>PAB00023811 ATGGCCCACCCTTTGGAATCCTTGGAAGGCCAAGATCCGGGTGCTTCGGGGGCTTTTATATCCCAGTACCCATTACCATGCCGAACCAGGACTAGTACCTCCCTTGTTTCCAGTACCAGTACTCCTGATCAAGTGCTGCGTATTGTTTGTTCTGCCTCATCGCAAACCAGAGCTCTTTCTACAGGCCGTGGCTGGATCATATCGAGACTGTCATCTAACAAGGCAGGAATGCAAGCAATGGCAGCGAGGCCGGTGAGCTACGAGCAAGTGTTCTGGCAGTCCAGAGTTAGTGCTGCCTTCCGAACAGGATGGGCATGTCTCATGGTAGGGATCGTCATGCAGTACAGCAGCATGCATCGCCACTGGTTGGCGTTCCCTGTCTTTGCATATGTTATGGCCGTTACGGTCGTCGGGGAGGCCTCGTTCGGAGAAGCACTGCGATCTGCCTTCTCTGTTCTGGTGGGAACTCTGCATGGAGTCTTCCCCACGATCGCCACCCTCTGGTTCATAAAACCCCAGAGGTTTTCAGTGTGGACAACGACCGCCTGTGTTACTGTCAGCTGTTTTTCCATCGCCTATCCCAAAGTCACCAATATCACCTCCAAGCGAGTGGCATTTGCCCAGGTTGTTATCATTTACATCTCTGCGTTCATGATGAAGGAAACCATGGATGCAGTCACATACCCTCTGCGTATAGCTGGGAGTACTGCTCTTGGAGCAGGCTGTGCCTTACTGGCTTTGATTCTTCCTGTTCCAAAATTAGCTTGCTACCAGTTTCAAGAGAAAAGCAAGCTGTCTGCTCGCATAACCTCAGAGGTCTTAAGGCTTTTGGTTGAAGCCTTCAGTGCAGATGAATACGAGGATGCTAATTCATTACGCTTCCAGGCTAAGTCCTTGTCCACTGCAGGAGGCATCATTCTTAAGCAGGTGGAAGACAATCAGGTAGATTTAAAGTGGGAGCTGCCAGCATTGGGATGTTTGCCATCAGTTAGACTTTTAAGTAAAGAATATGGAAAACTGAAGCAATCTCTTGCAGGCATGGAAATGGCCCTGAAATTTTCGTCCCCGTCTCAAATCGGAGACACGACGCATGTGTTGCTGGCAGACCCATTACTCCATCTCACAACGTGGACAAGTCTGACTTTAAATCATGCGGGTTCAGCCTCCATCAGCACAAATCCCATGCAAGGACATATTGAATTCATCCTGGAACAAGGGAAAGAAGCATTAAAGTCATTCGACGAAGCCTTGGCAATTGTCATACAAAGAATCTGTGGTAACAACATGCAGAAGCCGTATACTAGTAAACCCACTAATCTTCCAATCCCTGGCCATGAATTGCGGTCAATTAACTCTGAAGAGTTGGATAAGGTAAGACAAGGTATCTTCAAATATCATCTGCCAACGTGCTTCTTTGCGTTCAGCATGAAGCATTTGTGTAAGGAAGCCATGGACATGTTGCGGCCTTGCGGTGAGAGGGTGCAGCAGATTGCTCCACTGAAACCTGAATCCGAATCCACAGAAGGGTCTAGCTATTGCCGCCAATGCGCGCTGCCTCTGAGATCTATATCTATTAACGTTGATGCCTTACAGGAAGAATCGTCACAGGTGAAGATGAAATCTAAACGTATATGGCAGTTTCTCTCCAAATGGATAAGCTGCGTAGATGCCAACAGACTACTCATAGCATTAAAATGCTCTCTATCTCTTGGCCTTTCAGTCTTGTTGGGGGTTTTATTCAGTCCCAAACGAGGGTACTGGGCTGGAATTGCAGTGGCTATCAGCATGGGCACTTCCAGAGAGGCAACCTTCAAACTTGCAAACGTTAGAGCTCAAGGTACTGTAGCAGGATCCGTGTATGCAGTAATCGCAAGCATTTTAACAGCAGAATCCATTCTTCTGAGAGCCGTGGCTCTTATACCATGGGTAATGTTTACCAGTTTTCTCAGACAGAGCAAGATGTATGGTTATGCAGGAGGACTGTCTGCCTTCATTGCAGCAGTCATCATTCTTGGGCGAAAGGATGTGGATCCGCCTTCAGAGTTTGCTATAGTAAGAATCACCGAGACTTTCATAGGGATAGGATGTTATATCCTCGTGGAACTCATGTTACAGCCAAGGAGAGCTTCAACCCTTGCTAGAAAAGAGTTAGTCGTCGGCATCTGTAGTCTCCGCGACTTTACCAGTTCATTGATTTCTGCTCAAACTCGCGAAGGTTGTGTGCACTCATATGCGTTGGCTCTACTAGAGCTCAAAGAGAAGGAGAAGAAATTAAAGGACCATATTTATCACTTAAAGAATTACATAGAAGAAGCAAAGGTCGAGCCAGACTTCTGGTTTCTGCCATTCCCAGCAACTACTTACTCAAAACTCCTGAACAGTTATTGCAAAATAGCAGACCTCTTGCATTTCGCTATGCTTTCCCACGAATACATTATTGAGAGCTGTGCCAGAAATGATATCTCAGTAGAGAGGATCTATGGCTTCATCGGGGATGATCTCCAAGCGTTTGAAAGTAGAGTCAGCGAAGCATTTCAATGCTTTGCAGAAATACTCCGAGTGAAATCTCTCAGAAAACTTATTATGCAGAGCCGACATATCGAAGACAGCAGATCGGACAACCTTCAATCGAGTACTGGATCGGCCTCAGTTCATGATCACAGTAGTGTTCGTGGGATCGATACAAACAAAGGGCAGCAGCCCAATTCAGATTATCATTCCGTTTTTGTAGGCCAGAACTCATATAACATTGCAGGTGATGAGGATATTACGCATTCCCTTATTAAAAGTGTGCAAGAAGTGGTGACTGATATTCTGCGCCTTCAGGACGACATTAGCTCCAGAAACGATTTTGTTATTTCCATAAGTTCTCTGGCCTTCTGCCTGGAGAATATAATGAATGAGTCAAAGGAGATTGAGAAAGCCATTCATGAGCTCCTTCAGTGGGAGAATCCTTGGAGTCTTATAGACTTGTGGGAAATATACGATATGATAAATGGCGGTGGTCAGATTCTCTGA >PAB00032470 ATGGCAGCGAGGTCGGTGAGCTACGAGAAAATATTCTGGTTGTCCAGAGTCGGTGCTGCGTTTCGGACTGGATTGGCCTGTCTCTTGGTGGGGATCGTCATGCAGTACAGCAGCATGCACCACCACTGGTTACCACTCCCTGTCTTTGCATATATCATGGCAGTTACGGTAGTCGGAGAGGCCACGCTCGGAGAAGCCCTGCGATCTGCTGTCTCTGTTCTGTGGGGAACTGTGCATGGAGTCTGCCCTACGATCGCTATCCTCTGGTTGATAAAACCCCAGAGGTTTTCAGTATGGGTAACGACCGCGTGTGTTACGGTCAGCTGTTTTTTCATCGCCTATCCTAAAGTCACTAATATCACGTCCAAGCGAGCGGCGTTTGCCCAGGTTGTTGTCATCTATGTTTTTGCGTTTATGGAGAGGGAAAGTATGGATGCACTCACTTACCCTCTGAGTATAGCAGGAACTACTGCTCTTGGTACCTGCTGCGCCTTACTTGCTTTGGTCCTTCCAATTCCAAGACTAGCCTGCTCCCAGATTCAAGAAAAAAGTAAGCTGTCTGCTCGCATAATATCAGATGTTTTCACCGTTTTGGTAGAAGCTTTTAATGCTGATGAATACGAGAAAGCTAATTCACTATGCTTCCAAGCTAGGTCCTTGTCGACTGTGGGGGGCAGCATTCTTAAGCAACTGGAAGACAAACAGGTAGACTTAAAGTGGGAGCTTCGATCATTAGGATGCTTACCTTCAGTGAGAGTTTTAAGCAAAGAATATGGCAAACTGAAGCAATATCTTGCAGGCATGGAAATGGCCCTAAAATCATCGTCCCCATCACAAATCGGAGACGCAACGCATGTGCTGCTAAAAGATCCATTACTCTATCTCACAAAGTGGACAAGTCTGGCTTTAAAGCATGCGGCTTGTGCTACCATGAGCACAAATCCGATGCTAGCTAGCAATGAATTCATCCTGGAACAAGGGAAAAAAGCCTTGAACTCATTCGATGAATCTCTGGCATTTGTCTTACAAAGCATCTATTGTACCAATATGCAGAAGCTGTATACAAGTAAACCCGGTAGTCCTATAATCCCAGATCATGAATGTCGGTTTAATAACTCTGAAGACCGGGGGATGCAAGGTGCGTTCAAACATTATCAGCCAACGTTCTTCTTCGTGTTCAGTATGAAGCATGTTTGTAAAGAAGCCAGAAACATGTTGCTTCATTATTTGGCCCCTTCTGCTGAGAGACTGCAGCAGATTGCTAAACGGAACCCCGACTCCGAATCCACAGAAGGGCTTAATCATTGCCACCAATGCGCGTTGCCTCTGAGAACTATATCTGTCAGAGTTGATGCGTTACAGGAAGAGTCATCACAGGTGGTGGCCAAATCTAAACATACATGGCAGTTTCTCTGCAAATTGATAAGCCACCTAGATACCAACAGAGTAGTTATAGCATTGAAATGTTCTTTATCTCTTGGTATTTCAATCTTGTTCGGGGTTATATTCAGTCACCACAGAGGGTATAGGGCTGGAATTGTAGTTGCTATCAACAGGGGCTCTTCCAGAGAGTCAACCTTCAAATGTGCAAATGTTAGAACTCAAGGTACCGTGGCAGGATCTGTCTATGCAGTAATTGTGAGCAATTTAACGGAAGAATGCATTCTTCTGCGAGCCGTTGCACTTATACCATGGGTGAAGCAACAAATAGCTCGGCTGGAACATAACGAAGACAGAAGACCGCAGAACCTTCAATCAAGTGCTGGATCGGCCTCAGTTCAAGATCAGAATGGTGTTCGTGGGATCGATACAAACAATGAGCAACAGCCCAATTCAAATTATCATTCCGTTTTAATAGGACAGAACTCATACAACATTTCAGGTGATGAGCATATTACACGTTCCCTTATTAAAAGTGTGCAGGAGGTGGTGACATATATTCTGTGCCTTGTTGACCAGGAAGAGATCAGCTCCGGTAATGATTTTGTTATTTCCTTGAGTGTTCTTGCCTTCTGCCTCGAGGATGTAATGAAGGAGTCAAGGGAGATCGAGAAAGCCATTCATGAACTCCTGCAATGGGAGAATCCTTGGAGTCTTATAGACTTGCGGGAAATATACGAAACATTAAATAGATGA >PAB00058771 ATGTTGCTTCATTATTCGACCCCTTCTACTGAGAGACTGCAGCAGATTGCTACACGGAAGCCCGACTCCGAATCCACAGAAGGGCTTAATCATTGCCACCAATGCGCGTTGCCTCTGAGAACTATATCTGTCAGAGTTGATGCATTACAGGAAGAGTCATCACAGGTGGTGGCCAAATATAAACATATATGGCAGTTTCTCTGCAAATTGATAAACCACCTAGATACCAACAGAGTAGTTATAGCATTAAAATGTTCTTTATCTCTTGGTATTTCAGTCTCGTTCGGGGTTTTATTCAATCACCACAGAGGGTATAGGACTGGAATTGCAGTTGCTATCAGCATGGGCTCTTCTAGAGAGTCAACCTTCAAAATTGCGAACGTTAGAACTCAAGGTACCATGGCAGGATCCGTCTATGCAGTAATCGCGAGCAGTGTAATGGAAGAATGCATTATTCTGCGAGCCGTTGCACTTATACCATGGGTGGTATTTACCAATTTTCTCAGACAGAGCAAAATGTATGGTTATGCAGGAGGACTGTCTTCCTTCATTGCAGCAGTCGTCATTCTTGGACAAAAGGATTTCGGGCCGCCTTCAGAGTTTTCTATATCCCTTAATGAGATTCGAAATAGTTGCGCGAATCCAAATGATGCCATGAAATTTCTTGGGAAATGGCTTCTTCACGTCAGTCGCTCGAATGTAATGCCTCTTTGGTTGCATGCATTAGGGTTTCATGTGGACGTGAGGCAAATTAGGGTTTTGATTAGAGATCTATGTGCATTGAAGAAAGCCAAGAGTCGTTACTCTAAAAACCTTGTCCAGACTAGCAGAAAAGAGGTCAGAAACGAGCTCAAGAAGACCATTCACCAAGTGCTCGTTGGTGGTGGTGCAGAACGTGGAGG >SMO199G0110 ATGGACGCGTTAGCTTCCGACAGCGTCCCGTGGCTGTCACGGCTGCTATCCGCTCTAAGAACTGGAATTGCATGCTTACTTGTCTTGCTTGGTGTGTCCAAAGCCAGCCGTTTTGTTGAATTCCCTGTCTTTGGATACGTTGTCACAGTTCTCGTGCTCAGCGAGTCGGCACTCGGCAAAGCTCTCGAAGATGCTGCCTTTGTCATGTATGGAACTCTCCAGGCTGCTGCATTCTCGATGGTGGTGCTGTTGATCATAGGAACGAAGAACTTCTCGCTCGGCGTGTGCCTCACTTGTATCTTCGTCAAGAGCTTCCTGTGGAGCTATCTCCCGAACCAAAAGCCAGTGAAGAAGAGGCTCGCGCTGGCTATCACCACCATCGTCTACGTGAATGCGTACAACAATCCCCTGACTCATCCGGTCTTCTTTCCGCTCAAGTTGACGCTCACCACCACGCTCGGCACTGTGTCTGCGATAATTGCCTTGATATTCCCCGTGCCACGCCTCTCAGCTTATCAGGTGCAATATAACACGAAGCTCTTCGCCAAGCTCGCGATGGAAAACTTTGCTGTCCTTGTCCATGCATTCTGCAGTAACGACCAAGAAGAGATCACGAGTTTGTGCCTGCAATCCAAATCAGTGCAGCGAGCTGCTTTGAAAGCGTACTCGGAGATACAGAGAAGAAAAGTTGAAATAGCTTGGGAGCCTGGGGTTTTGGTTCAAGCAAGGAGTCAAGGTGAAAACGTGAGCCGAATGATAACCAACATGAATCAGTACCTGATTGGGATGAACATCGCGATTCAGCAAGGTGCAGCTGTTTCGAAGCCGGTTCAAGATATGACGAGGAACTCCTTGGAGAAACTCGGGAGCTGGAGCAACTCTTTTCTGTCAGGTACAGTCTCTAGTTTTCCAAAATCTCAAATCCAGGCCGAGAAGCAAGTCCGGATTGAGGAAGTTCGCGAAGCTCTGCTGACTCTTCATGATTATGCCGCGGCTACTTGGAACCGCTCAGACTGTACACCGGATGAGGAATTTCGACGGATGTTTTTCCTGTTCACTGTCAAAAAGTTTGTCGAGGAGGAGATCAAGATTCTGATGGCCGGCCAAGTTCCTGTTGCTTTGTCACATCCTGCTTGCCACCACGGTTGCAAAGCAGCAGCAATTTCAAGCGGATCAGCTCTCCCAGTTCACTCATCAAACACCACTCCAAGTAACTTAGTCGCAGCAACGAGGAGATCATTGAATCTGGCAGCGAATAAAAAAATGGTCATTGAGGCGTTTAAGATCGCACTATCAATGGTCATAGCTGTGTACCTGGGAGTGCTGTACAGGAAGGACTATGGGTACTGGTCGACTATCACAGTAGCATTGGGCCTTTTCAACCATCGCACCGGAACGTTCAAGAGCACCAGCCTGAGGCTCCAAGGTACAGCCCTGGGAACAGTATATGGCTATCTGGTCGCATTGACAACACATCAAGCTCTACTTACCACCATTTTTGCAATATTGCCTTGGCTGGCCTTTACGAGCTTCATGAGAAAGAGCAAACTGCTGGAACTCACTGGAGCATCCACGGCTTACACCTCGGCTGTGATATTTGACGTGCACAGCATAGAATGCAGTGAGTGCTTTAAAGCAGCGATACCTGAGGTGAGAAAGAAGGAGCAAACAATCAGAGATGGAGTCGAACGTCTGAGACAACTTACAGCTGAAGCAAGAGCAGAGCCTGACTTCTGGCACGCACCGTTTCATGACGGTATCTATAGCAAGCTCTGGGAGAGTCAGAGTAGGATCACGGAGCTCTTGAGTTACCTGAGCCTCGCAACAGTCGACTTCCGGTCAGAAGGCAAACTGTTCACTGGTGGTGTCACTCGCCAACTAAAGATAAGCCAAATTGGCCTCTCAAAAACTTTCGAGTGCACTTATCAGTCCCTGCGCCAAAAAAGAAGCAAGGTCCAGCATACTGCAGACATAGAGAATCAGTTCGAAGAGTCTAGCATCAAAGACGACGTCGACACCTCAACTCCAGAAGAAATCTACGGAGATTTCCAGCTAGTGCATTCGGAAGCCGCGTTGACGATTGGAGCAATCGGCTTTTGCTGCCACGAGCTTCTAAAACAAGCCACGTATCTCAAAAAGCTGACGCAAGAGCTGCTACTGCAGGAAGAAGAAGAATCGCAAAGTTAG >SMO340G0081 