>Pp3c15_11110 ATGAGAATTCCTCCTCGATCCATCTTGGCCGACTTTCTCAAGCTCGGAAGAACGTCTAATGAAGTTGGGTGCGGTGGAAGGGCCGCATCTCGGGCTCGACATGGAATTCGCGGCGTCTATTCTGGTCATGGGCTAGAAGCAGCAGTGCTGAACATACGCTCAGTTGGATGCAATCAGCTGCATTCTATGACAACATGGGCGCCATTTGCAATTGGCCATGGCTATCACAGCGATGTCCGTGCAGGGGAAAATACAGGGAAGGAAAGAATTGCGGTGATTGGGAGTGGGAATTGGGGTAGTGTCGCTGCCAAGCTCGTGGCTACAAATGCCCTCTCCCACGAAAATATACACGACGAAGTGCGGATGTGGGTGTTTGAGGAGACATTGGCTAATGGGGAGAAGCTGACACAGGTCATCAATAAGAATAAGATAAATGTGAAGTATTTGCCCAATGTGAATCTAGGTGTCAACGTTGTTGCGGATCCAAATCTCGAGAACACTGTTAAGGATGCAACGATGTTAGTGTTTTGCACACCACATCAATTTGTCGAATCAATTTGCAAGCAACTTCAGGGTAAAGTGAATCCCAATGCCAAGGCTATATCTTTGATAAAAGGAATGGAGGTGAAACCAGATGGCCCTGTCATGTTGTCGAAGTTGATCACGAAGCACCTAGGCATCGACTGTTCGGTACTTATGGGAGCAAATATTGCAAATGAGGTGGCCATGGAACAATTTAGTGAAGCAACTGTTGGTTACAAAGCAGATACCAGTATAGCGAAATCTTGGGTCCAAGCTTTTGCCACTCCATATTTTCATGTTGCAGCTATAAAAGACGTTGAAGGAGTTGAGCTGTGTGGTACATTGAAGAATGTGGTAGCAATAGCTGCGGGATTTGTGGATGGCTTGGGGATGGGCAACAACACAAAGGCTGCTATCATGCGGATAGGGCTGAAGGAGATGATTGGATTTTCAAAGCTGCTGTTTCCAACTGTCAGTGATGCAACCTTTTTTGAGAGCTGTGGCGTAGCAGATCTGATCACTACATGCTTTGGGGGGCGCAACAGGAAAGTTGCTGAGGCATATGCACGAAATGGTGGAAAGAGATCTTTTGATGAGCTTGAGGCGGAGTTATTAGGAGGGCAAAAACTTCAAGGAGTGTTGACAGCTGGCGAAGTCTTTCAAGTGTTGAAGGCACGAAATTGGGAGAAAAAGTTTCCGCTTTTTGCAACTGTTCACAAGATCGCTATTGGCCACTTGCCTCCATCAACCATTGTTGACTACGACAACGAGAGCGCTCAAAAACTCCACAGAAATCCCAGTGTAGGTGTAATTGGCTAA >SMO244G0041 ATGGCGCCTCCCGGATTGGAGGTGGCATCGTCCTCGCCAGAGATCCAGAAGATCACGCCGCTCGATGCTGCTGCTGCCGTGGTGGAGGATGATGGTACCTCCGCGTCCTCGGAGTCCATCGCTACTGCTGCGAGAGATCGGGTTGCAGTGATTGGGAGTGGGAATTGGGGGAGCGTTGCGGCCAAGCTCATTGCTTCCAACACTTGCTGCTCTGATCTCTTCGATGATGAGGTGAGGATGTGGGTCTACGAAGAAACTCTTCCAAGCGGGGAGAAGCTTTCGCAGGTTATCAACAGGGAAAAGGAAAATGTGAAATACTTGCCTGGAGTTAAGCTTGGATCCAATGTAGTTGCAGTGCCAGACCTTTTGAATGCTGTGGCTGATGCAACGATGTTGGTGTTCGTAACTCCTCACCAGTTTATCGAGGGAATTTGCAATACATTGAAAGGAAACATACGCCAGAATGCTATTGCCATCTCGCTGATAAAAGGAATGGAGGTCAAGAAAGACGGGCCATGCATGATCTCCAACTTGATCACGGAGCTTCTTGGAATTGACTGCGCTGTTCTCATGGGTGCAAATATTGCCAACGAGGTAGCCGTGGAGAAGTTTAGCGAAGCAACTGTTGGCTTCAGGCATGATAAGCGAGCTGCAGATAAATGGGTGCGAATTTTTCGCAGGCCTTATTTCCTGGTGACTCCTGTACAAGATGTGGAAGGTGTGGAGTTGTGTGGAACACTGAAAAACGTCGTTGCTGTTGCCGCTGGTCTGGTGGATGGCTTGGACATGGGCAACAACACAAAGGCCGCAATCATGCGAATCGGGCTGAAAGAGATGCGATTCTTCTCAAAGCTGCTGTTTCCCTCGGTTCGAGACACCACCTTCTTCGAGAGCTGCGGCGTTGCCGACCTTATCACAACATGCCTTGGAGGTCGCAACAGAAGAGTGGCCGATGCATTCGCCAGGAACAAAGGGAAGCGCTCCTTCGACGACTTGGAAACCGAGCTTCTCCAGGGTCAGAAACTCCAGGGAGTTTCAACCGCGAGAGAAGTTTATGAAGTTTTGCGAGCTCGAAAGTGGGAAGAATCGTTCCCACTGTTCTCCACAGTCCATCTCATAGCAACTGGAGCTCTGGCCCCGTCAGCCATCGTCGAGTACAGCGAGCACACTCCTCGACAAATCACTAGCTCCCAAATCCAGTATTCGTCGCTATGA >Pbr012522.1.g ATGGCTCCAGAACTCCAACAGGAGGAAGATTACATTACTGGCCCTGAAGCTCCTCACAAAACCAGAGTCACCGTCGTCGGCAGTGGCAACTGGGGTAGTGTTGCCGCCAAACTCATTGCCTCCAACACCCTCAGGCTCTCTTCCTTCCACGATGAAGTGAGAATGTGGGTGTTTGAGGAAACATTACCAAGTGGTGAGAAGCTCACAGATGCCATCAACCGCAACAATGAAAATGTGAAATACCTGCCCGGCATTAAGCTGGGGAAAAATGTTGTTGCAGACCCGGACCTTGAGAATGCAGTGAACGGTGCGAACATGCTGGTGTTTGTTACTCCACATCAATTTATGGAGGGTATATGCAGGAGGCTTGTTGGGAAGGTAAAAGCGGATGTGGAGGCAATTTCCCTCATCAAAGGAATGGAGGTCAAGATGGAAGGCCCGTGCATGATCTCGACACTCATCTCACAGCAGTTGGGTATTAATTGTTGTGTTCTGATGGGAGCAAACATAGCTAATGAGATTGCTGTGGAGAAATTTAGTGAAGCCACAGTTGGATACAGAGAGAACAAGGAGATTGCACAGAAATGGGTTCAGCTCTTTAGTACTTCCTACTTCATAGTCACACCTATCCAAGATGTGGAAGGGGTAGAACTATGTGGAACCCTGAAAAATGTTGTGGCCATAGCAGCAGGTTTTGTGGATGGGTTGGAGATGGGAAATAACACAAAGGCTGCAATTATGAGAATCGGTCTAAGAGAGATGAAGGCATTTTCCAAGATGTTATTTTCATCTGTCAAGGACACCACCTTCTTTGAAAGCTGTGGTGTCGCTGATCTCATCACAACATGCCTGGGAGGAAGAAACAGGAAAGTTGCGGAAGCTTTTGCAAGGAGTGGAGGGAAAAGATCGTTTGATGAGCTTGAAGCAGAAATGCTGCAGGGTCAAAAATTACAGGGTGTCTCAACAGCAAAAGAGGTTTACGAGGTTTTAAGCCACCGCGGGTGGCTAGATTTCTTCCCACTTTTTGCAACAGTTCATGAGATCTGCATTGGCACTCTTCCTCCATCAGCCATAGTTGAACACAGTGAGCGCACGCCTAAAATCTAG >Pbr014496.1.g ATGGCTCCAGAACTCCAACAGGAGGAAGATTACACTACTGGCCCTGAAGCTCCCCACAAAACCAGAGTCACCGTCGTCGGCAGTGGCAACTGGGGTAGTGTTGCCGCCAAACTCATTGCCTCCAATACCCTCAGGCTCTCTTCCTTCCACGATGAAGTGAGAATGTGGGTGTTTGAGGAAACATTACCAAGTGGTGAGAAGCTCACGGATGCCATCAACCGCAACAATGAAAATGTGAAATACCTGCCCGGCATTAAGCTGGGGAAAAATGTTGTTGCAGACCCAGACCTTGAGAATGCAGTGAACGGTGCGAACATGCTGGTGTTTGTTACTCCGCATCAATTTATGGAGGGTATATGCAGGAGGCTTGTTGGGAAGGTAAAAGCGGATGTGGAGGCAATTTCCCTCATCAAAGGAATGGAGGTCAAGATGGAAGGCCCGTGCATGATCTCGACACTCATCTCACAGCAGTTGGGTATTAATTGTTGTGTTCTGATGGGAGCAAACATAGCTAATGAGATTGCTGTGGAGAAATTTAGTGAAGCCACAGTTGGATACAGAGAGAACAAGGAGATTGCACAGAAATGGGTTCAGCTCTTTAGTACTTCCTACTTCATAGTCACACCTATCCAAGATGTGGAAGGGGTAGAACTATGTGGAACCCTGAAAAATGTTGTGGCCATAGCAGCAGGTTTTGTGGATGGGTTGGAGATGGGAAATAACACAAAGGCTGCAATTATGAGAATCGGTCTAAGAGAGATGAAGGCATTCTCCAAGATGTTATTTTCATCTGTCAAGGACACCACCTTCTTTGAAAGCTGCGGTGTCGCTGATCTCATCACAACATGCTTGGGAGGAAGAAACAGGAAAGTTGCGGAAGCTTTTGCAAGGAGTGGAGGGAAAAGATCGTTTGATGAGCTTGAAGCAGAAATGCTGCAGGGTCAAAAATTACAGGGTGTCTCAACAGCAAAAGAGGTTTACGAGGTTCTAAGCCACCGCGGGTGGCTAGATTTCTTCCCACTTTTTGCAACAGTTCATGAGATCTGCATTGGCACTCTTCCTCCATCAGCCATAGTTGAACACAGTGAGCGCACGCCTAAAATCTAG >Pbr032239.1.g ATGGCTCCAGAACTTCAGGAGGAAAATTACACTACTGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTGAACCTCCCCAGAAAACCAGAGTCACCGTCGTAGGCAGTGGCAACTGGGGCAGTGTTGCCGCCAAGCTCATTGCCTCCAACACCCGCAGGCTCTCTTCTTTCCACGATGAAGTGAGAATGTGGGTGTTTGAGGAAACGTTACCAAGTGGTGAGAAGCTCACAGATGCCATCAACCGCAACAATGAGAATGTGAAATATCTGCCTGGCATTAAGCTGGGGGAAAATGTTGTTGCAGACCCGGATCTTGGGAATGCAGTGAACGGTGCGAACATGTTGGTGTTTGTTACTCCACATCAATTTATGGAGGGTATATGCAGGAGGCTTGTTGGGAAGGTAAAAGCAGATGTGGAGGCGATTTCCCTCATCAAAGGAATGGAGGTCAAGATGGAAGGCCCATGCATGATCTCGACGCTCATCTCAGATCAATTGGGTATTAATTGTTGTGTTCTGATGGGAGCAAACATAGCTAATGAGATTGCTGTGGAGAAATTTAGTGAAGCCACGGTTGGATACAGAGAAAAAAAAGAGATTGCACAGAAATGGGTTCAGCTGTTTAATACTTCCTACTTCATAGTCACACCTGTCCAAGACGTGGAAGGAGTAGAACTGTGTGGAACCCTGAAAAATGTTGTGGCCATAGCAGCAGGTTTTGTGGACGGATTGGAGATGGGAAATAACACGAAGGCTGCAATTATGAGAATTGGTCTAAGGGAAATGAAGGCATTTTCCAAGATGTTATTCCCATCTGTCAAGGACACCACCTTCTTCGAAAGCTGTGGCGTTGCTGATCTCATCACAACATGCCAAACAGGAAAGTAG >Carubv10004974m.g ATGCGACTCCGATCATTCTTCTTCTCTATCTTCTCCCTTTCACGTTCCCCTTCTCCTTCTCTTCCTTCCTCTCGCTTCTCCTCTCTCTCCGCCGCTATGTCTCCTGCTCTCGAGAAATCCCGACAAGGCAATGGTGAATGTAATGATGATTTGAAGTCTAAGGTTACGGTCGTTGGTAGTGGCAATTGGGGCAGTGTTGCTGCTAAGCTCATTGCTTCTAATGCCCTCAAGCTTCCTTCTTTCCATGATGAAGTGAGGATGTGGGTATTTGAGGAGGTTCTACCAAATGGTGAGAAGCTCACTGATATAATCAACAAGACTAATGAAAATGTCAAGTACCTCCCTGGGATTAAGCTTGGAAGAAATGTTGTTGCGGATCCTGACCTTGAAAATGCAGTCAAGGAAGCAAACATGTTGGTTTTTGTTACACCGCATCAGTTCATGGATGGAATATGCAAGAGATTAGATGGAAAGATCACAGGAGATGTTGAGGCTATATCTCTTGTTAAGGGAATGGAAGTGAAGAAGGAAGGTCCTTGTATGATCTCAAGTCTAATCTCCAAGCAACTTGGTATCAATTGTTGTGTTCTTATGGGCGCAAACATTGCAAACGAGATAGCTGTGGAGAAGTTTAGTGAAGCAACAGTTGGATATAGAGAGAGTAGAGAAATAGCAGACACATGGGTTCAGTTGTTTAGTACTCCATATTTTATGGTCACACCCGTCCATGATGTGGAAGGAGTAGAATTGTGTGGTACCTTGAAGAATGTAGTGGCTATTGCAGCGGGTTTTGTGGATGGTTTGGAAATGGGTAATAACACAAAGGCTGCAATCATGAGGATTGGTCTAAGAGAGATGAAAGCGCTCTCAAAGCTTCTGTTTCCATCTGTTAAAGACAGTACTTTCTTCGAGAGCTGTGGTGTAGCAGATGTCATTACAACTTGCTTAGGAGGAAGAAACCGAAGAGTTGCGGAAGCATATGCAAAAAGCGGAGGAAAAAGATCTTTTGACGAGCTTGAAGCAGAGATGTTACAAGGGCAAAAGCTACAGGGAGTATCAACAGCAAGAGAGGTCTACGAGGTGTTGAACCATTGTGGATGGGTAGAGATGTTTCCGCTCTTTTCAACGGTCCACCAAATCTGCACTGGTCGTCTTCAGCCTGAAGCCATTGTCCAATACCGCGAGCACAAAGCTTGA >Prupe.3G296200 ATGGCATCTCCGCCCCGACGAGTGTCTTCTCTCTTATATTCTCTCCTGCCCTCCTCTCTCGCTCCTAATCCTCTCTTCCACGCATTACCCATTTACCCTTTGCTTCTTTCTTCCGTATTCTCTCCATCTCCCTCTCGTTCTCTCTCTTCATCCATGGCTCCAGAACTTCAACAAGACGGAGAAACTCTGCCCCAAAATAACAACACTTACACTAGAGACCATGAAGCTCTACACAAAACCAAAGTCACCGTTGTGGGTAGTGGCAACTGGGGCAGTGTGGCTGCCAAACTCATTGCCTCTAACACCCTCAGGCTCTCTTCTTTCCATGATGAAGTGAGAATGTGGGTATTTGAGGAAACGTTACCGAGTGGTGAGAAGCTCACAGATGCCATCAACAGAAACAATGAAAATGTGAAATATCTGCCCGGCATAAAGCTGGGGAAAAATGTTGTTGCAGACCCAGACCTTGACAATGCAGTGAATGGTGCAAACATGTTGGTGTTTGTTACTCCACATCAATTTATGGAGGGTATATGCAAGAGACTTGTTGGGAAGATAAAAGGGGATGTGGAAGCTATTTCCCTCATCAAAGGAATGGAGGTCAAGATGGAGGGCCCGTGCATGATCTCTACACTCATCTCGGAGCAATTGGGCATTAATTGTTGTGTTCTAATGGGAGCAAACATAGCTAATGAGATTGCTTTGGAGAAATTTAGTGAAGCCACAGTTGGATACAGAGAAAACAGAGCGATTGCAGAGAAATGGGTTCATTTGTTTAGTACTCCCTACTTCATAGTCACACCTGTCCAAGACGTGGAAGGAGTAGAACTGTGTGGGACCCTGAAAAATGTTGTGGCCATAGCAGCAGGTTTTGTGGATGGATTGGAGATGGGAAATAACACAAAGGCTGCAATTATGAGAATTGGTCTAAGAGAGATGAAGGCATTTTCCAAGATGTTGTTTTCATCTGTCAAGGACAGCACCTTCTTTGAAAGTTGTGGTGTTGCTGATCTCATCACAACATGCTTGGGTGGAAGAAACAGGAAAGTTGCTGAAGCTTTTGCAAGGAGTGGAGGGAAAAGATCGTTTGATGAGCTCGAAGCAGAAATGCTGCAGGGTCAAAAATTACAGGGTGTGTCAACAGCAAAAGAGGTTTATGAAGTTCTAAGCCACCGTGGGTGGCTAGAGTTTTTCCCACTGTTTGCAACAGTTCATGAGATCTGCATTGGCTCCCTTCCTCCCTCAGCCATAGTTGAGCACTCTGAGCGCAAACCTGAACTCTAG >Manes.15G153800 ATGCGCTTTCTGTTTCCCCTATATCATCCCCTCTTCTGTTTTTCTTATTCTTCTTCTTCTCCATCCTTCTTCTCCATCTCTCGTTCCCTTCTCTCTCCTTTTCTTTCTTCTTCTTCCTTTCTCATGGCCCCACCTGCTGCCATGGAAGCGCCAGAAGCTGCTCCAAGAAACGCATTCACCAACGTTGCTTCTGCTGCTTCACACATTTCTAGAGTCACTGTTGTGGGTAGTGGCAATTGGGGTAGTGTGGCTGCTAAGCTTATTGCTTCTAACACCCTCAAGCTTCCTTCTTTTCATGATGAAGTAAGAATGTGGGTGTTCGAAGAGACATTACCAACTGGTGAGAAGCTAACAGATGTCATTAACAGAACTAATGAAAATGTTAAATATCTCCCTGGTATAAAGCTTGGAAAAAATGTCATTGCAGATCCTGATCTTGACAATGCAGTGAGGGACGCAAACATGTTGGTATTTGTGACTCCACATCAGTTTATGGAGGGTATATGCAAGAGACTTGTTGGAAAGGTAAAGGAAGGTGTAGAGGCTATTTCACTCATCAAAGGAATGGAGGTCAAAATGGAAGGCCCTTGCATGATCTCAACTCTTATAACTGAGCAGCTTGGTATTAACTGTTCTGTGCTAATGGGGGCAAATATTGCAAATGAGATTGCCGTTGAGAAATTCAGTGAGGCGACAGTTGGATACAGAACCAACAGAGAGATAGCAGAGAAATGGGTTCAGTTATTTAGTACTCCTTACTTCATGGTCACACCAGTCCAAGACGTAGAGGGAGTTGAACTCTGTGGGACCTTGAAGAATGTTGTGGCGTTAGCAGCAGGTTTTGTTGATGGTCTGGAAATGGGAAATAACACAAAGGCTGCAATAATGAGAATTGGTCTGAGGGAGATGAGAGCCTTCTCCAAGTTGTTGTTTTCATCTGTTAAAGACAGCACTTTCTTCGAAAGCTGTGGAGTAGCTGATGTCATCACAACATGCTTGGGAGGAAGAAACAGGAAAGTTGCTGAAGCCTTTGCAAAGAATGGGGGGAAAAGGTCTTTTGATGAGCTTGAGGCAGAGATGTTGCAGGGCCAAAAACTACAGGGTGTCTCAACTGCAAGAGAGGTGTACGAAGTCTTGAGCCACCGTGGATGGTTAGAGTTGTTTCCACTCTTTGCAACAGTGCATGAGATTTGTATTGGGCGTCTTCCACCATCAGCCATAGTTGAATATAGCGAACACAAACCAAACTTCGCCTTGGTAGAGGGCTCAGCTGAATATTATTGA >Solyc02g067930.2 ATGGCGCCTTCCAATACCAAACCTGTTGCAGTTACAGATGAAGTTCTTCAGAAATCAAGAGTCACCGTTGTTGGTAGTGGAAATTGGGGTAGTGTGGCAGCCAAGCTCATTGCTTCTAATACACTCAACATCAATTCTTTCCACGATGAAGTTAGGATGTGGGTCTTTGAGGAGACAGTGCCATCCGGTGAAAAACTCTCCGAAGTCATCAATCGAACCAATGAGAATGTTAAGTATCTTCCTGGTATAAAATTACCTAAGAATGTTGTTGCAGACCCTGATATTGAACATGCAGTGAAGGATGCTAACATGTTGGTGTTTGTGACTCCTCATCAATTCATGGAGGGGATTTGCAAGAGGCTAGTTGGGAAAATTAGGAAAGATGCTGTAGCGATTTCCCTGATTAAAGGAATGGAGGTCAAGAGGGAAGGACCTTGCATGATCTCTACCCTCATCTCTGAAATTCTTGGGATCAGTTGTTGTGTTCTAATGGGAGCCAACATTGCCAATGAGATTGCAGTTGAGAAGTTCAGCGAAGCAACGGTTGGATATAGGGATAACAAAGAGATTGCGGATAAATGGGTTTGCCTATTTAATACTCCTTACTTTTTGGTCTCAGCTGTTCAAGATGTGGAAGGAGTCGAACTTTGTGGAACTCTTAAAAATGTTGTGGCTCTAGCAGCAGGCTTTGTGGACGGCCTCGATATGGGAAATAACACTAAGGCTGCAATAATGAGAATTGGCTTGAGAGAGATGAAGGCCTTATCCAAGCTATTGTTTCCTTCTGTCAAAGATAATACATTCTTTGAGAGTTGTGGAGTAGCAGATCTAATAACTACTTGCTTGGGAGGAAGAAACAGGAGATGTGCTGATGCTTTTGCAAGGAACGGAGGAAAAAGGTCTTTTGATGAACTTGAAGCGGAGATGTTGCAAGGCCAAAAACTGCAGGGTGTCTCTACAGCAAAGGAGGTTTACGAGGTTCTAAGTCATCGAGGATGGTTTGAATTATTCCCCCTTTTCGCAACAGTTCATCAGATCTGCAGTGGCCGTCTTGCTCCCTCAGCCATAGTTGAATATACCGAGCACTCAGCCAGATTGCCCTTGCTGTAA >CAN.G1057.16 ATGGCTCCTTCCAACCAACTTGAGGTTCCTCAAAAATCAAGAGTCACCGTCGTTGGTAGTGGCAATTGGGGTAGTGTTGCTGCCAAGCTCATTGCTTTTAACACCCTCCACATCAATTCTTTCCACGATGAAGTGAGGATGTGGGTCTTTGAGGAGACATTGCCATCAGGTGAAAAACTCTCCGACGTCATCAACAGAACCAATGAGAATGTTAAATATCTTCCTGGTATAAAACTACCTAAAAATGTTGTTGCTGACCCTGACATCGAACATGCAGTGAGGGATGCTAACATGTTAGTGTTTGTGACTCCTCATCAATTCATGGAGGGCATTTGCAAGAGGCTAGTTGGGAAAATTAGGGAAGATGCTGTGGCAATTTCCCTAATAAAAGGAATGGAGGTCAAGAGAGAAGGACCATGCATGATCTCCTCCCTCATCTCTGAAATTCTTGGAATCAGTTGTTGTGTTCTAATGGGAGCCAACATTGCTAATGAGATTGCAGTTGAGAAGTTCAGCGAAGCAACAGTAGGATATAGGGAGAACAAAGAGATAGCAGAGAAATGGGTTCAACTATTCAATACTCCTTACTTTATGGTCTCAGCCGTTCAAGACGTGGAAGGAGTCGAACTTTGCGGGACTCTTAAAAATGTTGTGGCTCTAGCAGCAGGGTTTGTGGACGGCCTGGAAATGGGAAATAACACTAAGGCTGCAATAATGAGAATTGGCTTGAGAGAGATGAAGGCATTATCCAAGCTATTGTTTCCTTCTGTTAAAGATAATACATTCTTTGAGAGTTGTGGAGTAGCAGATCTTATAACTACTTGCTTGGGAGGAAGAAACAGGAGGTGTGCTGATGCTTTTGCAAGGAATGGAGGAAAAAGGTCTTTTGATGAACTTGAAGCAGAGATGTTGCAAGGCCAGAAACTGCAGGGCGTCTCTACAGCAAAGGAGGTTTATGAGGTTCTAAGTCATCGGGGATGGTTGGAATTGTTCCCCCTTTTCACGACAGTTCATGAGATCTGCAGTGGCCGTCTTGCTCCCTCAGCCATAGTTGAATATACCGAGCACTCAGCCAGATTGCCCTTGCTGGAAAGTCCTGTTCACTTGAACTGA >FVE27988 ATGGCTCCACAAGAAGCAGCAGCAGCAGCTAGTGTGACCCAGAAGACTGATGAGGCTGCTCCTCGCAAGAACAGGGTCACAGTTGTGGGCAGTGGCAACTGGGGCAGTGTGGCTGCTAAGCTCATTGCCTCCAACACCATTAGGCTTCCTTCTTTTCATGATGAGGTGAGAATGTGGGTGTTTGAGGAGACATTGCCAAGTGGTGAGAAGCTCACAGATGCCATCAACACAAGAAATGAAAATGTAAAATATCTGCCTGGCATAAAACTTGGGAAAAATGTCGTTGCAGACCCAGACCTTGTCAATGCAGTGACTGGTGCAAACATGTTGGTGTTTGTTACTCCACATCAATTTATGGAGGGTATATGCAAAAGACTAGCAGGGAAGATAAGCGGGGATGTGGAGGCTATTTCCCTTATTAAAGGAATGGAGGTCAAGATGGAAGGCCCATGCATGATCTCTAAACTGATCACTGACCAATTGGGTGTAAATTCTTGTGTTCTAATGGGAGCAAACATAGCTAATGAGATTGCTTTGGAGAAATTCAGTGAAGCCACAGTTGGATACAGAGAAAACAAAGAGATTGCAGAGAAATGGGTTCAACTATTTAGTACCTCCTACTTCATAGTCTCACCTGTCCAAGATGTGGAAGGTGTAGAACTGTGTGGTACCCTGAAAAATGTTGTGGCCATAGCTGCAGGTTTCGTGGATGGCTTGGACATGGGAAATAATACAAAGGCTGCAATTATGAGAATTGGTCTAAGAGAGATGAAGGCATTTTCCAAAATGTTGTTTTCATCTGTCAAGGACAGCACCTTCTTTGAAAGCTGCGGTGTTGCTGATCTCATCACAACATGCTTGGGAGGAAGAAACAGGAAGGTTGCAGAAGCTTTCGCAAAGAGTGGAGGGAAAAGATCGTTTGATGAGCTTGAAGCAGAAATGCTACAGGGTCAAAAATTACAGGGTGTGTCAACAGCAAAAGAGGTATATGAAGTTTTAAGCCACCGTGGGTGGTTACAGTTTTTCCCGCTTTTTGCAACAGTTCACGAGATCTGCATTGGCACACTTCCTCCATCAGCCATAGTGGAACACAGTGAGCGCACACCTAAATAG >Mapoly0218s0007 ATGCCGTGGAGCGCCTGCTTTATGGCCGAGAGGACGAGAGGGGGCTCGGGGAGGATCGGTGGTGGCAGGGGCCAAGAACGCCCAGGCGCAGCAACTGCAGCAGCAGACCGTTCTGCTTGGGATATGGCGCCGGGGTTGGATGTGGGGTCGGGCACCCGCGATGGAGGTCTCTTGAATTCCTATGAGGCGGAGCCCGATCGCGTGGCCGTGATTGGAAGCGGTAATTGGGGGAGCGTGGCGGCTCGCCTTGCTGCGACCAATGCTCGCCGTCTCCCTTACTTCCAAGATGAAGTGCGAGTTTGGGTTTACGAGGAGAAACTCAGCAATGGAGAATTACTGAGCGACGTTATAAACAAAACTCAGGAAAATGTGAAGTATTTACCCAATGTAAAGCTGGGGCCCAATGTTGTGGCAGATCCTAATCTGGAGACAGCTGTGAAGAATGCTACCATGCTGGTATTTGTCATGCCTCATCAATTTATCGAGGGCATTTGTCAGAAGTTGAAGGGAAAGATTCGACCCGACGCAAAAGCCATATCTCTCATCAAAGGCATGGAAATGGGCGACGATGGCCCGCGCCTAATCTCCAGGGAGATCAGTGAGCAATTAGGGATAGACTGTTCTGTACTGATGGGTGCCAACATAGCAAATGAGATAGCTGTCGAACAATTTAGCGAGGCAACTGTTGGCTACAGAGACGATAAGGAAACTGCGGATAAATGGGTTCAAGTGTTTGGAACACCCTACTTTCAAGTCACTCATGTCCAAGATGTGGAAGGGGTCGAGCTGTGCGGGACCTTGAAGAACATAGTCGCAATTGCTGCTGGTTTGGTGGACGGTCTCGGCATGGGGAACAACACCAAGGCTGCTATCATGCGCATTGGGCTGAAGGAGATGATCCTGTTTTCCAAGCTCTTATTTCCATCCGTACAAGATGCCACATTCTTCGAAAGTTGTGGAATCGCAGATCTAATCACCACTTGCCTTGGGGGCCGCAACAGAAAGGTTGCCGATGCTTTTTCAAAACATGGGGGAAAGCGATCTTTTGACGAGCTGGAAGTAGAGTTGCTGAATGGCCAAAAGCTACAGGGAGTATTAACGGCGAAGGAAGTATTTGGTCTCTTGAAGGCTAAAGATTGGGAGGAGTCTTTTCCTCTATTTTCAACTGTACACGCAATAGCTACACGGCATTTGCCCCCCTCAGCAATTGTGGAGTACTCGGAACGTGCTCCTCGAAAAATTGTGCTCGTCTGA >TCA.TCM_017024 ATGCGCTTTCCTTTCCCCTTATATTATTCTCCTTCTTCTCTCTTCTCTAACTTCTCTTCCTCTCCTTATTCCTTCTTTTCCTCGTTGCCACTCATCTTTGCCTCCTCTCATTTCTCTCCATTTCGTTCCATTTCTTTACCTGTTTCCATGGCTCCTGCCTTTGAACAAGTCCCAGTCCCACAGGAGGGTGAAACTGCAACACCCCATGACACCAACACTGGGAACAATGTTGGTAATGATGGTCAAGCTGGTTTTAAATCAAGGATCACAGTGGTCGGAAGTGGCAATTGGGGTAGTGTTGCTGCTAAGCTCATTGCTTCTAACACTCTCAAGCTCAACTCTTTTCATGATGAAGTGAGGATGTGGGTATTTGAGGAGACATTGCCAAGTGGTGAGAAGCTCACAGATGTCATTAACCGAACTAATGAGAATGCTAAATATCTCCCTGGTATTAAGCTAGGTAAAAATGTCATTGCAGATCCAGACCTCGACAATGCAGTTAAAGATGCAAATATGTTGGTTTTTGTGACCCCCCATCAATTTATGGAGGGTATATGCAAGAGGCTTGTTGGTAAAGTGAGTGGAGATGTGGAGGCTATTTCCCTTATTAAAGGGATGGAGGTCAAGATGGAAGGCCCTTGCATGATCTCCACTCTTATTTCTGAGCAGCTTGGCATCAACTGTTCTGTTTTGATGGGGGCAAATATCGCAAATGAGATTGCTGTCGAGAAGTTCAGTGAAGCAACAGTTGGGTACAGAGACAACAGAGAGATTGCAGAACAATGGGTTCAATTATTCAGCACACCTTATTTCATGGTCACTCCTGTTCAGGACGTGGAAGGTGTTGAGCTATGTGGGACTTTGAAGAATGTTGTGGCCATAGCAGCTGGTTTTGTGGATGGACTTGACATGGGAAATAACACAAAGGCTGCAATAATGAGAATTGGTCTGAGAGAGATGAGAGCTTTCTCCAAGCTGTTATTTTCATCTGTTAGGGATAGTACCTTCTTTGAAAGCTGTGGAGTTGCTGATGTCATCACAACATGCTTGGGGGGAAGAAACAGAAAAGTTGCCGAGGCATTTGCTAAAAATGGAGGAAAAAGATCTTTTGATGAGCTTGAAGCTGAGATGTTGCAGGGCCAGAAATTACAGGGTGTATCCACGGCAAGAGAGGTCTATGAAGTTTTAAGTCACCGTGGATGGCTAGAGTTGTTTCCTTTATTTGCAACAGTGCACGAGATCTGCATTGGTCATCTTCCACCATCAGCCATAGTTGAATACAGTGAGAAGAAACCAAGGTTGTCCCTATTAGAGGACTCTGCTCGTTACCATTGA >AUR62035520 ATGAAAGCTGAAGAATTTCCAGATAAATACAAAGTCGCTGTTATTGGCAGCGGTAACTGGGGAAGTGTTGCTGCCAAGCTAATTGCATCCAATACCCTTAATTACAACATCTTCCATGATGAAGTTAGGATGTGGGTATTTGATGAAACATTGCCCAGTGGAGAGAAATTGTCCAATGTTATCAATCAAACCAATATAAATGTGAAGTACCTCCCTGGCATAGAGCTTGGTAGAAATGTGATTGCTGACCCGGACCTCGATACCACAGTCAGAGATGCTAACATGCTGGTATTCGTGACACCACATCAGTTTGTCGATGGTGTTTGTAAGAGACTAGCTGGAAAACTAAGGGGTGATGTTGAGGCTATTTCATTGATCAAAGGCATGGAGATAGCTGAGGAGAAGTTTAGTGAAGCAACATTAGGATATAGTGAGAATAAAGAGGTTGCAGATAGGTGGGCTCGACTATTTGCCACACCCTATTTTGCTGTCACAACTATTCAAGATGTGGAAGGAGTGGAATTATGTGGTACACTAAAAAATGTAGTGGCAATAGCTGCAGGATTTGTTGATGGCTTGGATATGGGGACTAATTCAAAAGTAAGCAAAGTTTTGTCACATGTGGCTGCAAGAGTAATCAGAACGGTCTATTTAGCTAGATTTGTTGCTGTTGGAGGAAGGAACAGAAAAGTTGCAGAGGCTTTTGCAATTCATGGAGGAAAGAGACCCTTTAAGGAGCTGGAAGCTGAGATGTTGCAGGGGCAGAAATTACAGGGTGTCTCGACAGCTAAAGAGGTATACGAGGTCTTAGAAAGCAACAGATGGTTTGATTCATTTCCCCTTTTCAGAACAATACACGAGATTTGTATCGGATCTTTACCGCCGTCTGCCATTGTGCATTATAAAGCAGAAGTACATCCAAGCTCTTTCCAACAGAAACTGTGA >AUR62041297 ATGAAAGCTGAAGAATTTCCAGATAAATACAAAGTCGCTGTTATTGGCAGCGGCAACTGGGGAAGTGTTGCTGCCAAGCTAATTGCATCCAATACCCTTAATTACAACATCTTCCATGATGAAGTTAGGATGTGGGTATTTGATGAAACATTGCCCAGTGGAGAGAAATTGTCCAATGTTATCAATCAAACCAATATAAATGTGAAGTACCTCCCTGGCATAGAGCTTGGTAGAAATGTGATTGCTGACCCGGACCTCCATACCACAGTCAGAGATGCTAACATGCTGGTATTCGTGACACCACATCAATTTGTCGATGGTGTTTGTAAGAGACTTGCTGGAAAACTAAGGGGTGATGTCGAGGCTATTTCATTGATTAAAGGCATGGAGGTCAAAGTTGACGGCCCACACATGATATCCTCTGTAATCTCTAAGCAACTTGGAGTCAATTGTTGTGTTTTAATGGGGGCAAATATTGCTGATGAGATAGCTGAGGAGAAGTTTAGTGAAGCAACATTAGGATATAGTGAAAATAAAGAGGTTGCAGAGAGGTGGGCTCGACTATTTGCCACACCCTATTTTGCTGTCACAGCTATTCAAGATGTGGAAGGAGTGGAATTATGTGGTACACTAAAAAATGTAGTGGCCATAGCTGCAGGATTTGTTGATGGCTTGGATATGGGGAGTAATTCAAAAGCAGCAATCATGAGAATTGGCTTGAATGAAATGAGGGCATTCTCCAAGCGACTGTTCCCATCGGTTAGAGAGGACACTTTCTTTGAGAGTTGTGGAGTGGCTGATCTTATCGCTACTTGTTTTGGAGGAAGGAACAGAAAAGTTGCAGAGGCTTTTGCAATTCATGGAGGAAAGAGACCCTTTAAGGAGCTGGAAGCTGAGATGTTGCAGGGGCAGAAATTACAGGGTGTCTCGACAGCCAAAGAGGTATACGAGGTCTTAGAAAGCAACAGATGGTTTGATTCATTTCCCCTTTTCAGAACAATACACGAGATTTGTATCGGATCTATACCGCCGTCTGCCATTGTGCATTATAAAGCAGAAGTACATCCAAGCTCTCTCCAACAGAAATCTGTGAGCTGA >Cla004639.g ATGGCCCCCGGAATCGAGCCTCTACAGCGTTCTACCAATGGGGGCTCTGTTAAGCCCGATTCCCATTTATCCGATGATGGGGTTTCTCACAAATCCAAAGTTACCGTCATTGGAAGTGGCAATTGGGGTAGTGTGGCAGCCAAACTCATCGCCTCTAATGCCGCTAGGCTCACCTCTTTCCATGATGAGGTTAGAATGTGGGTGTATGAGGAGACTCTGCCTACTGGTGAGAAGTTAACTGATGTTATCAATCTCAACAATGAGAATGTTAAGTATCTCCCTGGTATAAAGCTTGGCAAGAATGTTATAGCAGACCCAGACCTTGAAAATGCAGTGAAGGATGCTAATATGTTGGTGTTCGTGACTCCCCATCAATTTGTGGAGGGGATATGTAAGAGACTGGTTGGAAAGATAAGGGGAGATGTGGAAGCTATTTCCCTCATTAAAGGAATGGAGGTGAAGAAGGAAGGTCCATGCATGATTTCTTCCCTCATCTCCCAGGAATTGGGGATCAATTGTTGTGTTCTTATGGGGGCCAACATAGCAAACGAGATTGCTGTAGAGAAATTTAGTGAAGCAACAGTGGGATACAGGGAGAACATGAGAGAGGTAGCTGAAAAATGGGTTCAACTTTTCAGCACTCCCTATTTTGTTCTTACACCTGTCCAAGATGTTGAAGGAGTTGAAATGTGTGGAACTCTTAAAAATGTTGTGGCATTAGCAGCAGGCTTTGTTGATGGTTTGGAGATGGGAAATAACACGAAGGCTGCAATAATGAGAATTGGTCTGAGGGAGATGAGGATGATTTCCAAACTTCTGTTTTCATCTGTCAAGGACAGTACTTTCTTTGAGAGTTGTGGAGTAGCCGACCTGATTACAACGTGCTTGGGAGGAAGAAACAGGAAGGTGGCAGCAGCTTTTGCTATGAATGGAGGGAAAAGGTCCTTTGATGAACTTGAAGCAGAGATGCTGCAGGGCCAAAAATTGCAGGGTGTCTCCACTGCAAAGGAGATGTACGAGGTTTTGAACCACCGTGGGTGGCTGGAGCTGTTTCCATTGTTTGCATCAGTCCACGAGATCTGTATCGGACATCTTTCACCATCAGCCATCGTCGAATATAGCGAGCGCAAACCCAACTTCTCTGTTATTGATGGCCATGCTCAGTAA >Cc07_g00150 ATGGCCCGGCAGCAGCTGCCGATTGAGGAAGAGACACCACAAGATGCGGCAGCCGACAACAACAGTGTAGCATTCCATGACGCCGGGGCCTCCAACAAATCCAAGGTCACGGTTGTGGGCAGTGGCAATTGGGGTAGCGTTGCAGCCAAGCTCATTGCCTCCAACACCCTCAAGTTCCCTTCTTTCCACGATGAAGTGAGGATGTGGGTTTTCGAGGAGACATTGTCTAACGGTGAAAAACTGTCAGAGGTCATCAACCAAACCAATGAGAATGTTAAATATCTTCCTGGGGTAAAGCTTGGCAAAAATGTTGTGGCAGACCCTGACCTTGAACACGCAGTAAGAGATGCAAACATGTTAGTATTTGTGACTCCTCATCAGTTCATGGAGGGCATATGCAAAAGGCTAGTTGGGAAGATTAAAAAGGAAGCTGAGGCGATTTCACTGATCAAAGGAATGGAAGTCAAGATGGAAGGTCCCTGCATGATCTCTACCCTCATCTCCGAAAAGCTTGGAATCAATTGTTGCGTACTAATGGGGGCAAATATTGCTAACGAGATTGCAGAGGAGAAGTTCAGTGAGGCTACAGTTGGATACAGAGGAAACAAGGAAATTGCAGACAGATGGGTTGAGCTCTTCAACCATCCTTACTTTATAGTCTCAGCAGTTCAAGATGTGGAAGGAGTTGAACTGTGTGGAACCCTTAAAAATGTAGTCGCAATAGCAGCAGGATTTGTGGACGGTTTAGAGATGGGAAACAATACAAAGGCTGCGATAATGAGAATTGGCTTGAGAGAAATGAAGGCCTTCTCCAAGTTACTATTCTCGTCTGTTAACGACAGTACATTTTTTGAGAGCTGTGGTGTGGCAGACATCATAACCACTTGCTTAGGTGGAAGGAATAGGAAATGTGCTGAGGCTTTTGCTAGACATGGCGGGAAAAGGACTTTTGACGAGCTTGAAGCTGAGATGTTACAGGGTCAAAAACTACAGGGCGTCTCAACAGCAAAGGAGGTTTACGAGGTTTTGAGGCACCGGGGATGGTTGGAGTTATTCCCACTTTTCACGACCGTGCACGAGATTTGCAGTGGCCGCCTCCCACCATCAGCCATAGTCGAGACAGTGAAGTGA >Gorai.006G036200 ATGCGCTTTCATTTCCCCTTATATTCTTCTTCCTCTTTCTCCCTCTTTTCTGACTTCACTTCCATTTCTTCATTGCCACTCATCTTTTCTTCCTCCTATTTCTCCACTTTCATTTCAATGGCTCCTGCTTTTGAACCTCTCTCTCCCCCACACCAAGAAGCTGAACCCCAAACTGCAACACCCCATCACGCTGACACTGTAAACAATTTTGGGAATGATGGTCAAGTTGTCTCTAAATCAAAGGTCACTGTTGTTGGTAGTGGTAATTGGGGTAGTGTTGCTGCTAAGCTCATTGCTTCTAACACTCTCAAGCTCAACTCTTTTCATGATGAAGTGAGGATGTGGGTATTTGAGGAGACATTGCAAACGGGTGAAAAGCTTACAGATGTCATTAACAAAACTAATGAAAATGTTAAATACCTTCCTGGTATTAAGCTCGGCAAAAATGTCATTGCGGATCCAGACCTCGAGAATGCAGTAAAAGATGCAAACATGTTGGTCTTTGTGACCCCTCATCAATTTATGGAGGGCATATGCAACAGGCTTGTTGGTAAAGTAAGGGGAGATGTTGAGGCTATTTCTCTTATTAAAGGGATGGAGGTCAAAATGGAAGGCCCTTGTATGATCTCCAATCTTATATCCGAGCAGCTCGGCATCAATTGTTCTGTTCTAATGGGGGCAAATATCGCAAATGAGATCGCTGTGGAGAAATTCAGTGAAGCAACGGTTGGATATCGAGACAATCGAGAGATTGCGGAGCAATGGGTTAAATTATTCAGTACCCCTTATTTCATGGTCACTCCTGTCCAGGATGTGGAAGGGGTTGAACTATGTGGAACTTTGAAGAATGTTGTGGCCATTGCAGCTGGTTTCGTGGATGGACTTGAGATGGGAAATAACACAAAGGCTGCGATAATGCGAATTGGTCTAAGAGAGATGAGAGCTTTCTCCAAACTGTTATTTTCATCTGTTAGAGATAGTACCTTCTTTGAAAGCTGCGGAGTTGCTGATGTCATCACAACATGCTTGGGGGGAAGAAACCGAAAAGTTGCAGAGGCATTTGCTAGGAATGGAGGAAAAAGATCTTTTGATGACCTAGAAGCTGAGATGTTGCAGGGCCAGAAATTACAGGGTGTATCCACGGCAAGAGAGGTCTATGAAGTTTTAAGCCATCGCGGATGGCTAGAGTTGTTTCCTCTATTTGCAACAGTGCATGAAATCTGTGTTGGTCGACTTCCACCATCAGCCATTGTCGAATACAGCGAGAAGAAACCAAGGTTATCCCTCTTAGAGGACCCCGCCTGTTACCAATGA >Gorai.012G066600 ATGGGTGACACTGCAACCACCCATCACACTAAATCTGCAAACAATGGTGCTAATGATAATCAAATTGGGTTTAAATCAAGGGTTTCAGTTATTGGTAGTGGCAGTTGGGGAAGTGTTGCTGCTAAACTCGTTGCTTTCAACACTCTCAACCTCAGCTCTTTTCATGATGAAGTAAAGATGTGGGTATTTGAGGAGACATTACAAAGTGGTGAGAAGCTCACAGATGCCATTAACCGCACTAATGAGAATGTTAAATATCTCCCTGGTATTAAGCTGGGTAAAAATGTCATTGCAGATCCAGACCTTGACAATGCAGTTGAAGATGCAAACATGTTGGTTTTTGTCACCCCCCATCAATTTATAGACAACATATGCAAGAGCCTTGTGGGTAAAGTGAGGAGTGATGCGGAGGCTATTTCTCTTATTAAGGGGATGGAGGTCAAGATTGAAGGCCCTTGCTTGATCTCAACTTATATTTCCGAGCAGCTTGGCATCAATTGTTCCGTTCTGATGGGGGCAAATCTTGCGAATGAGATTGCTGAGGAGAAATTCAGTGAAGCAACAGTCGGGTATAGAAACAATAGAGAAATTGCAGAACAATGGGTTCAATTATTTACTACCCCTTATTTCATGGTTACTCCTGTGCAGGATGTGGAAGGGGTTGAATTATGTGGCACTTTGAAGAACGTTGTGGCCATAGCAGCTGGTTTTGTGGATGGACTTGACATGGGAAATAACACGAAGGCTGCGATTATAAGATTTGGTCTGAGAGAGATGAGAGAGTTCTGCAAGCTGTTATTTTCATCCGTTAAGGATGATACCTTCTTTGAAAGCTGTGGAGTTGCTGATGTTATCACAACATGCTTCGGGGGAAGAAACAGAAAAGTTGCCGAGGCATTTGCTAGGAATGGAGGGAAAAGGTTAGCCTTAAAACATTTGGTGCACAAGCTTAACCCGGATATAAGGCAAATTGTGACACTACTGTTTCTTATCCACAGATCCTTTGATGAGCTTGAGGCTGAGATGCTGCAGGGCCAGAAATTACAGGGGGTAACAACGGTACGAGAGGTCTATGAAGTTTTAAGGCACCGGGGATTGTTAGAGTTGTTTCCTCTGTTTGCAACAGTGCACGAGATCTGTAGTGGTTGTCTTCCACCATCAGCCATAGTTATATATAGTGAGAAAAAAAACATTTTTCCTGTCTGA >Cre01.g053000 ATGATGCTGTCAGGCCGCACCTGCAACCATGCCTTCAGCACTCGTCAAATGAGCCACCAGCGCGGAGCGCTCGCGCTTCGATCAGCGCGGGTAGCTCAACGGCCGGTCACTTGCCGTCGCGCACCGTTTGTGCCCAGCGCCGTCTTCCTACAGTCAGAGCCGGCACAAAAGACCGCTTCCTCTGCCAACAACGGCGATGCCGCGCCCTCGGAGGCTCGCACCGTCCCGTCCGAGCGCGCGCTGGCCATCTGGCGCTCCGCCGACGCCGTCTGCTTCGACGTAGACTGCACCATCACCATCAATGACGGCCTGGACCTGCTGGCCGAGTTCATGGGCGTCAAGGAGGAGGTTGAGGAGCTCACCAACAAGGCCATGGACGGCACCATGTCTCTGACGCGCTCTCTGGAGGAGCGCCTCAACCTGATCAACTGCTCGCCCGACGACATCCGCCGCTTCATCAAGGCCTACCCGCCCCAGTCCCGCCTGGCGCCCGGCATCAAGGAGCTGATCAAGGCGCTCCAGAAGCGCGGTGTGGCGGTGTACCTCATCAGCGGCGGCTTCCGCGAGCTGCTGCTGCCCATCGCGGCGCACCTGGGCATCCCGAAGGACCGCGTCTTCGCCAACCGCATGCACTGGCAGTGGGACGACGAGACCGGCATGCCCACCAAGCTGGTCGGCTTTGACACGTCCGAGCCCACGGCCCGCAACCAGGGCAAGCCCGAGGCCATCGCGCGCATCCGCGAGAACAACCCCTACAACACCGTGGTCATGATCGGCGACGGCATCACCGACCTGGAGGCGGTGCAGACCAGCGGCGGCGCCGACTTGTTCATCGGCAGCGGCGTGGTGGTGGAGCGCGAGGCCGTGGTGGCGGAGGCCGAGTGGTATGTGTACGACTACAAGGCACTTGTGTCGGCCCTGTCCCGTTACAAGGTGGCCATGGTGGGCAGCGGCGCCTGGGCGTGTGCGGCGGTGCGCATGATCGCGCAGAACACCAGCCAGGACGACCCCGAGGACGAGTTTGACGACGACGTCCGCATGTGGGTGCACCAGGGCGGCGAGCTGGTCGACACGATCAACAGCACCCACGAGAACCCGGCCTACTTCCCCGGCATCCCCCTGGGCCCCAACGTCATCGCCACCGGCAACCTGGCGGAGGCAGTGGCGGACGCCGACCTGCTGGTGTTCTGCGCGCCGCACCAGTACATCCGCGGCATTTGCAAGCAGCTCATGGGCAAGGTCAAGCCGGGCGCCGCCGCCATCAGCCTGACCAAGGGCATGCGCGTCACGCCCGAGGGCCCCGAGCTCATCAGCCAGATCGTGCGCCGCACCCTGGGCGTGGACTGCTCCGTGCTCATGGGCGGTAACATCGCCGAGGACGTGGGCCGCGAGCAGCTGTCCGAGGCCGTGATCGGCTACTACAACCTGGAGCACGCCCAGCGCTTCAAGAAGCTCTTCCAGCGCCCCTACTTCCGCGTGACGCTGCTGCCGGACCCGGTGGGTGCTGAGCTGTGCGGTACGCTCAAGAATATCGTGGCCCTGGGTGTGGGCATGGTGGACGGCCTGGGCATGGGACCCAACTCCAAGGCCGCTATCATCCGCCAGGGCCTGCTTGAGATGCGTGACTTCTGCCAGGCCCTCTACCCCTCCGTCCGCGACGACACCTTCCTCGAGTGCTGCGGCGTGGGCGACCTGGTCGCCACCTGCATCGGCGGCCGCAACCGCCGCGTGGCCGAGGCCTGGACGCGCTCCGCAGTTGAGGGCGCCGAGGCTGGCGAGGGCAACGGTGCCGGCCGCAGCTGGGCTGAGCTGGAGAAGGAGCTGCTCCAGGGCCAGAAGCTGCAGGGCGTGCTGACCAGCAACGAGGTGCAGCAGATCCTGAGGACCCGCGGCTGGGAGAGCAAGTACCCGCTGTTCACCACCATCAACCGCATCGTCAACGGCCACCTGCCGCCGCACCTGGTGGTCGACTACCTGGAGGGCGCCAAGGCCGATATCGCCGTTGACGTCGAGGAGGATATTGTGCCCCTGCCGCGCCAGCCCGCCTCCGCCATGGCCCGCCTATTCGGCCAGCTGGTCGGCGGCATCACGCAGCAGGGCGGAGCAGCTGCTGGCGCCGCCGCCAGCGCCGCCGCAGGCGCCGCCTCCGGCGCTGCCAGCAACAGCGTGTAA >Cre01.g053150 ATGCCAACAGAGGTGGAACAGAAGACCGGCACCACTTCCAACAACGGCAATGTCACACCCTTGGAGGCTCGGACTGTCCCTTCCGAGCGCGCGCTGACCATCTGGCGCTCCGCCGACGCCGTCTGCTTCGACGTAGACTGCACCATCACCGTCAACGACGGCCTGGACCTGCTGGCCGAGTTCATGGGCGTCAAGGAGGAGGTGGAGGCGCTCACCAACAAGGCTATGGACGGCACCATGTCTCTGACGCGCTCTCTGGAGGAGCGCCTCAACCTGATCAACTGCTCGCCAGACGACATCCGCCGCTTCATCAAGGCCTACCCGCCCCAGTCCCGCCTGGCGCCCGGCATCAAGGAGCTGATCAACGCGCTCCAGAAGCGCGGCGTGGCGGTGTACCTCATCAGCGGCGGCTTCCGCGAGCTGCTGCTGCCCATCGCGGCGCACCTGGGCATCCCCAAGGACCGCGTCTTCGCCAACCGCATGCACTGGCAGTGGGACGATGAGACCGGCATGCCCACCAAGCTGGTCGGCTTTGACACGTCCGAGCCCACGGCCCGCAACCAGGGCAAGCCCGAGGCCATCGCGCGCATCCGCGAGAACAACCCCTACAACACCGTGGTCATGATCGGCGACGGCATCACCGACCTGGAGGCGGTGCAGACCAGCGGCGGCGCCGACTTGTTCATCGGCAGCGGCGTGGTGGTGGAGCGCGAGGCCGTGGTGGCGGAAGCCGAGTGGTATGTGTACGACTACAAGGCACTTGTGTCGGCCCTGTCCCGTTACAAGGTGGCCGTGCTGGGCAGCGGCGCCTGGGCGTGTGCGGCGGTGCGCATGATCGCGCAGAACACCAGCCAGGACGACCCCGAGGACGAGTTTGACGACGACGTCCGCATGTGGGTGCACCAGGGCGGCGAGCTGGTCGACACGATCAACAGCACGCACGAGAACCCGGCCTACTTCCCCGGCATCCCCCTGGGCCCCAACGTCATCGCCACCGGCAACCTGGCGGAGGCAGTGGCGGACGCCGACCTGCTGGTGTTCTGCGCGCCGCACCAGTACATCCGCGGCATTTGCAAGCAGCTCATGGGCAAGGTCAAGCCGGGCGCCGCCGCCATCAGCCTGACCAAGGGCATGCGCGTCACGCCCGAGGGCCCCGAGCTCATCAGCCAGATCGTGCGCCGCACCCTGGGCGTGGACTGCTCCGTGCTCATGGGCGGTAACATCGCCGAGGACGTGGGTCGCGAGCAGCTGTCTGAGGCCGTGATCGGCTACTACAACCTGGAGCACGCCCAGCGCTTCAAGAAGCTCTTCCGGCGCCCCTACTTCCGCGTGACGCTGCTGCCCGACCCGGTGGGTGCTGAGCTGTGCGGTACGCTCAAGAACATCGTGGCCCTGGGTGTGGGCATGGTGGACGGCATGGGGATGGGACCCAACTCCAAGGCCGCAGTTATCCGCCAGGGCCTGCTTGAGATGCGTGACTTCTGCCAGGCCCTGTACCCCTCCGTCCGCGACGACACCTTCCTCGAGTGCTGCGGCGTGGGCGACCTGGTCGCCACCTGCATCGGCGGCCGTCACCGCCGCGTGGCCGAGGCCTGGACGCGCTCCGCAATTGAGAGCGCCGTGGCCGGCGAGGGCAACGGTGCCGGCCGCAGCTGGGCTGAGCTGGAGAAGGAGCTGCTGCAGGGCCAGAAGCTGCAGGGCGTGCTGACCAGCAACGAGGTGCAGCAGATCCTGAGGACCCGCGGCTGGGAGAGCAAGTACCCGCTGTTCACCACCATCAACCGCATCGTCAACGGCCACCTGCCGCCGCACCTGGTGGTCGACTACCTGGAGGGCGCCAAGGCCGATATCGCCGTTGACGTCGAGGAGGACATTGTGCCCCTGCCGCGCCAGCCCGCCTCCGCCATGGCCCGCCTATTCGGCCAGCTGGTCGGCGGAATCATGCAGCAGGGAGGAGCAGCCGCCGGCGCCGCCGCCAGCGCCGCCGCAGGCGCCGCCGCGGGCGCTGCCAGCAACAGCGTGTAA >Cre10.g421700 ATGCAGCTGCACTGCACGCAGCGCTCCGCAGCAGCGAGCTGCCATGCTCGCCGTGGCGCTGCAGTGGCGCAAGCGCCAGTCCGCTGCAGCCACCCGTCAGGCGTTTTCCTGAATGGAGCCTCGATTGCACCGAGCGTGCACCGCTCTCGCCGATGCGTAAAGGCGTTTGTGAGTGTGGCGAGCCAGAATGCTGCCCAGATGGATGCTGCCCCTCAGAAGGCGCAGGCTACGCAGCAAGATTGGACGCCCAAAACCACTGCCAGCGACTCAGTTCTCGCAGTGTGGAGGAAGGCGGACGCAGTTTGCTTCGATGTTGATTGCACCATTACCGTGAATGACTCGCTGGACCTGCTGGCCGAGTTCATGGGCGTGAAGGAGCAGGTGGAAATCCTGACCAACAAGGCCATGGACGGCTCTCTGTCTCTGGAGCAGGCCCTGGAGGAGCGGCTCAACATCATCAACTGCTCGCCCGATGACATCAAGCGGTTCATCAAGGCGCACCCGCCCGCCTCGCGCATGGCGCCGGGCATCAAGGAGCTCATCAACTCGCTTCAGGCCCGCGGCAAGGCCATCTACCTCATCAGCGGAGGATTCAGGGAGCTGACGCTGCCCATCGCCGCGTACCTGGGCATCCCCAAGGAGAACGTATTTGCCAACCGCATGAACTGGCAGTGGGACGACGAGACCGGCATGCCCACCAAGCTGGTCGGCTTCGACATGTCGGAGCCCACCGCACACAACCAGGGCAAGCCGCAGGCCATCGCGCGCATCCGCCAGCGCAACCCCTACAACACCGTTGTCATGATCGGCGACGGCATCACCGACCTGGAGGCGGTCCAGACCACCGGGGGCGCCGACCTGTTCATCGGCAGCGGCGTGGTGGTGGAGCGCCCGGCGGTGGCCAGGGAGGCGGACTGGTACGTGTACGACTACACGGACCTCCTGCGCACCATGGCCCGCTACTCGGTGGCCATGGTGGGCAGCGGCGCCTGGGCGTGTGCAGCGGTGCGCATGATCGCGCAGAACACACAGGTGGACGACGCGGCGGATGAGTTTGTGGACGAAGTGCGCATGTGGGTGTACGAGGAGGACTTCGAGGGCAAGAAGCTCACGGAGGTCATCAACCAGACCCACACGAACCCCAAGTACTTCCCCGGCTTCGACCTGGGCCCCAACGTGGTGGCCGTACCCAACATCGTGGACGCGGTGGCTGACGCCGACCTGATTGTGTTCTGCGCGCCGCACCAGTTCCTGCACCACATCTGCAAACAGCTGGTCGGCAAGATCAAGCCTGGCGCCGCCGCCATCAGCCTGACCAAGGGCATGCGCGTGCGGCCCGAGGGCCCGCAGCTGATCAGCCAGATGGTGCGGCGCCTGCTGGGCATCGACTGCTGCGTGCTCATGGGCGCAAACATCGCCACGGACATCGGCCGCGAGCAGCTGTCCGAGGCAGTCATTGGGTACGACAACCTGGATGCGGCCACGCTGTTCCAGAAGATCTTCCAGCGCCCCTACTTCCGCGTCAACCTGCTGCCCGACCCGGTGGGCGCGGAGATGTGCGGCACGCTCAAGAACATCGTGGCCCTGGGTGCGGGCATGGTGGACGGCCTGGGACTGGGACCCAACTCCAAGGCCGCAATCATCCGCCAGGGCCTGGTGGAGATGCGGGCGTTCTCCAAGGCGCTGTACCCCTCCGTGCGTGATGACACGTTCATGGAGAGCTGCGGCGTGGGAGACCTGGTGGCGACCTGCTATGGTGGCCGCAACCGCCTGGTCGCCTGCGAGTGGACCAAGGCGCAGATGGAGGGCAAGCCGCGAACCTTTGAGGACCTGGAGACGGACCTGCTCAAGGGCCAGAAGCTGCAGGGCGTCCTCACCAGCAACGAGGTGCAGGAGATCCTCAAGGTGCGCGGCTGGGAGTCGCAGTACCCGCTGTTCACCACAGTCAACCGCATCATCAACGGCTACCTGCCGCCCAAGTACGTGGTGGAGTTCGTGGCTGGCGCCAAGTACCACATCCGCCGCCCCGGCACCGACGATGAGGAGATTGTCCCTGTGCGGCCCAAGCGCCCCGCTGCCGCCGGTGGCGTGGCCACCGCACCCATTCTTGCCGCCTAA >C.cajan_00927.g ATGTGTTTCTATTGCCTCTTCGTTTTCTATTCCGTGCCACCACCCTTTGCAATTGTCTCTCTGTCGTTTCCCTGCCCCTTGCGCCGAAACAACGACGTCATCATGTATAAGGTCACCGTTGTTGGTAGCGGCAATTGGGGCAGTGTTGCGGCAAAGCTTATTGCCTCCAACACCCTTAGGCTTAACTCTTTCCATGATGAAGTGAGGATGTGGGTATTCGAGGAAAAATTACCAAGTGGGGAGAAGCTCACAGATGTTATCAACAAAACCAATGAAAATGTCAAGTATCTCCCTGGAATCAAGCTTGGCAAAAATGTAGTCGCAGATCCAGACCTTGAAAATGCAGTGAAGGATGCCAACATGCTAGTGTTTGTAACTCCACATCAATTCATGGAAGGAATATGCAAAAGGCTTGCTGGGAAAATAAGACCAGACGCAGAGGGGATTTCTCTTATCAAAGGGATGGAAGTCAAGAAGGAAGGCCCATGCATGATCTCTACTCTCATTTCCAAAAGACTAGGAATCAATTGTTCTGTTTTAATGGGGGCCAACATAGCAAATGAGATAGCCATGGAGAAATTTAGTGAAGCAACAGTTGGATATAGTAAAAACAAAGAAGCAGCAGAGAGATGGGTTCAGTTGTTTAGAACTCCTTATTTCATTGTGACAGATGTCCAGGATGTTGAAGGGGTGGAACTGTGTGGAACCCTGAAAAATGTAGTGGCCATAGCTGCAGGTTTTGTTGATGGCTTGGAGATGGGAAATAATACAAAAGCTGCAATCATGAGAATTGGTCTGAATGAGATGATGGTATTTTCAAAGATGTTGTTTCCATCTGTTAAGGAAAGCACCTACTTTGAGAGCTGTGGTGTAGCTGACCTTATCACAACATGCTTGGGTGGAAGAAATAGGAAAGTTGGTGAGGCTTATGCCAGATATGGAGGGAAGAGATCTTTTGATGAGCTTGAAGCAGAGTTGCTTAATGGCCAGAAATTGCAGGGTGTCTTAACTGCACTAGAGGTTCATGAGGTTCTAAGTGATCGAGGATGCGTACACATGTTTCCTCTCTTCTCAGCAGTTCATGCAATCAGCGCAGGTCGCCTTCCACCATCAGCCATAGTTGAAATCAGCAATGAAAAACCCAGGTATACTCTTCATTATAAGCTCAGGGAAGCAGTAGTATTTCATGTTAAGAAATAA >C.cajan_36706.g ATGAAGGCATTTTCAAAGATGCTGTTTCCATCTGTTAAGGACAGCACCTTTTTTGAGAGCTGTGGTGTAGCTGACCTTATCACAACATGCTTGGGTGGAAGAAACAGGAAAGTTGCTGAGGCCTATGCAAAGAATGGAGGGAAGAGATCTTTTGATGAACTTGAAGCAGAGATGCTTCAAGGCCAGAAATTGCAGGGTGTCTCAACTGCAAGTGAGGTTTATGAGGTTCTAAGCCACAGGGGGTGGCTACAGTTATTTCCTCTCTTCTCAACAGTGCATGAAATAAGCACTGGCCTACTTCCACCATCAGCCATAGTTGAATACAGTGAGAAGCTACCAAGGTCCTTCTAA >Achn088881 ATGGCTCCATCCGAGCAGGTGCCACTACAGGGAGAAACCGCATCTGACAGCAATGTCAACCACGATGAATCGCCCAACAAATCAAGAGTCACCGTTGTTGGTAGTGGCAATTGGGGAAGTGTTGCGGCCAAGCTCATTGCCTCCAACACCATCAAACTCGCCTCCTTTCACGTTGGGGAATATGCAGTTAGGGATGCAAACATGTTAGTTTTTGTGACCCCACACCAGTTCATGGAAGGTATATGTAAGAGGCTAGTGGGAAAGATAAGGGAAGATGCAGAAGCAATTTCCCTCATTAAAGGAATGGAGATTGCAGTGGAGAAGTTCAGTGAAGCGACGGTTGGATACAGAGAGAATAGGGAGATAGCGGAGAAATGGGTTCGGCTTTTCAATACTTCTTATTTCATGGTCTCAGCTGTTCAAGACGTGGAAGGAGTTGAACTATGCGGGACCCTGAAAAATGTAGTGGCAATAGCAGCAGGTTTTGTGGATGGCTTGGAAATGGGAAACAACACAAAGGCTGCAATAATGAGAATTGGTCTAAGAGAAATGAAGGCTTTTTCCAAGCTGCTGTTCTCATCCGTTAAAGATAGCACCTTTTTTGAAAGCTGTGGTGTAGCTGACCTCATAACAACTTGCTTAGGGGGAAGAAACAGGAAATGTGCCGACGCTTTTGCTCGGAATGGCGGGAAAAGGTCTTTCGATGAGCTTGAAGCCGAGATGCTGCAGGGTCAGAAATTACAGGGTGTCTCAACTGCAAAAGAGGTTTACGAGGTTTTAAGCCATCGGGGATGGTTAGAATTGTTCCCACTATTCACGACCGTGCATGAGATCTGCATTGGTCGTCTTCCGCCAACGGCCATAGTTGAGTACAGTCAAAGTTGA >Achn307301 