGATTTCGCAGCCTTGCACCGAAGACCAAGAATCTGGTTGTTGCTGGAGGGTTAACAGGATTCGTCTTTGGGGTATATTTCTACACAATGAGGGCTGTCGGTGGCACTGATGAACTTCAGATAGCTATCGACAAATTTGAAGATCAGAAACATACGACCGAGCCGGAGGCAACATTGGCACCAAAAGCTTAG >AL4G42650 ATGGCGGGATTTCCAGGTTTTAGTTACCTTGGTCCTAAAAGCAAGAACACAGTTGTAGCAGGTGGCTTGACAGCTTTTGTTTTTGGGGTGTACTTCTACACAATGAGGGCGGTTGGTGGCACAGACGAGCTTCAAGTGGCTATTGACAAGTTCGAAGGCCAAAAACAGGTTGAGACCGACACCAAGGCTCCATCTAAGGTCTAA >GSVIVG01038176001 ATGGCTGGATTCAGTGGTCTCCCAACTAAGGGCAAGAACGGCATTGTTGCTGGTGGCTTGACAGCGTTTGTGGTTGGGGTGTATATCTACACCATGAGAGCTGTTGGAGGCACAGATGAAATCCAGGTAGCTATCAACAAGTTTGAGGAGGAGAAAGCCATGAAAGAGGATGCACCCAAGACCTGA >TPR.G18242 ATGGCTGGAGTATTAGCATTTAGGAGCCTAGCTCCCAAGACAAAGAATTTCATAGTTGCCGGGGGTTTGACAACTTTTGTCTTTGGGGCATACTTCTACACGATGAGAGCTGTCGGAGGTACCGATGAACTACAGGTAGCAATAGATAAGTTTGAAGCAGACAAGAGCAGCATTAAAGAGGGTGAAGCAAGCATTCCATCAAAAGTCTAA >ATR0743G065 ATGAGGGCCAACTTGGAGGCAATACAAGCTGCAAAGGAGAGAAAAAGAGCTATATTACAAGGAGCAAATATAACTACTGATTTTTCTGGTGAAGAAAATACTTTGTCGGATCGTAAAAGAAAGGGAAAGGAATTAGTAGATGAGGGTTCGGCAAGAGGATCAAAAGGGAAGAGCCTACAAGGAGCACATTGTCTTAGTATTGTACCTAGTACTTGTAGTGTAGGCGCTAGTGTTGGTGGTGCTGGTCGGTTGAATTCATTCTTTGAGCCTAGATCTACACAACTGAAACTTAAATCTTTCTGGGATAACAATCAAGCTCGACACAAAGCACATATCGCGATTTCTGACTTCTTCTATCATTGTGCCATACCCTTTAACTCAATAAACTCACAGTATTTTAAGAAGATGTTAGATGTAGTGGGGAGTTATGGGCCTGGCTTGAAACCTCCATCGGGTAAGGAGATAGCCGGGATTCTTTTGAAGAATAAGCGCCCTGAGTTACAACGGGGATTGAACGATTGCATTGTGCGTCTAGAGCCTGATAAGCTGAAGCAGATACGTGCGGCCCAAGAGATTGATATGTATAGGAATGCTCAAGAAGACTTTGGATCAGATTTGGCCGTGAGAACTAGGGATAAGTTAACTCCAGAGGATCCATTGGATGAATGGGTTGTAGAGACAGAAATCCAGGCCCCACTACTTGATGAGAGTGAGGTGGTTAGTTGGATGGACATAGAGTATGAAGTTGATGATGACGATGCAATTCCAGAGAGTGCTGTACATAGCCCGAGTGTGGGGGATGTTGGTGAGCCCATAATGGCTGGGTTTGCAGGATTGGCGCCGAAGACCAAGAATGTGATAGTCGCTGGGGGCCTAACGGGTTTTGTGTTGGGTGTGTATTTTTACACCATGAAAGCAGTTGGAGGCACAGATGAGCTACAGGTTGCGATTGACAAGTTTGACGAGCTTAAGAAGCAAGAAAATTCTAGCACCAGTTCCCCTTCAGCCTCTTAA >Zm00001d038795 ATGGCGGGATTCAGAAGCCTTGCACCCAAGACCAGGAACCTGGTGGTGGCTGGGGGCCTGTCGGCCTTCGTGCTCGGGGTCTACTACTACACCATGAGAGCCGTGGGAGGCACGGACGAGCTGCAGGTGGCGATCGACAAGTTTGAGGAGATGAAGAAGAAGGACGCTGCCAGAAACTCCAGCACAGGAGGATCGTAA >Zm00001d010792 ATGGCGGGGTTCAGAAGCCTTGCACCCAAGACCAGGAACCTGGTGGTGGCCGGGGGACTGTCTGCCTTCGTGCTCGGGGTCTACTACTACACCATGAGAGCGGTGGGAGGCACGGACGAGCTCCAGGTGGCGATCGACAAGTTTGAGGAGACGAAGAAGCAGGATGCCGCTAGAAACTCTAGCTCCAGCGCAGGAGGATCATAA >AH011712 ATGGCTGGGATTTCAAGTTTCGGTGCCCTTGCACCCAAAACTAAGAACTTGATCGTTGCGGGGGGACTGACTTCGTTTGTTTTTGGTGTGTACTTTTACACAATGCGAGCTGTTGGAGGTACCGATGAACTTCAGGTAGCCATTGACAAGTTTGAAGACCAGAAACACCAGAGTGAGTCCAAAGCAAATTAA >Glyma.08G364500 ATGGCTGGACTTTTGGGATATAGGAGCCTTCCACCTAAGGCAAAGAATTTGGTAGTTGCTGGGGGTTTGACAGCTTTTGTCTTTGGTGCCTACTTCTACACCATGAGGGCTGTTGGAGGCACTGATGAACTGCAGGTAGCAATTGATAAGTTTGAAGCTGACAAGAACAAGAATGCGGGCGATGCCAACATGCCATCAAAGGTCTAA >Glyma.17G205600 ATGGCTGGACTTTTGGGATATAGGAGCCTTCCACCTAAGGCAAAGAATTTGGTAGTTGTTGGGGGTTTGACAACTTTTGTCTTTGGTGCCTACTTCTACACCATGAGGGTTGTTGGAGGCACTGATGAACTGCAGGACTTTGATGTTATAACTTCAGCTGAGCTTAAAGAGAGAACATTTTCATGGTGTGAGATAGTTGGTAAACGTTTTCCGGTATGCCATGTTCACATGGATCATACCATTGTTGAGGTTGGATATTCCTGTTAA >Glyma.18G297600 ATGGCTGGACTTTTAGGATATAGGAGCCTTCCACCTAAGGCAAAGAATCTGGTAGTTGCTGGGGGTTTGACAGCTTTTGTCTTTGGTGCATACTTCTACACCATGAGGGCTGTTGGAGGCACTGATGAACTGCAGGTAGCAATTGATAAGTTTGAAGCTGACAAGAGCAAGAATGAGGGTGATGCCAACATGCCATCAAAGGTCTAA >Glyma.19G030600 ATGGCTAGAATTTTGGGATATAGGAGCCTTCCACCTAAGGCAAAGAATTTGGTTGTTGGGGGTTTGATAGCTTTTGTCTTTGGTGCCTACTTTTACACCATGAGGGTTGTTGGAGGCACTAATGAACTGCAGGTAGCAATTGATAAGTTTGAAGTTGACAAGAACAAGAATGCGGGTGATGCCAACATGCCATCAAAGGTCTAA >Glyma.19G073500 ATGGCTGGACTTTTGGGATATAGGAGCCTTCCACCTAAGGCAAAGAATTTGGTAGTTGTTGGGGGTTTGACAACTTTTGTCTTTGGTGCCTACTTCTACACCATGAGGGCTGTTGGAGGCACTAATGAACTGCAGGTAGCAATTGATAAGTTTGAAGCTAACAAGAACAAGAATGTGGGTGATGCCAACATGCGATCAAAGGTCTAA >MELO3C011854 ATGGCTGGACTTTTGGGATATAGTGGCCTTGGACCCAAGACAAAGAATATCGTTGTTGCTGGAGGTTTAACTGCATTCGTTTTCGGGGTATATTTCTACACCATGAGAGCTGTTGGAGGTTCGGATGAACTGCAAGTAGCCATTGACAAGTTTGAAGCGCAGAAAAGCAACAAGGAATCAAATGTGTAG >Eucgr.H04449 CGGTCTTCCTTTCTCCAATTTGGACATCCTTTTTCGTTCACCATACGGGCTTTTCTATTTGGCCGTTCCTTATCCTTCTCCTCAACGCTTCAACCAAAAACCCTAGCGCCGTCGCCGTCCTCTCGCCGGTCAGATCGTCGCTCATCTCGCCGTCGCCGTCGCCGTCGCCGTCGCCGTCCTCAGACCGTCCAATTTGCTCCGGTCGTCCCGTCGGATTCCGCTCTCGATTCCGCAACTCCGGTCGCCGTCGCCCATCTCCGTCGTTATTCAATCCCTCGCGTACGTGTTCGTTCGCGGCCTTCTCTGGAACTTCCCCCCGCGATTTCTCACGAGATGGCAGGGCCATCTGCATACAGGAGCCTTGCTCCCAAGACAAAGAACCTGGTTGTCGCGGGTGGTCTGACAGCATTTGTGTTTGGAGTGTATTTCTACACAATGAGAGCTGTTGGCGGTTCAGATGAGCTCCAGACGGCAATCGATAAGTTTGAAGAGCAAAAGAGCAAGCAAGGAGCTTAG >DCAR_030842 ATGGCTGGATTTTTAAGCTTTAATAACCTCGCACCAAAGACCAAAAATATAGTTGTTGCTGGAGGACTGACATCCTTTGTCTTCGGGGTGTACTTCTACACCATGAGAGCTGTTGGAGGTACAGATGAACTTCAGGTTGCTATCGATAAGTTTGAAGCAGAGAAAGGCAAAAGTGAAACTGAAGTAAAGGTCTGA >THA.LOC104802329 ATGGCTGGATTTTCAGGTTTTAACAGCCTTGCTCCTAAAATCAAGAATCTTGTGGTGGCGGGAGGCTTGTCCGCCTTTGTATTTGGGGTGTACTTCTACACCATGAGAGCTGTCGGGGGCACAGACGAGCTTCAGGTGGCCATCGACAAGTTTGAAGAGCAAAAACGAGTGGATAATGCTTCCAATTTACCATCCAAGGCTTGA >Brara.C02223 ATGTCGGGATTTCCAGGTTTGAGTTTTCTAGGCCCAAAAGGCAAGAACGCGGTTGTAGCGGGAGGCTTGACAGCATTTGTTTTTGGGGTTTATTTCTACACGATGAAAGCTGTTGGTGGCACAGACGAGCTTCAGATGGCTATAGACAAGTTTGAAGACCAGAAACAGGTCGAGACCGACCCCAAGGTTACAGCAAAAGCCTGA >Brara.E00380 ATGTCGGGAGTTCCAGGTTTGAGTTTTCTAGGCCCAAAAAGCAAGAACGCGGTTGTAGCGGGAGGCTTGACTGCCTTTGTATTCGGGGTATATTTCTACACAATGAAGGCCGTTGGTGGCACGGACGAGCTTCAGATGGCTATAGACAAGTTTGAAGACAAGAAACAGGTTGAGACCGACCCCAAGGTTCCATCAAAGGCCTGA >Cucsa.075820 ATGGCTGGACTTTTGGGATTTAGTGGCCTTGGACCTAAGACAAAGAATATCGTTGTTGCCGGAGGTTTGACTGCATTTGTCTTCGGGGTATATTTCTACACCATGAGAGCAGTTGGAGGTTCGGATGAACTGCAAGTAGCCATTGACCAGTTTGAATCGCAGAAAAGAAACAAGGAATCGAATGTGTAG