ATGTGGAAGTCCCGTCTCCTCTCCTCGGCAAGAACAGGGGTGGCATGTCTCATCGCCGCTTTGCTGCTGCAGTACGCGCACGGCTATGTCAAATGGACGTCATTCCCGGCATTCTCCTTCATCCTCTCCTTCGTCATCGTGAGCGAATGCCCCTCGCTCGCAAAGGTGATGAGAGATTCATGGTCTGTGCTCTTCGGCGGGATCCAGGGGCTCAGCCTGGGAATGCTCGCGATCAATCTCTTGGGGCCGAGCGTGTCCATCTGGACGAGCCTCATGTTCATCTTCTGGAGCAGTATGGTGATCGCCTACCCGTCTTTCTCCAATCTTCTCACCAAGAGGGTTGCGCTCACCGTCGCGACCCACCTCCATGTCATTGCGTACGCGAGGCAGCAAGACATGGACAGGATATTCTACCCCTTGAAGCTGGGCGCGACGATGGTGCTGGGCCTGGCGTGCTCCATCCTCGCTCTCACTTTTCCCTTCCCAAAGTTCGCGTCCGTTAAGGCGAGGCAGCAGCTGATTCAATCCATCGAGATCATTTCGCAAGCGTTCGACGCACTGCTGACGATGTTCTGTACTCGGGAGAGATTTCAAAGGCAGTCCTTGAGATTCCAGGCGAAATCTCTCATGGAGGCAGGATCCAAAGTCATCCTCGAAGTCCACAACACAGACTGCTTTCTTCCGTTTGCGGTCAAAGCCAAGTCCAACTACGAGAAACAGGTCAACAAGCTCATGCAACATGTCAAAGCAATGGAGCTGGCCATGAACTCGAGCTCTTGCTCCGACCAGGAGCTCTCGGACTCTGCCAAGGCCTCGCTCGAGGAGACCATGTCACAAGTAAGAGAGTGGAGCAAATCCTTCGCCGCAAAGATGAATCATCCATCTGGCAAGGAGAGCGTGGACTCGGACAAGCTCCTGAAAGACGGAAAGGAGATCATGAGCCAAGCTCTCGAGACCGCGCTCTCGCTCCAAGATCCCTCACAACTCCAAGCGCAGATTTGCGGCCTGTCCTTCGCACACAATGCGAGGCTTTTCCTCGCGGAAGCCACCACCATGCTACAGACCACACCGAATCTAAGCAAGGTCCGGTCAACGCTCGACACTCCCGAGTCAACACCGGTCAGCGCGAGTCCGTGCTGCAAGCTAATTAGTAGCGTGGATCCAATCGAGGAGAGCAAAAGTGAGAAAGAGACCGAGTTTCACTGGGGGTTTTTCAGCCAAATTCTCAAGCTCTACGACCGGGAGCGATTCATCGTGGCGCTCAAGATCTCGCTGGCTATGGTGCTCGGCTCCTACGCGGGCTCCACGTACAACCGCTACCACATCAACTGGACGACGCTGATAATCGGGATGGGCTTCAACGCCCACCGCGACGGCTCCTTCCGCGTCTCGGACCTCCGCTTGCACGGGATGGTGCTCGGCACCATCTTCGGCTACCTCGTCTCGTTCTACACGCAGAGCTCCAGTCCCATCTTCTCCATCGTCGCGCTCGCCGGATGGATCGTCTTCACCAGCTTCATGAAGCACAACCGCTTCTACGGTCCCCTTGGTAACGTCTCGGCGCTCATCGGCGCCATCTTCCTCGTCGGCCACCGCAAGAGAGTCCCGCTCGACAGCCTCGCCATGCTCCGGCTCACGCAGAGCTTCATCGGCATTGCTGCTTTCGTGGTCGTCGAGTACCTCGTCTTCCCGAGAAAGGTGTCGGTTCTCGCAAAGTCGACGCTGGCGGCGGGGCTGGCGGCGCTGGAGCGGTGCGCGAAGACGGTGGTCAGTGCTGGTGTTGACGTTGCGCGGTGCTGCTGCGAGAGGTGCCAGGGGTCCGCGCTGGAGGAGCTTGGGCAGGCGAGGCAGGAGGCGAGCTCCATCGCGCAGAAGCTGGGCGTGCTGGTGCAGGAGGCGGCGCTGGAGCCCTGCTGGACCGACCCGTTCCAGGAGAAGGCCTACGCCAAAATCTTGAGCTCCCATGCCAGGATCCTCGATCTGCTGCAAGCGCTCGTCATGTCCATCCTGGAGCTGAGGTCCAGAAGGCTGCCCTGGTGCTGCAAGACACTCCAGGACCTCCAGGCTCCTTGCTTTGGCCCCGTGTTGGTACGGTTAGATACTGCTGGAGGTGGCGGAGACGTTGAGAGCCAGTCCGCGAGCGTAGATCTCGTCGACGTCGACTGCTGGAGCTCGTCAGTGGTTGATGCGTGCCGGTCCAGGTTCCAGGAGGTGATGGCGACGGCGGGCGATGACCGGAACTGGGAAGATACTGTCGTGTTTGGCGCCTTCATCTTCAACGCTCAAGCGCTGGCGATGGAATTTGCCAAGATCGAGCGGAACGTTCTCAAGCTGATGTCACTGGACGAGAAATAG >SMO340G0115 ATGGCGGGAGCTATGGAATTGGACATCTGGAAATCCCGCCTTCACTCCTCCGCAAGAACAGGCCTGGCTTGTCTCATCGCGGCTGTGCTCCTCGAATACGCTCATGGCTACGTCAAGTGGACCTCCTTCCCGGCATTCTCTTTCGTTCTCTCGTTTGTCCTCCTCAGCGAATGCCCGTCGCTGGAAATGGTGATCCGAGACTCGTGGTCGGTGATCCTGGGTGCCATCCAAGGCCTCGTTCTGGGAATGTTCGTGATCAATCTCTTGGGCCCAACCGTGTCGATCTGGACGAGCCTCTTGTGTATCTTTTGGAGCAGCATGGTGGTGGCGTATCCATCTTTCTCCAGTCTTCTCACCAAGAGGATTGCGCTCACCGCCGTCACACACCTCCATGTAGTCGCGTACGCGAGGCAGGAAAGCATGGACAGGATATTCTACCCCCTGAAGCTGGGGGCGACGATGATGCTCAGTGTCTCGTGCTGTCTTGTCGCTCTCACTTTTCCCGTGCCAAAGCTTGCGTCCACCAAGGTGAAGCAGCAGATCGTCCAATCCACCCGAGTGATCTCTCGAGCTTTTGATGCTCTACTTGCAAGTTTCTGTACCATGGAAAGATGTGGATGCCATTCTTTGAGATTCCAGTCGAAGTCTCTTGTTGAGGCTGGATCCAAACTTGTGTCGGATATACCACGCCTGGAATGCGCGCTTTTCTTCAAAGCCAAAGCTTTTGGAATCTCTGGAAAGAGGCTTGATAAGCTCATGCTGCACTTGAAAGCAATGGAGATGGCCAAGGTTATCTCCATTGATCATGCAACCATAGTCTTGCTGGAGGATCCATTCACTCGGATAAGAGAATGGAGCAAATTGGTCTTAATGGCACCAGGGGGAACTGGAAACGATAAGCTCCTGGAGGATGGGACAGACATCATCGGCAGCTTGAATGAAGCTCTAGAGATTGCAGTTGGGTCTTTCGATACCAAAGATCCTTCGCAGCTCGAGGCTCATTTCTCGTGCCTTTTCTTCGTCCAAAATATGAGACTCTTCCTCGGCGCGCTAAAAGGTGGCACCTCAAAACCAGCACGGTCAATGCAAGATTTAAAGAGGGTCAACGGTAGTCAATGCCAGCCTTGCAAAGGAGAGATCGATCATATCACGAATGATAGCAACGATAAACGCACGATCTCAAGATGGCTCCTTGATCTCTACGACCGGGAGCAATTCATTCTCGCGCTCAAGATCTCACTCGCAATGGTCCTGGGAGCGTTTGCCGGATTCATGTACGATCGAAGCCACACCATCTGGACAACGCTGATAATCGGGATGGGATTTAACGCTCGCCGGGATGCCTCCCTGCGAATCTCAGACATACGCTTGCACGGAGTGGTGCTGGGAACGCTCTACGGTTACCTGGTCTCCTTCTACACGCTCAGATATCCAGCCATGATCTCCATCGTCGCCCTGGCAGCATGGATCGTCTTCACGAGCTTCATGAAACACAGTCGGCTCTACGGGCCGCTGGGGAACGTCTCCGCCTTGATTGGCGCAATCTTTCTCGTGGGTCATCGCAAGAGAGTTCCTCTCGACCGGCTCGCCATGCTTCGGATGGCCGAGACTTTCCTGGGCATCGCAGCCTTCGTCGCCGTTGACTATCTAATCCTTCCAAGGCGAAACTCATCGGCTATGGCGAGAGCCAAAGCTACCGCGAGCGCGGACAAAATCAAGCGGTGCACGAGAGCAGCGGTCAGCGCGTGCGCTGACTGCGAGGACGGGTCAACGATGGAGGGAGCTGAACGGGATGCGGGTCTGGCGGTGGCGGAATTGGAAGCGCTTGTGGAGGAGATGAAGATGGAGCCCTGTGGAATGCATGATCTGCTAGAGGAGCGAGCGTTTACCAAGATCGTGAGATCTCAAAAGAGGATCCTCGGCTTGCTACAAACGCTTGTGATTTTCGCCCTGGAGCTTCGGAGAATCTCGGGATGCGAGCACCTCCAGCTGTCCACGCTAGATTTGCTGACGCTCAAAGAGGGTGGCGGCGACGTGGAAGACCAGTCTAAAGATGGCATTGACTTAGTTGACTCGTGTAGAACAAAGTTTCTGCTGGGCAGAAGGACAGGGAGCTGGGAAGAAATCCTTGTCTCTGGGGCACTGGCATTCAATGTCCAGGAACTTCTGCTAGAGGTTTCAAAGATGGAGAGAAACATTCTCAAGTTGGTGAAGACAGGAAATGTTAAATTTATTTAA >SMO361G0017 ATGGACGCGTTAGCTTCCGACAGCGTCCCATGGCTGTCACGGCTGCTATCCGCTCTAAGAACTGGAATTGCATGCTTACTTGTCTTGCTTGGTGTGTCCAAAGCCAGCCGTTTTGTTGAATTCCCCGTCTTTGGATATGTTGTCACAGTTCTCGTGCTCAGCGAGTCGGCACTCGGCAAAGCTCTCGAAGATGCTGCCTTTGTCATGTATGGAACTCTCCAGGCTGCTGCATTCTCGATGGTGGTGCTGTCGATCATAGGAACGAAGAACTTCTCGCTCGGCGTGTGCCTCACTTGTATCTTCGTCAAGAGCTTCCTGTGGAGCTATCTCCCGAACCAAAAGCCAGTGAAGAAGAGGCTCGCGCTGGCCATCACCACCATCGTCTACGTGAATGCGTACAACAATCCCCTGACTCATCCGGTCTTCTTTCCGCTCAAGTTGACGCTCACCACCACGCTCGGCACTGTGTCTGCGATAATTGCCTTGATATTCCCCGTGCCACGCCTCTCAGCTTATCAGGTGCAATATAACACGAAGCTCTTCGCCAAGCTCGCGATGGAAAACTTTGCTGTCCTTGTCCATGCATTCTGCAGTAACGACCAAGAAGAGATCACGAGTTTGTGCCTGCAATCCAAATCAGTGCAGCGAGCTGCTTTGAAAGCGTACTCGGAGATACAGAGAAGAAAAGTTGAAACAGCTTGGGAGCCTGGGGTTTTGGTTCAAGCAAGGAGTCAAGGTGAAAACGTGAGCCGAATGATAACCAACATGAATCAGTACCTGATTGGGATGAACATCGCGATTCAGCAAGGTGCAGCTGTTTCGAAGCTGGTTCAAGATATGACGAGGAACTCCTTGGAGAAACTCGGGAGCTGGAGCAACTCTTTTCTGTCAGGTACAATCTCTAGTTTTCCAAAATCTCAAATCCAGGCCGAGAAGCAAGTCCGGATTGAGGAAGTTCGCGAAGCTCTGCTGACTCTTCATGATTATGCCGCGGCTACTTGGAACCGCTCAGACTGTACACCGGATGAGGAATTTCGACGGATGTTTTTCCTGTTCACTGTCAAAAAGTTTGTCGAGGAGGAGATCAAGATTCTGATGGCCGGCCAAGTTCCTGTTGCTTTGTCACATCCTGCTTGCCACCACGGTTGCAAAGCAGCAGCAATTTCAAGCGGATCAGCTCTCCCAGTTCACTCATCAAACACCACTCCAAGTAACTTAGTCGCAGCAACGAGGAGATCATTGAATCTGGCAGCGAATAAGAAAATGGTCATTGAGGCATTTAAGATCGCACTATCAATGGTCATAGCTGTGTACCTGGGAGTGCTGTACAGGAAGGACTATGGGTACTGGTCGACTATCACAGTAGCATTGGGCCTTTTCAACCATCGCACCGGAACGTTCAAGAGCACCAGCCTGAGGCTCCAAGGTACAGCCCTGGGAACAGTATATGGTTATCTGGTCGCATTGACAACACATCAAGCTCTACTTACCACCATTTTTGCAATATTGCCTTGGCTGGCCTTTACGAGCTTCATGAGAAAGAGCAAACTGCTGGAACTCACTGGAGCATCCACGGCTTACACCTCGGCTGTCATCATCGTCGGAAGAAGGCGACCCGGAATTGTTCAAGACTTTGCGGTTCTTCGCATGGCAATGGCTGTTCTTGGCCTGGGGGCTTTTATGGCCGTTGAGGCACTCATCTGTTCCAGGAGAGCAGCGAGACTTGCACGCAGGGAACTCGAGCTTAACTTGAAGAAAATCCAGGAATGCATGCAGGTGATATTTGACGTGCACAGCATAGAATGCAGTGAGTGCTTTAAAGCAGCGATACCTGAGGTGAGAAAGAAGGAGCAAACAATCAGAGATGGAGTCGAACGTCTGAGACAACTTACAGCTGAAGCAAGAGCAGAGCCTGACTTCTGGCACGCACCGTTTCATGACGGTATCTATAGCAAGCTCTGGGAGAGTCAGAGTAGGATAACGGAGCTCTTGAGTTACCTGAGCCTCGCAACAGTCGACTTCCGGTCAGAAGGCAAACTGTTCACTGGGGGTGTCACTCGCCAACTAAAGATAAGCCAAATTGGCCTCTCAAAAACTTTCGAGTGCACTTATCAGTCCCTGCGGCAAAAAAGAAGCAAGGCCCAGCATACTGCAGACATAGAGAATCAGTTCGAAGAGTCTAGCATCAAAGACGACGCCGACACCTCACCCCCAGAAGAAATCTACAGAGATTTCCAGCTAGTGCATTCGGAAGCCGCGTTGACGATTGGAGCAATCGGCTTTTGCTGCCACGAGCTTCTAAAACAAGCCACGTATCTCAAAAAGCTGACGCAAGAGCTGCTACTGCAGGAAGAAGAAGAATCGCAGAGTTAG >Pbr017673.1.g ATGGTTCCGGCCAGCAGGACGAGCTGGACCTGTGCCGTGTGGTGCCTAAGGCTGCGCTCAGCATTTCAAACCATCTTAGCCTGCACCATAGTCTACACCACCACTCTCTACGGTCCACAGCCTCTCAGGCGTTTAGTAGCTTACCCTGGATACTCTTACCTCACCACAATCCTCATCCTCTCAGACGCGACACTTGGGGAGGCGCTGAGAGGCTTCTGGCACGCGCTTTATGGTTGTATTCAGGTCCTGATCCTTACACTCCTGAGCCTCCGGCTGATAGGACCCGCACACTTCAGTTATTTCGTATCCGCCCTTGCAGTGGCACTGTGCACTTTTGTTGTGGCACTGCCGGGAGCAACTCATTTGATGTCTAAGCGGATTGCGTTTGGTCAGATTGTGATTGTGTATGTAGGCACTGCCATTCATTGTGCAGAAGCTGATGAGTTGGTACTTATGCGCCCGATTCAGGTGTGTTTGAGTACTGTGCTTGGAGCTTCGGCATCTGTTGGGGCTATGTTGTTTCCCAACTTGTTCTTCTACCGAAAGCCATCTCTGGCAGCTGTGTTGTCTCCTTACCTTGCCTACCACGAGGTATATATACATCTACACACACACACACACACACACATACATACAACATGTGTTGTGAGACAAATGTGCCAAAAATATGCCGAGAACGCTAGGAAGAGGTTCAACTTCTATTTAGATGCAATCTTGTCTCAAGACAGCTCTGCTGCACTTGACTTTATTTTACAGGCCAAACCCTTGGCTGAAGCAGGAGAAAAGCTCCTCCGAAGTATCGAACATAAACAGGAAGCCTTACTGTGGGAAAGACCAACAATCAGAAATATCCTCAACCCTAGTCGCTTCTATGTTCGAGAAAAATTGCAGGAAGTTGAAATACCCTTGAGAGGGATTGCAATAGCTTCAACTTCATGCCCTTCCTTTCCTGTTGCCATGATGAAGAAACTGCAAGCGGACGCTTTACACGACCTGAAAAGGCGAATACATGACCAGCTTGAGCAGTTCGAGCGCTTTGCACCTTTCTACACAAGAAAGAAAAAGGAAAGATCTTTGAAAGAGGCCTTCTGGCCCCTTGAAACCATTTTTCATGAAGATTTATTGGCTTTCTTTTTCGTTGATTGTCTGAAACTCCTCCAAGAAAATACCGAGGCTATTGAAGAATGCAAGCGAGAGAGCTCTTACACTGAAAGCTCAGGCGGTTCACAAATCAAATGGAGCTGTGACATTTTGTGCATTAAACCAAGCAAAACAAGTCTATATTTTGCAGTTAAGTGCTCACTTACATTAGGCCTTGCTGTGCTGTTGGGTTTGCTGTTCAATGAGAGAGAAGCATGTTGGGCAGGACTAATAATTGCAATAAGCTTTGTTAGGGGAAGACAAGCAACATTTACTGTAGCAAATGCTAGAGCACAATCTACGGCAATGGGATCAATCTACGGGATCTTGTGTTGCTTCATCTTCAAGGAAGTCGAGGACTTGAGTTTCTTATCTCTTCTACCTTGGTTAGTTTTCACAAGCTTTCTAAGGCACAGCAGGATGTATGGCCAAGCCGGTGGAATATCAGCAGCTGTAGGGGCACTACTAATACTTGGCAGGAAAGATTATGGCCCTCCGATCGATTTTGCAATTGCTCGAATCACAGGGGCTGTCATTGGATTGATATGTTTCGTCACCATAGAGATTCTCACATCCCCTGCAAGAGCAGCAACTCTGGCAAAACTCAAACTTTCACTTGGATTGGGTTCCCTTCAAGAATGCATCGAAGATTTAGTTCTTTTCGACAACCAAATCGCTTCAATGAGTCCAAAGTTGAGAAAGAAACAGAGCAAGTTGAAATCCCATGTCAAAAAGTTAGAGAAGTTCATTGAAGAAGCTCAGCTGGAGCCTAATTTCTGGTTCATCCCTTTCAACGGTGCCTGTTATGGCAAGCTCCTGAGATCTTTATCAAACATGGAGAATCTTTCGCTTTTCATGTCCAACATAATAGAATCTCTATCACTCATATTACAGTGCTTCGACCTTGATTTGGAAGAACTCCGAAAACCCATGAAGGGCCTTGAGAAAGATTTGAAGATTTTCAAGAAAAAATTTGGGAAATCTCTGCACTGTCTTCAAGAACTGGCTTCCAAGAAGTCTGTTGCAGTTCATAACAAACATGACATTGAGTTTGGAACATCAGCAAGGGAAAATGATTCTAGGGGTTTGGATTCAGAGAAGGAAGAGACTGAAAGCATTGTAAACTCTTTTCTTCAAAATTCCAATGAATTATCCTCAAAAATTGCCGCCATGACTGGATTAATAGAGGATCATCAGAAGCTTAGAGGGCAAGTAACTGTTTGTTTGGGTGGATTAGGGTTTTGCATCAGCAGTCTGCTGAGGGAAGTAAAAGAGATGGAGAAAGAGTTTCAAGAACTTATCAAATTGGAACACCCTTCAAGCCATGTAATTGTATGA >Pbr017681.1.g ATGCGCCTAGGCTCCGCCCTTCGCACGGCTTTGGCATGCACCATTGTCGACTGCACCGTCCTCTATGGACCTCCACAACTTAAAAAGTACATAACCTACCCGTCCTTTTCGTACATGACCACAATCCTAATAGCCCCGGACGCAACGCTTGGGGACGTCATGAGAAGCTGTTGGCATGTGATCTTTGCCACGGCACAGGTACTTTTGTCTTCTGTGCTGACCCTTTGGCTGGTGGAGCCTAAAAACTTCACGGTGGAGGTAGCGGTGGTGGCAATTGCTCTGAGTGCTTTTGTGGTGGCATTGCCGGAGTCCACGCACTTGATGTCGAAGAGAATTGCGTTTGGGCAGTTTGTGAGTGTTTATGTTGGCACTGTGATTCATGGGGCACAAACTGGAGTTGTCATGCATCCACTTGGCGTTGCATCAAGCACTGTCCTTGGAGCTTTCGCTTCTGTTGTTGCTATGTTGTTTCCTTATCCTCGGCTATCTTACTATGAGGTCAGTGAATCATGGCGCATGTATGCCGGAAATGCTTCTCAGAGGTTAGCTCGCTTCGTTGAGGCCATCTCTTCCCGGGACAAGAGCGGAGCACTCGAACTCCTCTCTCAAGGACAATCTCTCTCTAAAGAAGCAGCTAAGCTTCTTCAAAGCATCAGTAATAATCTGGAAACGATGGTGTGGGAGAGACCACATATCAAATTTCTGAAACCAAATTATCTGGACTCAGGTGAAAGGTTGCAAGAAATTGAGGTTCCACTGAGGGGAATGGAAATAGCCTTATCTAGTTGCTCTTCACATCCTGTAAACCTAATTGATGAAGAGCTAAGACGCAATTTACAAAGTTCAGAAGTACAGGTTAGGCTAAGGCTTCTGCAAGCGAAGTACTCTTTGCCTTCCGATGCAACATTGGCTCCGGAGTCATACAGAGAAATCTTCGACAAGCCACTTTGGGCTGGAAAACCCACCACCAATAACCGTGAGAATCTTCCGGCTTTCTTCTTCTTGTACTGCATGGAACTCCTCCTAGAAAACCAACCCATTGCCCGGAATCCTGGAAACACTAGGAAACCTAACCAAGAACCGAGTGATTCGCAAAATCAACAGCGGTGGACCTTCAAAAGTGTTTGGAGAAACATAATCCCAAGTACCAGGAGTATAATTTTTGCTCTCAAGTGCTCACTTGCATTAGGCCTTGCTGTGTTATTCGGCTTGTTGTATAACAAGGAAAACGGGTACTGGTCAGGCCTCACCATTGCCATCAGCTTTGTAACAGGACGGCAAGCAACATTCACAGTTACAAATGCTCGAGTTCAAGGAACGGCACTGGGATCGATCTACGGAATCATATGGTTATTTATTTTCCAAAGACTTGAGAAATTCAAGCTCGTACCACTCATACCTTGGATCTTTTTTTGCCATTTTCTTAGGCATAGCAGGATGTATGGCCAAGCTGGTGGGATCTCGGCAGCCATTGGAGCATTACTTATCTTGGGTAGGGAAAACTATGGTCCTCCAAGTGAATTTGCATTTACAAGAATGATAGAGGCATCCATTGGACTGCTTTGTTTCCTTTTTGTAGAGATTGTCTTTTATCCGATGAGAGCAGCGACCCTAGCAAAAAATAAGCTCTCACAAAGCATGGAGGCGCTTCGAGATTGTATCGGAGTAAATCTTTGTGTACCAGCTTCCACAGGATTGAGGGAAAAGCGGAGGAAGCTCAAGTCCCATATGAAAGAACTAGAAACATTCATCCAAGAAGCTGAAACAGAGCCTAATTGCTGGTTCTTGCCCTTCCAGGGTGCCGGTTACAATCGGGTGCTAGGATCTTTATCAAAAATCGCTGATCTTTTACTATTTGTGGCCTATAAGACGGAGTTTCTCGCACAAGTAGAGCAGAACTTTGGAGGTGTTTGGGAGGAACTAAGGCAACAAATGAATGCTGATCTAGAGCTGCTAAAGGTTTGCCTTGAGGAGGCGTCTTCGATCAAGCCCATGCCGGTATCCGAGACAATGTCGGAAAGTGATTACCACGACAGTGAATTGGGCAAACCACCAAGGGGATTTGCGACTTTGGGTTGTACTGATGATAAGGAGGTTGAGACTATTGTGAGTAGTTTTCTTCAACATTTGCAGGAAGTGGCTGACAAGGTACATACTAGTGACATTGAAGAGAAACAGAAGAGCCAAATGATTCTTTGTTTGACTAGCCTGGGATTCTGCATTTCAAGCGTGATGAGAGAAGCAATGGAGATGAAGAAAGAATTGAAAAAACTAGTCAAATTGAATGCGCCTACATAG >Pbr020839.1.g ATGCCAACCTTTCTCGACCACACCGACCGAGCCCGAGCCATGTGGCTAACATGCCTAGCCTCTGCATTCCGTACATGTCTTGCTTGCACCATAGTAGCCCTAACCACCCTCTATGGCCCACAATCTCTCCAACGCCAAGTAGCCTTCCCGGCATTCTCTTATGTCACAGTCCTTCTCATTGCTCCTGATGCAACTCTAGGGCACACACTTTGTGGTTTTTGGCTCGGGCTCTACGCCACAGCACAAACTATTGGGCTGGCCGTGTTGAGTCTGTGGCTGATTGGGCCGGCCCGGCTTTCAACCAGCACGACCGCTCTGGTGGTGGGGCTTGCTGCATTTGTGGTGGCTCTGCCGGAGTTTACTCACTTGGTAACCAAACGCATAGCACTCGGACAAATCGTTATTATGTATGTTATAGCTTATATAAATGGGGGGCATACAGATGCTATCATGCACCCCGTCCACGTCGCAGCAAGTACTGCAATTGGGGTGTTGGCTTGTGTTTTGGCTTTGTTGATTCCCTTCCCGCGCCTTGCTTCTCGAGAGGTTAAACAAAACTCAGAGCTATTTGCCAAGAATGCTTCGGAAAGGCTCAAGATCTTTGTAAAGGCGTTTTGCGCAGAAGATAGCACATCAGCACTTGCATCAATTTCTCAAGCAAATTCCATGGCTTCCACGGCAACCAAGCTTTTCCAAACTATCAAAAGCCACCAAGAAAGCATGAAGTGGGAGAGAGTTCCACTAAAGTTATTTTCGAGACATGGCTATGTAAATCCAGGAAATAGATTGCAGGGCTTAGAGATTCCCTTCAGAGGGATGGAAATGGCATTGACCTGCATTCCTTCATTTCCAGTTAAGGTGGTGAATGGAGAACTCAATAAAGATGCTCTACTAAGACTAGTAGAGCAGCACATGAGCCTAAACTTGAGCCCACCTTGTGATTCAATAACTGTTCCTGAATCAAAAGCAGAAAATGTTGGTTTCCTCCAAACACTTCAAACCATCCCAAATATCCACCAAGATCTACCCCCAATTTTCTTTTTGTTTTGTATCAATCTCCTCCAAGGAAAATTATCATCCAGAAGTAGTATTTTACCTGAAAAATTATTGGTTCACCAAAATGAAGGAGCAATTAACTCTTCCAAACAAAATGGATTGTATTTCACGATATGGAGTAACTTGTCCACCAAGGTAAGCGGCAAGAGGCTTACAGCAGCTTTCAAATGTGCACTCTCCTTGGGTCTTGCCGTGTTTTTCGGTCTGAAATACAGCAAAGATGATGGTTACTGGGCAGGACTCCCAGTAGCAATCAGTCTTGCATCAACCAGAGAAGCAACATTTAAAGTTTCAAATGTTAAAGTACAAGGGACTGTTTTAGGAACTGTATATGGAGTTTTGGGTTGGTTTCTCTTCCAAAGGTTTATGTCAATGAGACTTTTATCTCTGATTCCTTGGTTCATTTTCACCAGTTTTCTCCAGCGTAGCCGAATGTACGGCCAGGCGGGAGGCATTTCAGCAGTAATTGGAGCTGTACTAGTTTTGGGGAGAACAAACTTTGGTCCTCCAAGTGAATTTGCCATAGCCAGAATCACAGAAACCTTCATTGGATTATCTTGTTCAATTATCGTTGACCTATTATTGCAACCCACAAGAGCTTCTGTTCTTTCAAAAGTTCAACTCTCTAGGACTCTTGGGACATTGCAGGAGTGCATCAACTCGGTGAGTCTTCAACCAGGAAGAGCCAATTTGAAAGAGAATCAAAAGAGACTGAAAATGCATATTGAAGAACTTGGGAAGTTGATTGGAGAAGCAGAGGCGGAGCCCAATTTCTGGTTTTTGCCTTTTCATAGTGCTTGCTATGGAAAACTCTTGGGGTCTTTCTCCAAAATGATGGACCTCCTAGTTTTAAGTGCTCATGCTGCGGGATTTCTTGAACAAAACTTCCAAAGATTTGAGGCTTCATGGAAGGACATTGGACATGCGGTGGATTGTGATCTTGAAAGTTTCAAGAAAATGGTTGACTCTTTGATAACATTCTTCAAGGAGGTCACGTCGATAAAATTACTCTCAGTTCTTGATCAAAAGAGTGATATAGCTCATGATCTTGAGTTGGGAAAATCTCGAGCCCCGAATATGTTTGGGGTTTGCAGTTCAGAGGATGAAGAGACAGATAAGATTATAAGTTCTTATCTCCAACACTCAAGGGAAGTTGTAGAGAAAATTGATGCTAAAAGTGAGGAGCTCAAGAGCCAAATGGTTTTGTGTTTAAGTGGTTTAGGGTTCTGCATGAGTAGTTTAATAAGAGAAACCAGGGAGATTGAAGAGGGAATCAAGGAACTTGTTCAATGGGAGAATCCCTCAAGCCACATTAGTTTGTATGAAATCTCTTGTAAGTTGTATGATTTAAAGAAATAA >Pbr020840.1.g ATGGAAGCTTTGAACTGCTCACTTTCCTTGAGTCTTGCCATGTTTTTGAGTTTGATATACAGCAAAGAAAATGGTTATTGGGCAGGACTTTCAGTAGCAACCAGTCTTGCCTCAGCCAGAGAAGCAAAATTCAATGCTGCAAATGCTAAAGCACAGGGGACTGTTTTAGGAACTCTCGCTAGGACTCTTGGGACACTGCAGGAGTGCATCAACACGGTGAGTCTTCAATCAGGGAGAGCCAATTTGGAGGAGAATCAAAAGAAACTGAAAATGCATGTTGCGGAATTGGGGAAGTTGATTGGAGAAGCTGAGGCGAAACCCAATTTCTGGTTTTTGCCTTTTCATAGTGCTTGCTATGGAAAGCTGTTGAGGTCCTTGTCCAAAATGACGGACTTGCTAGTTTTAAGTGCTCATGCAGTTGGAGTTGTTGAAGATAATTCACAAACACTTGAGGCTTAA >Pbr029531.1.g ATGGGAGATCACCAAACCCAATCGTTGTGTCAGATGCGCCTAGGCTCCGCCCTACGCACGGCTTTGGCATGCATCATAGTCGGCTGCACCACCCTCTATGGACCTCCACAACTTCAAAAGTACTTAACCTACTCGTCCTTTTCGTACATCACCACAATCCTAATAGTCCCGGACGCAACGGTTGGGGACGTCATGAGAAGCTGTTGGCATGTGATCTTTGCCACGGCACAGGTACTGGTGTCTTCTGTGCTGACCCTTTGGTTGGTGGAGCCTAAAAACTTTTCGGTGGGGGTAGCGGCAGCGGCAGTAGCACTGAGCGCTTTTGTGGTGGCGTTGCCGGAGTCCACGCACTTGATGTCTAAGAGAATTGCATTTGGGCAGTTTGTGAATGTTTATGTTGGTACTGTGATTCACGGTGCTCAAACTGGAGTTGTCATGCACCCACTTGGTGTTGCATCCAGCACTGCCCTTGGAGCTCTAGCTTCTGTTGTGGCCGTCTTGTTTCCTTATCCTCGGCTATCTTACTACGAGGTCTGTAAATCGTGGCAGCTGTATGCCGGAAATGCTTCCCAGAGGTTAACTCGCTTCGTCGAGGCCATCGTTTCCCGGGACAAGAGCGGAGCACTCGAACTCCTTTCTCAAGGACAATCTCTCTCTAAAGAAGCAGCTAAGCTTCTTCATAGCATCACTAATAATCTGGAAACCATGGTGTGGGAGGGACCACATATCAAATTTCTGAAACCAAAATATATGGACTTGGGTGAAAGGTTGCAAGAAATGGAGGTTCCACTTAGGGGGCTGGAGATAGCTTTATCTAGTTGCTCTTCACATCCTGTTAACCTAATTGATGAAGAGCTAAGAGGCAATTTACAAAGTTCAGAAGCACATGTTAGACTAAGGCTTCTGCAAGCTAAGTACTCTTTGCCTTCCGATGCAACATTAGCTCCAGAGTCGGACAGAGAAATCTTCGACAAGCCCCTTTGGACCAAAAAACCCACCACCAAAAACCGTGAGGACGTTCCGGCTTTCTTCTTCTTGTACTGCATGGAACTCCTACTAGAAAATCAGCCCACTGCCCGAAATCCCGGAAACACTAGGAAACCTAACCAAGAACCGATCGATTCACAAAATCAACAGCGGTGGAACTTCAAGGGGGTTTGGAGAAACATACTCCCGAGTCGCAGGAGTTCAATTTTTGCTCTCAAGTGCTCACTTGCATTAGGCCTCGCTGTGTTATTCGGCTTGTTGTATAACAAGGAAAACGGATACTGGTCAGGCCTCACCATTGCCATCAGCTTTGTAACAGGAAGGCAAGCAACATTCACTGTTACGAATGCCCGAGTTCAAGGAACGGCACTGGGATCGATCTACGGGATCTTATGGTTTTTTATTTTCCACGGACTTGAGAAATTCAGGCTCTTACCACTCATACCTTGGATCTTTATCTGCCATTTTCTTAGGTACAGCAGGATGTATGGCCAAGCTGGTGGCATCTCAGCAGCCATTGGAGCTCTACTAATCTTGGGTAGGGACAACTATGGTGCTCCAAGTGATTTCGCAATTGCAAGAATCATAGAGGCTTCCATTGGGTTGCTTTGTTTCCTAACAGTAGAGATTGCCTTTTATCCAATGAGAGCGGCGACCCTAGCAAAAAACAAGCTCTCACGAACCATGGGGGTGCTTCGAGATTGCATCGAAGGTGTAAATCTGTGTGTACCGGCTTCTACCGGATTGAGGGATAAGCAAAGGAAGCTAAAATCCCATGTCAAGGAACTAGAAACGTTCATCCAAGAAGCTGAGACAGAGCCTAATTGCTGGTTCTTGCCCTTCAAGGGTTCCGGTTACAATCGAGTCCTAGGATCTTTATCGAAAATTGCTGATCTTTTACTATTTGTGGCCTACAAAACAGAGTTTCTCGCACAAATTGGGCAGAACTTTGGAGGTGTTTGGGAGGAACTAAGGCAACAAATGAATGTTGATCTAGGGCTACTAAAGGAAAAAATAAACTCTCCATTAAGATGCCTTGAGGAGGCCACTTCGATCAAGCCCCTGCCGGTATCTGAGACAAAGTCGGAAAGTGATTACCACGATAGCGAATTGGGCAACCCGCCAAGGGGATTTGCGACTTTGGGTACTGATGATGAAGAGGTTGAGACTATTGTGAGTAATTTTCTTCAACATTTGCAGGAAGTAGCTGACAAGGTACATGCTAGTGACAGTGAAGAGAAACACAAGAGCCAAATGGTTCTTTGTTTAACTAGCCTGGGATTCTGCATTCAAAGCATTACGAGAGAAACAATGGAGATGAAGAAAGATGTGAGAAAACTAGTCAAAATTAATGCACATACGTAG >Pbr029533.1.g