ATGGCTCCATCCGAGCAGGTGCCACTAGACGGAGAAATCGCATCTGACAGCAATGTCACCCTCGATGAATCGCCCAACAAATCAAGAGTCACCGTTGTTGGTAGTGGCAATTGGGGAAGTGTTGCGGCCAAGCTCATTGCCTCCAACACCATCAAACTCACCTCCTTTCACGATGAAGTGAGGATGTGGGTGTTCGAGGAGGTATTGCCTATCGGAGAGAAACTCTCAGAGGTCATCAACAAAACCAATGAGAATGTTAAGTATCTTCCTGGTATAAAACTTGGCAAAAATGTTGTTGCAGTCCCAGACCTTGAACATGCAGTTGTGGAATATGCAGTTAGGGATGCAAACATGTTAGTTTTTGTGACCCCACATCAGTTCATGGAAGGTATATGCAAAAGGCTAGTTGGGAAGATAAGGGAAAATGCAGAAGCAATTTCCCTCATTAAAGGAATGGAGATTGCAGTGGAGAAGTTCAGTGAAGCGACGGTTGGATACAGAGAGAATAGGGAGATAGCTGAGAAATGGGTTCGGCTTTTCAATACGTCTTATTTCATGGTCTCAGCTGTTCAAGACGTGGAGGGAGTTGAACTATGTGGGACACTGAAAAATGTAGTGGCAATAGCAGCAGGTTTTGTGGATGGCTTGGAAATGGGAAACAACACAAAGGCTGCAATAATGAGAATTGGTCTAAGAGAAATGAAGGCCTTTTCCAAGCTACTGTTTTCATCCGTTAAAGATAGCACCTTTTTTGAAAGCTGTGGTGTAGCTGACCTCATAACAACTTGCTTAGGGGGAAGAAACAGGAAATGTGCCGAAGCTTTTGCCCGGAATGGCGGGAAAAGGTCTTTCGATGAACTTGAAGCCGAGATGCTGCAGGGCCAGAAACTACAGGGTGTTTCAACAGCAAAAGAGGTTTACGAGGTTTTAAGCCACCGGGGATGGTTAGAGTTGTTCCCACTATTCACGACCGTGCATGAGATCTGCATTGGTCGTCTTCCGCCAACAGCCATAGTTGAGTACAGTCAAAGTTGA >ZJU.LOC107415218 ATGGCTCCATCTTTGGAGGTCCAAGAAGAAGAAACTGCTCTGCCCTTTAGCAATCCCACCCATACCAATGAAGCTCCTCCTCACAAATCTAAAGTCACCGTTGTTGGTAGTGGCAACTGGGGCAGTGTTGCTTCCAAGCTCATTGCTTCTAACGCCCTCAGGCTCGCTTCTTTCTATGATGAAGTGAGGATGTGGGTTTATGAGGAGACATTGCCAAGTGGAGAGAAGCTCACAGATGTCATCAACCGTACCAATGAAAATGTTAAATATCTACCCGGCATAAAGCTTGGCAAGAATGTTATTGCAGACCCAGACCTTGAAAGTGCAGTAAAGGATTCAAACATGTTGGTATTTGTGACCCCACACCAATTTGTGGAGGGTATTTGCAAAAGGCTTGTTGGGAAAATTAGAGGAGATGTGGAGGCTATTTCCCTCATTAAAGGAATGGAAGTCAAGATGGAAGGTCCATGCATGATCTCCACTCTCATTTCCCAACATCTGGGAATTAATTGTTGTGTCTTAATGGGGGCAAACATAGCTAATGAGATTGCTGTGGAGAAATTTAGTGAAGCAACTGTTGGATACAGAGGAAACAGAGAGATTGCTGAAAAATGGGTTCAACTGTTTACTACTCCCTATTTCATGGTCACAGCTGTGAGTGCAACAGAATGTCTAATTGGAAAAAAAAAATGA >ZJU.LOC107415257 ATGGCTCCATCTTTGGAGGTCCAAGAAGAAGAAACTGCTCTGCCCTTTAGCAATCCCACCCATACCAATGAAGCTCCTCCTCACAAATCTAAAGTCACCGTTGTTGGTAGTGGCAACTGGGGCAGTGTTGCTTCCAAGCTCATTGCTTCTAACGCCCTCAGGCTCGCTTCTTTCTATGATGAAGTGAGGATGTGGGTTTATGAGGAGACATTGCCAAGTGGAGAGAAGCTCACAGATGTCATCAACCGTACCAATGAAAATGTTAAATATCTACCCGGCATAAAGCTTGGCAAGAATGTTATTGCAGACCCAGACCTTGAAAGTGCAGTAAAGGATTCAAACATGTTGGTATTTGTGACCCCACACCAATTTGTGGAGGGTATTTGCAAAAGGCTTGTTGGGAAAATTAGAGGAGATGTGGAGGCTATTTCCCTCATTAAAGGAATGGAAGTCAAGATGGAAGGTCCATGCATGATCTCCACTCTCATTTCCCAACATCTGGGAATTAATTGTTGTGTCTTAATGGGGGCAAACATAGCTAATGAGATTGCTGTGGAGAAATTTAGTGAAGCAACTGTTGGATACAGAGGAAACAGAGAGATTGCTGAAAAATGGGTTCAACTGTTTACTACTCCCTATTTCATGGTCACAGCTGTCCAAGACGTGGAAGGAGTAGAGTTATGTGGGACACTGAAAAATGTTGTGGCCATAGCAGCAGGTTTTGTGGATGGCTTGGAGATGGGAAATAACACAAAGGCGGCAATAATGAGAATTGGTCTCAAAGAGATGAAGGCATTTTCCAAAATGTTGTTTCCTTCTGTCAAAGAAAGCACCTTCTTCGAGAGCTGCGGTGTAGCTGATCTCATAACAACATGCTTGGGAGGAAGAAATAGGAAAGTTGCAGAAGCGTTTGCAAAGAATGAAGGGAAAAGATCATTTGATGAACTTGAAGCAGAGATGCTACAAGGACAGAAATTACAGGGTGTCTCCACAGCAAGAGAACTTTATGAGGTTTTAAGCCACCGTGGATGGCTAGAGTTATTTCCGGTTTTCGCAACAGTTCATGAGATCGCCATTGGTCGTCTCCCACCTTCAGCCATAGTTAGGTTTTAG >Tp7g01260 ATGTCTCCTGCTCTCGAGAAACCCCAACATGGCGGAAATGGTGAAGCTCTTGGCGAATGTCGTGACGGAGATGATTTGAAATCCAGGGTTACGGTCATCGGAAGTGGGAATTGGGGAAGCGTTGCTGCTAAGCTCATCGCTTCCAATGTCCTTAAGCTTCCTTCGTTTCATGATGAAGTGAAGATGTGGGTGTTTGAGGAGGTTCTACCAAATGGTGAGAAGCTCACTGAAGTCATCAACAAGACAAATGAAAATGTCAAGTACCTCCCTGGAATTAAGCTAGGAAGAAATGTTGTTGCGGATCCTGACCTTGAAAATTCAGTGAAGGAAGCAAACATGTTGGTTTTTGTTACACCGCATCAGTTCATGGATGGTATATGCAAGAAACTAAAAGGAAAGATAACAGGAGAGGTTGAGGCTATATCTCTTGTTAAAGGGATGGAAATGAAGAAAGAAGGTCCCTGTATGATCTCCAGTCTCATTTCCAAGGAACTTGGTATCAATTGTTGTGTTCTTATGGGCGCAAACATTGCAAACGAGATCGCTCTGGAGAAGTTCAGTGAAGCAACGGTTGGATATAGAGAGAGTAAAGAAATAGCTGACAAATGGGTTCAGTTGTTTAGTACTCCGTATTTTATGGTGACACCGGTCCATGATGTTGAAGGAGTAGAGTTGTGTGGGACCTTGAAGAATGTAGTAGCTATTGCAGCGGGTTTCGTTGACGGTTTGGAAATGGGTAATAACACAAAGGCTGCAATCATGAGGATTGGTCTAAGAGAGATGAGAGGGCTCTCGAAGCTTCTGTTTCCATCTGTTAAAGACAGTACTTTCCTCGAGAGCTGTGGTGTAGCAGATGTCATAACAACTTGCTTAGGAGGACGAAATCGTAGAGTTGCAGAAGCATTTGCCCAAAGCGGAGGGAAAAGGTCTTTTGATGAGCTTGAAGCAGAGATGCTACAGGGGCAAAAGCTACAGGGGGTCTCGACGGCAAGAGAGGTGTACGAAGTCCTGAACCATTTTGGATGGCTCGAGATGTTTCCGCTGTTTTCAACGGTTCATCAAATCTGCACAGGTCATCTTAAACCTGAAGCCATTGTCCATTACCGTGAGCAGAAAATCTGA >Ca_14695.g ATGGCTCCAGCACTTGAAGCTCAAGGAGGAGAAACTTTATCTCAGAACAGTTTTTTGAACAGTGTTGGTGATGTTACAAACAGATCCAAAGTCACTGTTATTGGTAGTGGAAATTGGGGTAGTGTTGCATCTAAACTTATTGCCTCTAACACTCTAAGGCTCAGCAATTTCCATGATGAAGTTAGGATGTGGGTATATGAGGAGACATTACCAAGTGGAGAGAAGCTCACAGATGTCATCAATCAAACCAATGAAAATGTAAAATATCTACCTGGAATTAAGCTTGGCAAAAATGTTGTTGCAGATCCAGATCTTGAAAATGCAGTGAGGGATGCAAATATGTTGGTGTTTGTGACTCCACACCAATTTATGGAAGGAATATGCAAAAGGATAGCAGGGAAAATAAGGGCAGATGCTGAGGCTATTTCCCTTGTTAAAGGAATGGAAGTCAAAATGGAAGGACCTTGCATGATCTCTACTCTCATTTCTCATGAATTAGGAATCAATTGTTCAGTTTTGATGGGAGCCAACATAGCAAATGAGATAGCTGTAGAGAAGTTTAGTGAAGCAACTGTTGGATACAGACAGAACAGAGAAGCTGCAGAGAGATGGGTTCATTTGTTTTATACTCCTTATTTCATTGTGACAGCTGTTCAAGATGTTGAAGGAGTTGAATTATGTGGAACACTAAAAAATGTTGTGGCCATAGCAGCAGGTTTTGTTGATGGCCTGGAGATGGGAAATAATACAAAAGCTGCTATCATGAGACTTGGTCTTAGAGAAATGAAGGCATTTTCAAAGTTGTTGTTTCCATCTGTTAAGGATAGTACCTTTTTTGAGAGCTGTGGTGTAGCTGACCTTATCACAACATGCTTGGGAGGAAGGAACAGGAAAGTTGCTGAGGCTTATGCAAAGAATGGAGGGAAGAGATCTTTTGATGAGCTTGAAGTTGAGATGCTACAAGGCCAGAAGTTGCAGGGTGTCTCAACTGCAAGGGAAGTATATGAAGTTCTAAGCCATCGTGGCTGGCTAGAGTTATTCCCTCTCTTCTCAACAGTTCATGAAATAAGCAGTGGTCTCCTTCCACCATCAGCCATTGTTGAATATAGTGAGAAGTCACCAAGGTCCTTCTAA >Peaxi162Scf00080g01518 ATGGCCCCTTCAATGGAATCTCAGCAACAAGAACAACAAATGCAACATGAAGGGGCAATTCCTAATGGAAATGTATCTGTTGTTAATGATATTGTTGCTGCTGATGAGGTTGTTACTAATAAATCAAGAGTTACCATTGTTGGTAGTGGTAATTGGGGTAGTGTTGCAGCCAAGCTTATTGCTTCTAACACCCTCAAAATGGATTCTTTTCATGATGAAGTGAGGATGTGGGTATTTGAGGAGACGCTGCCATGTGGTGAAAAACTCTCTGAGGAGAATGTTAAATATCTTCCTGGTATAAAACTAGGTAGAAATGTTGTTGCGGACCCTGACCTCGAACATGCAGTGAGGGATGCTAACATGTTAGTGTTTGTCACTCCACATCAATTCATGGAGGGAATTTGCAAGAGGCTAGTTGGAAAAATCAGGAAAGATGCTGTAGCAATTTCCCTAATTAAAGGAATGGAGGTCAAGAGGGAAGGACCATGCATGATCTCTACCCTCATCTCTGAAATTCTTGGCATCAGTTGTTGTGTTCTAATGGGAGCCAACATTGCTAATGAGATTGCAGTTGAGAAGTTCAGTGAAGCAACAGTCGGATATAGGGAGAACAAAGAGATTGCAGAGAAATGGGTTCACCTATTTAATACTCCTTACTTTATGGTCTCAGCTGTCCAAGATGTGGAAGGAGTCGAACTTTGTGGAACTCTGAAGAATGTTGTGGCTCTTGCAGCAGGCTTTGTGGACGGCCTGGAAATGGGAAATAACACAAAGGCTGCAATAATGAGAATTGGCTTGAGAGAGATGAAGGCCTTCTCCAAGCTATTATTCCCTTCTGTTAAAGATAATACATTCTTTGAGAGTTGTGGGGTAGCAGATCTAATAACTACTTGCTTGGGAGGAAGAAATAGGAGATGTGCTGATGCTTTTGCAAGGAATGGAGGAAAAAGGTCTTTTGATGAACTTGAAGCAGAGATGTTGCAAGGGCAAAAACTGCAGGGTGTCTCAACAGCAAAGGAGCTTCACGAGGTTCTAAGTCATCGAGGATGGTTACATTTATTCCCCCTCTTCTCAACAGTTCATGAGATCTGCAGTGGCCGTCTTGCTCCCTCGGCCATAGTTGAATATAGCGAGCTCTCAGCCAGATTTCCCTTGCTGGAAGGATCTGCTCACTTGAACTGA >HBR1055G059 ATGCGCTTTCTGTTTCCCATATATCATCCCCTCTTCCCTTCACCTTCTTCTCTGTCATCTCCATCCTTCTTCTCCATCTCTCGTTCCCTTCTCGGTCCTTTTCTTTCTTCTTTTTCCCCTTCCTTTCTCATGGCCCCACCTGCTGCCATGGAAGCCCAAGAAGCTGCTTCAAGAAACGCCTTTGCCAACGATGTTTCTGCTGCTTCACATATTTCTAGAGTCACTGTTGTGGGTAGTGGCAATTGGGGTAGTGTGGCTGCTAAGCTTATTGCTTCTAACACCCTCAAGCTTGCTTCTTTTCATGATGAAGTGAGAATGTGGGTGTTTGAAGAGACATTACCAAGTGGTGAGAAGTTAACAGATGTCATTAACCGAACTAATGAAAATGTTAAATATCTCCCGGGTATAAAGCTTGGAAAAAATGTTATTGCAGATCCTGATCTTGACAATGCCGTGAGGGATGCAAACATGTTGGTATTTGTAACTCCACATCAGTTTATGGAGGGTATATGCAAGAGACTTGTTGGGAAGATAAAGGAAGGTGTAGAGGCTATTTCACTCATCAAAGGAATGGAGGTCAAAATGGAAGGCCCTTGCATGATCTCAAATCTTATTTCTGAGCTGCTTGGCATTAATTGTTGTGTGCTAATGGGAGCAAATATAGCAAATGAAATCGCCGTTGAGAAGTTCAGTGAGGCGACAGTTGGATACAAAGCGAACAGAGAGATTGCAGAGAAATGGGTTCAGTTATTTAGTACTCCTTACTTCATGGTCACGCCTGTCCAAGATGTAGAGGGAGTTGAACTATGTGGGACCTTGAAGAATGTTGTGGCATTAGCAGCAGGTTTTGTCGATGGTCTGGAAATGGGAAATAACACAAAGGCTGCAATAATGAGAATTGGTCTGAGGGAGATGAGAGCCTTCTCCAAGTTGTTGTTTTCATCTGTTAAGGACAGCACTTTCTTCGAAAGCTGTGGTGTAGCTGATGTCATCACAACATGCTTGGGAGGAAGAAACAGGAAAGTTGCAGAAGCCTTTGCAAAGAATGGAGGAAAAAGGTCTTTTGATGAGCTTGAGGCAGAGATGTTGCAGGGCCAAAAATTACAGGGTGTCTCAACAGCAAGAGAAGTGTATGAAGTCTTAAGTCACCGTGGATGGCTAGAGTTGTTTCCACTTTTTGCAACAGTGCATGAGATCTGTATTGGACGTCTTCCACCATCAGCCATAGTTGAATATAGCGAGCACAAACCGAACTTTGCCTTGGTAGAGGGCTCAGCTCAATATTATTGA >Potri.017G070900 ATGGCTCCTCCTGCTGCCATGGAAGAAACTGCACCAACTATTAACCTTCTCTCCAATATTAATGATGGTAATAATGCTGCTTCACAGATATCTAGAGTCACTGTTGTTGGCAGTGGCAATTGGGGTAGTGTTGCCGCTAAGCTCATTGCTTCTAACACCCTCAAGCTTGCTTCTTTTCATGATGAAGTGAGGATGTGGGTGTTTGAGGAGACATTGCCAACTGGTCAGAAGCTCACCGAGGTCATCAATCAAACCAATGAAAACGTAAAATATCTCCCTGGCATAAAGCTTGGCAAAAACGTAGTTGCGGACCCTGACCTTGATAATGCAGTGCGGGATGCAAAGATGTTGGTATTTGTGACCCCACATCAATTCATGGACGGTATATGCAAGAGACTTGTCGGAAAGCTAAAGGAAGATGTGGTGGCTATTTCACTCATCAAAGGCATGGAGGTCAAGATGGAAGGTCCACACATGATTTCCACTCTCATCTCTGAGCAGCTCAGGGTTAATTGTTGTGTGCTGATGGGAGCAAACATTGCAAATGAGATTGCTGTCGAGAAGTTCAGTGAAGCAACAGTTGGATACAGAGAAAACAGAGAAGTTGCAGAAAAATGGGTTCGGTTATTTAGTACCCCTTATTTCGTGGTCACACCTGTTCAAGATGTGGAGGGAGTTGAACTGTGTGGGACTTTGAAGAATGTTGTGGCTTTAGCAGCAGGTTTTGTGGACGGTCTGGAAATGGGAAATAACACGAAGGCTGCGATAATGAGAATTGGTCTAAGGGAGATGAGAGCCTTTTCCAAATTACTGTTTTCCTCTGTTAAGGACAGCACATTCTTTGAAAGCTGCGGTGTAGCTGATCTCATCACAACATGCTTGGGAGGAAGAAACAGGAGAGTTGCAGAGGCTTTTGCTAAGAATGGAGGAAAAAGGTCTTTTGATGAGCTTGAAGCAGAGATGTTGCAGGGCCAAAAGTTACAGGGTGTCTCAACTGCAAGAGAAGTTTATGAAGTTTTAAGGCACCGTGGATGGCTAGAGCTCTTTCCACTTTTTGCAACAGTACATGAGATCTCCGCTGGACGTCTTCCACCATCAGCTATAGTAGAATATAGCGAGCACAAGCCTAACTGCTCCCTGGTGTAA >Araip.Y3JJL ATGGCTCCAGCAGCTTTGGAGGCTCAATCTCAACAAAAGGAAGAGACTGTGGCTCATAACAGCGTCTTGAGCAGTACCAGTGTCAATGACACTACACACAGATCGAAGGTTTCTGTTATTGGTAGTGGCAACTGGGGCAGTGTTGCTTCTAAGCTCATTGCCTCCAACACCTTCAGGCTGAACTCATTCCATGATGAAGTAAGGATGTGGGTGTATGAGGAGACATTACAAAGTGGTGAGAAACTCACTGATGCCATCAACCGAACCAATGAAAATGTCAAATATCTCCCTGGAATCAAGCTTGGCAATAATGTTGTTGCAGATCCAGATCTTGAAAATACTGTGAGGGATGCGAACATGTTAGTCTTCGTGACTCCACATCAATTTATGGAAGGAATATGCAAAAGGCTTGTTGGGAAAATAAGAGCAGATGCTGAGGCTATTTCTCTTGTCAAAGGGATGGAGGTGAAGATGGAAGGCCCGTGTATGATCTCTAGTCTCATCTCTCAGATACTCGGAATCAATTGTTCTGTTTTAATGGGGGCCAACATAGCAAATGAGATAGCAGTAGAGAAGTTTAGTGAAGCAACTGTTGGATACCGGCAGAACAGAGACGTCGCCGAGAGATGGGTTCAGTTGTTTTATACTCCATATTTCATTGTCACAGCTGTCCAGGATGTTGAAGGAGTTGAACTGTGTGGAACGCTGAAAAATGTTGTGGCCTTAGCAGCAGGTTTTGTTGATGGCCTGGAGATGGGAAACAATACGAAGGCTGCAATCATGCGACTTGGTCTTAGAGAGATGAAGGCATTTTCGAAGTTGTTGTTTCCATCTGTTAAGGACAGCACATTTTTCGAGAGCTGTGGTGTGGCGGACCTTATCACAACTTGCTTGGGTGGTCGAAACAGGAAAGTTGCTGAGGCTTATGCAAAGAATGGGGGAAGGAGGTCTTTCGATGAGCTCGAAGCAGAGATGCTGCAAGGCCAGAAATTGCAGGGTGTTTCAACTGCAAGAGAGGTTTATGAGGTTCTCAGCCACCGCGGATGGCTAGAATTGTTTCCTCTCTTCGCAACCGTTCATGAGATAAGCAGTGGCTTACTTCCACCATCAGCCATAGTTGAGTACAGTGAGAAGCAAGTCAGGTCCTTTTGA >Araip.N3W37 ATGAAGAACAAAGTGACAGTTGTTGGAAGTGGCAATTGGGGCAGTGTTGCGGCAAAGCTCATTGCTTCTAACACCGTTCGACTCAGCTCCTTCGATGGTACACATTTCTTCTTCTACTTTATATTCCTGCATGCATATGAGGTAAGAATGTGGGTGTTCGAAGAGAAATTGCCAAGTGGGGAGAAGCTTACGGATGTAATCAATAGAACCAATGAAAATGTCAAATATCTCCCTGGAATCAAGCTTGGAAAAAATGTAGTTGCAGACCCTGACGTTGAAAGTGCAGTAAAGGGTGCGAATATGTTGGTATTCATAGCCTTGGAGAAATTTAGTGAAGCAACGGTTGGATACAGCAAAAATAAAGAAGCTGCTGAGAAATGGGTTCAGTTGTTTGGAACTCCCTATTTCATTGTGTCAGCCGTCCAAGATGTGGAAGGTGTCGAAATGTGTGGAACTCTGAAAAATATTGTGGCCATAGCCGCAGGTTTTGTTGATGGCATGGAGATGGGAAACAACACTAAAGCTGCAATCATGCGAATTGGTCTGAAAGAGATGATAAAGTTTTCAAAGATGTTGTTTCCATCGGTTAAGGATAGCACATTTTTTGAAAGTTGTGGTGTAGCTGACCTTATAACCACATGCTTGGGTGGAAGAAACAGGAAAGTTGCTGATGCTTATGCAAAAAATCAAGGGAAGCGGTCTTTTGACCAGCTTGAGGCAGAGTTGCTTAATGGCCAGAAATTGCAGGGTGTATTAACTGCAAAAGAGGTTTATGAGGTTCTAAGTGATCGAGGATGGGTAGAGCAGTTTCCACTCTTCTCAACAGTTCATGCAATCAGCATCGGTCGCCTTCCACCTTCCGCCATAGTCGAACTTGGCGATTCCAAGTCGGCAAATAAACAGGTTGGTAACAGTACTCTTTGA >RCO.g.29633.000036 ATGGCCCCTCCTCCTGCTGCCCCTGAAGCTCAAGAAACTGCCCCAAGAAGCACTTTCTCTAACGATTCCGCCGCTGCTTCTCATATGTCCAAAGTTACTGTTGTTGGTAGTGGCAACTGGGGCACCGTTGCTGCTAAACTCATTGCTTCTAATACCCTCAAGCTCAATTATTTTCATGATGAAGTGCGAATGTGGGTTTTTGAAGAGACATTGCCAAGTGGTGAGAAGCTATCAGATGTTATTAACCGGACCAATGAAAATGTTAAATATCTGCCCGGCATTAAGCTTGGGAAAAATGTTATTGCAGACCCTGATATTGATAATGCAGTTAAGGATGCAAACATGTTGGTATTTGTGACTCCTCATCAGTTTATGGACGGTATATGCAAGAGGCTTGTCAGGAAGATAAAGGATGGTGTAGAAGCTATTTCGCTTATTAAAGGAATGGAAGTCAAGATGGAAGGCCCTTGCATGATCTCTAGTCTTATTTCTGAGCAGCTAGGTGTTAACTGTTGTGTGCTAATGGGGGCAAATATTGCAAATGAAATTGCTGTTGAAAAGTTCAGCGAGGCGACAGTTGGATTCAGAACAAACAGAGAGATTGCAGAGAAATGGGTTCAATTGTTTAGTACTCCTTACTTCATGGTCACAGCTGTCCAAGATGTGGAGGGAGTCGAACTATGTGGAACCTTGAAGAATGTTGTGGCACTAGCAGCAGGCTTCGTTGATGGTCTGGAAATGGGGAATAACACAAAGGCTGCAATGATGAGAATTGGTCTGAGGGAGATGAGAGCCTTATCCAAGTTGTTGTTTTCATCTGTTAAGGACAGCACATTCTTTGAAAGCTGTGGTGTAGCTGATGTCATCACTACATGCTTGGGAGGAAGAAACAGGAAAGTCGCGGAGGCTTTCGCAAGAAATGGGGGAAAAAGGTCTTTTGATGAGCTTGAAGCAGAGATGCTGCAGGGCCAAAAATTACAGGGTGTTTCAACAGCAAGGGAGGTGTATGAAGTTTTAAGTCACCGTGGATGGTTAGAGTTGTTTCCGCTATTTGCAACAGTGCATGAGATCTGCATTGGACGTCTTCCACCATCAGCCATAGTTGAATACAGCGAGCACAAACCCAACTTTGCACTGGTATGA >Ciclev10015567m.g ATGGCTCCTGCATTCGAAGATAACAATTCTGAAACTTTGCCCTCAAGCTTTTCTTCTGGCAGTGATGATGGTGTCTTGCATAAATCTAAGGTCACTGTTGTGGGTAGTGGCAATTGGGGTAGTGTTGCTTCTAAGCTCATTGCTTCTAACACCCTCAGGCTCAGTTCTTTTCATGATGAAGTGAGGATGTGGGTATTTGAGGAGACATTGCCAAGTGGTGAGAAGCTCACAGATGTCATCAATCGAACCAATGAAAATGTTAAGTATCTCCCCGGGATTAAGCTTGGCAAGAATGTTGTTGCAGATCCAGACCTTGAAAATGCTGTTAAGGATGCCAACATGTTGGTGTTTGTGACTCCTCATCAGTTTATGGAGGGTATTTGCAAGAGGCTTGTTGGAAAGGTAAATGGAGATGTGGAAGCTATTTCACTTATTAAAGGAATGGAAGTTAAGAGGGAGGGTCCTTGCATGATCTCCACTCTAATCTCCGAGCAGCTTGGTGTTAGTTGCTGTGTTCTGATGGGAGCGAATATTGCAAACGAGATTGCTGTTGAGAAATTCAGTGAAGCAACAGTTGGGTACAGAGACAACAGAGAGATTGCAGAGAAATGGGTTCAGCTATTTAGTACTCCTTATTTTATGGTCACTGCTGTCCAAGACGTGGAAGGAGTTGAACTATGTGGGACCTTGAAAAATGTTGTAGCAATCGCTGCAGGTTTCGTTGATGGCCTTGAAATGGGAAATAACACTAAGGCTGCAATAATGAGAATTGGTCTCAGAGAGATGAGAGCCTTTTCCAAGTTGTTGTTTTCATCTGTTAAGGACAGCACCTTCTTTGAGAGCTGTGGTGTAGCTGATCTCATCACAACATGCTTGGGAGGAAGAAACAGAAAAGTTGCCGAGGCTTTTGCTAAGAACGAAGGGAAAAGGTCTTTCGATGATCTAGAAGCAGAGATGCTTCAGGGCCAGAAATTACAGGGAGTCTCAACTGCAAGAGAAGTTTATGAAGTGCTAAGCCACCGTGGATGGCTAGAGCTGTTTCCGCTTTTTGCAACAGTGCATGAGATCTGCGTTGGGCATCTCCCACCGTCAGCCATAGTTGAATACAGTGAGCGCAAACCCAGATTGTCTCTACTGGAAGGCTCTACTCAGTACTACTGA >Bv4_094790_ouwp ATGAACGCTGAAGTTGCGGAGAAATACAAAGTTGCAATTGTTGGCAGCGGCAATTGGGGTAGCGTTGCGGCCAAGCTTATTGCATCTAACACCCTCAAACACAACATCTTTCATGATGAAGTTAAGATGTGGGTATTTGATGAAACATTACCAAGTGGAGAGAAATTGTCAGAAGTTATTAATCGAACCAATGTTAATGTAAAGTACCTCCCTGGTACACAGCTTGGTAAAAATGTGATTGCTGAGCCAGACCTTCATCATGCAGTGAGAGACGCAAACATGCTGGTATTTGTGACACCACATCAATTTCTTGAGGGTGTTTGTAAGAGACTTGTTGGAAAATTAAAAGGAGACATCGAGGCTATTTCATTGATCAAAGGCATGGAGGTCAAAGTGGACGGTCCATCTACGATTTCCTCTATAATCTCTAAGCATCTTGGAGTTAATTGTTGTGTTTTGATGGGTGCAAATATTGCTGATGAGATTGCTGAGGAGAAGTTTAGCGAGGCAACTATAGGTTATAAAGACAATAGGGATGTCGCAGAGAGGTGGGCTCGGCTATTTGCTACACCTTATTTTTCTGTCACAGCTGTTGAGGATGTTGAAGGAGTTGAATTATGTGGTACACTGAAAAATGTAGTCGCCATAGCTGCAGGATTTGTGGATGGCTTGGGTATGGGGAGTAACACAAAAGCAGCAATCATGAGAATTGGTTTGAATGAAATGAGGGCCTTCTCCAAGCGACTGTTCCCATCTATCAGAGACGACACTTTCTTTGAGAGTTGTGGGGTGGCTGATCTTATCGCTACTTGTTTTGGAGGAAGAAACAGGAAAGTTGCAGAGGCTTTTGTAATCAATGGAGGAAAGAGACCCTTTGAGGAGCTAGAAGCTGAGATGTTGCAGGGCCAGAAACTACAGGGTATCTTGACGGCCAAAGAGGTATATGAGGTCTTAAAAAGCAACAGTTGGTTTGACGCGTTCCCTCTTTTCAGAACAATTTATGAGATTTGTGTTGGTAGCAAACTGCCGTCGGCCATAGTGCACTATAATGACTTTCAAAAGGCAGGAGTGCATCCAAGTTCTCTTTAA >MDO.mRNA.g.3782.32 ATGGCTCCAGAACTTCAGGAGGAAAATTACACTACTGGCCCTGCTGAACCTCCCCAGAAAACCAGAGTCACCGTCGTAGGCAGTGGCAACTGGGGCAGTGTTGCCGCCAAGCTCATTGCCTCCAACACCCTCAGGCTCTCTTCTTTCCACGATGAAGTGAGAATGTGGGTGTTTGAGGAAACGTTACCAAGTGGTGAGAAGCTCACAGATGCCATCAACCGCAACAATGAGAATGTGAAATATCTGCCTGGCATTAAGCTGGGGAAAAATGTTGTTGCAGACCCGGACCTTGAGAATGCAGTGAACGGTGCGAACATGTTGGTGTTTGTTACTCCACATCAATTTATGGAGGGTATATGCAGGAGGCTTGTTGGGAAGGTAAAAGCAGATGTGGAGGCGATTTCCCTCATCAAAGGAATGGAGGTCAAGATGGAAGGCCCATGCATGATCTCGACACTCATCTCAGATCAATTGGGTATTAATTGTTGTGTTCTGATGGGAGCAAACATAGCTAATGAGATTGCTGTGGAGAAATTTAGTGAAGCCACGGTTGGATACAGAGAGAAAAAAGAGATTGCACAGAAATGGGTTCAACTGTTTAGTACTTCCTACTTCATAGACACCACCTTCTTCGAAAGTTGTGGCGTCGCTGATCTCATCACAACATGCCTGGGAGGAAGAAACAGGAAAGTAGCGGAAGCTTTTGCAAGGAGTGAAGGGAAAGATCGTTTGATGAGCTCGAAGCAGAAATGCTGCAGGGGTGTCTCAACCGCAAAAGAGGTCTACGAAGTTTTAAGCCACCGTGGGTGGCTAGATTTCTTCCCACTTTTTGCAACAGTTCATGAGATCTGCATTGGCACTTCTTCTCCAACAGCCATAGTTGAACACAGTGAGCGCACGCCTAAAATGTAG >MDO.mRNA.g.513.31 ATGGCTCCAGAACTCCAACAGGAGGAAGATTACACTACTGGCCCTGAAGCTGCTCATAAAATCAGAGTCACCGTCGTCGGCAGTGGCAACTGGGGTAGTGTTGCCGCCAAACTCATTGCCTCCAACACCCTCAAGCTCTCTTCTTTCCACGATGAAGTGAGAATGTGGGTGTTTGAGGAAACATTACCAAGTGGTGAGAAGCTCACAGATGCCATCAACCGCAACAATGAAAATGTGAAATACCTGCCCGGCATTAAGCTGGGGAAAAATGTTGTTGCAGATCCAGACCTTGAGAATGCAGTGAACGGTGCGAACATGTTGGTTTGTTACTCCACATCAATTTATGGAGGGTATATGCAGAGGCTTGTTGGGAAGGTAAAAGCGGATGTGGAGGCAATTTCCCTCATCAAGAAATGGAGGTCAAGAGAAGGCCCGTGCATGATCTCGACACTCATCTCACAGCAGTTGGATCATATCACATCTGGTGTGGCTGAAACTAGAGACTGTTTGTGTAGATTGCTGTGGAGAAATTTAGTGAAGCCACAGTTGGATACAGAGAGAACAAAGAGATTGCACAGAAATGGGGAGGAAGAAACAGGAAAGTTGCGAAGCTTTTGCAAGAGTGGAGGGAAAAGATCGTTTGATTGCTTGAAGCAGAATGCTGCAGGGTCAAAAATTACAGGGTGTCTCAACAGCAAAGAGGTTTACGAGGTTTTAAGCCACCGCGGGTGGCTTGATTTCTTCCCCACATTGCAAACAGTTCATGAGATCTGCATTGGCACTCTTCCTCCATCAGCCATAGTTGAACATAGTGAGCGCACGCCTAAATCTAGCCGGCTCTTCCACTGCCCGCTTATCATGGGTAGGGGTAGTTTACTTAAGTGA >Bo4g140370 GGTAACCGATCACACCCAACGTGTCGCCTCTCTCAATCTCCTATTCTCCATGCGAATCCGTTCCTCATTCTTAGCTATCTTCCTCCTTCCCTCTTCTCCTTCTCATTCTCTTCCTTCTCATTATCTTACCTTTCTCTCGATTCTCCTCTCTCTCCGGTCTCCGCTATGTCTCATGCTAAATCCCGAGAAGACGCAAATGGTGAATGTCGTGATTCGAAATCTAGGGTTACCATCGTTGGAAGTGGAAGTTGGGGGAGCGTCGCTGCTAAGCTCGTCGCTTCTAATGCCCTCAAGCTTCCTTCGTTTCATGATGAAGTGAGGATGTGGGTGTTTGAGGAAGTCCTACCAAATGGTGAGAAGCTCACTGATGTCATCAACAAGACCAATGAAAATGCTAATTACCTTCCCGGGATTAAGCTAGGAAGAAATGTTGTTGCGGATCCTGACCTTGAAAATGCAGTGAAGGAAGCAAACATGTTGGTTTTCGTTACACCGCATCAGTTCATGGATGGTATATGCAAGAAACTAAAGGGAAAAATAAAAGGAGAGGTTGAGGCTATATCCCTTGTCAAAGGAATGGAAGTGAAGAAGGAAGGTCCCTGTATGATCTCAAATCTCATCTCCAAAGAACTCGGTATCAACTGTTCTGTTCTTATGGGCGCAAACATCGCAAACGAGATTGCTGTGGAGAAGTTTAGTGAAGCAACGGTGGGATATAGAGAGAGTAGAGAAATAGCTGACACTTGGGTTCAGTTGTTTAGTACTCCCTATTTTATGGTCACACCGGTACGTGATGTTGAAGGAGTAGAGCTGTGTGGGACATTGAAGAATGTAGTGGCTATTGCAGCAGGTTTCGTTGATGGTTTGGAAATGGGTAATAACACAAAGGCTGCAATCATGAGGATTGGTCTAAGAGAGATGAAAGCACTCTCCAAGCTTTTGTTTCCATCTGTTAAAGACAGTACTTTCTTTGAGAGTTGCGGTGTAGCAGATGTCATAACAACTTGCTTAGGAGGAAGAAACCGAAGAGTTGCAGAAGCATTTGCCCAAAGCGGAGGAAAAAGGTCTTTTGATGAGCTTGAAGCAGAGATGCTAGAAGGGCAAAAGCTACAGGGTGTTTCCACGGCAAGAGAAGTGTATGAGGCTCTGAACCATCGTGGATGGATGGAGATGTTTCCGCTGTTTTCAACGGTTCACCAAATCTGCATAGGTCGTCTTAAACCTGATGCCATTGTTAATTACCGAAATTTTGGTCCAAATCCAAAGCTTTAA >Bo6g064600 ATGCGAATCCGTTCCTCATTCTTCTCTATCTTCCTCCTTTCCTCATCCTCTTCTCCTTCCTCGTCCTTCTTCTCCTCTCGTTTCTCCTCTCTCTCCGCTATGTCTCCAGGCGCTAATGGTGATTTCAAATCTAGGGTTACGGTCGTGGGCAGTGGCAACTGGGGAAGCGTTGCTGCTAAGCTCATCGCTTCCAATGCCCTCAAGCTTCCTTCTTTCCATGATGAAGTTAGGATGTGGGTGTTTGAGGAAGTTCTGCCAAATGGTGAGAAGCTCACTGATGTAATCAACAAGACCAATGAAAACGTCAAGTATCTCCCTGGGATTAAGTTAGGAAGAAATGTCGTTGCAGATCCTGACCTTGAAAATGCAGTGAAGGAAGCAAACATGTTGGTTTTTGTTACGCCGCATCAGTTCATGGGTGGTATATGCAAGAAGCTTAAGGGAAAGGTAACAGGAGAGGTTGAGGCTATATCTCTCGTTAAAGGGATGGAAGTGAAGAAGGAAGGTCCCTGCATGATCTCTAGTCTCATCTCCAAGGAACTTGGTATCAACTCTTGTGTTCTTATGGGCGCAAACATCGCCAACGAGATTGCTGTGGAGAAGTTTAGCGAAGCAACGGTTGGATATAGAGAGAGTCGAGAAATAGCTGACACTTGGGTTCAGTTGTTTAGTACTCCCTATTTTATGGTCACACCGGTTCATGATGTTGAAGGAGTAGAGTTGTGTGGGACCTTGAAGAATGTAGTGGCTATTGCAGCGGGTTTCGTTGATGGTTTGGAAATGGGTAATAACACAAAGGCTGCAATCATGAGGATTGGTTTACGAGAGATGAGAGCACTCTCGAAGCTTCTTTTTCCATCTGTCAAAGACAGTACTTTCTTTGAGAGCTGTGGTGTAGCAGATGTCATAACAACTTGCTTAGGAGGAAGAAACCGAAGAGTTGCAGAAGCATTTGCCCAAAGTGGAGGAAAAAGGTCTTTTGATGAGCTTGAAGCAGAGATGCTACAAGGGCAAAAGCTACAGGGTGTTTCCACGGCAAGAGAGGTCTACGAGGTCTTGAACCACTGTGGATGGCTGGAGATGTTTCCACTGTTTTCAACGGTTCACCAAATCTGCACAGGTCGTCTTAAACCTGAAGCCATTGTTCATTACCGTGACCACAAAGCCTAA >Cpa.g.c44855 ATGAGGGTGTGGGTTTTTGAGGAGACATTGCCAAGTGGTGAGAAGCTCACAGATGTCATCAACCGAACTAATGAAAATGTCAAGTATCTTCCTGGGATTAAGCTTGGTAAAAATGTTGTTGCAGACCCCAACCTTGAAAGTGCAGTGAAGGATGCAAACATGTTAGTTTTTGTTACGCCGCATCAATTTATGGAGGGGATATGCAAGAGTCTTGTTGGGAAGATAGAGGGAGATGTTGTGGCCATTTCGCTTATCAAAGGGATGGAGGTTAAGAAGGAAGGCCCCTGCATGATCTCCAGTCTCATCTCCAAGGAGCTCAGCATTAACTGTTGTGTACTGATGGGGGCAAATATTGCAAACGAGATTGCTGTGGAGAAGTTTAGTGAAGCAACGGTTGGATACAGAGGCAACCGAGAGATTGCAGAGAAATGGGTTCAGTTATTTAGTACTCCCTTACTTCATG >Cpa.g.sc1921.1 ATGAGAGCACTTTCCAAGTTGTTGTTTTCATCGGTTAAAGACAGCACCTTCTTTGAGAGTTGTGGCGTAGCTGATCTGATCACCACATGCCTGGGAGGAAGAAATAGGAAAGTTGCTGAGGCTTTTGCAAGGAATGGAGGCAAAAGGTCTTTCGATGAGCTTGAAGCCGAGATGCTGCAGGGCCAGAAATTACAGGGTGTTTCAACAGCAAGAGAGGTTTATGAGGTTCTGAGCCACCGGGGATGGCTGGAGTTATTTCCGCTTTTTGCAACAGTGCACAAGATCTGCATTGGTCATCTTCCACCATCAGCCATAGTTGAATACAGCGAACATAAGCCAAATTTCTCTCTGGTTGACGGATCTGCCGAATATTTTTGA >Cpa.g.sc862.6 ATGCGCTTTCTCTCCTCCTTTTATTCTCTCTTCCATCTCTCCTCCCTTTCCCGGCGCACTTCTTCTCAATCTCTGTCCCTTCCCCGGTCCCTTCCTTCTTTCCTCTCCGCCTCCTTCATGGCCCCCGCTGTAGAACATAACCAGAATGATGATAAGAGATCAACTGTCACCGTTGTGGGAAGTGGCAATTGGGGCAGTGTTGCTGCTAAGCTCATTGCCTCTAATACTCTCAACCTCCCTTCTTTTAATGATGAAGTGAGGATGTGGGTTTTTGAGGAGACATTGCCAAGTGGTGAGAAGCTCACAGATGTCATCAACCGAACTAAT >LOC_Os01g74000 ATGGAGAACGGACACGCCAAGAATCTTGTGGCCGTCATCGGCAGCGGCAACTGGGGCAGCGTCGCCTCCCGCCTCATCGCTTCTAACACCGCTAAGTTGCCCTCCTTTCATGATGAAGTAAGGATGTGGGTGTTTGAAGAAATATTACCAACAGGCAAGAAGCTCTCTGAGTCCATTAACCAAGCAAATGAGAATTGCAAATACTTACCTGGTATAAAGCTCGGAGCTAATGTAATTGCTGATCCTGATTTGGAGAATGCAGTGAAAGATGCAAATATGCTTGTTTTTGTGACTCCCCATCAATTTGTGGAGGGTATATGTAAGAAGCTTGTGGGTAAACTAAGGCCAGGAACTGAGGGTATCTCCCTCATCAAGGGCATGGAGGTCAAGATGGAAGGACCATGCATGATATCTAAATTAATTACAAACATACTTGGAATCAATTGCTGTGTCCTTATGGGTGCTAACATTGCAAATGAGATTGCTGTTGAGAAATTCAGTGAAGCGACAATTGGATATAAGAAAGACAAGGAAGTGGCAACCCGATGGGCTAAACTTTTTACAACACCTTACTTCCTGGTTTCTGTTGTAGAGGATATTGAAGGAGTTGAATTATGTGGAACACTGAAAAATGTCGTGGCCATTGCAGCAGGTCTTGTTGATGGTTTGGATATGGGGAACAATACCAAGGCTGCAATAATGAGGATTGGTTTGCGGGAAATGCGTGCTTTCTCTAAGCTTCTATCCCCTACAGTCAGGGACAACACTTTCTTTGAGAGCTGTGGTGTGGCTGACCTAATAACTACATGCCTTGGTGGGAGAAACAGAAGAGTCGCTGAGGCCTTTGCACGAAATGGTGGCAAAAGGTCTTTTGATGAGTTGGAGGCCGAGATGCTACATGGCCAAAAACTTCAGGGAGTGTCCACAGCAAAAGAAGTTTATGAAGTCTTGACTTATCGAGGGTGGCAAGAATTGTTTCCTCTTCTGTCCACAGTGCATGAGATTTGTATTGGTCAGCTACCTCCTACATCAATAGTTGAATACAGAATCCACTGA >Medtr6g021915 