ATGGGAGATCACCAAACCCAATCGTTGTGTCAGATGCGCCTAGGCTCCGCCCTACGCACGGCTTTGGCATGCATCATAGTCGGCTGCACCACCCTCTATGGACCTCCACAACTTCAAAAGTACTTAACCTACTCGTCCTTTTCGTACATCACCACAATCCTAATAGTCCCGGACGCAACGGTTGGGGACGTCATGAGAAGCTGTTGGCATGTGATCTTTGCCACGGCACAGGTACTGGTGTCTTCTGTGCTGACCCTTTGGTTGGTGGAGCCTAAAAACTTTTCGGTGGGGGTAGCGGCAGCGGCAGTAGCACTGAGCGCTTTTGTGGTGGCGTTGCCGGAGTCCACGCACTTGATGTCTAAGAGAATTGCATTTGGGCAGTTTGTGAATGTTTATGTTGGTACTGTGATTCACGGTGCTCAAACTGGAGTTGTCATGCACCCACTTGGTGTTGCATCCAGCACTGCCCTTGGAGCTCTAGCTTCTGTTGTGGCCGTCTTGTTTCCTTATCCTCGGCTATCTTACTACGAGGTCTGTAAATCGTGGCAGCTGTATGCCGGAAATGCTTCCCAGAGGTTAACTCGCTTCGTCGAGGCCATCGTTTCCCGGGACAAGAGCGGAGCACTCGAACTCCTTTCTCAAGGACAATCTCTCTCTAAAGAAGCAGCTAAGCTTCTTCATAGCATCACTAATAATCTGGAAACCATGGTGTGGGAGGGACCACATATCAAATTTCTGAAACCAAAATATATGGACTTGGGTGAAAGGTTGCAAGAAATGGAGGTTCCACTTAGGGGGCTGGAGATAGCTTTATCTAGTTGCTCTTCACATCCTGTTAACCTAATTGATGAAGAGCTAAGAGGCAATTTACAAAGTTCAGAAGCACATGTTAGACTAAGGCTTCTGCAAGCTAAGTACTCTTTGCCTTCCGATGCAACATTAGCTCCAGAGTCGGACAGAGAAATCTTCGACAAGCCCCTTTGGACCAAAAAACCCACCACCAAAAACCGTGAGGACGTTCCGGCTTTCTTCTTCTTGTACTGCATGGAACTCCTACTAGAAAATCAGCCCACTGCCCGAAATCCCGGAAACACTAGGAAACCTAACCAAGAACCGATCGATTCACAAAATCAACAGCGGTGGAACTTCAAGGGGGTTTGGAGAAACATACTCCCGAGTCGCAGGAGTTCAATTTTTGCTCTCAAGTGCTCACTTGCATTAGGCCTCGCTGTGTTATTCGGCTTGTTGTATAACAAGGAAAACGGATACTGGTCAGGCCTCACCATTGCCATCAGCTTTGTAACAGGAAGGCAAGCAACATTCACTGTTACGAATGCCCGAGTTCAAGGAACGGCACTGGGATCGATCTACGGGATCTTATGGTTTTTTATTTTCCACGGACTTGAGAAATTCAGGCTCTTACCACTCATACCTTGGATCTTTATCTGCCATTTTCTTAGGTACAGCAGGATGTATGGCCAAGCTGGTGGCATCTCAGCAGCCATTGGAGCTCTACTAATCTTGGGTAGGGACAACTATGGTGCTCCAAGTGATTTCGCAATTGCAAGAATCATAGAGGCTTCCATTGGGTTGCTTTGTTTCCTAACAGTAGAGATTGCCTTTTATCCAATGAGAGCGGCGACCCTAGCAAAAAACAAGCTCTCACGAACCATGGGGGTGCTTCGAGATTGCATCGAAGGTGTAAATCTGTGTGTACCGGCTTCTACCGGATTGAGGGATAAGCAAAGGAAGCTAAAATCCCATGTCAAGGAACTAGAAACGTTCATCCAAGAAGCTGAGACAGAGCCTAATTGCTGGTTCTTGCCCTTCAAGGGTTCCGGTTACAATCGAGTCCTAGGATCTTTATCGAAAATTGCTGATCTTTTACTATTTGTGGCCTACAAAACAGAGTTTCTCGCACAAATTGGGCAGAACTTTGGAGGTGTTTGGGAGGAACTAAGGCAACAAATGAATGTTGATCTAGGGCTACTAAAGGAAAAAATAAACTCTCCATTAAGATGCCTTGAGGAGGCCACTTCGATCAAGCCCCTGCCGGTATCTGAGACAAAGTCGGAAAGTGATTACCACGATAGCGAATTGGGCAACCCGCCAAGGGGATTTGCGACTTTGGGTACTGATGATGAAGAGGTTGAGACTATTGTGAGTAATTTTCTTCAACATTTGCAGGAAGTAGCTGACAAGGTACATGCTAGTGACAGTGAAGAGAAACACAAGAGCCAAATGGTTCTTTGTTTAACTAGCCTGGGATTCTGCATTCAAAGCATTACGAGAGAAACAATGGAGATGAAGAAAGATGTGAGAAAACTAGTCAAAATTAATGCACATACGTAG >Pbr034014.5.g ATGTGGCTAACATGCCTAGCCTCTGCATTCCGTACATGTCTTGCTTGCACCATAGTTGCCCTAACCACCCTCTATGGCCCACAATCTCTCCGACGCCAAGTAACCTTCCCGGCATTCTCTTATGTCACAGTCCTCCTCATTGTTCCTGATGCAACTCTGGGGCACACACTTTGTGGCTGTTGGCTCGGGGTCTACGCCACGGCACAAACTATTGGGCCAGCGGTGTTGAGTCTGTGGCTGATTGGGCCGGCCCGGCTTTCCACCAGCACGACCGCTCTGGCGGTGGGGCTTGCTGCATTCGTGGTGGCTCTGCCGGAGTTTACTCACTTTGTGACCAAACGCATAGCACTTGGACAGATTGTGATTATGTATGTCATAGCTTATATAAATGGGGGCCATACAGATGCTATCATGCACCCTGTCCACGTGGCTACAAGTACTGGAATTGGGGTGTTGGCTTGTGTTTTGGCTCTGTTGATTCCCTTCCCGCGCCTTGCTTCTCGAGAGGTTAAACAAAACGCAGAGCTACTTACCGAGAATGCTTCAGAAAGGCTCAAGATCTTTGTAGAGGCGTTTTGCGCAGAAGATAGCACATCAGCACTTGCATCACTTTCTCAAGCAAATTCGTTGGCTTCCACTGCAACCATGCTTTTCCAAACTATCGAAAACCACCAGGAAAGCATGAAGTGGGAGAGAGTTCCGCTGAAGTTAATTTCGAGATGCAACTATGTAAATCCAGGAGATAGATTGCAGGGCTTAGAGATACCCTTTAGAGGAATGGAAATGGCATTAACCTGTATTCCTTCATTTCCAGTTAAGGTGGTGAATGGAGAGCTCAGTAAAGATGGTCTACTTAGACTAGTAGAGCAGCACATGAGCCTAGACTTAATCACGCCTTGTGATTCAGTAACTGTTCCTGAATCAAAAGGTTTCCTCCAAACACTTCAAACCATCCCACAAATCCACCAAGATTTACCCCCAATTTTCTTTTTGTTTTGCATCAATCTCCTCCAAGGCAAGTTATTATCCAGAAGTAAGACTGTACAGGAAAAATTTTTGGTTCACCAGAATGGAGGAGCAACTAATTCATCCAAACAAAATGGATTGTATTTCAAGATATGGAGTAACTTGTCCACCAAGGTAAGCAGCAAGAGGCTTATGTCAGCTTTCAAATGTTCACTCTCCTTGGGTCTTGCCGTGTTTTTCGGTTTGATGTACAGCAAAGATGATGGCTACTGGGCAGGACTCCCGGTAGCAATCAGTTTTGCATCAACCAGAGAAGCAACATTTAAAGTTTCAAATGTTAAAATACAAGGGACTGTTTTAGGAACTGTATATGGAGTTTTGGGTTGGTTTCTCTTCCAAAGGTTTTTGTCAATGAGACTTTTATCTCTGATTCCTTGGTTCATTTTCACCAGTTTTCTCCAGCGTAGCCGAATGTACGGCCAGGCAGGAGGCATTTCAGCAGTAATTGGAGCCGTACTAGTTTTGGGGAGAAGAAACTTTGGTCCTCCAAGTGAATTTGCCATAGCCAGAATCACAGAAACCTTCATCGGATTATCTAGTTCTATTATCGTTGACCTAATCTTGCAACCCACAAGAGCTTCTGCTCTTGCAAAAGTTCAACTCTCTAGGACTCTTGGGACATTGCAGGAGTGCATCAACTCGGTGAGTCTTCAATCAGGAAGAGCCAATTTGGAAGATAATCAAAAGAGACTGAAAATGCATACTGAAGAACTTGGGAAGTTGATTGGAGAAGCTGAGGGGGAGCCCAATTTCTGGTTTTTGCCTTTTCATGGTGCTTGCTATGGAAAACTCTTGAGGTCTTTCTCCAGAATGATGGACTTGCTAGTTTTAAGTGCTCATGCAGTTGGAATTCTTGAAGAAAATTCACAAACACTTGAGGCTTCATGGAAGGAAATTGTACATACATTGGAATGTGATCTTGAACATTTCAAGAAAATGGTTGGAAGTTTGATGACATGCTTCAAGGAGATCACCTTGGTAAAATCAATCACAGTTCTTGATCAAAAGAGTAACATATCTCCTGACTCCGAGTTGGGAAAATCTCGATCACCGAATATTTTTAGGGCTTGTAGTTCAGAGATGGATAAGATTATGAGTTCTTATCTCCAACACTCGGAGGAAGTTGTTGGTAAAATTGATGCTAAAAGTGAGGAGCTCAAGAGCCAAATGATTTTGTGTTTAAGTGGTTTAGGATTCTGCATAAGTAGTTTAATAAGAGAAACAAGAGAGATTGAAGAGGGAATCAAGGAACTTGTTCAATGGGAGAATCCTTCTTCCCACATTAATTTGTACGAAATCTCTTGTAAGTTGCATGATTATCAGAAATAA >Carubv10015769m.g ATGCGTGATACAACATGGCTCGAGCGACTTGGCCTGGCTCTAAGAACCGTTATGGCTTGTCTCATCGTGAGCTTAACAACTTTGTACGGTCCCAAACAACTAAAACACTTCACAACATTTCCAGCCTTCTCTTACTTGACCACAATCCTGATCTGGCTCTCCGATGCTGAACCAACATACGGCGAAGTACTCAAGTGCTGTGTTGATGTCTCTTACGCCACTTTTCAGACAATAGCCATTGCACTAGTGAGTGTCTTGGTGGTTGGACCAGCTTCACTAGCAAATAGCTTGGTGGCTCCAGTTGCTGTGGCTCTAGCGTCATTCATCGTGGCTTTCCCCGTTTCCACGAGTCTTCTGACTAAACGGATTGCCTTTGGGCAAATTGTTGTCGTCTACGTGACTTTTGTCGTCTTCAATGGAGAGGTGGCTCATGTTTTCATGCTCCCGGTTCATGTGGCGGCCAGTACAGCACTTGGAGCCATCGCTTCTCTCCTCGCCGTGCTTCTCCCGTTTCCAAGGCTAGCTCATAGTCAGATGAGTAAGGATTGCAAATTATATGCTGAAACTGCTCTTGAGAGGTTGAATTTGTTCGTCGAGGTCATGATGGCTCGAGACAACACCACAGCTAAGGTTTTGATCGCACGGGCTGCTTCATTATCTGCAGCAGCAAAAAGCATACTCAAAAGCATCAAAATCCACCATGGGCGTTTGGCATGGGAGCGACCAGATACAAGATTCTTGAGAAGGAAGCAGAAGTTGGATCCTGAGGAGAAACTCCATGCAACAGAATTTCTGATGAGGGGGCTGGAGCTGGCATTGGGTTCTTGCAGTTCCTTTCCTCAAGGCATGACCCGCGATGAACTGACTTGTCTTTTAGAAGGTCCCAGAACACATATCTCTCCCCAGTCACCATCTACTCTCAGGTCCCAAGATAGTCTAGGATGGAATCTTGAGGCTGGGTCTCTGTCCACGACAGCTTTACCGGAGTGTTTCTTCTGGTACTGCGTAAGACTCTTCAGAGGTGATTTCTTATCTGTGAGACAAGACAGTAAATCTGTAAATAGAAGTAACACGGAGGAAGAAACTCAGCCAGAAAACGAAGAATTATCCATAACCAAAAAGGTTTTAGACATTCTTTGTGTCTGGATGGCCAGAGAAAAGTTTGTTTTTGCATTCAAGTGCTCGGTGTCTCTAGGCCTTGCGGTTCTATTTGGTATTATGTATAATAAACAGAATGGGTATTGGTCGGGTCTTACTGTAGCCATTAGCCTTGTAAGCGGGAGGCAAGCAACACTAACAGTAGCAAATTCTCGCCTACAAGGGACAGCGATGGGATCAGTCTACGGTCTGTTATGTTGTTATGTTTTCCACAGACTAGAAGAATTCAGGTTCTTACCTCTGCTCCCTTGGATAATCCTTGCCGTCTTCATGAGGCACAGCAAAGTCTACGGCCAACCTGGAGGAGTTACAGCTGCCATTGCTGCACTGTTGATACTTGGAAGGAGAAATTATGGAGCGCCAACTGAGTTTGCGATTGCTCGCATTGTTGAAGCTTCAATTGGGTTGCTCTGTTTTGTCTTTGGGGAGATTCTCGTTACCCCTGTGAGAGCAGCAACCCTTGCAAGAACCGAACTTACCCATTGTCTTGATGCCCTCTTAGATTGCATCCAGTCACTGGTTCTCTGTTCTGAGCAGAGGAACCAGAAAATGTCAGTGGTTACAGGTTTGAGAAAAAGGCAGGCAAAACTCAAATCTCATGTAGACGCATTAGAAAGGCTTACAGCAGAAGCCTTAACAGAGCCTAACATTCCGTTTCTCCGCCCACTCAACACGGTCAGTTACTACAAGCTTTTGGGCTCTTTTTCGAAGATATCTGATCTTTGTCTCTATGTTTGTGATGGCCTCGACAACCTATCTGGAGTTCAACCAAAACTTGTGTTTCCTTGGGAAAACATCACTCATGACCTGAGAGCATTCCAAGAAAAGCTTAACCCTTCGGTGAAATGCTTAGAAAAGATGGCTTTAACCAAGTCGCAAGCAAGACTCCAAAAGGAGTTGCAGAAGAGAAAGATATGCCACGATGTTGAAGCAGGAGTAACATGCAATGAAAACTACTCAAACATGGAGTTGGGTCCAAGCCAGGAAGATGCAGAGAGGTTTTCGGTTTCTTTCGTAATGCTACTGAAGGAAGCAACTGACAAGATAAGTGAAGAGGTTCTCAAGAGTGAAACTGCTCTATGCTTAAGCAGTCTAGGGTTTTGCATTAGCAGATTGATGCAAGAAACAGTAAGTATTATGGCAGAAATAACCCATACAACAACTTGA >Carubv10022663m.g ATGCAAATGACTGAGAGAGGCCGAGCCATGTGGCGCACGTGCCTAGCCTCAGCGTTCAGAACAGCTCTAGCTTGCACTTTCGTTGGCGCAGCTACACTCTACGGCCCCGAATGGATCAACCGCCACGTAGCATTCCCGGCCTTCTCTTACGTCACGGTTATCCTCATCATCACCGACGCTACACTCGGAGACACGCTACGTGGCTGCTGGCTAGCTCTTTACGCCACGTGTCAGAGCGTTGGCCCTGCGATCGTCACGTTGAAGCTTATAGGACCAGCTCGTCTCACGGCCGAAACCACTGCTCTCGCCGCGGCTCTAGCTGCGTTCGTGGTGGTTCTGCCTAATAGTTCGACCCACTTGGTGGCTAAGAGAATCGCTTTAGGCCAAATCGTTCTCATTTATGTTATTGGTTATATTAAAGGAGCTGAGACTGATCCGGTCATGCACCCTCTCCGAGTCGCGGCTAGTACCGCGCTTGGTGTTTTAGCTTGCGTTCTTGCACTTCTCCTCCCACTTCCTCGCTTGGCTACTTGTGAGGTGAAACAAAGCTGCAAAGAGGTTGGTCAAAATGTAACGACGAGAGTGAAGTTGTACATGAAGGCTTTTTGCACCGAGGATGCTATGTCAGCAACGGCGTCAGTCTCACAGGCTAGAGTGTTGGCTCGTTCTTCCTCCAAGCTTTATCAAAAACTCAAACGTTACGAACCAAGCATGACATGGGAGAGGCTACCGTTTAAGATATGGAGGTGGCAAAACGTGAATGATAACAAAGGAGAGAAACTACAGAGCATGGAGATTGCTCTTAGAGGAATGGAAATGGTAGTAGCAAGCAAATCTCCTATTCCTTCGAGTTTACTTGAGGGTGAAGTCAAAGAAGATCTCAAGAATATACAAGAACGTGTGATTCTTTCAATCAAACGAGTAAACAATAGTCCGCAACCATCGGTAACACCAGAATCCGATACAGAAAAATCAGATGAGTGCCTCCAAACACTTCAGGAGATCCCGGGAACGCCTCAAGATTTGCCGTTTTACTTCTTCTTGTTCTGCCTCAGGCTCCTTGAAACCATCATAATAGCTAAACCGGAGGAGAACAAAGTCAAGGTCTTAGAAAAATCCAAAACGAAGTTTTGGTTAAGTGATTGGGACAGCAAGAAGGTTATGCCAGCGTTGAAGCTTTCGCTTTCGTTAGGTTTAGCGATTTTGCTAGGTTCAATATTTAGTAAGCCAAACGGATATTGGGCTGGTTTACCAGTAGCTGTCAGCTTCGCAGCGGCAAGAGAGGCAACGTTTAAAGTGGCGAACGTGAAGGCACAAGGGACAGTGATAGGAACAGTGTATGGAGTGATGGGTTGTTTTGTCTTTCAGAAGTTTTTGCCAGTTAGGTTTCTATCTTTGCTTCCATGGTTTCTCTTCTCTAGCTTCTTGAGCAGGAGCAAGATGTACGGACAGGCCGGAGGGATATCGGCGGCTATAGGAGCCGTTTTGATCCTCGGAAGAAAGAATTTTGGGCCACCAAGCGAGTTCGCGATTGAGAGAATCATCGAGACTTTTATTGGGTTGTCTTGTTCGATCATGGTGGAGCTTGTCTTTCAACCAACAAGAGCCGCTAACATAGCTAAACTTGAGCTCTCTAGAAGCTTCCACGCTTTGTACGAGTGTGCAAGCTTGTTTGGAGCTAAAGCGAGTAAAGCAGAGATAATGGAGAGTCAAAAGAAGTTGAGAAGTCACTTAAATGAGCTCAAGAAGTTCACGGCAGAAGCCCATGCAGAGCCAAGTTTCTGGTTTTCGCCTTTCAACTTCTCTTGCTACGAGAAGCTGTTCAAGTCACTATCAAAAATGGCTGATTTATTGCAATTCAGCGGTTACGCCATAGGCTTTCTTGGAGAACAAGGAAAAGATAAATCACCTCAGTGCAAGGAGATTCTAAGCACCGTAGACAAAGATCTCAAGAGTCTAACAGGGAGCATAGGTCTTCTAGCAAAATCATACGAGGAGATCACACTCCTCAAATCACTCGACGCCCTCGAACAAGCCCTAGCCAAGAGCGACAACACCTCATGGGACATTGAGCTAGGGAAGACACCAAACCCTAGCTTCTCAACAGCCGTGAGCGAGCCGGAGAAGATTTTAGAGACATATCTCCAGCATTGCAGAAGCGTGGCTGAAGGAATATTCCGTGTGGAAGAAGGAGAAGGAGACGAGGTTAAAGTGGACAAGAGTGAGGTCGTGTTGAGTTTGAGCGCATTAGGGTTTTGTGTGGAGAGGATTGGGAAAGAGACAAGAGAGATTGAGGAAATGGTTAAAGAGGTTGTTCAATCAGAGAACCCTTCAAGCCATGTTAACTTGCATGAGATCTCTTGCAAAATACGTTCTTTGTACAAATGA >Prupe.6G081000 