ATGGCTCCAGCATTGGAGGTTCAAGGAGTAGAAAATGTGTCTCAAAACAATGGTTTGAACAATGTTGATGATGTTACAAACAGATCCAAGGTTACTGTTATTGGTAGTGGTAATTGGGGTAGTGTTGCATCTAAACTTATTGCTTCTAACACCATTAGGATGAACAATTTTCATGATGAAGTAAGGATGTGGGTATATGAGGAGACATTACCAAGTGGAGAGAAGCTCACGGATGTGATCAATCAAACCAATGAAAATGTAAAATACCTCCCTGGAATCAAGCTTGGCAAAAATGTTGTTGCAGATCCCGACTTAGAAAATGCAGTGAGGGATGCGAATATGTTAGTCTTTGTGACACCGCATCAATTTATGGAAGGAATATGCAAAAGGATAGCTGGTAAGATAAGGGCTGATGCCGAGGCTATTTCCCTTGTTAAAGGTATGGAAGTCAAAATGGAAGGCCCTTGCATGATCTCTACTCTAATTTCTGAAGAACTTGGAATCAACTGTTCTGTGTTGATGGGAGCAAACATCGCAAATGAGATAGCGGTAGAGAAGTTCAGTGAAGCAACTGTTGGATACAGGCAGAACCGAGAAGCTGCAGAGAGATGGGTTCATTTGTTTTACACTCCTTATTTCATCGTGACAGCTGTTCAAGATGTTGAAGGAGTTGAATTATGTGGAACTCTAAAAAACGTTGTGGCCATAGCAGCAGGTTTTGTTGATGGCTTGGAGATGGGAAATAATACAAAAGCTGCAATCATGAGACTTGGTCTCAGAGAAATGAAGGCATTTTCAAAGTTATTGTTTCCATCTGTTAAGGACAGTACTTTTTTCGAGAGCTGTGGTGTAGCCGACCTTATCACAACTTGCTTGGGTGGAAGAAACAGGAAAGTTGCTGAAGCTTATGCAAAGAATGGAGGGAAGAGATCTTTCGATGAGCTTGAAGCAGAAATGCTACAAGGCCAGAAATTGCAGACATATTTTGAGGTCTCTTTACCTATGATCACATTAATCTTTGATGTAGCCATAGAGATGGTGCCATTTGTTATTGGTTAA >Medtr7g032630 ATGAATAAGGTCACCATTGTTGGTAGTGGCAATTGGGGTAGTGTTGCCGCAAAACTTATTGCATCAAACACCATCAAGCTCAGTAATTTCCACGATGAAGTGAGGATGTGGGTATTTGAGGAAACTTTACCAAATGGGGATAAGCTCACTGATGTCATCAAACAAACCAATGAAAATGTTAAGTACCTCCCAGGAGTCAAGCTAGGTCAAAATGTAGTTGCAGATCCAGACCTTGAAAATGCAGTTAAGGATGCAAACATGCTGGTATTTGTAACACCACATCAATTCATGGAAGGAATATGCAAAAGGCTTGATGGGAAAATAAGGACAGATGCAGAAGGGATTTCTCTAGTAAAAGGGATGGAGGTCAAGAAGGAAGGTGCATCCATGATCTCTACTTTAATCTCCAATCAATTGAAAATCAATTGTTCTGTTTTAATGGGGGCCAATATAGCAAATGAGATTGCAATGCAGAAATTTAGTGAGGCAACAATTGGATACAGAGAAAATAAAGAAGCTGCAGAGAGATGGGTTCAGTTGTTCAACACTCCTTATTTTAATGTGACATCTGTTCAGGATGTTGAAGGAGTTGAAATGTGTGGAACCCTGAAAAATATAGTTGCTATAGCTGCAGGTTTTATTGATGGCTTGGAAATGGGAAATAACACAAAATCTGCAATAATGAGAATTGGTCTGAAAGAGATGATGGCATTTTCAAAGCTGTTGTTTCCATCGGTCAAGTACAGTACCTTTTTCGAGAGCTGTGGTGTAGCTGACCTTATCACAACATGCATGGGTGGAAGAAATAGGAAAGTTGCTGCTGCTTATGCAAGAAATGGCGGAAAGAGGTCTTTTGATGAACTTGAAGCAGAGTTGCTTAAAGGCCAGAAATTGCAGGGTGTGTTAACTGCAAAAGAGGTTTATGAGGTTCTTACCGCTCGCGGATGGGTAGAGAGGTTTCCACTCTTCACAACAGTGTACGAAATCAGCTCAGGTCTCCTTCCACCATCAGCTATAGTTGAATTCAACAATAAAAGTAAGTTGTAG >AT5G40610 ATGCGCTTCCGATCATTCTTCTTCTCCTCCTCTATCTTCTCCCTTTCACATTCTCGCTCTCCTTCTCTTTCTTCCTCTCGTTTCTCCTCTCTCTCCGCCGCTATGTCTCCTGCTCTCGAGAAATCCCGACAAGGCAATGGTGGATGTAATGATGATTCGAAATCTAAGGTCACGGTCGTTGGTAGTGGCAATTGGGGAAGTGTTGCTGCTAAGCTCATTGCTTCTAATGCCCTCAAGCTTCCTTCTTTCCATGATGAAGTGAGGATGTGGGTGTTTGAGGAGGTTCTACCAAATGGTGAGAAGCTCAATGATGTTATCAACAAGACCAATGAAAATGTCAAGTACCTCCCTGGGATTAAGCTAGGAAGAAATGTTGTTGCGGATCCTGACCTTGAAAATGCAGTGAAGGACGCGAACATGTTGGTTTTTGTTACACCGCATCAGTTTATGGATGGTATATGCAAGAAGTTAGATGGAAAGATCACAGGAGATGTTGAGGCTATATCTCTTGTTAAAGGAATGGAAGTGAAGAAGGAAGGTCCTTGTATGATCTCAAGTCTCATTTCCAAGCAACTTGGTATCAATTGTTGTGTTCTTATGGGCGCAAACATTGCAAACGAGATAGCTGTGGAGAAGTTTAGTGAAGCAACGGTTGGATATAGAGGGAGTAGAGAAATAGCGGACACATGGGTTCAGTTGTTTAGTACTCCGTATTTTATGGTCACACCGGTCCATGATGTGGAAGGAGTAGAGTTATGTGGGACTTTGAAGAATGTAGTTGCTATTGCAGCGGGTTTCGTGGACGGTTTGGAAATGGGTAATAACACAAAGGCTGCAATCATGAGGATTGGTCTAAGAGAGATGAAAGCACTCTCAAAGCTTTTGTTTCCATCTGTTAAAGATAGTACTTTCTTCGAGAGCTGCGGTGTAGCAGATGTCATTACAACTTGCTTAGGAGGAAGAAACCGGAGAGTTGCGGAAGCATTTGCAAAAAGCAGAGGAAAAAGGTCTTTTGATGAGCTTGAAGCAGAGATGCTACAAGGGCAAAAGCTACAGGGGGTATCGACGGCAAGAGAGGTCTACGAGGTGTTGAAACATTGTGGATGGTTGGAGATGTTTCCGCTCTTTTCAACGGTTCACCAAATCTGCACTGGTCGTCTTCAACCTGAAGCCATCGTCCAATACCGCGAGAACAAACTATAA >COL.COLO4_29204 ATGGCTCCTGCCTTTGACAAACAATCCCCACCCGTTAAGGAGGCTGAAACTGCAACTACCCATAACTCTAATACTGTAATCAATGTCGGTAATCATGGTGGAGATGATTATAAATCGAGGGTCACTGTCGTTGGTAGTGGCAATTGGGGTAGTGTTGCTGCTAAGCTCATTGCTTCTAATGCTCTCAAGCTCAACTCTTTTCATGATGAAGTGAGGATGTGGGTGTTTGAGGAGATGTTGCCAAGTGGTGAGAAGCTTACAGAAGTCATTAACCGAACTAATGAGAATGTTAAATATCTCCCTGGTATCAAGCTTGGTAAAAATGTCATTGCGGATCCAGACATTGAGAATGCAGTTAAAGATGCAAACATGTTGGTTTTTGTGACCCCCCACCAATTTATGGAGGGAATATGCAGGAGGCTAGTCGGTAAAGTGAGAGGAGATGCGGAGGCAATTTCCCTTATTAAAGGAATGGAGGTCAAGATGGAAGGCCCTTGCATGATCTCCAATCTTATTTCCGAGCAGCTTGGCATCAATTGTTCTGTTTTGATGGGGGCAAATATTGCAAATGAGATTGCAGTGGAGAAATTCAGTGAAGCAACAGTTGGGTACAGAGACAACAGAGAGATTGCAGAACAATGGGTTCAATTGTTCAGTACCTCTTATTTCATGGTCACTCCTGTCCAGGATGTGGAAGGGGTTGAACTATGTGGGACTTTGAAGAATGTTGTGGCCATTGCGGCTGGTTTTGTGGATGGACTTGACATGGGAAATAACACAAAGGCTGCAATAATGAGAATTGGTCTGAGAGAGATGAGAGCTTTCTCCAAGCTCTTATTTTCATCTGTTAGGGATAGTACCTTCTTTGAAAGCTGTGGAGTTGCAGATGTCATCACAACATGCTTGGGGGGAAGAAATAGAAAAGTCGCTGAGGCATTTGCTAAGAATGGAGGCAAAAGATCTTTCGATGAGCTTGAAGCAGAGATGTTGCAGGGCCAAAAATTACAGGGTGTATCCACAGCAAGAGAGGTCTATGAAGTTTTAAGCCACCGTGGATGGCTAGAGTTGTTTCCTCTATTTGCAACAGTGCATGAGATCTGTGTTGGTCGTCTTCCACCATCGGCCATAGTTGAATATAGTGAGAAGAAACCAAGGTTGTCCATGATGGAGGACTCTGCTCGTCACTAG >Vradi01g08300 ATGGCTCCAGCCTTGGAAGCCCAGGTTCAACAAGAGGAACAATCTCTGCCACACAATAACAACTTCTATAACACTCTCAATGATGCCACACACAGATCCAAAGTCACTGTTATTGGAAGCGGCAACTGGGGCAGTGTTGCTTCTAAGCTCATTGCCTCCAACACCCTCAGGCTTCCCTCCTTCCATGATGAAGTTAGGATGTGGGTGTACGAGGAGACATTACCGAGTGGTGAGAAGCTAACAGATGTCATCAATCGAACCAATGAAAATGTCAAATATCTCCCTGGAATCAAACTTGGCCAAAATGTTGTTGCAGATCCAGACCTTGAAAATGCAGTGAGGGATTCCAACATGTTAGTATTTGTCACTCCACATCAATTTGTGGAAGGTATATGCAAAAGGCTTGTTGGGAAAATAAGGGAAGATGCTGAGGCTATTTCCCTTGTTAAAGGGATGGAGGTCAAGATGGAAGGGCCATGCATGATCTCTACTCTCATCTCCCAGCAACTGGGAATCAATTGTTCTGTTTTAATGGGTGCCAACATAGCCAATGAGATAGCTGTGGAGAAGTTTAGTGAAGCAACGGTTGGATACAGGAACAACAAAGAAGTTGCTGAGAGATGGGTTCAGTTGTTCTATACTCCTTATTTCATTGTGACAGCTGCTCAAGATGTTGAAGGAGTTGAACTGTGTGGAACTTTGAAAAATGTAGTGGCCATAGCAGCAGGTTTTGTTGATGGCCTGGAGATGGGAAATAATACAAAAGCTGCAATCATGAGACTTGGTCTTAGAGAAATGAAGGCATTTTCAAAGTTGTTGTTTCCATCTGTTAAGGACAGCACCTTTTTTGAGAGCTGTGGAGTAGCTGATCTTATCACAACATGCTTGGGTGGAAGAAATAGAAAAGTTGCTGAGGCATATGCAAGGAATGGAGGGAAGAGATCTTTTGATGAGCTTGAAGCAGAAATGCTACAAGGCCAGAAATTACAGGGTGTCTCAACTGCGAGTGAGGTTTATGAGGTTCTAAGCCATCGTGGGTGGCTAGAGTTGTTTCCTCTCTTCTCAACAGTGCATGAGATATGCTCTGGCCTACTTCCTCCATCAGCCATAGTTGAATACAGTGAGAAGCTACCTAGGTCCTTCTAA >Vradi0007s01990 ATGGCAGTGATAAGCCCGAACTTCGACTTTATCACATTTCGGCAACGTTTTGGTCTATTCTTGGCCCACTTTTGGATTTCCTCTGCTTCTGTCTTGTTTTCCCTACCCCTTCCGCTTAAACCAAACATAGCTATGTATAAAGTCACTGTTATTGGTAGCGATGAAGTGAGAATGTGGGTATTCGAGGAAAAATTACCAAACGGGGAGAAGCTCACAGATGTTATCAACAAAACCAATGAGAATGTTAAGTATCTCCCTGGGATTAAGCTTGGTAAAAATGTTGTTGCAGATCCAGACCTTGTAAATGCAGTTAAGGATGCCAACATGCTGGTGTTTGTAACCCCACATCAATTCGTGGAAGGAATATGCAAGAGGCTTGCAGGGAAAATAAGGGCAGATGCAGAGGGAATTTCTCTTATCAAAGGGATGGAGGTCAAGAAAGAAGGGCCAAGCATGATCTCAAATCTCATTACCAAACAACTAGGAATTAATTGTTCAGTTTTAATGGGGGCCAACATAGCAAATGAGATAGCAATGGAGAAATTTAGTGAAGCAACAGTTGGATATAATCAAAACAAATCAGCAGCAGATAGATGGGTTCAGTTGTTTTGCACTCCTTATTTCAATGTCACAGCTGTCCAGGATGTTGAAGGCGTCGAGCTCTGTGGAACTCTGAAAAATGCTGTGGCCATAGCTGCAGGTTTTGTTGATGGCTTGGAGATGGGGAATAACACAAAAGCTGCAATAATGAGAATTGGCCTAAAAGAGATGATGACATTTTCAAAGATGTGTTTTCCATCTGTTAAGGATAGTACCTTTTTTGAGAGCTGTGGTGTAGCTGATCTTATCACAACATGCATGGGAGGGAGAAATAGGAAAGTTGCCGATGCTTATGCCAGAAATGGAGGGAAGAGGTCTTTTGATGAGCTTGAAGCAGAGATGCTTCAAGGCCAGAAATTGCAGGGTGTCTTAACTGCAAAAGAGGTGCATGAGGTTCTAAGTAATCGCGGATGGCTACACATTTTTCCTCTCTTCTCAGCAGTGCATGCAATCAGCACAGGTCGTCTTCCACCATCAGCCATAGTTAAAATCAATGAAGAAAATCTCAGGCATGTACAAATAGTAAGCTCGCTTTAG >PGSC0003DMG400006965 ATGGCGCCTTCGAATACCAATCCTGTTGCAGTTGCAGATGAAGTTCTTCAGAAATCAAGAGTCACCGTTGTTGGTAGTGGAAATTGGGGTAGTGTTGCAGCCAAGCTCATTGCTTCTAACACCCTCAACATCAATTCTTTCCACGATGAAGTTAGGATGTGGGTCTTTGAGGAGACATTGCCATCCGGTGAAAAACTCTCCGAAGTCATCAATCGGACCAATGAGAATGTTAAGTATCTTCCTGGTATAAAATTACCTAAAAATGTTGTTGCAGACCCTGATATTGAACATGCAGTGAAGGATGCTAACATGTTAGTGTTTGTGACTCCTCATCAATTCATGGAGGGGATTTGCAAGAGGCTAATTGGGAAAATTAGGAAAGATGCTGTAGCAATTTCCCTAATTAAAGGAATGGAGGTCAAGAAGGAAGGACCTTGCATGATCTCTACCCTCATCTCTGAAATTCTTGGGATCAGTTGTTGTGTTCTAATGGGAGCCAACATTGCCAATGAGATTGCAGTTGAGAAGTTCAGCGAAGCAACGGTTGGATATAGGGAGAACAAAGAGATTGCGGAGAAATGGGTTCGCCTATTCAATACTCCTTACTTTATGGTCTCAGCTGTTCAAGATGTGGAAGGAGTCGAACTTTGTGGAACTCTTAAAAATGTTGTGGCTCTAGCAGCAGGCTTTGTGGACGGCCTCGATATGGGAAATAACACTAAGGCTGCAATAATGAGAATTGGCTTGAGAGAGATGAAGGCCTTATCCAAGCTATTGTTTCCTTCTGTCAAAGATAATACATTCTTTGAGAGTTGTGGAGTAGCAGATCTGATAACTACTTGCTTGGGAGGAAGAAACAGGAGATGTGCTGATGCTTTTGCAAGGAACGGAGGAAAAAGGTCTTTTGATGAACTTGAAGCAGAGATGTTGCAAGGCCAAAAACTGCAGGGTGTCTCTACAGCAAAGGAGGTTTACGAGGTTCTAAGTCATCGAGGATGGTTAGAATTATTCCCCCTTTTCTCAACAGTTCATGAGATCTGCAGTGGCCGTCTTGCTCCCTCAGCCATAGTTGAATATACCGAGCACTCAGCCAGATTGCCCTTGCTGTAA >Migut.K01420 ATGCCTCAATTTCTTCTGGATAATAATCACATCGCCGCCGCCGCCGCCGGAGGAGGAGCAGGAGCTGCTGACGAAACAATGACGGCTAAGTCGAGAGTCACCGTTGTCGGTAGTGGCAATTGGGGAAGCGTCGCTGCCAAACTCATCGCTTCCAACACACTCAAGCTCAATTCTTTCCACGATGAAGTGAGTATGTGGGTATTTGAGGAGACACTGCCAACTGGTGAAAAACTCTCACAAGTCATCAATCGAACTAATGAGAATGTCAAATACCTACCCGGAGTAAAGCTTGGTAAAAACGTCGTTGCAAATCCCGATCTTGAAAATGCAGTGAAGGATGCGAATTTGTTAGTATTTGTGACGCCACATCAATTCATGGAAGGCATTTGTAAAAGGCTTGTGGGGAAAATAAGAGCCGATGCCGAGGCAATTTCTCTAATTAAAGGAATGGAAGTGAAGAGAGAGGGTCCATGCATGATATCTACTCTAATCACAGAACAGCTCGGAATTAATTGCTGTGTTTTAATGGGCGCAAACATTGCCAACGAGATTGCGGTGGAAAAATTCAGTGAGGCAACAGTCGGATACAGAAAGAATAAAGAGATGGCTGAGAAATGGGTTCAGTTGTTCAACACTTCATACTTTATGGTCTCACCTGTTCAAGATGTGGAAGGAGTCGAACTATGTGGGACGTTGAAAAATGTCGTGGCTATTGCAGCAGGATTGGTGGATGGATTGGAAATGGGGAACAATACAAAGGCTGCAATAATGAGAATTGGATTGAGAGAAATGATGGCCCTTTCGAAGCTTCTTTTTCCTTCTGTCAAAGATAGTACTTTCTTCGAGAGCTGCGGTGTAGCAGATTTAATCACAACTTGCTTGGGGGGAAGAAACAGAAAATGTGCCGAGGCTTTTGCTAGGAATGGTGGTAAGAGGTCTTTTGATGAGCTCGAAGCAGAGATGTTACAGGGCCAGAAATTACAGGGAGTCTCTACTGCAAAAGAGGTTTACGAGGTTTTAAACCATAGAGGATGGTTGGAGCTTTTCCCACTTTTCTCGACAGTTCACGAGATCTGCATCGCTCGTCTCCCACCAATTGCTATTGTTAATGTCAAATTTAAATAA >AL7G49190 ATGCGCCTCCGATCATTCTTCTTCTCTATCTTCTCCTTTTCACATTCTCCTTCTCTTCCTTCCTCCTCCTCTCGTTTCTCCTCTCTCCGCGCCGCTATGTCTCCTGCTCTTGAGAAATCCCGACAAGGCAATGGTGAATGTAATGAGGTTTCGAAATCTAAGGTTACGGTCGTTGGTAGTGGCAATTGGGGAAGTGTTGCTGCTAAGCTCATTGCTTCTAATGCCCTCAAGCTTCCTTCTTTCCATGATGAAGTGAGGATGTGGGTGTTTGAGGAGGTTCTACCAAATGGTGAGAAGCTTACTGATGTTATCAACAAGACCAATGAAAATGTCAAGTACCTTCCTGGGGTTAAGCTAGGAAGAAATGTTGTTGCGGATCCTGACCTCGAAAATGCAGTGAAGGAAGCAAACATGTTGGTTTTTGTTACACCGCATCAGTTTATGGATGGTATATGCAAGAAATTAGATGGAAAGATCACAGGAGATGTTGAGGCTATATCTCTTGTTAAAGGAATGGAAGTGAAGAAGGAAGGTCCTTGTATGATCTCAAGTCTCATTTCCAAGCAACTTGGTATCAATTGCTGTGTTCTTATGGGGGCAAACATTGCAAACGAGATAGCTGTGGAGAAGTTTAGTGAAGCAACGGTTGGATATAGAGGAAGTAGAGAAATAGCAGACACATGGGTTCAGTTGTTTAGTACTCCGTATTTTATGGTCACACCGGTCCATGATGTGGAAGGAGTAGAGTTGTGTGGGACCTTGAAGAATGTAGTGGCTATTGCAGCGGGTTTCGTGGACGGTTTGGAAATGGGTAATAACACAAAGGCTGCAATCATGAGGATTGGTCTAAGAGAGATGAAAGCGCTCTCAAAGCTTCTGTTTCCATCTGTTAAAGACAGCACTTTCTTCGAGAGCTGCGGTGTAGCAGATGTCATTACAACTTGCTTAGGAGGAAGAAACCGAAGAGTTGCGGAAGCATTTGCAAAAAGCGGAGGAAAAAGGTCTTTTGATGAGCTTGAAGCAGAGATGCTACAAGGGCAAAAGCTACAGGGGGTATCGACAGCAAGAGAGGTCTACGAGGTGTTGAACCATTGTGGATGGTTGGAGATGTTTCCGCTCTTTTCAACGGTTCACCAAATCTGCACGGGTCATCTTCAGCCTGAAGCCATCGTCCAATACCGCGAGAACAAACTATAA >GSVIVG01003989001 