ATGGCAACCTCTCCATACCAGACCAACCGAGCACAAGCTCTCTGGCTCACATGCCTAGCCTCTGCATTCCGTACATGCCTTGCTTGCACCATAGTGGCCCTCACCACCCTCTATGGCCCACAAGCTCTCCAACACCAAGTAGCCTTCCCAGCATTCTCTTATGTGACAGTGATTCTCATTGCACCGGATGCAACTCTAGGTAACACACTTTGTGGCTTATGGCTGGGGCTTTACGCCACAGCCCAAACTATCGGACCGGCCATGTTGAGCTTGTGGCTAATAGGCCCGGCCCGGCTTTCGAGCGGCATCACCGCTCTGGCGGTGGGCCTTGCTGCATTTGTGGTGGCTCTGCCAGAGTTTACTCACTTGGTGTGCAAACGCATCGCCTTGGGACAGATTGTGATTGTGTATGTAATAGCTTATATAAAGGGTGGGGAGGTACAGGCCATCATGCACCCTGTCCACGTGGCAGCAAGTACAGGGATTGGAGTCTTGGCCTGTGTTCTGGCATTTTTGGTTCCCTTCCCACGCCTGGCTTCTCGAGAGGTTAAACAGAACGCAAAGCTACTTGGTGAGAATGCTTCAGAGAGGCTCAAGCTCTTTGTGAAGGCCTTTTGTGCAGAAGACAACACATCCGCACTTGCATCAATTTCTCAAGCAAAGTCCCTGGCTGCTACAGCAACCAAGCTTTTCCAAACTATCAAGCGCCACCAAGAAAGTATGGAGTGGGAGAAACTTCCCTTGAAATTTTCGAGATACAAGTATGCAAATCCAGGAGACAGATTGCAAGGCTTTGAGATACCCTTAAAAGGGATGGAAATGGCATTGACCAGTACTCCTTCATTCCCAATTAAGGTGGTAAATGGAGAGCACAAAGATGGCCTACTTAGAGTAAACTTAAGCGCACCCTGTGATTCAACAACTGTTCCTGAATCAAATGCAGAAAATGTTAGGTTCCTCCAAACACTTAAAACCATCCCACAAACCCAACAGGATTTACCCCCAATTTTCTTTCTGTTTTGCATAAAGCTCTTTCATGGAAAATTATCAGCCACAAGTCCCACAGAGCAAGGCAAATTATTGGTTCACCAAAATGAAGGAGCAATCGATTCACGTAAACAAAATGGGTTCTGTTTCAAAGAGGTATTGAGTAACTTGTCCATCAAGGCAAGGAGCAAGAGGCTTATGATAGCTTTCAAATGCTCACTTTCCTTGGGTCTAGCTGTGTTCTTTGGTTTGGTATACAGCAAAAAAAATGGTTTTTGGTCTGGACTTCCAGTAGCTATCAGTTTTGCATCAGCCAGAGAAGCAGCATTCAAAGTTGCAAATGTTAAAGCACAGGGGACTGTCTTAGGCACTGTGTATGGAGTTTTGGGTTGCTTTCTGTTCCAAAGGTTCTTGTCCATAAGACTCTTATCCCTTATTCCTTGGTTTATTTTCACCAGTTTTCTCCAGCGTAGCCGAATGTATGGCCAGGCTGGTGGGATTTCTGCAGTAATTGGAGCTGTACTAATTTTGGGCAGAGCAAATTTTGGCCCTCCAAGTGAATTTGCCATAGCCAGAATCACAGAGACCTTCATTGGATTATCTTGTTCAATTATGGTTGACTTACTCTTGCAGCCCACAAGAGCTTCTACTCTTGCAAAAGCTCAACTTTCTAGGACTCTTGACACATTGCAGGAGTGCATTAACTCAGTGAGTCTTCAATCAGGCAGAGCCCTTTTGGAAGAGAACCAGAAGAGACTGAAAAATCATGTTGAAGAATTGGGGAAGTTGATTGGAGAAGCTGAGGCAGAGCCCAATTTCTGGTTTTGGCCTTTTCATAGTGCTTGCTATGGAAAGCTCTTGAGGTCCTTGTCCAAAATGATGGACCTCCTACTCTTTAGCGCTCATGCAGTGGAAGTTCTTGAACAAAATTCACAAATGCTTGAGGCTTCGTGGAAGGACATTGTACATACAGTAGAATGTGACCTTGAACTTTTCAAGAAAATGGTTGGCTCTTTGATAGAATGCTTCAAGGAGATCACCTTGATAAAATCAATCACAGTTCTTGACCAAAAGAGTGACATAGCTCATGATCTTGAGTTGGGGAAATCTGGAAACCCAACCATTTTTCGGATTTGCGGTTCGAAGGATGAAGAGATGGATACGATTATAAGTTCTTATCTCCAACACTCAAAAGAAGTAGTTGATAAGATTCATGTCCAAAGTGAGGAGCTCAAAAGTCAAATGGTTTTATGTTTGAGTGCTTTAGGGTTCTGCATAAGTAGTATAATAAGAGCAACGAAAGAGATTGAAGAGGAAATCAAGGAACTTGCTCAATGGGAGAATCCCTCAAGCCACATTAATTTGTATGAAATCTCCTGTAAGGTGCATGCTTTACAGAAATAA >Prupe.6G250900 ATGAGTCCGGGCAGCAGGACTGCCTGGAACTGTGCCTTGTGGTGCCTAAGGCTACGCTCAGCTTTCCAAACCATCTTAGCCTGCAGCATAGTCTACACCACCACACTCTACGGTCCACAGCCTCTCAGGCAGCTAGTAGCCTACCCTGCATACTCTTACCTCACCACCATCCTGATCGTGTCAGACGCGACTCTTGGGGACTCGCTGAGAGGCTTCTGGCATGCCCTTTGCGCTTGTGTTCAGGTTATGACCCTCTCAATCTTGAGCCTCCTGCTGATAGGGCCTGCGCACTTCAGTTACTTCATATCAGCCTTGGCAGTGGCTCTGTGCACTTTTGCTGTGGCATTGCCGGGAGCAACTCACTTGATGGCTAAGAGGATTGCATTTGGACAGATTGTGATTGTGTATGTAGGCACTGCCATTCATTGTGCAGAAGCTGGTGAGTTGGTACTTATGCACCCGATTCAGGTGGCGTTGAGTACTATGCTTGGAGCCTCAGCATCAGTCATGGCTATGCTGTTTCCCAACTTGTTCTTCTACCAAAAGGCATCTGTGGCAGCTTTTCTCTCTCCTTACCTTGCCTACCACGAGGTGAGAGATATGTGCCAAAAATATGCTGAAAACGCTAGGAAAAGGTTGAACTTCTATTCAGATGCCATCTTGTCCCAAGACAGCTCGGCTGCACTTGGCTTTATTTTACAAGCACAGCCCTTGGCTCAAGTAGGAGAAAAGCTCCTTCAAAGTATCAAACACAAACAGGAAGCCTTAATGTGGGAGAGACCAAAACTCAGAAATATCCTGAAACCAACTTGCATGGATCTGGGAGAAAAATTGCAGGACATAGAAATACCCTTAAGAGGGATTGCAATTGCTGCAACTTCTTGTCCTTCTTTTCCTGTTGCCTTGATTAAGAAAGTGCAACCAGATGCTTTACATGACATGAAAAGGCGAATACACGACAAGCTGGAGCAACTTGAGCATTTTGCACCCTTATGCATACTAAAGAAAAAGAAAAAATCTTTGGATGAGTCCTTCTGGCCCCTCGAAACCATTTTTCGTGAAGATTTGCTGGCTTTCTTTTTTCTGGATTGTTTGAAACTCCTCCAAGAAAATACTGAGGCAGTTGAAGAATGCAGGGAGAGCTACTCTGAAAATGAAAGTTCACATGGTTCAGAAAATCAAAGCCATGGTGGTATCAAATGGAGCTGGAGCATTTCATGCATTATACCAAGCAAAACAAGCCTATTTTTTGCAGTTAAGTGCTCAGTTTCATTAGGCCTTGCTGTGCTATTGGGTTTGTTGTTTAATGAGAGAGAAGCATATTGGGCAGGCCTCACAATTGCAATAAGTTTTGTCAGAGGAAGACAAGCAACATTTACAATTGCCAATGCCCGAGCACAATCTACGGCAATGGGATCAATCTACGGAATCTTGTGTTGCTTTATTTTCCGTAAAGTTGAGAATCTAAGTTTCTTACCTCTTCTTCCTTGGTTAGTTTTCACAAGCTTTCTAAGGCACAGCAGGATGTATGGCCAAGCTGGTGGAATATCAGCAGCTGTAGGGGCACTGCTGATACTTGGTAGGAGACATTATGGCCCTCCACTTGATTTTGCAATTGCTAGAATCACAGAGGCTGTTATTGGATTGATTTGTTTCATCACCATGGAAATCCTCATATACCCTGCAAGAGCAGCAACTCTAGCAAAACATAAACTTTCACTTAGCTTGGGAACTCTTCAAGAATGCATCAAAGATGTAGTTCTTTTTGACAACCAAAACAACATGCAAGCTTCAATCTTTCCAAAATTGAGACAGAAACAGAAGAAGTTGAAGTCCCATGTCAATAAGTTACAAAAGTTCATTGAAGAAGCTGAACTGGAGCCTAATTTCTGGTTCATCCCTTTCAATGGTTCTTGCTACAGAAAGCTCCTGAGGTCTTTATCAAAGATGGGGGATCTTTCACTTTTTATGTCCAACAAAACAGAATTTCTGTCAGTTGTCTTACAGAGATGTGAAGTTGATTCAGAGGACCTCCAAAAACCCCTGAAGTGCATTAAAAATGACATAGAACTTTTCAAGAAAAAAGTTGAGACTTCACTGCAATGCCTCCAAGAGCTGTCTTCCAAGAAGTCTCTTGCAGTACATGACAAGCATGACATTGAGTTGGGTACATCACCAAAAGCAAATGAGTGTAGGTGTTTGGAGACAGAGAAGGATGAGATGGAATGCATTTTAAATTCTTTTCTTCAACATTCCAATGAAGTATCTGACAGAGTTGGTACCAATACTGAAGGCGAGGATCAGAAGCTTAAGAGCCAAGTTATTGTTTGCTTGGCTGGCCTAGGGTTTTGCATCAGTAGTTTACTCAGGGAAGTGAGAGAGATGGAGAAAGAGTTTCAAGAACTGGTCAATTTGGAAAACCCTTCAACCCATGTCATAGTATGA >Prupe.6G252300 ATGGCAGCCTCTACAACAATGGGAGATTACCAAACCCAATCGTCATGGCGCCCACGCCTAGGCTCCGCTCTACGCACTGCCTTGGCGTGCACCATAGTTGGCTGCACCACCCTCTATGGACCTCCACAACTCCGAAAGTACTTGACATACCCATCTTTTTCTTACATGACCACCATTCTAATTGTCCCGGACGCAAAGCTTGGTGATGTCCTGAGAAGTTGTTGGCATGTCATGTATGCCACTGTCCAAGTAATGGTGCCTTCTGTGCTTACCCTTTGGCTGGTTGGCCCGAAAAATTTCGACATCTTGCTGGCAGCAGTGGCTGTGGCAGTCAGTGCTTTTGTAGTGGCTTTGCCAGAGTCTACACACTTGATGTCTAAGCGGATTGCATTTGGGCAGTTGGTGAATGTTTATGTAGGCACTGTGGTTCATGGGGCTCAAACTGGAGTTGTCATGCACCCTCTTGGTGTTGCAGCAAGCACAGCCCTTGGAGCTCTGGCTTCTGTCCTTGCTTTGTTGTTTCCCTACCCTCGGCTGGCTTACTTTGAGGTCAAGAAATCATGGAGGATGTATGCTGAAAATGCTTCCCAGAGGCTAACTCACTTTGTTGAGGCCGTCTCTGCCCAAGACAAAAGAGGAGCACTTGAATTCATTTCTCAAGAACAATCTCTCTCTAAAGCAGCAGCTAAGCTTCATCAAAGCATCAGCAACAATCTGGTAGGGATGGTGTGGGAGAGACCACATATGAAATTTTTAAAACCAAATTATATGAAGTTGGGTGAACAGTTGCAAGAAACTGAGATTCCATTGAGGGGGATGGAGATAGCTTTATCTAGTTGCTCTTCATTTCCTCTTAATCTGATTGATGAAGAGCTAAGAGGTCATTTACAAAGTTCAGAAGTACAGATAAGCCTAAGGCTGCTGCAATCTAGGTACTCTATGCCTTCTGATGCAACAACAGCTCCAGAGACAAACAGAGAGATTTTGGACAATGCCCCTTGGATTGGCAAACCCACCACCACAAACCATGACAACATGGCGGCTTCGTTCTTCTTGTACTGCATGGAACTCCTGCTAGAAAACCAACCCATTGCCCGAAATCCCGGAAACACTCTGAAATCTAACCCTAACCAAGAACCAAGCGGTGCACAAAATCAAGCGCACTGTAACTTCCAAAGGGTTTGGAAGAACATAATGCCAAGCCTCAGGAGTTTAGTTTTTGCCCTCAAGTGCTCACTTGCATTAGGCCTTGCTGTGTTATTCGGTTTGATATATAACAAAGAAAACGGATACTGGGCAGGCCTCACCATTGCCATTGGTTTCGTGACAGGACGGCAAGCCACATTTACAGTTACAAATGCTCGAGCACAAGGAACGGCGATGGGGTCTGTCTATGGAGTCATATGCTTATTTCTTTTCCAAGGAATTGAGCACTTCAGACTTTTACCACTCATACCTTGGATCTTTTTCACCCATTTTCTTAGGCATAGCAAGATGTATGGCCAAGCTGGTGGGATCTCAGCAGCCATTGGGGCATTGCTAATTTTGGGTAGGGAAAATTATGGTCCTCCAAGTGAATTTGCAATTGCAAGAATGACAGAGGCATGCATTGGACTGATTTGTTTCGTTTTAGTAGAGATTGTCTTTTATCCTCTGAGAGCAGTGACCCTAGCAAGAAATGAGCTTTCTAAAAGCATGGGGGCACTTCGAGATTGCATCAAAGACATAAATCTTTGTGTACCGGCTTCTGCCGGACTGAGGGAAAAGCAGAGGAAGCTAAAATCCCACCTTAAAAAGTTAGAAAACTTCCTCCAAGAAGCTGAAACAGAGCCTAATTTCTGGTTCTTGCCCTTTAAGGGTGCAAGTTACAGTAAGGTCCTAGGATCTTTATCGAAAATGGCTGATCTTTTACTATTTGTGGCCTGTGAAACGGAGTTCCTCTCACAAGTAACACAGAAATTGGGAGGTGCTTCAGAGGAACTAAGGCAACATATGAATGCTGACGTAGAGCTTCTAAAGGAAAAAATTAACTCTTCACTGAAATGCCTTGAGGAGGTGACTTCGATCAAGTCCGTTGCAGCATTTGAGACACAGGCGCAAGATGATTACCACGACAGCGAATTGGGCAAACCAGCAAACCCCTTTAGGATTTTGGGTGCAGGAGATGAAGAGGTTGAGATTATTGTAAGTATTCTTCTTCAACATTTTGAGGAAGTGGCTGACAACGTACATAATAGTGACAGTGAAGCGAAACGTAAAAGCCAAACGGTTCTTTGTTTGGCTAGCCTGGGATTCTGCATCCGAAGTTTGACGAGTGAAACAATGGAGATGGAGAAACAAGTGAGGAAACTAGTAAAATGGGAGAGTCCTTCAAGGCACAAAAAATTTCTTAATATTTGTTGTAAAGCTGATGCACTGGATGCACATACATAG >Manes.11G132400 ATGCCAGCTCCAACAAACAGCCCTGAACGTGTCCGAGCCGTCTGGAGGTGGTGCCTAGCCACCGCCTTTAGGACAGGACTGGCATGTACAATTGTGGGTTGCCTGACCCTCTATGGACCAGCCTCTATTCACCAGCAAATAGCCTTCCCTGCATTCTCTTACGTGACTGTGATACTTATTGCGACTGATGCAACTCTGGGTGATACTCTTCATGGTTGCTGGCTAGCACTCTACGCCTCAATCCAGAGTCTGGGTCCTGCTCTGTTGACCATGTGGTTGATTGGCCCTGCTAAGTTCACTAGTGGCACCATATCCTTAGCAGTGGCTTTAGCTGCATTTGTGGTGGCACTTCCTGAGTGGACTCATTTGGTTGCTAAGAGAATTGCTTTAGGTCAGATTGTTATTGTTTATGTTATAGCCTTTATTAAAGGTGCGCATACAGAGAGAATCATGCATCCTTTGCATGTGGCAGCCAGCACTGCCATTGGAGTCTTAGCTTGTATTCTTGCCTTGCTGCTGCCATATCCAAGATTGGCCTGTTGGGAGGTGAAAGAAAATTGTAAGCTGCTAGCAGAAAATGCTTCAGAGAGGCTGAAGCTCTACGTGAAGGCATTCTGTGAAAAAGACAGTGCATTGGCCTCGTCGTCTATCTCTCAGGCCAAGTCATTGACCATCTCTGGTGCCAAATTTCTCCAAAGTATTAAACGTTACCAAGGAAGCGTGAAATGGGAGAGACTTCCATTTAGGTTTCTGAGGCCTTATTACATGAATCCTGGAAAGAAATTGGCAGAACTAGAGTTATCCTTGAAAGGGATGGAAATGGCTTTAACCAATATCTCGTCATTTCCTGTGAGAATGATGGAAGGAAAGAGCAAAGAAGGCCTGCAATTATTAGAGGAGCATATCAGCCTGATCTTTAAGCAAATCAAGAATTCCTCGCCTTGTGACCCTTTAACTTTTCCTGAATCAAGTGCTGAAAATATAATCGAGTCCCTCCAAACTCTTCACATAACTCCAACGGATGACCAAGATTTATGCTCTCTTTTCTTCTTGTTTTGCATGAAACTCCTCCACTGCAAACCATTGACAAAACCAATCACTTCCAAACAAGAAAATGAAGGCTCAAACAATTCAAGTAAGCAAAATGGTTTCTTTAAGAGCATCAGGAGCAACTGGACCATGAATCTCAGCAGCAGAAGGCTTATGCCAGCTTTCAAATGTTCTCTTGCTTTGGGTCTTGCAATCTTATTTGGTTTGTTATATAGCAAGGAAAATGGTTATTGGTCAGGACTTCCAGTGGCCATTAGCCTGGCCTCGGCAAGAGAGCCGACATTCAAAGTTGCCAACGTTAAAGCACAAGGGACAGTTTTGGGAACCATCTACGGAGTCGTAGGTTGCTTTGTCTTTGAAAGGTTCTTGCCAATAAGATTCTTGTCTCTTCTTCCTTGGTTCATCGTCACCAGTTTTCTAAGGCGTAGCAAAATGTATGGCCAAGCTGGTGGAATTTCTGCGGCCATTGGTGCCGTACTAATATTGGGTAGGAAAAATTTTGGTCCACCAAGTGAATTTGCTATAGCAAGAATTACAGAAACCTTCATTGGATTATCTTGCTCAATTATGGTGGAGCTACTGTTACAACCCACAAGAGCTGCCTCTCTAGCTAAAACTCAACTCACTAAATGCTTGAGTTCATTGTCTGCATGCGTTGGCTCAATGAGCCTTGAAGCCAACCAAGCCATCTTGCTAGAGAATCAAAGAAGACTAAAATTGGAAGTTAGTGTGCTAGAGAAATTCATTGGAGAAGCTGATGTGGAGCCCAACTTCTGGTTTTTGCCTTTTCATAGTGCTTGCTTTGGTAAGATTTTGGGGTCTTTATCAAAGATGGTGGATCTCCTACTTTTTAGTGCTCAATCAGTTGAATTCCTCGAACAAGAATCACAAAAAATGGGAATTTCTTGGAAAGAATCTGCAAATAAACTAGAGGGTGACCTTCAACTTTTCAAGGAAATGGTTGGTTCATTAATAAAATGTTTTGAGGATCTCAGCTTGTTGAAATCCCTGGCATTTCTTGACAAGGAACTTGAAAACAGAAACATCTGTTATGATCCTGAACTGGGGAAATCACCAAATCCAAAGATTTTCAAGGTTTCTTCAAGTTCAGATGATGAAAATGAGATAGAGGGTATCATAAAATCTTATCTCAAACATTCAAAGGAAGTTATAGATAAGTTCCATGATCATGATGAAGATGAAGAGCAGAAGAGTGAAATGATTTTAAGCCTGGGAGCAATGGGATTTTGCTTGATGAATTTAATAGAAGAGGCAAGAGAGATTGAGAAGGGTATCCAGGAACTTGTTCAGTGGGAAAACCCTGGAAAGGACATAAATTTGTACGAAATTTCATGTAAAGTTCGTGCTTTATACAATTGA >Solyc09g010570.1 ATGCCAACCACCATGGTGGCAAAACGAGCTCGCGCCATGTGGTGGATGAGGCTACACTCAGCTATTCGAACCGCCTTAGCATGCATTATAGTAGGGTGTGTCACCCTCTATAGTCCACCTTCTCTTTCGAAGCAACTAGCATTTCCTTCTTTTTCCTACGTGACGTCGATATTCATAGTATCCGACGCCACGTTAGGCCATGCCCTAAGGGGATGTTGGCATGCATGTCTTGCCACACTTCAAACCATGCCACTTTCCATGCTAGGCCTATGGATCCACAATTATGTCGCCACCGATGACTACTCGCCCGAGGTAGCCGCCCTCATGGTGGCGGTGAGCGCGTTTTTGGTGGCGTTGCCGGAGAGTACCGACTTAATGTGCAAGAGAATTGCCTTTGGACAACTTGTTATAGTCTATGTTGATGCTGTTATTCATGGACTTTATGTCAATTCTCCTATGATGCACCCTTTTAGAATTGCTTTTAGCACTGCACTTGGAGTTGTGGCTTCTATCATAGCTTTGTTGCTACCTTATCCTTGGCTTGCATATCATGAGGTATGTATATATATCAACTTCATCGCTAATCTATCGTTAAATTATATTCTCATAATCTTTTACTAA >Solyc06g075970.2 ATGGCAACACCATCCTCTGAATCGAGCCGAGCTCGAGCCATGTGGCGGACTTGCCTAGCATCCGCCCTTCGAACCGCCTTGGCTTGCACCATAGTTGGTGTTGCAACCCTTTTCGGTCCACAATATATCAAAAATCAAGTTGCACTCCCAGCTTTTTCCTATGTTACGGTTATACTAGTTGTGACCGATGCAACTTTAGGTGACACATTTCGTGGTTGTTGGCTTGCACTTTATGCTACCATTCAGGGCGTTTGTCCTGCTATGCTAAGCCTTTGGTTAATCGGTCCGGCCCGACTCACGGCCGGGACCACCGCGATAGCAGTGGCTCTGAGCGCATTCCTGGTGGTTGTGCCTGAAAATACTCACTTAATAGCGAAGCGCATCGCGCTAGGACAAATTGTTCTTGTTTATGTCATAGCTTATATCAATGGTGGCCAAACGGAAACTATTATGCATCCGGTTCACGTTGCGGCTAGCACAGGGCTTGGAGTTGTGGCTTGTGTTTTGGCCTTGATTTTTCCCTATCCATCCCTGGCTTGTTGTGAGGTGAAACAGAATTGTAAGCTCTTTGCTGAAAATGCTTCAGAGAGGTTTAACTTGTTTGTGAAGGCATTTACTGCTGAAGACAACAGTAGTGCACTTGCTTTCATTTCTCAAGCCAAGTCTTTAGTCAAAACAGGATCCAAACTCCTCCAGGACATTAAAACCAAACAAGAAAGCATGAAGTGGGAAAGATTTCCATTCAAATTTTTAAGACCATATGGAGAGAACCCTGGAAGCAGATTTCAAGATGTTCAAATACCTTTAAGAGGAATGGAAATTGCCTTAGATAATTCTCCTCCATTTCCTGTTGAAATTCTTAACACTGACCAAAAATCTGTTCTACATATGCTTGGTGACCACATACCAAAGCAAGTCAACAGTATATCCCTTGAGTCATCAGCAACTGTGCCAGAGTCAAATCAACAAAATACCCAAATGTTCTTCCAAACACTTCAACCAACAAAAAAAGACCTTCCTTCTTTATTCTTTTTATTTTGCTTAAACCTATTATTAAACAAACCAATTACCAATTCACCATCTTCCACTAATCCCAAACAACAAAATCAAGAAGGGTTCTTTCAAAATTACTTGTCAATTACCAAAAGTAACAAAAGGTTCATGGCAGCTTTCAAATGTTCACTTTCATTAGGCCTAGCTATATATTTTGGATCAATCTATAGCAAGGACAATGGATTTTGGGCAGGGCTTCCAGTTGCCATTAGCCTCGCGGGATCGAGAGAAGCAACATTCAAAGTAGCTAATGTTAAGGCACAGGGGACAGTATTAGGAACAATATATGGTCTTTTAGGATGTTTTGTCTTTGAAAAATACGTTCAAATTAGATTCTTGTCTCTTCTTCCATGGTTCATTGTCAGCAGTTTTTTGAGACAAAGCACAATGTATGGGCAAGCTGGTGGACTTTCAGCTATAATTGGGGCATTACTAATTCTTGGTAGAAAAGGTTTTGGTCCACCAAGTGAATTTGCAATAGCAAGAATAACAGAGACATTTATTGGATTGTCCTGTTCTATTGTAGTGGAAATTTTGTTACAGCCTACAAGAGCTACTACATTAGCAAAATTGCAACTTTCCAAGAGTTTTCAAATCCTGAATGAGTCTATTTCGTTGATAAGCTTTGGATCAATTGGAAATTTAGTGGAAAGTCAAAATAAATTGAAAACACACGTAATTGAGATGGGGAAATTCATCGCGGAAGCAGAGGTAGAGCCAAATTTTTGGTTTGTACCATTTCATAGCGTTTGTTATCGTAAACTCATGGGGTCATTAACAAAAATGTTGGAGTATTTACATTTTGGGTCACAAGCTTTTATGTTACTTGAACAAGAATCAGGAGGGTTGATTGACAATTTTGTACATAAGCTGGATGGTGACATCAAGCTATTCAAAGATTTTGTTGGCTCTTCAATGAAATGTTTTGAGGAGGTTAGTTTGGTCAAATCACTAGCAATACTTGACAAGGAATTTGAGAAGAAGAAACTTTCAGTTGATGTTGAATTAGGAACATCACAAAGTAGTAGTTATTGTAATATAATAAGGTATGCAAGTGAAGAGGAGATTGATGACAACTTCAGGTCTTATTTTGAGCATTCGAAAGAGTTTGTGGACCAAATTGTCAATGGTGAGGAGTTGAAGGGTCAAGTTGTATTAAGTTTGAGTGCATTGGGTTTTTGCATGGATGGACTTGTGAAGGAAACTAAAGAAATTGAGAAGGCAATAAAAGAACTTGTGCAGTGGGAAAATCCTTCAAGTCATGTTAATTTGCATGATATTTCTTGTAAAGTAAGGGCTTTAGCAAATATTATTGTAGCTAATTAG >Solyc11g066140.1 ATGGCAACAACTTCTAGCTTTGAATCCATTAGGGCTAGAGCTGTGTGGCGGACTTGCCTAGCCTCCGCCTTTCGAACCGCCTTGGCTTGTTCGATAGTTGGTGTAGCCACCCTTTTCGGCCCAGAAAGTTTCAAGATTCAAGTCGCATTTCCCGCTTTTTCCTACGTTACTGTTATTCTAATCGTGACTAATGCCACGTTAGGTGACACTTTACGTAGTTGTTGGCTAGCGCTATACGCAACGATTCAAGGTGTTTGTCCCGCTATATTAAGCCTATGGTTGATCGGGCCGGGCCGACTCACCGCCAGCACTACGGCTACTGCCGTGGCGCTGAGCGCATTTGTGGTCGTTCTGCCCGAAAAAACTCACTTGATAGCGAAGCGTATAGCGCTAGGGCAACTTGTGATTGTGTATGTCATAGCTTATATTAACGGTGCGAAAACCGAACCGATCATGCACCCGGTTCGGGTCGCGGCTAGCACCGCGGTTGGAGTTGTGGCTTGTGTTTTAGCATTGTTGCTTCCCTATCCTAACCTTGCTTGTTGTGAGGTAAAAGAGAAAAGCAAGCTCTTCGTGGAAAATGCTACCGAGAGGATTAACTTGTTTGTGAAGGCTTTTTCAGCTGAAGACAACACTTCAGCACTTGCTTTAATTTCTAAAGCCAAATCCTTAGTTAACAATGGACCTAAACTTCTCCAAGCCATTAAATCCAAGCAGGAAAGCATGAAGTGGGAAAGATTTCCTTTCAAGTTTTTAAGACCATATGGAGAGAATCCAGGGGACAAATTTCAAGAAATACAAACACCTTTAAGAGGGATGGAAATTGCATTGGAAAATTCTTCTTCAATATTCCCAATTAGTATTCTCAACATAGAGCTAAAAGATGGTCTAGAAAAACTAGGAGATCACATCTCAAAGCAAATCAACAACATGTCTATAGATGAGTGGTCAGCAACTGTCCCTGAGTCAAATGCACATGATGCAGAAAAGTTCCTCCAAACACTTCAATTGATTCAACCAACAAAAAAAGACCTCCCCTCTTTATTTTTCCTTTTTTGCCTCAAATTGTTGTTACACAAACCAACTTTCCCTTTATCATCCAAAAAAGGAGTTGACATTGGTTCCAACAAACAAGTTGATGATGATCAAGAAGGATTTGTTAAAAAGACATGGAACAATTTGTCAATGACTATAAATAGTAGGAGATTTATGACATCTTTTAGATGTTCACTTTCATTAGGCCTTGCTATATTTTTTGGATCAATTTATAGCAAGGAAAATGGATTTTGGGCAGGGTTGCCTGTTGCAATAAGCCTGGCAGCAACAAGAGAAGCAACATTTAAAGTTGCTAATGTTAAAGCACAAGGGACAGTGTTGGGCACAGTTTATGGTGTCTTAGGATGTTTTCTCTTTGAAAAATTTGTGCAAATAAGGTTCTTGTCTTTGCTTCCTTGGTTCATTGTCAGCAGCTTCTTGAGCCGTAGCCGGATGTACGGCCAAGCAGGTGGGATTTCAGCAGTTATTGGGGCAGTACTAATTCTAGGTAGAAATGGATTTGGTCCTCCAAGTGAATTTGCCATAGCAAGAATTACAGAAACATTCATTGGATTATCATGTTCCATCATGGTTGAAATATTGTTCCATCCAACAAGAGCTTCAACATTAGCTAAAATTCAGCTCTCCAACACCTTCAAGATCTTGCACGAATGCGTCGACTCAATAGCCTTCTCGTCCTCTAACAAAAACAACTCCGAGGAAATTCAAAAGAATTTGAAATTCCATGTAAATGAATTGGGAAAGTTCATCGCGGAAGCTGAGGCAGAGCCCAATTTTTGGTTTTTACCTTTTAATAGCGGTTGTTATGGTAAGGTCCTGGGGTCCTTGTCAAAGATGATGGAGTACTTACTTTTCGGGTCACAAGCACTAAGATTCCTCCAACAACATTCAACAAGTTCAATCGATTGGAATAACATAGATGCTGACTTAATGCTTTTTAAGGATTTAATAAGTACATCCACTAAATGTTTTGAGGAGGTTAGTTTGGTAAAATCACTCGCGATACTTGACAAGGAATTCGAGAAAAAGAAAAATTCAATTGATCTTGAATTGGGAAAATCATCATCATATAATATAAGGTCTTTATCATCAAATGATCAAGATGGAATTTTGACTTCTTATCTTCAACATTCAAATGAACTTGTGGATTTTATTATCAATGTTGGTGATGATAAAAATAATGATGAAAAACTCAAGGGCCAATTGGTTTTAAGTTTGAGTGCTTTGGGTTTTTGCATGGAAAGTCTAGTGAAGGAAACTAGAGAAATTGAAAAGGCAATTAAAGAACTTGTACAATGGGAGAATCCATCATGTCATGTAAATTTGTATGACATTTCTTGTAAAGTAAGGGCTTTAGCCAATACTCAAACAAATTGA >Solyc10g084720.1 ATGGCAAGTACAACTATGGCTAAGCGAGCTCAAGCAATGTGGCGAATGAGGCTACATTCTGCTATTCGCACCGCCTTAGCATGCATAATAATCGGCTGCACCACCCTACTCAGCCCGCCTTCTATTGCAAGGCATCTGGCATTTCCCTCCTTTTCATATGTAACCGCCATAATTATTGTGCCAGATGCTACCCTAGGGAAAGTTTTAAGGGGCTGTTGGAGCGCGTGTTGTGCTACGCTCCAAGTCATGCCCCTTTCTATGGTTGGGTTATGGATTCATGGCTTCGCCACTGATGATAACAACTTCTCGCCCCTAGTAGCTTCTGTGATGGTGGCGGGGAGTGCTTTTTTGGTGGCGTTGCCTGGGAATACGGATTTGATGTGTAAGCGGATTGCTTTCGCGCAGCTGGTTATTGTGTATGTGGATGCTGTTGTTCATGGAATCCGTGTGAATATAGTGATGCACCCTCTACGAGTTGCATCTAGTACTGCTCTTGGAGCTGTGGCTTCTGTTCTTGCTTTGTTGCTGTTCTTCCCCTGGCTAGCTTATTTTGAGGTGAGGAAACTATATGGTATGTATGCTGAAAATGCTTCAGAGAGATTGGATCTTTACATCAAAGCCCTCCATTCTCCAAATGAACAAATAGCTATGGAGATCTTATCTCAAGCCAAACCAATTTCCCAAACAGGAACCAAGCTTCTTCAGAGCATAAAACTCTTAGAGGGAAGTTTACGATGGGAGAAACCTTGGCTAAGATTCATAGTTCCCTGTTTCACTGATCCTGGAAATGGTTTGCATGACATAGAGAGTCCAATGAAAGGAATGGAAATTGCTTTAACTTCTTGTCCTTGTTTTCAAACTACAATTATTGATGAAAAGCTCATGCGTGTCTTCTCACATCGCGTGCTACAGCTACTCGGTCTAAAACTGGAGCAAGCTCGTTGTCTTTTGCGAACACATTCAATGATAGTTACAGAAACAGAAGGGGTATTTGAGAATGAGTTTACCATTTTTTCCCCCGAGTCAATTTCCCTGACAAGCCTAGATCAACCAGCAATTTTCTTCTTGTCTTGTATCAAAATGTGCATAAATGATCTAATCATGACTAAAGGATCCAAAGATTCAGGAGGAAGTGACAAAGTTAGCTCGAAACGAGTCTGCATCAATTGGACTAACCTAATGAACCGTGAAAGCCTTGTATTCGCGTGCAAGTGCTCAATTTCATTAGGTCTGGCTGTACTACTTGGTCTGCAATTTAACAAACGGAATGGATATTGGTCAGGGCTTACAACAGCCATCAGCTTTGAAACAGGAAAAGTAGCAATTTTTACGGTTGCAAATGCTCGAGCACAAGGAACAGCTCTAGGATCAGTCTATGGAGTACTAGGCTGCACTGCTTTTCAAAATTTCGCGAGAATAAGATTCATAGCTATGATCCCTTGGATAATTTTCGCGTCAATTTTAAGGCACAGTAAAATGTACTCTACAGCAGGAGGAGATGCAGCAATTATCGGAGCATTACTGATTCTAGGCAGAAGACGATATGGTCCCCCGAGTGAATTCGCTATTGCTAGACTCACCGAGGCCTTAATTGGATTATCATGTTTCATCATCATAGAGCTTGTAATCCAACCAACACGAGCAGCAACAATCGCGAAAAATCATCTTCTTCTGTGCTTTGGAACACTTAAAAGTTGTACTAAGCAAATTGACTTGGACTCAGGGCAGATCAATGGCTTTAAGAAGAAGCAAAGACAATTGAATTCTCAAGTAGAGAAATTACAAAAGTTCATAGTAGATGCAGAGTTGGAACCTGGTTTCTGGTTTACGCCTTTTCCTGTTTCTTGCTACCAAAACCTTCAACGATCTCTATCAAACGTCGTGCACTTACTGTATTTCATGGCCTACAGTATAGAATCCCTCATACAAGCATTAGATAGTTGTGATGCTGAGAGAAACAAGATCCAGGAACACTTAAAGAAAGACAGGCAGATTGTCAATGATGCGATTAGCTCTTCAATGAAATGTATCGAGAAAACCATTTCTATCGGAATGTCAAGAGCTTTCCAAGATCAACCAGAGGATCATAAAGTTGTTTATGACCTCGAGGAGGGAAAGTCACAACGCGAATATACAACTACTTCTACTAGCAATAAGGAATGGAAAGCTTCAAGTGATTTTCTTGAGCACTCAAAGGAGGTTATTGATAACATGACATCTATTGAAGGCAAAGAAGAAAATATTAGAAATATCATTATCTGTTTGTGTTCAATAGGATTTTGCATGAGTAGTTTGATGAGAGAAGTAAAAGACTTGGAGAAAGGTGTAAAAGAATTGCTGAATTGGGAACATCCATAA >CAN.G97.42 