ATGGCTCCAGCTTTTGAAGATGAAACCGCATCAGAGACCAACTTCTCAGATGTTGAGCAGCTTCATAAATCTAAGGTCACCGTGGTGGGTAGTGGAAATTGGGGCAGTGTGGCTGCAAAGCTCATTGCCTCCAATACTCTCAAGCTTAGCTCATTCCATGATGAAGTGAGGATGTGGGTGTACGAGGAGATATTACCAAGCGGTGAGAAACTCTCAGAAGTCATCAACCAAAACAATGAAAATGTTAAATACCTTCCTGGTATAAAGCTTGGCAAAAATGTTGTTGCGGACCCAGACCTTGAACACGCAGTGAAGGATGCAACCATGTTGGTGTTTGTGACCCCACACCAATTCATGGAGGGTATATGCAAGAGGCTTGTTGGGAAGATAAGGGGAGATGCGGAGGCTATTTCCCTCATCAAAGGAATGGAGGTCAAAATGGAAGGCCCATGCATGATCTCCACTCTCATTACTGACTTGCTAGGAATCAATTGTTGTGTTCTAATGGGTGCCAACATTGCTAATGAGATCGCTGTGGAGAAGTTTAGTGAAGCAACAGTTGGATACAGAGAGAACAGAGATATTGCAGAGAGATGGGTTCGACTGTTTAGTACTCCATATTTCATGGTTTCAGCTGTCCAGGATGTGGAAGGCGTTGAACTATGTGGAACCCTGAAGAATGTTGTGGCCATTGCAGCAGGTTTTGTGGATGGGTTGGAGATGGGAAATAACACCAAGGCTGCGATTATGAGAATTGGTCTAAGGGAGATGAAGGCTTTCTCCAAGTTGCTGTTCTCATCTGTTAGAGACAGTACCTTCTTTGAGAGCTGTGGCATAGCTGATCTCATCACTACATGCTTGGGAGGAAGAAACAGGAAAGTTGCAGAGGCTTTTGCAAGGAATGGAGGGAAAAGGTCTTTTGATGAGCTTGAAGCAGAGATGTTGCAAGGTCAGAAGCTACAGGGTGTTTCGACAGCAAGAGAGGTTTATGAGGTTTTAAGTCACCGTGGATGGCTCGAACTATTCCCGCTTTTCACTGCAGTGCATGAAATCAGCACAGGGCGTCTTCCACCCTCGGCTATAGTTGAATATAGTGAGCACACACCCAGACTCAACGTGTTGGAAGGCTCTGCTCAGTACTGTTGA >TPR.G1131 ATGAATAAGGTCACCATTGTTGGTAGTGGCAATTGGGGCAGTGTTGCGGCAAAGCTTATTGCATCCAACGCCATCAAGCTGAGTAACTTCCATGATGAAGTGAGGATGTGGGTATTTGAAGAAACTTTACCAAGTGGGGAGAAACTCACAGATGTCATCAACAAAACAAATGAAAATGTTAAGTATCTTCCAGGTGTAAAGCTTGGTAAAAATGTTGTTGCAGATCCAAACCTTGAAAGAGCAGTTAAGGATGCAAATATGTTGGTATTTGTATCACCACATCAATTCATGGAAGGAATATGCAAAAGGCTTGTTGGGAAAATAAGGACAGATGCAGAGGGGATTTCCCTTGTAAAAGGCATGGAGGTTAAAAAGGAAGGTCCATGCTTGATATCTACTTTAATATCCAATCAATTGAGAATCAATTGTTCTGTTTTAATGGGAGCCAATATAGCTAATGAGATTGCCATGGAGAATTTTAGTGAGGCAACAGTTGGATACAGGCAAAACAAAGAAGCTGCAGAGAAATGGGTTCAGTTGTTCAATACTCCTTATTTTAATGTGACATCTGTTGAGGATGTTGAAGGAGTAGAAATGTGTGGAACCTTGAAAAATATAGTAGCTGTAGCTGCAGGTTTTATTGATGGCTTGGAGATGGGAAATAACACAAAAGCTGCAATCATGAGAATTGGTTTGAAAGAGATGATAGCATTTTCAAAATTGTTATTTCCATCTGTTAAGGACAGTACCTTTTTTGAGAGTTGTGGTATAGCTGACCTTATCACAACATGCATGGGTGGAAGAAATAGGAAAGTTGCTGAGGCTTATGCAAAAAATAGGGGAAAGAGGTCTTTCGATGAACTTGAAGCAGAGATGCTTAAAGGCCAGAAATTGCAGGGTGTGTTAACTGTGAAAGAGGTTTACGAGGTTCTAACCGCTCGTGGATGGGTAGAGATGTTTCCTCTCATAACAGCAGTGTATAAAATCAGCTCAGGCCTCCTTCCACCATCAGCTATAGTTGAATTCAGCAGTAACAGTCACAACCGTATACAAAGCAGGCTATAG >TPR.G21634 ATGGCTCCAGCACTTGAAGTTCAAGGAGGAGAAACTGTGTCTCAAAACATTGTTTTGAATAGTGTTAATGATGTTATAAACAGATCCAAAGTCACTGTTATTGGTAGTGGTAATTGGGGTAGTGTTGCATCTAAGCTTATTGCTTCTAACACCCTCCGGCTGAACAATTTCCATGATGAAGTTAGGATGTGGGTATATGAAGAGACATTACCAAATGGAGAGAAGCTCACAGATGTTATCAATCAAACCAATGAAAATGTAAAATACCTCCCTGGAATCAAGCTTGGAAAAAATGTTGTTGCAGATCCAGACCTAGAAAATGCAGTGAGGGATGCAAATATGTTAGTGTTTGTGACTCCACATCAATTTATGGAAGGAATATGCAAAAGAATAGCTGGAAAAATAAGGGCAGATGCTGAGGCTATTTCTCTTGTTAAAGGTATGGAGGTTAAAATGGAAGGCCCTTGTATGATCTCAACACTCATTTCAGAAGAACTTGGAATCAATTGTTCTGTTTTGATGGGCGCAAATATAGCAAATGAGATAGCTGTAGAGAAGTTTAGTGAAGCAACTGTTGGATACAGGCAGAATAGAGAAGCTGCAGAGAGATGGGTTCAATTGTTTTATACTCATTATTTCATTGTAACAGCAGTTCAAGATGTTGAAGGAGTTGAATTATGTGGAACTCTAAAAAATGTTGTGGCCATAGCAGCAGGTTTTGTTGATGGATTGGAGATGGGAAATAATACAAAAGCTGCAATCATGAGACTTGGTCTTAGAGAAATGAAGGCATTTTCAAAGTTGTTGTTTCCATCTGTTAAGGATAGTACCTTCTTTGAGAGTTGTGGTGTAGCTGACCTTATCACAACATGCTTGGGTGGAAGAAACAGGAAAGTTGCTGAGGCTTATGCAAAGAATGGAGGGAAGAGATCTTTTGATGAACTTGAAGCTGAGATGCTACAAGGCCAAAAGTTGCAGATTCAAAGCCAGCAATTGCAAAAAGGGATGAGGTAG >ATR0824G013 ATGGTCCCTGCCCTCGAAGTAGCACCCCAAGAGAACCAGGATCTGGAGCTTGACTCAGACATGAATTCCAACTGCAATGGCGCGACCCAAGAAAGGGTGGCCGTTATAGGAAGCGGCAACTGGGGAAGTGTGGCGTCCAAACTCATCGCCTCAAACACTGCTAAGCTCTCCTCCTTCCATGATGAAGTGAGGATGTGGGTTTTTGAAGAAACGTTGCCCAGCGGCGAGAAACTCAGCGAAGTCATTAACAGAGAGAATGAAAATGTGAAGTATCTTCCTGGTGTTAAGCTTGGAAAGAACGTAGTAGCAGATCCTGATCTTGTGAATACAGTAAAGGATGCTACCATGCTTGTATTTGTAACCCCACATCAATTCATGGAGGGCATATGCAAGAGACTCATAGGAAAGGTCAGGCCTGATGCACAGGCTATTTCTCTCATCAAGGGGATGGAGGTGAAGAAAGAGGGCCCTTGCATGATTTCCACTCTAATCACTCAACTTCTTCACATCAATTGCTCAGTTCTCATGGGTGCCAACATTGCTAATGAGATTGCACAAGAGAAATTCAGCGAAGCGACAGTTGGATATAGAGAGGATGAGGAGACTGCCCTGAAATGGGTTCTCCTGTTTAGTACACCGTATTTCCTTGTAACACCAGTTCAAGATGTTGAGGGCGTCGAACTCTGTGGCACACTGAAGAACGTGGTTGCTTTAGCTGCAGGATTTGTGGATGGGCTGGAGATGGGTAACAACACCAAGGCAGCAATAATGAGAATTGGGCTAAGAGAAATGCGTGCCTTCTCTAAGCTGATGTTCCCTAGTGTGAAAAACAACACCTTCTTTGAGAGCTGTGGCGTTGCAGATCTCATCACCACATGTTTGGGTGGGAGGAACAGGAAAGTTGCAGAAGCCTTTGCTAAGAACAATGGCAAAAGGTCTTTTGATGAACTTGAAGCAGAGATGCTCCAAGGCCAGAAATTACAGGGTGTTTCGACTGCAAGAGAAGTTTATGAGGTTCTAAGCCATCGGGGATGGCAAGAGTTGTTCCCACTCTTTACGACAGTGTATGAAATCTGCATTGGGCACTTGTCCCCATCAGCCATTGTTGAATACAGTGAGCACAAACCGAACTTTGCTCTAGTGGATGGTTCTGCACAGGTTTACTAG >Zm00001d041962 ATGGAGATGGAGAACGGGCACGCCAAGTACCGGGTGGCCGTCATTGGCAGCGGCAACTGGGGCAGCGTCGCCTCCCGCCTCATCGCCTCCAACACCGCCAAGCTGCCCTCCTTCTATGATGAAGTAAGGATGTGGGTGTTTGAGGAAATACTGCCTACAGGCAGGAAGCTATCTGAGTCCATTAACGAACAGAATGAGAACTGCAAATACTTGCCAGGTATAAAGCTTGGAACGAATGTTATTGCCGACCCTGACTTGGAGAGCGCAGTCAAAGACGCGAATATGCTGGTTTTTGTGACGCCCCATCAATTTGTGGAGGGTATATGTAAGAAGCTTGTAGGGAAGCTAACACCAGGAGCTGAGGCTATCTCCCTCATCAAGGGCATGGAGGTCAAGATGGAAGGGCCATGCATGATATCCAAGTTAATCGCGGATACACTTGGAATCAATTGCTGTGTGCTCATGGTGCAGATTGCTGTCGAAGAGTTCAGTGAAGCAACAATTGGGTATAGGAAAGATAAGGAAGTGGCAAATCGATGGGCTAAACTTTTTACCACACCCTACTTCCTAGTTTCTGTCGCAGAAGATATTGAAGGAGTAGAGCTGTGTGGAACTCTGAAAAATATCGTGGCTATTGCAGCAGGCCTTGTGGATGGCTTGGATATGGGAAACAATACAAAGGCTGCAATAATGAGGATTGGTTTGCGAGAAATGCGTGCTTTCTCTAAGCTTCTGTTCCCTTCAGTCAGAGACAACACGTTCTTCGAGAGCTGTGGTGTCGCCGACCTAATAACCACGTGCCGTACGTATCTTCACCATTGCCAATTAACCATCCAACAGATGGATACTGAAAAGTCTTTTGATGAACTGGAGGCAGAGATGTTGCGTGGCCAAAAACTCCAGGGAGTGTCCACAGCAAGGGAAGTCTATGAAGTGTTGACTTATCGAGGATGGCAGGAGCTGTTTCCTCTGTTATCAACAGTGCATGAGATCTGTATTGGGCAGTTGCCTCCTACATCGATAGTTGAATACAGTGAGCACACGCCAAATCTCTCCATCATCGGTGGTCATACTCCATTCTACTGA >AH007818 ATGCAAAATCTGCATACTTTGTCACATAACCAAATCTTCATAATCAAACCCTGTGAAACATTAATTTCCCATCCTAAATCAAATTTTCGGATTTCCATCCCTAACTTTTCCCTTAAATCATCCATAAAAATGACAGCCCATGCTTCGGAGAAATACAAAGTTGCCGTTATTGGTAGCGGCAATTGGGGTAGCGTTGCAGCCAAACTCATTGCATCCAATACAATCAACAATAACATCTTCCATGATGAAGTTCGGATGTGGGTATTTGATGAAACTTTGCCAAGTGGGGAGAAATTGTCGGAAATCATTAATCAAACCAATGTAAATGTGAAGTACCTTCCTGGTATAAATCTTGGTAAGAATGTGGTTGCTGACCCAGACCTTGAACATGCAGTGAGAGATGCAAACATGTTGGTGTTTGTGACACCTCATCAATTCGTCGAGGGTATTTGTAGAAGACTTGTTGGAAAATTAAGGAGAGATGTTGAGGCTATTTCATTGATAAAAGGCATGGAGGTGAAAGTGGAAGGTCCATTGATGATCTCTTCTGTAATCTCTAAGCAACTTAAGGTTGATTGTTGTGTTTTAATGGGTGCAAATATAGCGGATGAGATTGCTGATGAGAAGTTCAGTGAAGCAACTGTAGGATATAGACAAAATAGAGAGGTTGCAGAGAGGTGGGTTCAACTCTTTGCAACACCTTATTTTGCTGTCACAGCGGTCAATGATGTTGAAGGAGTAGAACTATGTGGTACTTTGAAAAATGTTGTGGCCATTGCTGCAGGATTTGTGGACGGATTGGCTATGGGGAGTAACACAAAAGCTGCAATAATGAGAATTGGCTTGAATGAAATGAGGGTCTTCTCCAAGCAGCTATTCCCATCTGTTAAAGATGATACCTTTTTTGAAAGTTGCGGTGTGGCTGATCTAATTGCGTCTTGTTTCGGAGGAAGGAATAGGAAAGTTGCAGAGGCTTTTGTAATCAATGGAGGAGAACGAACCTTCGAGGAGCTGGAAGCCGAGATCCTGCAGGGCCAGAAGCTACAGGGTGTCTTGACAGCCAAAGAAGTATATGAAGTCCTAGAAAGCAATGGGTGGTTTGATTCATTCCCCCTTTTCAAAACAATACACGAGATTTGTGTCGGTGACAAACCGCCATCGGCCATAGTGCACTATAATGAATTTTGA >Glyma.05G114400 ATGGCTCCAGCCTTGGAAGCCAAACAAGTTGTTCTTCCACAAGAGGGAGAAACTACTGTGGCACCGAACAACTTCTTGAACAGTGTTGTCAATGATGCCACACACAGATCCAAAGTCACTGTTATTGGAAGTGGCAACTGGGGCAGTGTTGCTGCTAAGCTCATTGCCTCCAACACCCTCAGGCTTAGCTCCTTCCATGATGAAGTGAGGATGTGGGTATATGAGGAGACATTACGAAGTGGTGAGCAGCTCACAGATGTCATCAATCGAACCAATGAAAATGTCAAATATCTTCCTGGAATCAAGCTTGGCAAAAATGTTGTTGCAGATCCAGACCTTGAAAGTGCAGTGAAGGATTCCAACATGTTAGTGTTTGTGACTCCACATCAATTTATGGAAGGAATATGCAAAAGGCTTGTTGGGAAAATAAGGGAAGATTCTGAGGCTATTTCCCTTGTTAAAGGGATGGAGCATCTGGGAATCAATTGTTCTGTTTTAATGGGTGCCAACATAGCAAATGAGATAGCTGTGGAGAAGTTTAGTGAAGCAACTGTTGGATACAGGCTCAATAGAGAAGTTGCTGAGAGATGGGTTCAGTTGTTTTATACTCACTATTTCATTGTGACAGCTGTTCAGGATGTTGAAGGAGTTGAACTGTGTGGAACTTTGAAAAATGTTGTGGCCATAGCAGCAGGTTTTGTCGATGGCCTGGAGATGGGAAATAATACAAAAGCTGCAATCATGAGACTTGGTCTTAGAGAAATGAAGGCATTTTCAAAGTTGTTGTTTCCATCTGTTAAGGACAGCACTTTTTTTGAGAGCTGTGGTGTAGCTGACCTTATCACAACATGCTTGGGTGGAAGAAACAGGAAAGTTGCTGAGGCTTATGCAAGGAATGGAGGGAAGAGGTCTTTTGATGAGGTTGAAGCAGAAATGCTACAAGGCCAGAAATTGCAGGGTGTCTCAACTGCGAGTGAGGTTTATGAGGTTCTAAGCCATCGCGGGTGGCTAGAGTTGTTCCCTCTCTTCTCAACAGTGCATGAGATAAGCACTGGCCTACTTCCACCATCAGCAATAGTTGAATACAGTGAGAAGCTACCCAAATCCTTCTAA >Glyma.19G053500 ATGGCTCCAGCCTTGGAAGAAGGAGGAGAAAGAGAAACTAGTGTGGCACAGAACAACTCCTTGAACAGTGTTGTCAATGATGCCACACACAGATCCAAAGTCACTGTTATTGGAAGTGGCAACTGGGGCAGTGTTGCAGCTAAGCTCATTGCCTCCAATACCCTCAGGCTTAGCTCCTTCCACGATGAAGTGAGGATGTGGGTATATGAGGAGACACTACTAAGTGGTGAGAAGCTCACAGATGTCATCAATCGAACCAATGAAAATGTCAAATATCTCCCTGGAATCAAGCTTGGCAAAAATGTTGTTGCAGATCCAGACCTTGAAAGTGCCGTGAAGGATTCCAACATGTTAGTGTTTGTGACTCCACATCAATTTATGGAAGGAATATGCAAAAGGCTTGTTGGGAAAATAAGGGAAGATGCTGAAGCTATTTCCCTTGTTAAAGGGATGGAGGTCAAAATGGAAGGCCCATGCATGATCTCTAGTCTCATTTCTCAGCAACTGGGAATCAACTGTTCTGTTTTAATGGGTGCCAACATAGCAAATGAGATAGCTGTGGAGAAGTTTAGTGAAGCAACTGTTGGATACAGGCTCAATAGAGAAGTTGCTGAGAGATGGGTTCAGTTGTTTTATACACACTATTTCATTGTGACAGCTGTTCAGGATGTTGAAGGAGTCGAACTGTGTGGAACTTTGAAAAATGTTGTGGCCATAGCGGCAGGTTTTGTGGATGGCCTGGAGATGGGAAATAATACAAAAGCTGCAATCATGAGACTTGGTCTTAGAGAAATGAAGGCATTTTCAAAGTTGTTGTTTCCATCTGTTAAGGACAGCACCTTTTTTGAGAGCTGTGGTGTAGCTGACCTTATCACAACATGCTTGGGTGGAAGAAATAGGAAAGTTGCTGAGGCTTATGCAAGGAATGGAGGGAAGAGGTCTTTTGATGAGCTTGAAGCAGAAATGCTACAAGGCCAGAAATTGCAGGGTGTCTCAACTGCGAGTGAGGTTTATGAGGTTCTAAGCCATCGTGGGTGGCTAGAGTTGTTCCCTCTCTTCTCAACAGTGCATGAGATAAGCACTGGCCTACTTCCACCATCGGCCATAGTTGAATACAGTGAGAAGCTACCCAGGTCCTTCTAA >Glyma.19G079400 ATGTTTAAAGTCACCGTTGTTGGTAGCGGCAATTGGGGCAGTGTTGCGGCAAAGCTTATTGCCTCGAACACCATCAGGCTTGCCTCCTTCCATGATGAAGTGAGAATGTGGGTATTCGAGGAAAAATTACCAAGTGGGGAGAAGCTCACAGATGTTATCAACAAAACCAATGAAAATGTCAAGTATCTCCCTGGAATCAAGCTTGGTAAAAACGTAGTTGCTGATCCAGAGCTTGAAAATGCAGTTAAGGATGCCAACATGCTAGTATTTGTAACTCCGCATCAATTCATGGAAGGAATATGCAAGAGGCTTGCAGGGAAAATAAGGTCAGATACAGAGGGAATTTCTCTTATCAAAGGGATGGAGGTCAAGAAGGAAGGCCCAACCATGATCTCTACTCTCATTACCAAACAACTAGGAATCAATTGTTCTGTTTTAATGGGGGCCAACATAGCAAATGAGATAGCATTGGAGAAATTTAGTGAAGCAACAGTTGGATATAATCAAAACAAATTAGCAGCAGAGAGATGGGTTGAGTTGTTCAATACTCCTTATTTCAATGTGACAGCCGTCGAAGATGTTGAAGGGGTCGAACTCTGTGGAACTCTGAAAAATGTAGTGGCCATAGCTGCAGGTTTTGTTGATGGCTTGGAGATGGGAAATAATACAAAAGCTGCAATCATGAGAATTGGCCTGAAAGAGATGAGGGCATTTTCAAAGATGTGGTTTCCATCTGTTAAGGACAACACCTTTTTTGAGAGCTGTGGTGTAGCTGACCTTATCACAACATGCATGGGTGGGAGAAATAGGAAAGTTGCCGATGCTTATGCCAGAAATGGAGGGAAGAGGCCTTTTGATGAGCTTGAAGCAGAGATGCTTCAAGGACAGAAATTGCAGGGTGTCTTAACTGCACAAGAGGTTCATGAGGTTCTAAGTCATCGTGGGTGGCTACACATGTTTCCTCTCTTCTCAGCTGTGCATGCAATCAGCACAGGTCGCCTTCCACCATCAGCCATAGTTAAAATCAGCGACCTAAAGCCCAGGCATGGACAATTACAAAGCATGCTTTAG >MELO3C021604 ATGCACAGATGCGCTTTGTTTCTCACGAAACGTGTATGGCAACTCCGCCCCTTTGAGCCTTTTCAATCTCCAAATTTCTCTTTATATTCTATTTCTTCTTTCTCCCTTCTAATTCTCTCCACCCCTTCTTCCCATTTTCTTTCTCCTTTTCTCCATTCTCTCTCTCCTTCTTCTTCCATGGCACCCGGAATCGAAGCTTTACAGCGTTCTTCAAATGGGGGTTCTGTTAGACCCGATTCCCATTTATCCGATGATGGGGTTTCTTCCAAATTCAAAGTTACTGTCGTTGGAAGTGGTAATTGGGGTAGTGTTGCAGCCAAACTCATCGCTTCTAATGCCGCTAGGCTCAGCTGTTTCCATGATGAGGTTAGAATGTGGGTGTATGAGGAGACTTTGCCTACTGGTGAGAAGTTAACTGATGTTATCAATCGCAACAATGAGAATGTTAAATATCTCCCTGGTATAAAGCTTGGGAAGAATGTTATAGCAGACCCAGACCTTGAAAATGCAGTGAAGGATGCTAATATGTTGGTGTTTGTTACTCCTCATCAATTTGTGGAGGGGATATGCAAGAGACTGGTTGGAAAGATAAGGGGAGATGTGGAAGCTATTTCCCTCATTAAAGGAATGGAGGTGAAGAAGGAAGGTCCATGCATGATTTCTTCCCTCATCTCTCAGGAATTGGGAATCAATTGTTGTGTTCTTATGGGAGCCAATATAGCAAACGAGATTGCTGTAGAGAAATTTAGTGAAGCAACAGTGGGATACAGGGAGAACATGAGAGAGATAGCTGAAAAATGGGTTCAACTTTTCACGACTCCCTATTTTGTTGTTACACCTGTCCAAGATGTTGAAGGAGTTGAGATGTGTGGAACCCTTAAAAATGTTGTGGCTTTAGCAGCAGGTTTTGTTGATGGTTTGGAAATGGGAAATAACACAAAGGCTGCAATTATGAGAATTGGTCTGAGGGAAATGAGAATGATTTCCAAGCTTCTGTTTTCATCTGTCAAGGATAGTACTTTCTTTGAGAGTTGCGGAGTAGCTGATTTGATTACAACGTGCTTGGGAGGAAGAAACAGGAAGGTGGCAGCAGCTTTTGCCATGAATGGAGGAAAAAGGTCCTTTGATGAACTTGAAGCAGAAATGCTGCAAGGCCAAAAATTGCAGGGTGTGTCCACTGCAAAGGAGATGTATGAGGTTCTGAACCACCGTGGGTGGCTGGAGCTGTTTCCATTGTTTGCATCAGTCCACGAGATCTGTACCGGACATCTCTCACCGTCAGCCATCGTTGAATATAGCGAGCGCAAACCCAACTTCTCTGTTATTGATGGTCATGCTCAGTAA >Eucgr.J02265 ATGGCGCCTGCCCAAGAACTGCCGCCGGAGACGGAGGCCGTGCAGCTCGGGGACGCCGCCCAGAAGTCCAGGGTCACCGTCGTCGGCCGCGGCAACTGGGGCAGCGTCGCCCCCAAGCTCATTGCGTCCAACACCCTCAGGCTCCCTTCCTTTCACGATGAAGTGAGGATGTGGGTATTTGAGGAGATTTTGCCGAGTGGGGAGAAACTCACCGATGTCATCAACAGTACCAATGAAAATGTTAAGTATCTCCCCGGAATTAAGCTTGGCAACAATGTCGTTGCAGACCCAGACCTCGAAAACGCAGTAAAGGATGCAAACATGTTGGTGTTCGTGACCCCGCATCAATTTGTGGAGGGGATATGCAAGAGGCTTGTTGGGAAGGTGAAGGAGGGTGTGGAGGCTATTTCGCTCATCAAGGGGATGGAGGTCAAAATGGAAGGGCCATGCATGATCTCGAGTCTGATCTCGGAGCAGCTTGGGATCAACTGCTGTGTTCTTATGGGAGCCAACATTGCGAATGAGATTGCTGTGGAAAAGTTCAGCGAAGCAACAGTGGGATATAGAGAGAACAGAGAGATTGCGGAGAAGTGGGTTAAACTTTTTAGCACTCCATACTTCATGGTCTCACCTGTCCAAGATGTGGAAGGTGTTGAATTATGTGGGACACTGAAGAATGTTGTGGCAATAGCAGCAGGTTTTGTAGACGGTTTGGAGATGGGAAACAACACAAAGGCTGCAATAATGAGGATTGGTCTGAGAGAGATGAAGGCCTTTTCGAAACTTTTGTTTCCGTCCGTCAAGGATACCACCTTCTTCGAGAGCTGTGGCGTGGCTGATCTCATTACAACTTGTTTGGGAGGAAGGAACAGGAAAGTCGCAGAGGCTTTTGCCAAGAATGGGGGGAAAAGGTCTTTCGATGAGCTTGAAGCAGAGATGCTGCAGGGACAGAAATTACAGGGCGTGTCCACGGCAAGAGAGCTTTACGAGGTTCTGAGCCACCGTGGGTGGCTAGAGCTGTTCCCACTGTTCGCAACAGTGCATGAGATAAGCAGCGGGCGTCTCCTGCCATCGGCCATCGTCGAGTACAATAGGTGA >DCAR_011275 ATGGCTCCAACCATTGAATCCCATCAAGAAAGCCACTCACTTGAGGCTGCTCAAGCTGTTTCTGTGCTTGATATCAATGCCCAGATTGAAGTGCCCTCAAGATCAAGAGTTACTGTGGTGGGGAGTGGCAATTGGGGAAGTGTGGCTGCTAAGCTTATTGCTTCCAACACTTTAAAGCTCGAGTCTTTTCATGATGAAGTGAGAATGTGGGTTTTTGAGGAGGTCTTGCCTTGTGGGCAGAAACTCTCTGAAGTCATCAACCAAACCAATGAAAATGTCAAGTATCTTCCTGGAATTAAGCTTGGTAATAATGTCATTGCAGTCCCAGACCTTGAAAATGCAGTAAGAGATGCAAACATGTTAGTATTTGTGACCCCACATCAGTTTATGGAGGGTATATGCAAAAGGCTTGTCGGAAAGATTTGTCAAAATGCCCAAGCAATTTCCCTCATCAAAGGGATGGAGGTTAAGAAGGAAGGTCCATGTATGATCTCTACCCTTATCCAGGAACAGCTCGGGATTAATTGTTGTGTTCTGATGGGGGCCAACATTGCTAATGAAATTGCTGTTGAGAAGTTTAGCGAAGCAACAGTTGGGTACAGAGACAATAAAGAGATTGCGGAGAAATGGGTTCAACTATTCAACACTAATTACTTCATGGTCTCAGCTGTTCAAGATGTGGAAGGAGTTGAACTATGTGGGACACTGAAAAATGTTGTGGCCATTGCAGCAGGTTTTGTGGATGGCCTTGAGATGGGAAATAATACAAAGGCTGCAATAATGAGAATCGGATTAAGAGAAATGAAGGCATTTTCTAAGCTGCTATTTTCCTCTGTTAAAGATAGCACCTTCTTCGAGAGCTGTGGTGTAGCTGATCTTATAACAACTTGCCTGGGGGGAAGAAACAGAAAATGTGCAGATGCTTTTGCTAGGAATGGTGGCAAAAGGTCTTTTGATGAGCTTGAAGCTGAGATGCTGCAAGGCCAGAAGCTCCAGGGTGTTTCCACGGCAAAAGAGGTCTATGAGGTTTTAAGCCACAGGGGGTGGTTAGAGTTGTTTCCTCTCTTCACGACGGTCCATGAGATCTGCAGTGGACGTCTTCCACCATCAGCAATTGTTGAATACAGCGAGCATGCACCAAAGTTATCACTACTGGGAGGCTCTGCTCAGATATACTGA >DCAR_021744 ATGGCTTCAAGTAAATCAAAAGTTGCAATTGTTGGCAGTGGTAATTGGGGCAGTGTTGCAGCCAAGCTCGTCGCCTCCAACACCCTCAAGCTTTCCTCTTTCCATGATGAAGTGAGAATGTGGGTATTCGAGGAGACTTTGCCAAGCGGAGAAAAACTCTCTGATGTTATCAACCAGAAGCACGAAAATGTGAAATATCTTCCTGGAATAAAGCTGGGTGAAAATGTTGTTGCTGACCCTGACGTTGTAAGTGCAGTGAAAGATGCAAATATGTTGGTTTTTGTAACACCACATCAATTTATTGATGGTATATGCAAAAAGCTAGCCGGAAATATAAGGCAGGACGCGGTAGGAATCTCCCTGATTAAAGGTATGGATCTAAAGCCAGAAGGTCCAAATATGGTGTCTAAACTCATCAAGGATAGCCTTCAAATTGACTGCTGTGTTTTAATGGGGGCCAACATTGCTAATGAGATTGCTGTGGAGCAGTTTAGTGAAGCAACAGTAGGATACGCAGAAAACAAACCGACTGCAGATGAATGGGTGCGGCTATTTAACACTAACTTTTTCTCTGTGTCAGCGGTTCAAGATGTGGAAGGAGTTGAACTATGTGGCACCCTGAAAAATGTTGTGGCTATAGCAGCAGGATTAGTGGATGGCCTAGAGTTAGGAAACAATACAAAGGCTGCAATAATGAGAATTGGCTTAAATGAAATGAGAGCCTTCTGCAAGATGCTGTTTCCCTCAGTTAGTGATGCGACCTTTTTCGAGAGCTGCGGTGTAGCTGATCTTGTAACCACTTGCTTGGGGGGGAGAAACAGGAAATGTGCTGAGGCATTTGCCAAGAATGGTGGCAAGAGATCCTTTGATGAGCTTGAAGCTGAAATGCTGCAGGGCCAGAAGTTACAGGGTGCATTAACAGCCAAGGAGGTTTATATTGTTCTAAGCCAAAGGGGATGTCTACAGATGTTTCCACTGTTCACTACAGTGTATCATATCTGCTCCGGCCGTCTTCCACCATCAGATATTGTCAGATACCGAGACCATGTGAACATTTCAGCCCTGTAG >THA.LOC104805357 ATGGCATCACACGTACGTTGTCGTCCCTTTCGACGTGTGTTCTCCATCTCCGTCTCTCGTGCGAATCCAGACATCCATGTCTCTCTCCTACTCTTCTCGACCCCTTCACGTTTTCTTCGTTTCTTCTCTTCTTATTCTCATCCTCGCCCCTTCTCTCGCTTCTCATCCCTCTCTGCTTCCTCCGCCATGGCTCCCGCCTTCGAGAAACGGCAACACGGAAATGGCGATTCGAAATATAGGGTTACGGTCGTGGGGAGTGGGAATTGGGGAAGTGTCGCTGCTAAGCTCGTTGCTTCCAATGCACTCAAGCTTCCTTCATGTCACGATGAAGTGAGGATGTGGGTGTTTGAGGAGGTTTTGCCAAATGGCGAGAAGCTTACTGATGTTATCAACAAGGCCCATGAAAACGTCAAATATCTCCCTGGGATTAAACTAGGAAGAAATGTCATTGCGGATCCAGACCTCGAAAACGCAGTGAAAGGAGCAAACATGTTGGTCTTTGTTACACCACATCAGTTCATGGATGGTATATGTAAGAGACTAAGGGGAAAGATAGATGGAGATGTCGAGGCAATATCTCTTGTTAAAGGGATGGAGGTGAAGAAGGAAGGCCCCCGTATGATCTCCAGTCTCATCTCCGAGCAACTCGGTATCAATTGCTGTGTTCTGATGGGAGCTAACATTGCAAACGAGATTGCCGTGGGGAAGTTCAGTGAAGCAACAGTTGGACATAGAGGGAGCATAGAAGTTGCAGACACATGGGTTCAGTTGTTTTCTGCTCCTTATTTCATGATAACGTCGGTTCACGATGTGGAAGGAGTAGAGTTGTGTGGTACCTTGAAGAATGTTGTGGCCTTAGCAGCGGGTTTTGTGGACGGGCTGGAAATGGGTAATAACACAAAGGCTGCAATCATGAGGATTGGTCTGAGAGAGATGAGAGCGATCTCAAAGCTTCTGTTTCCATCTGTGAAAGACAACACGTTCTTTGAGAGCTGCGGAGTCGCAGATGTCATCACAACATGCTTAGGAGGAAGAAACAGAAGAGTTGCTGAAGCATTTGCGCGAAATGGAGGAAAAAGGTCTTTTGATGAACTCGAAGCAGAGATGCTTCAAGGTCAAAAATTGCAGGGTGTCTCGACGGCGAGAGAGGTCCACGAGGTTCTGAGCCATAACGGGTGGCTCGAGCTGTTTCCACTTTTCACAACCGTCCACGAGATCTCCACAGGCCGGCTTCCACCAGCAGCCATCGTTAAATATAACGAACAGAAGCCTATTGGCTCCGTTTGA >THA.LOC104825312 ATGCGATTCCACTCATCCATCTCTCTCATTTTCTTCTCTTTCTCTTCACGTTCTCTCCGTCTCTTCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTTCTCTCGTCTCTCATCCTCTTCCGCATCCTCCGTCATGGCTCCCGCCTTCGAGAAGCGCCAACAAGGAAATGGCAACTGTGGTAATGGCGATTCGAAATCTAGGATTACGGTCGTCGGCAGTGGGAATTGGGGAAGTGTTGCCGCTAAGCTCATTGCTTCTAATGTCCTTAAGCTTCCATCATTTCATGATGAAGTGAGGATGTGGGTGTTCGAAGAGGTTCTACCAAATGGTGAGAAGCTTACTGATGTTATCAACAAGACCAAGGAAAACGTTAAGTATCTCCCTGGGATTAAACTAGGGAGAAATGTCATTGCAGATCCAGACCTCGAAAATGCAGTGAAAGAATCAAACATGCTGGTCTTTGTTACACCACATCAGTTCATGGATGGTATATGCAAGAGACTAAGGGGAAAAATAGATGGAGCTGTTGAGGCAATTTCTCTAATTAAAGGGATGGAGGTGAAGAAGGAAGGCCCCTGCATGATCTCCAGTCTGATCTCTGAGCAACTCGGTATCAGTTGCTGTGTCCTGATGGGGGCAAACATTGCAAACGAGATTGCGGTGGAGAAGTTCAGCGAAGCAACGGTTGGATACAGAGGGAGTAGAGAAATACCGGACAAATGGGTGCAGTTGTTTACTACTCCATATTTCATGGTAACAGCGGTTCACGATGTGGAAGGAGTCGAGTTGTGTGGGACTTTGAAGAATGTTGTGGCCTTAGCAGCGGGTTTTGTGGATGGGCTGGAAATGGGTAATAACACAAAGGCTGCTATTATGAGGATTGGCCTGAGAGAGATGAGAGCCTTCTCAAAGCTTCTGTTTCCATCTGTGAAGGACAGTACATTCTTCGAGAGCTGTGGGGTAGCAGATGTCATCACAACTTGCTTAGGAGGAAGAAACAGAAGAGTTGCTGAAGCATTTGCACGAAATGGAGGGAAAAGGTCTTTTGATGAACTTGAAGCAGAGATGTTACAGGGTCAAAAGTTACAGGGAGTCTCAACGGCGAGAGAGGTCTATGAGGTTCTGAGCCACCGTGGTTGGCTCGAGCATTTTCCACTTTTGTCAAGTGTCCATGAGATCTGCACTGGTCGGCTTCCCCCTTCGGCCATTGTTAACTATAACGATGAACACAAGCTCGGCTCCTACTGA >Brara.D01081 ATGCGAATCTGTTCCTCATTCTTCTCTATCTTCCTCCTTCCCTCTTCTCCTTCTCATTCTCTTACCTTTCTCTCGATTCTCCTCTCTCCGGTCTCCGCTATGTCTCATGCTAAATCCGGCGAAGACGCAAATGGTGAATGTCGTGATTCGAAATCTAGGGTTACCATCGTTGGAAGTGGAAGTTGGGGGAGCGTCGCTGCTAAGCTCGTCGCATCTAATGCCCTCAAGCTTCCTTCGTTTCATGATGAAGTGAGGATGTGGGTGTTTGAGGAAGTCCTACCAAATGGTGAGAAGCTCACTGATGCCATCAACAAGACCAATGAAAATGCTAATTACCTTCCCGGGATTAAGCTAGGAAGAAATGTTGTTGCGGATCCTGACCTTGAAAATGCAGTGAAGGAAGCAAACATGTTGGTTTTCGTTACACCGCATCAGTTCATGGATGGTATATGCAAGAAATTAAAGGGAAAGATAAAAGGAGAGGTTGAGGCTATATCCCTTGTCAAAGGAATGGAAGTGAAGAAGGAAGGTCCCTGTATGATCTCAAGTCTCATCTCCAAAGAACTCGGTATCAACTGTTGTGTTCTTATGGGCGCAAACATCGCAAACGAGATTGCTGTGGAGAAGTTTAGTGAAGCAACGGTGGGATATAGAGAGAGTAGAGAAATAGCTGACACCTGGGTTCAGTTGTTTAGTACTCCCTATTTTATGGTCACACCGGTCCATGATGTTGAAGGAGTAGAGTTGTGTGGGACATTGAAGAATGTAGTGGCTATTGCAGCAGGTTTCGTTGATGGTTTGGAAATGGGTAATAACACAAAGGCTGCAATCATGAGGATTGGTCTAAGAGAGATGAAAGCACTCTCCAAGCTTCTGTTTCCATCTGTTAAAGACAGTACTTTCTTCGAGAGCTGCGGTGTAGCAGATGTCATAACAACTTGCTTAGGAGGAAGAAACCGAAGAGTTGCAGAAGCATTTGCCCAAAGCGGAGGAAAAAGGTCTTTTGATGAGCTTGAAGCAGAGATGCTAGAAGGGCAAAAGCTACAGGGTGTTTCCACGGCAAGAGAGGTGTATGAGACTCTGAACCATTGTGGTAAGTTGGAGATGTTTCCGCTGTTTTCAACGGTTCACCAAATCTGCATAGGTCGTCTTAAACCTGATGCCATTGTTCATTACCGAAATTTTGGTCCAAATCCAAAGCTTTAG >Brara.G01487 ATGGCGGCTTATAGCATTGAAGAAGGCATAACAGTTACTACACGTACCCCTCCTTCTCCCCGTAACGTGTCCTCTCAAACCGGTTCCTATCTTCCATGCGAATCCGTTCCTCATTCTTCTCTATCTTCCTCCTTTCCTCTTCTCCCTCTCCTTCCTCCTCCTTCTTCTCCTCCTCTCGTTTCTCCTCTCTCTCCGCTATGTCTCCAGGCGCTAACGGTGATTTCAAATCCAGGGTTACGGTCGTGGGCAGTGGCAACTGGGGAAGCGTTGCTGCTAAGCTCATCGCTTCCAATGCCCTCAAGCTTCCTTCTTTCCATGTTTGTTATATCACAGGTGTTTGAGGAACTTCTGCCAAATGGTGAGAAGCTCACTGATGTAATCAACAAAACCAATGAAAATGTGAAGTATCTCCCTGGGATTAAGTTAGGAAGAAATGTTGTTGCAGATCCTGACCTTGAAAATGCAGTGAAGGAAGCAAACATGTTGGTTTTTGTTACGCCGCATCAGTTCATGGGTGGTATATGCAAGAAGCTTAAGGGAAAGGTAACGGGAGAGGTTGAGGCTATATCTCTTGTTAAAGGGATGGAAGTCAAGAAGGAAGGTCCCTGCATGATCTCTAGTCTCATCTCCAAGGAACTTGGTATCAACTCTTGTGTTCTTATGGGCGCAAACATCGCCAACGAGATTGCTGTGGAGAAGTTTAGCGAAGCAACGGTTGGATATAGAGAGAGTAGAGAAATAGCTGACACTTGGGTTCAGTTATTTAGTACTCCCTATTTTATGGTCACACCGGTTCATGATGTTGAAGGAGTAGAGTTGTGTGGGACCTTGAAGAATGTAGTGGCTATTGCAGCGGGTTTCGTTGATGGTTTGGAAATGGGTAATAACACAAAGGCTGCAATCATGAGGATTGGTTTAAGAGAGATGAGAGCACTCTCGAAGCTTCTGTTTCCATCTGTTAAAGACAGTACTTTCTTTGAGAGCTGCGGTGTAGCAGATGTCATAACAACTTGCTTAGGAGGAAGAAACCGAAGAGTTGCAGAAACATTTGCCCAAAGTGGAGGAAAAAGGTCTTTTGATGAGCTTGAAGCAGAGATGCTACAAGGGCAAAAGCTACAGGGTGTTTCCACGGCAAGAGAGGTCTACGAGGTCTTGAACCACTGTGGATGGCTGGAGATGTTTCCACTGTTTTCAACGGTTCACCAAATCTGCACAGGTCGTCTTAAACCTGAAGCCATCGTTCATTACCGTGACCACAAAGCCTGA >Cucsa.011050 ATGCACAGATGCGCTTTGTTTCTCACGAAACGTGTATGGCAACTCCGCCCCTTTGAGCCTTTTCAATCTCCAAATTTCTCTTTATATTCTATTTCTTCTTTCTCCCTTCTAATTCCCTCCACCCCTTCTTCCCCTTTTCTTTCTTCTTTTCTCCATTCTCTCTCTCCTTCTTCTTCCATGGCACCCGGAATCGAAGCTTTACAGCGTTCTTCAAATGGGGGTTCTGTTAGACCCGATTCCCATTTCTCCGATGATGGGGTTTCTTCCAAATTCAAAGTTACTGTCGTTGGCAGTGGTAATTGGGGTAGTGTTGCAGCCAAACTCATCGCTTCTAATGCCGCTAGGCTCAGCTCTTTCCATGATGAGGTTAGAATGTGGGTGTATGAGGAGACTTTGCCTACTGGTGAGAAGTTAACTGATGTTATCAATCTCAACAATGAGAATGTTAAGTATCTCCCTGGTATAAAGCTTGGGAAGAATGTTATAGCGGACCCAGACCTTGAAAATGCAGTGAAGGATGCTAATATGCTGGTGTTTGTTACTCCCCATCAATTTGTGGAGGGGATATGCAAGAGACTGGTTGGAAAGATAAGGGGAGATGTGGAAGCTATTTCCCTCATTAAAGGAATGGAGGTGAAGAAGGAAGGTCCATGCATGATTTCTTCCCTCATCTCTCAGGAATTGGGGATCAATTGTTGTGTTCTTATGGGAGCCAATATAGCAAACGAGATTGCTGTAGAGAAATTTAGTGAAGCAACAGTGGGATACAGGGAGAACATGAGAGAGATTGCTGAAAAATGGGTTCAACTTTTCACCACTCCCTATTTTGTTGTTACACCTGTCCAAGATGTTGAAGGTGTTGAGATGTGTGGAACCCTTAAAAATGTTGTGGCTTTAGCAGCAGGTTTTGTTGATGGTTTGGAGATGGGAAATAATACGAAGGCTGCAATTATGAGAATTGGTCTGAGGGAAATGAGAATGATTTCCAAGCTTCTGTTTTCATCCGTCAAGGATAGTACTTTCTTTGAGAGTTGTGGAGTAGCTGATTTGATTACAACGTGTTGTAAGGACACATTCTTCATTCTTTTTGTTCTTCATGTACTCTCTTTCTCTGTCTCATTCAGTAGAACTAATGTGTATTTGACAGTGGGAGGAAGAAACAGGAAGGTGGCAGCAGCTTTTGCCATGAATGGAGGAAAAAGGTCCTTTGATGAACTTGAAGCAGAGATGCTCCAGGGCCAAAAATTGCAGGGTGTGTCCACTGCAAAGGAGATGTATGAGGTTCTGAACCACCGTGGGTGGCTGGAGCTGTTTCCATTGTTTGCATCAGTCCACGAGATCTGTACTGGACATCTCTCACCGTCAGCCATAGTCGAGTATAGCGAGCGCAAACCCAACTTTTCTGTTATTGATGGTCATGCTCAGTAA