ATGCCAACTACCATGGTGGCAAAACGAGCTCGTGCCATGTGGTGGATGAGGCTACACTCCGCCATTCGAACAGCCTTGGCATGCACCATAGTGGGGTGTGTCACCTTATACAGTTCATCTTCTCTTGCGAAGCAACTAGCATTTCCTTCTTTTTCCTACGTTACATCGGTATTCATAGTGTCCGATGCCACGTTAGGACATGCCTTAAGGGGATGTTGGCATGCATGTCTTGCAACACTTCAAGTCATGCCACTTTCCATGCTAGGCCTATGGCTTCATAACTACGTTGCCACCGATGAATTTTCGCCCGAGGTAGCCGCCCTGATGGTGGCAGTGAGCGCATTTTTGGTGGCATTACCGGAGAGTACGGAATTAATGTGCAAGAGAATTGCTTTTGGACAGCTTGTTATAGTGTATGTTGATGCTGTTATTCATGGGGTTTATGTCAATTCTCCCGTCATGCACCCTCTTAGAATTGCTTTTAGCACTTTACTTGGAGCTGTGGCTTCTATCTTGGCTTTGTTGCTGCCCTATCCTTGGCTAGCCTATCATGAGGTGAGAAAATTATACCAAATATATGCAGAAAGTGCATCGGGAAGAATAAACTTATATTTGAAGGCCATCCGTAATCAAGATGATGAGATAACCATGGAGCTAATTTCTCAAACAAAGCCCTTTACCGATACAGGAAGTAAGCTTCTTGAGACTATCAAATTCTTGGAGGAAGGTTTACAATGGGAGAAACCTTGGCTAAGATACTTGAATCCCTATTACACAGATCCAGGACAAGGTTTTCAAAACATGGACATTGCAATGAAAGGAATGGAAGTGGCTATAACTTCTAGCCCATCTTTTCCCACAAGAATGATAGATAAAGAGCTCTTTAAAGTCACACATCATGTTATGATGTTTCTTGGCCAAAAATTGGGGCAAGAAAGATCATTTTTACCACATAATTCAGTAACAGCTTTGGAAACAGTAGGGGAATTTGAGGAGTCATCTAGGCTGCACCAAGAACCGATCTTACCAACGAAACAAGATCAACCAGCACTTTTCTTCTTATCTTGTTTCAAAATGTGCATGAGTGATTCTGACACTATCACTACTATGACCGAAGGACTAAGAAGCACAACGGGAAGTAGTAGTAACAAATCGTGCTGCAGACAAGCCTGTATTGATTGCACTATGCCAATAATCCATGAAAGAATGGTGGTATTTGCGTTCAAGTGTTCGCTTTCATTAGGCCTAGCTGTGCTACTTGGTCTTCTATTTAATACTGAAAATGGGTACTGGTCAGGCCTCACAATAGCCCTCAGCTTTGTCACAAGGAAAGAAGCAATTTTCACAGAAGCAAATGCTAGAGCACAAGGAACAGCTATAGGATCAGTCTATGGAGTACTTGGCTGTACTATCTTTCAAAAAGTCGCGCAAATAAGGTTCTTATCCCTCCTCCCTTGGATAATTTTCACCACATTTCTAAGGCATAGTAGGATGTTCACTCAAGCAGGGGGAACAGCAGCAGTAATAGGTTCACTACTGATTTTGGGCAGAAAAAGTTATGGTCCACCGAGTGAATTTGCAATTTACAGACTCACCGAGGCCTTCATTGGACTAGCTTGTTTCATTGTTGTTGAGCTTATGCTGCAGCCAACAAGTTCAGCCACTTTAGTCAAGAAGCACCTCTATCTGGTCCAGGGAACACTCAAAGATTGCACTGAACGCATGATTGTCGATTCAAGGCAAAAGGGGCTAATGGAGAAGCAAAGGGACCTGAAATATCAAGTCAAAGACTTGGACAAGTTCATTAAAGATGCAGTATTGGAACCTAGATTCTGGTTTTCTCCTTTTCCAATTTCTTGCTACCTGAAGCTCCAACGATCTTTGTCAAAGATGGCAGATGTTCTGTTTTTCATGTCCTGTGATATCGAATTCCTCTGTCAAGCATTCGATAGGTATTATCCTGATAAAAAGGAGCTTCAACAATACATAAACAAGGACCTACAGCAGTTTAAGGATGCTCTAAGCTCTTCAGTGAGCTGCTTTGAGAAAACTATTTCTATCAGACTGTTAAAAACTTCTCAAATCCAGCCAGAGCAGAATATAATGAATGATCTTGAAGAAGGGAACTCATCATGTCCAAGGGGGGAGGTGGAGATGATTCTAAGTTCTTTTCTTCAGAACTCAAACGAAGTTCGTGGTAAAGTGAGAGACATTGCAGGTATAGAGCTTAGAGGAACAATTGTTGGTTGTTTGTGTTCATTGGGATTTTGCATGAGCTTTTTGGAGAGAGAAGTAAGAGACTTCGATAGTGGGATAAAAGAATTGGTGAAATGGGTAGATCCTTTGGGCGAACCAATCCGTTCATAA >CAN.G394.45 ATGGCAACACCTAACTTTGAATCGAGCCGAGCCCGAGCCGTGTGGCGGACTTGCCTCCTATCAGCACTTCGAACCGCCTTGGCTTGCACCATAGTTGGTGTTGCAACCCTTTTCGGCCCACAATATATCAAGAAGCAGATAGCATTACCAGCTTTTTCATATGTTACTGTTATTCTTGTAGTTACTGATGCAACTTTAGGTGATACATTTCGTGGTTGCTGGCTTGCATTTTACGCCACCATTCAGGGAGTTTGTCCCGCTATCCTCAGCCTTTGGTTAATCGGCCCAGCCCGGCTCACGGCAGGCACCACAGCTATCGCGGTGGCTATAAGCGCCTTCGTGGTGGTTCTACCTGATTATACTCACTTGATAGCAAAGCGCATCGCGCTAGGCCAAATTGTTCTTGTTTATGCCATAGCATATATTAATGGTGGCCTAACGGAACCTGTTATGCATCCTGTTCATGTTGCTGCTAGTACTGGGCTAGGAATTGTGGCTTGTGTTTTGGCCTTGATTTTTCCCTACCCAAGCCTGGCTTGCTGTGAGGTGAAAAATAATTGCAAGCTCTTTGCTGAAAATGCTTCCGAGAGGTTTAACTTGTTTGTGAAGGCATTTTCTGCTGAAGACAACACTTGTGCACTTGCTTTCATTTCTCAAGCCAAATCCTTAGTCAAAACAGGATCCAAACTTCTCCAGGGCATTAAAACCAAACAAGAAAGCATGAAGTGGGAAAGATTTCCATTCAAGTTTCTAAGACCATATGGAGAGAACCCTGGGAGCAGATTTCAAGATCTTCAAACACCTTTAAGAGGGATGGAAATTGCCTTGGATAATTATTCTCCTCCATTTCCTGTTGGAATTCTTAACTTAGAGCTAAAATCTGGTGTAGAAATGTTAGGTGAACGCATTTCAGAGCAAATCAAGAACATGTCCCTTGATAAGTCAACAACTGTGCCAGAGTCAAATCCAGAAAATACTCAAAAGTTCTTCCAAACACTTCATACAATTCAGCCAACAAAAAAAGACCTTCCCTCTTTATTCTTTTTATTTTGCTTGAACCTACTATTAAACAAACCAAATGCCAATTCAATACCCAAAGAAGTGTCCACTAATCCCAAGCAACAAGATCAAGAAGGATTCTTGAAAAGAACATGGACCAATTACTTGTCCATTACCAAAAATAACAAAAGGTTTATGGCAGCTTTCAAATGCTCACTTTCATTAGGCCTTTCTATATATTTTGGATCAATCTATAGTAAGGGAAATGGATTTTGGGCAGGGCTTCCAGTTGCTATTAGTCTAGCAGGATCAAGAGAAGCAACGTTCAAAGTCGCGAATGTTAAGGCACAAGGGACAGTATTGGGAACAATATATGGTATTATAGGATGTTTTGTCTTCGAAAAATATGTGAAAATTAGATTCTTGTCTCTTCTACCATGGTTCATTATCAGCAACTTTTTGAGACAAAGCACAATGTATGGCCAAGCTGGCGGGATTTCAGCAGTTATTGGGGCAGTACTAATTCTTGGTAGAAAAGGTTTTGGTCCACCTAGTGAATTTGCCATAGCAAGAATAACTGAGACTTTTATTGGATTGTCATGTTCCATCATGGTGGAAATTTTGTTACACCCCACAAGAGCTTCTACATTAGCAAAGTTGCAACTTTCCAAGAACTTTGAAATCTTGCATGATTGCATTGGGTCAATAAGTTTTGGATCATTGGGAAATTTAGTTGAGAGCAAAAATAAACTATTATCCCATGTTAATGAGATGGGAAAATTTATTGTGGAAGCAGAGGCAGAGCCCAATTTTTGGTTTGTGCCATTTCATGGAGTTTGTTATACTAAGCTAATGGGATCATTATCAAAAATGGTGGAGTATTTACATTTTGGGTCACAAGCTTTTATGTTACTTGAACAAGAATCAGGAGGAATTGACAATTTTGTAAACAAGTTAGATGGTGATATCAAGCTTTTCAAAGATTTTATTGGCTCTTCAATGAAATGTTTTGAGGAGGTCAGTTTGGTCAAATCACTAGCAATACTTGACAAGGAATTTGAGAAGAAGAAACTTTCAGTTGATGTTGAGTTAGGAACATCACCAAGTAGTTATGACAATATAATAAGGTATGCAAGTGAAGAGGAGATTGATGAAAACTTCAGGTCTTATTTTCAACATTCAAAAGAGTTTGTGGACCAAATTGTCGATGGTGAGGAGTTAACGGGCCAAATTGTATTAAGTTTGAGTGCATTGGCTTTTTGCATGGATGGACTTGTGAAGGAAACTAAAGAGATTGAGAAGGCAATAAAAGAACTTGTACAGTGGGAAAATCCTTCAAGCCATGTTAATTTGCATGACATTTCTTGTAAAGTACGAGCTTTAGCAAATATTGTAGCAAATTAG >CAN.G502.1 ATGGAAGCCGCTACAACAACCACCGTGTCAGTGGCGGAGCACAACCACATTATGTGGCGGATGAGGCTACACTCCGCGATTCGAACAGTGGTAGCATATGCTATAATTGGCTGCTCCACCCTTTATGGACCACCTTGGTTCAAAAAATTAGCAGCATTTCCGGCCTTTTCATACGTAACAGCCACTCTAGTCACTAGCGATTCCACGCTAGGTGACACATTGAGTGGCTGTTGGCATGCCATTATTGCCACGGTTCAAACCATGCCACTTTCCATGCTTAGCCTGTGGATAGCAACAGCACCCAACGGGTCCAACAGGTTGTTCCCCGTGGTGTCTGCCTTGGCATTGGCGCTAAGTTCGTTGTTGGTGGCTGTCGTAGAATGTACAGATATTAGGTGCAAAAAAATTGCTTTTGGACAGTTGGTGCTTGTGTTTGCCGATGGTGTTATTCGTGGAGTGCATACAAGTGCTGTTGTTCACCCTCTTCGTGTTGCATATAGCACGGTCCTTGGGATGGTGGCTTCTCTTCTTGCCTTGTTACTTCCTTATCCAAGGCTAGCTTACTTTGAGGGAAGAAGAGTTGTGTTCTTCAAACAACTTGTGGGTTCTGGACTGTTACTTGTTAGTGGGACGCTTAAGGTTAATGGAGTTTCATTAAGGAGAGTTAATCAAGCTTATGTTATTGCTACTTCAACGAAAGTGGATGTTAGTGGAGTTAATGTTGATAAGATTGATGATAAGTATTTTGCTAAGGAGGTTAAGAAGAAGGAGAAGAAGGATGACCAGAAGGCCGTAGATGCAGCATTGCTCAAGGCCATCGAGCCTGTTCCTGAATTGAAGGTCAGGAAACTACATCAATTATATGCTGAAAACTCAAAAGAGAGAGTGGAAATATATTCTAGGGCAATCACTTCCCAAGACAATCTCATTGCAGTTGAACGGTTGTCCAAAGCCAAATTCCTTGCTCAAACAGCAGCCAAGCTTCTCCAAAGCGCCAAACTTTTGAAGGGAGGTCTAATGTGGGAAACACCTTGGATCCGATTTTTCAAATCATGTTCGGAAATTCCAGGAGAAAATGGCATCCAAAACATGGAATTAAGCATAAGAGGAATGGAAATCTCCTTAACTTCATGTCCTTCCTTTTCCACTGGCTTGGTGAAAGAAGAGTTAAAGGACACATTAATACATATGTCTGAGCAAATTCGTCGAAAATCAGACCAAGTCACTCATCAAGAAACGAATGGATCAGACTTTGCCAATAAATCCATCTTTCTCCATGATGACACCATGTCTCCTACACAAACAAGCCTGCCTGCATTTTTCTTCTTATTTTGTGCAAAAATGCTGCTCGACAATTCATCCACATCATATAACGAAGACACACAAAGACTTTGCCATAAGAGCTGGATGAAAATTAGACCAAGAAAAGAAACATTGATGTTCGCGTTGAAGTGTTCTGTTTCTTTAGGCCTAGCTATGTGGATAGGCCTGTTATTCGACAAACAAAATGGTTTTTGGGCAGGGCTGACAGTAGCCAGTACTTTAGCACAAGGCAAATTAGCAACCTTTACACTTGCTAATGCTCAAGCACAAGGCATTGCATTTGGATCAGTCTACGGAGTCTTGGGGTGTTCTGTTTTCCAAAAAGCCACTAACTTAAGGTTCTTAGCTCTTCTCCCTTGGATTATTTTCAGCAGTTTTCTCAAACATAGCCGGATTTCTGGCCACGCAGGAGGAATTTCAGCGTTATTAGGAGCTGTGATGATCTTAGGACGAAAATACTCTGACCCTGCTAATGAATTTGCCATCATAAGACTAACAGAAACTTTTATTGGATTGTCTTGTTTCATTGCGGTACAGTTTTTACTGAACCCAAAACGAGCAGCAAGTCTTGCAAGGAATCAATTGTATTGCACACTGGATATTCTCAAAGATTGCATGAACCAAATCGCGCAAAAAGACCAGCGAGAACTGAGAGGACTAATCGAAAAACAAAGGAAACTAAAATCCCATATTCTGAACTTGCAAAAATTGTGTCTTAATGCAGAACTAGAGCCTGATTTTTGGTTCCTTCCTTTTAATGCAACATGCTACAAGAAGCTGCAAGGTTCTCTCTCAAAAATAGCCGATTTATTTTACTATGTTGTCTACAATATCAACAACATGTCACATGATTTTCAAAGCCATGCTGTTGATTGCAAAGAGCTACATGACTCTATATATGATGAATTGGAGTATTTGAAGGAAACAACAATTTCGTTGATAAGTACATTTCTTGATAAGCCTAGTTTGATGAAGTTGTTCCCAGATGATGATGATCAAGAGGTGAAAATACTTCATGATCTTGAAGAGGGTAAATTGAGTAAAAAGAATGATGAAAAAACAGAAAGAGGATTATGTTTTTTCCTTGAGAGATCAAAAGAGGTGATTGATGGAATATTGAGTAGCCAAGACAAACAGGAGTTAAAAGGAAAGACAATTATTTCATTATATGCTTTGGAATTTTGTATAACAAGCATGTTGAAAGTGATCAAAGATATTAAAATGACTATGAAAGAATTGTCGCAGTGGGAAAGCTCTTGA >CAN.G661.6 ATGGCAACCTCTAACTTTGAATCCATTCGAGCTAGAGCTGTGTGGCGGACTTGTCTAGCCCCCGCCTTTCGGACCGCCTTGGCTTGTTCCATAGTTGGGGTAGCCACCCTTTTCGGCCCCGAATGTTTCAAGACCCAAGTCGCATTCCCCGCTTTTTCCTACGTTACGGTTATTCTCGTCGTGACTAATGCCACGTTAGGTGACACTTTGCGTAGTTGTTGGCTCGCTATTTACGCCACGATTGAAGGTGTTTGCCCTGCTATACTGAGCCTGTGGTTGATCGGGCCGGCCCGGCTCACAGCCAGCACCNNNNNCCACGGCTACTGCCGTGGCACTGAGCGCGTTCGTGGTGGTCCTGCCCGAAAACACTCACTTGATAGCGAAGCGCATAGCGCTAGGTCAACTAGTGATTGTGTATGTCATAGCTTATATTAA >CAN.G1362.1 ATGAAGTGGGAAAGATTTCCTTTCAAGTTCTTAAGACCATATGGAGAGAATCCAGGGGAAAAATTTCAAGAAATCCAAGCACCCTTAAGAGGGATGGAAATTGCATTAGAAAATTCCTCTCCATTTCCAGTTAGCATTCTCAACACAGAGCTAAAATATGGTCTAGAAAAACTAGGAGATCACATCTCAAAGCAAATCAAGAATATGTCCCTTGACGAGTCCGCGACTGTCCCGGAGTCAAACGCACATGACGCAGAAAAGTTCCTCCAAACACTTCAAACACTTCAACCAACGAAAAAAGACCTACCGTCTTTATTTTTCCTCTTTTGCCTAAAATTGTTGTTAAACAAACAAATTTCCCCTTTATCAGCCAAACAAGAAGAATACATTGGTTCCAACAAACAAATTGATCATCATCAAGAGGGATTTATGAGAAAGTTATGGAACAAGTTGGCAATTACTATAAATAGTAGAAGATTTATGGCAGCTTTTAAATGTTCACTTTCATTAGGCCTTTCAATACTTCTTGGATCAATTTATAGCAAGGAAAATGGATTTTGGGCAGGGCTACCAGTTGCAATAAGCCTAGCAGCAACAAGAGAAGCAACATTTAAAGTTGCTAATGTTAAAGCACAAGGGACAGTGTTGGGAACAGTATATGGTGTCTTGGGATGTTTTGTTTTTGAAAGATTTGTGCAAATAAGGTTGTTGTCTTTGCTTCCTTGGTTCATAGTCAGCAGCTTTCTGAGCCGTAGCCGGATGTACGGCCAGGCAGGTGGAATTTCAGCAGTTATTGGAGCAGTACTAATTCTAGGTAGACAAGGATTTGGTCCCCCAAGTGAATTTGGGATAGCAAGAATCACAGAGACCTTCATTGGATTATCATGTTCCATCATGGTTGAAATTTTGTTCAACCCAACAAGAGCTTCAACATTAGTTAAAATCCAGCTTTCCAACACCTTCAAAACCTTACACCAATGCATCGACTCAATTACCTTTTCTTCCTCTAACAAAAACAACTTGGAGGATATCCATAAGAATCTAAAGTTCCACGTAAATGAATTGGGAAAATTCATAGCGGAAGCTGAGGCAGAGCCCAACTTTTGGTTTTTGCCTTTTAGTAGTGGTTGCTATGGTAAGGTCATGGAGTCCTTGTCAAAGATGATGGATTATGTACTTTTTGGGTCACAAGCACTAAGATTCCTCCAACAACATTCGACAAGTTCAGTCGACTGGAACAACCTGGATAATGACCTCATGCTTTATAAGGATTTAATCGGCACATCCACTAAATGTTACGCGGAGGTTAGTTTGGTAAAATCACTTGCTATACTTGACAAGGAATTCGAGAAAAAGAAACTGCCAATAGATCTTGAGTTGGGAAAATCATCATCATATAATATAAGGGCATCATCAAGTGAAGAGGGGATTTTAAATTCTTATCTTCAACATTCAAATGAACTTGCGGATTTTATAGTCAATGTTGATAGTAATAAAAGTGATGAGAAACTCAAAGGCCAATTGGTTTTAAGTTTGAGCGCTTTGGGTTTTTGCATGGAGAGTCTTGTGAAGGAGACTAAAGAAACAGAGAAGGCAATTAAAGAAATTGTACAGTGGGAGAACCCATCGTGTCATGTAAATTTGTATGACATTGCTTGTAAAGTAAGGGCTTTAGCTAATACTGAAACAAATTTAAATGAATGA >FVE14147 ATGGCAACTTCTCAAGAGCAAACCAACCGTGCCCGAGCCTTGTGGCTAACATGCCTCGCTTCGGCCTTGCGAACCGCTCTAGCTTGCACCATAGTAGCCATCATCACCCTCTATGGCCCTCCCTCTCTCCGGCACCAAGTAGCCTTGCCTGCATTCTCCTACGTGACTGTCATCCTCATTGTTCCTGATGCAACTCTAGGTGACACATTGCGTGGATTCTGGCTCGCACTTTACGCCACTATCCAGAGCGTCGGGCCTGCTATATTGAGCCTATGGCTCATTGGACCGGCCCGCCTTACAACCAGCACAACGGCATTGGCCGTTGGTCTAGCAGCATTTGTGGTGGTTCTGCCTGGAGAGGCTACTCATTTGGTGTCCAAGCGCATAGCCTTGGGACAGATTGTGCTTGTGTACGTGATTGCTTTCATAAAGGGTGGGAGTGCGGACGCCATCATGCACCCTGTGCATGTAGCAGCGAGTACGGCCGTTGGTGTCTTGGCTTGTGTTCTTGCTTTGTTGGTTCCATTCCCACGCTTGGCTTGTCGAGAGGTTAAACAAAACTCAAAGGTGCTTGTGGATAATGCTTCGGAGAGGCTTAAGCTCTTTATGAAGGCTTTTTGTGCAGAAGATAACGCATCCGCGCTTGCTTCAGTTTCACAAACAAAGTCCTTGGCTTCTACAGCAACCAAGCTTTTCCAAACCATAAGATGCCACCAGGAAAGCATGCAATGGGAGAGACTTCCACTAACTCTTTTGAGACACAGTAACGTCAATCCAGGAAGCAGATTGCAAGGTTTGGAGATTCCCTTGAAAGGGATGGAAATGGCATTGAGTAGTACTCCTTCATTCCCAGTTGGGGTAGTGGATGGAGAGGTCAAGAGTGCTCTACTTAAACTAGTAGAGGAGCAAATGAGCTTAAATAGAAGCATCCATTGTGAGGATGCAATAACTATTCCTGAATCAAAACCAGAAATTGATATTAGGTGCCTCCAAACACTTCAAACCATCCCACAAACCCTACAGGATTTACCCCCATTTTTCTTTTTGTTTTGTATAAGTCTCCTTCATGGAAATTTATCAGCCACAAGTAGTTCTGCTACTATTGCACAGGACAAATTGGTGACTCACCCAAAAAAAGAAGCACTTACTTCATGTAAACAAAGTGTGGTATGGAGTAACTTCTCCATGAAGGTAAATAGCAAAAGGATTATGGCAGCTTTCAAGTGCTCACTTTCAGTAGGTCTAGCTGTGTTCTTTGGTTTGATATTCAGCAAAGAAAATGGCCACTGGTCAGGGCTCCCAGTTGCTGTAAGTTTCGCCGCAACTAGAGAAGCAACATTCAAAGTTGCAAATGTTAAAGCACAAGGGACTGTTTTGGGCACTGTATATGGAGTTTTTGGTTGTTTTTTGTTCCACAAGGTCTTACCCATTAGAATCTTATCTCTAGTTCCTTGGTTCATTTTCACCAGTTTTCTTCAGAGAAGCAAATTGTATGGCCAAGCTGGTGGTATTTCTGCAGTAATTGGAGCTGTACTAATTTTGGGCAGAACCAAGTTTGGGACTCCAAGTGAATTTGCCATAGCAAGAATCACAGAAACCTTCATTGGGTTATCGTGTTCGATTTTTGTCGAGCTGCTGTTGCAACCCACAAGAGCTTCCACTCTTGCAAAAGTTCAACTATCTAGGACTCTAGGGGCATTGCATGAGTGTATTGACTCAGTGAGTCTTCAATCTGGAAGAGCACAATTGGAAGACAGCCAAAAGTGTCTGAAACTTCATGTTGAAGAATTGGGGAAGTTCATTGCAGAAGCCGATGTGGAGCCTAATTTCTGGTTCTTGCCTTTGCATACTGCGTCTTATGGAAAGCTCATGAGTTCGATCTCCAAAATGATGGAGCTCCTGGTTTTTAGTGGCCATGCAATTGGAGTTCTTGAACAAAATTCACAATTTCTCGAGGGTTCTTGGAAAGGCATTGTGGCTAAAATGGAATGTGATCTTGAACTTTTCAAGAAGATGGTTGGCTCTTTGATTATTTGCTTTAGAGATATCACACTGCTCAAGTCAGTAACGGTTCTCGAGAGGGAAGGGCTTGATGATCAAGAAAGTGGCAAATCTTGTGATCTCGAGTTAGGGAAACCGCAAACCCTAAAAGCATTCAGGGTTTGTGGTTTAGAGGATGCAGAGATGGACAAGATTGTAAGTTCGTATCTTTTACACTCAAAGGAAGCTGTTGATAAAATTCATTGTCAGCAAAATGAGGAGCTCAAGGGCCAGATCGTTTTATGTTTAAGTGCTATAGGCTTCTGCGTAAGTGGTTTGATAAGAGCAACAAGAGAGATAGAAGAGGGAATTAAAGAACTTGTTCAATGGGAGAATCCTTCAAGCCACGTTAATTTGTATGAAATCTCTTGTAAGATGCATGCTCATCAAAAGTAA >FVE14150 ATGGCAACCTCTCAAGAGCAAACTAATCGTGCCCGAGCCTTGTGGCTAACATGCCTTGCTTCGGCCTTGCGAACCGCTCTAGCTTGCACCATAGTAGCCATCATCACCCTCTATGGCCCTCCCTCTCTCCGGCACCAAGTAGCCTTGCCTGCATTCTCCTACGTGACTGTCATCCTCATTGTTCCTGATGCAACTCTAGGTGACACATTGCGTGGATTCTGGCTCGCACTTTACGCTACTATCCAGAGCGTCGGGCCGGGTATATTGAGCCTATGGCTCATTAGACCGGCCCGCCTTACCACCAGCACAACGGTTGTGGCCGTTGGTTTGGCAGCATTTGTGGTGGTTCTGCCTGGAGAGGCTACTCATTTGGTGTCCAAACGCATAGCCTTGGGACAGATTGTGCTTGTATACGTGATTGCTTTCATAAAGGGTGGGAGCGTGGACGCCATCATGCACCCTGTGCATGTAGCAGCGAGTACGGCCGTTGGTGTCTTGGCTTGTGTTCTTGCTTTGTTGGTTCCATTCCCACGCTTGGCTAGCCGAGAGGTTAAACAGAACTCAAAGCTGCTCGTGGAGAATGCTTCGGAGAGGCTCAAGCTCTTTGTGAAGGCTTTCTGTGCAGAAGATAACTCATCTGCGCTTGCTTCAATTTCACAAACCAAGTCCTTGGCTTCTACAGCAATAAAGCTTTTCCAAACCATCAAACGCCACCAGGAAAGCATGCAATGGGAGAGATTTCCATTAACTCTTTTGAGACACAGCAACTTCAATCCGGGAAACAGATTGCGAGGTTTGGAGATTCCTTTGAAAGGAATGGAAATGGCATTGAGCATTACTCCTTCATTCCCAGTTGGGGTAGTGGATGGAGATGGAGAGCTCAAGAGTGCTCTACTTAAACTAGTAGAGGAGCAAATGAGCTTAAATACAAGCATTCCTTGTGAAGATGCAATAACTGTTCCTGAATCAAAACCAGAAATTGATATTAGGTGCCTCCAAACACTTCAAACCATCCCACAAACCCTACAGAATTTACCCCCATTTTTCTTTTTGTTTTGTATAAGTCTCCTTCATGGAAATTTATCAGCCACAAGTAGTTCTGCTACTACTGCACAGGACAAATTGGTGACTCACCCAAAAAAAGAAGCACTTACTTCATGTAAACAAAGTGTGGTATGGAGTAACTTCTACATGAAGGTAAATAGCAAAAGGGTTATGGCAGCTTTCAAGTGCTCACTTTCAGTAGGTCTAGCTGTGTTCTTTGGTTTGATATTCAGCAAAGAAAATGGCCACTGGTCAGGGCTCCCAGTTGCTGTAAGTTTCACCGCCGCTAGAGAAGCAACATTCAAAGTTGCAAATGTTAAAGCACAAGGGACTGTTTTGGGCACTCTGCTGTTGCAACCCACAAGAGCTTCCACTCTTGCAAAAGTTCAACTATCTAGGACTCTAGGGGCATTGCATGAGTGTATTGACTCAGTGAGTCTTCAATTTGGAAGAGCACAATTGGAAGACAGCCAAAAGTGTCTGAAACTTCATGTTGAAGAATTGGGGAAGTTCATTGCAGAAGCCGATGTGGAGCCTAATTTCTGGTTCTTACCTTTTCACACTGCTTCTTATGGAAAGCTCATGAGTTCGCTCTCCAAAATGATGGAGCTCCTGGTTTTTAGTGGTCATGCAATTGGAGTTGTTGAACAAAATTCACAATTTCTCGAGGGTTCTTGGAAATGCATTGTGGCTAAAATGGAATGTGATCTTGAACTTTTCAAGAAGATGGTTGGCTCTTTGATTATTTGCTTTAGAGACATCACACTGCTCAAGTCAGTAACGGTTCTCGAGAAGGAAGGGCTTGATGATCAAGAAAGTGGCAAATCTTGTGATCTCGAGTTAGGGAAACCGCAAACCCTAAAAGCATTCAGGATTTGTGGTTTAGTGGATGAAGAGATGGACAAGATTGTAAGTTCGTATCTTCTACACTCAAAGGAAGCTGTTGGTATAATTCATTGTCAGCAAACTGAGGAGCTCAAGGGCCAGATCGTTTTATGTTTGAGTGCTATAGGCTTCTGCAGGGGATCCAAGAAAATGGCTACCAATTCCTCCAATGGGGAGCACCAGACTACAACAAAGCAGCCTCCTTTGCCATCCCCTCTGCGTTTTTCCAAATTTTTTCAGTCGAATATGAGAATCTTAGTTACTGGAGGAGCTGGATTCATCGGTTCTCACCTGGTTGATAGATTAATGGAAAATGAAAAGAATGAGGTTATTGTTGTTGATAACTATTTCACTGGCTCCAAGGACAATCTTAAAAAATGGATTGGTCATCCCAGATTTGAGCTTATTCGTCATGATGTCACTGAGACATTGTTGGTTGAGGTTGATCGGATATACCATCTTGCATGCCCAGCTTCTCCAATTTTCTACAAATATAATCCTGTAAAGACAATAAAAACAAATGTGATTGGCACTCTAAACATGCTTGGACTTGCCAAGCGAGTTGGAGCGAGGATTTTGCTGACATCAACTTCAGAGGTATATGGAGATCCCCTTGTGCACCCGCAACCTGAGAGCTATTGGGGTAATGTTAACCCAATTGGAGTGAGGAGCTGCTATGATGAGGGCAAGCGTGTTGCTGAGACTTTGATGTTTGATTATCATCGGCAACATGGGATAGAAATACGCATTGCCAGAATCTTCAACACATATGGCCCTCGCATGAATATTGATGATGGGCGTGTAGTTAGCAACTTTATAGCTCAAGCACTTCGGGATGAACCTTTGACGGTCCAGAACCCTGGAACTCAGACTCGCAGTTTCTGTTACGTATCTGACATGGTTGATGGCCTCATCCGTCTCATGGAAGGAGAGCACACTGGACCCATAAACATTGGAAACCCAGGTGAATTTACAATGCTTGAACTCGCAGAGACAGTGAAAGAGCTCATCAACCCACAAGTAGAGATTAAAAGGGTGGAGAACACTCCTGATGACCCAAGACAAAGGAAACCCGACATCACAAAGGCAAAAGAATTGCTGGGATGGGAGCCAAAAATAACGTTAAGGGAAGGTCTGCCTCTAATGGAGGAGGATTTCCGTCTGAGGCTTGGAGCAGCCAAAAAGAACTGA >FVE11949 ATGGGTATTGTCTCAGTTTGGTGTGATGGGAATAAATCAAGTCTCAGGAGAAGAGGAGAGGGTGATGATGTCAGTTTCTTGTCTGAGATCGCAGGTTTCCTAAGGGAGGTACATCGGCAGTTCAGAGGAAGGTGGATGGATCTGATTTGGATGTTTGGATGGCTGGAAGTGCTAGATTTCCATGCTTGCATTCAGAAAAAAATGGCAGGAGGGAGAGACGTCCTATGTTTGTTTGACGTGAGGCGGAAGACGGCAGAGAAGCTGCTGGTGATGGGACGACCTATGTTTTGCAAATCGGATGTGGGCAATGATGGCATTAGTTCCATCAGCAAGAAGAATGATCTGGATAATGGAAGATTTTTGAGTGAAGATATGATTAAGGGTGGAAAATTGAAAGACGTCGGTTGTGCGGAAACAACCTGTGCTATGGGAAGAGATTGTTGGTGTTGCACACGAAAGGAGATAAGAAACTATTGCTATGCTACACAGAAGACGACGCGGCGGTCTGAGATAGATGACGGGCGGTCTGGGGCGACGCCGAGGCAGTATGATGGTCAGAGGTCGAAGGAGCTGCGGGATCTCGTCTGGGATCGCCGGAGATTCGTCTTGGTTTCGATGTCTACTCGACGAGAACTGGGTATTGGGAAGAGGAAGAAACAGAGTTCTTCTTCTTGGTTATGGTGCTGGTATTTTCTGGTACTTGGGTAA >FVE18223 ATGAGTCCGGGCAGTGGTACTACTGGCTGGACATGTATGTTGTGGCGTGTAAGGCTACACTCAGCCTTCCGAACCATCTTAGCCTGCTCAATGATCTACCTCACCACCCTCTATGCCCCGAAAACTCTCAAACAATTGGTAGCATACCCAGCCTATTCTTACCTGACAACAATCTTAACAGTCTCAGCAGACTCAACCCTTGGTGATGCCTTGAAAGGCTTCTGGCATGCCCTGTATGCTTGTGCTCAGGTTCTAACTCTGTCAATTTTTAGCCTCCAGCTGATTGGGCCCGCGCACTTCACCTCTCATGTGATTGCAGCCTTGGCAGTGGCTGTGTCTGCGTTTGTTGTGGCATTACCAGAAGGAACAGACTTGATGTGTAAGCGGATTGCGTTTGGGCAGATTGTGATAGTCTATGTGGGCACTGCTGTTCATAGTAGTACTTCACAGCCGAATCATGATCAGTATGATATGGTACTCACGCACCCAATTCAAGTGGCTTCAAGTACTGTGCTCGGAGCATTGGCATCTGTTCTGGCTATGTTGTTTCCAAACCTGGTCTTCTACCATGAAGCTTCTTTTCTTGCTATGTTGTCTCCTCACCTTGGCTATCACCAGGAAGCCTTGGTGTGGGAGAGACCGGATATCAGAATCCTTAGACCAAGTTGCACTGATTTGGAAAAGAAATTGCAGGATATAGAAGTACCCTTGCGAGGAATGGAAGTAGCTCTAATTTGTTGCCCTTCATTTCCTGTTGCCATGATTGAGAAAAGGCTATTGAAGAATGCAAGCTGGACACTAAGATTGAAAGTTTCAGTGGATCCACAAAACCAAAGCAATATCAGTATCAAAAGGAGCCGGAGCACTCTAGATCACATTATACCAAGCAGAGCAAGTTTACTTTTTGCAATCAAGTGCTCGCTTTCTCTAGGTCTTGCAGTGCTATTTGGTTTGATTTACAATGAAAAAGAAGCGTATTGGGCAGGACTCACAATTGCAATAAGTTTTGTCACAGGAAGACAAGCGACATTTACACTTGCTAATGCTCGAGCACAATCAACATCAATGGGATCAATCTACGGAGTCTTGTGCTGTTTTCTTTTCCAAAAATTTGAGGATCTAAGCTTCTTGCCTCTGCTTCCTTGGTTACTATTCACAAGTTTTTTAAGGCACAGTAGGATGTATGGTCAAGCTGGCAGGATATCAGCAGCTGTTGGGGCATTACTAATGCTTGGTAGGAAAAATTATGGCTCTCCCATCGATTTTGCTATTGCTAGAATCACAGAGGCTGTAATTGGATTGATCTGTTTTGTCACCATAGAGATTCTCTCATGTCCTGACAAGTTGAAATCCCATCTCGATCAATTGGAGAAGTTTGTTGTCGAAGCTGAGTTGGAGCCAAATTTCTGGTTCATCCCTTTCAATGGCGCTTATTATCGGAAGCTCCTCAGGTCTGTATCAAAAATGAGGTACCTTTCACTTTTTATGTCCAACAAAGTAGAATCTCTATCTGTGCAGTATGAGATAGACGACGGACGGTTTGGGGCTACGCCAAGGCAGTGTGATGGTCGGAGGTCGAAGGATCTGGGGGATCTCGTCTGGGATCGCCGGAGATCTGCCCGACGAGAACTAGGTATTGGGAAGAGGAAGAAACAGAGTTCTTCTTGGTTATGGTACTGGTATATTCTGGTTGAATCTGTGGCATTAAAAAGATTTGAAGTTGCTTCAGAGGACCTCCAAAGCCAAATCAAGGGCATGAAGAATGATCTAGATCTTTTCAAGAAGAAAGTCTTCTCCTCACTTTTATGCCTTCAAGAGTTGTCTTCCAAGAAGTCTCTTGCAGTATGTGACAAGCATGACATTGAATTAGGAACATCACAGAAGGTAAATGAGTGTAGGGGTTCGGGTACATATGAGGAAGATGTTGAGTGTTCCATTTTAGGTTCTTTTCTTCAACATTCCAACGATTTATCGGATGGAATTGGTACCGGTGAAGGGGAGGAAGATGAGAAGCTTAAAAGCCAGGTGGTTCTTTGTTTGGGTGGCCTCGGATTCTGCATCACTAGTCTGCTGAGGGAAGTACTAGAGATGGAGAAAGAGTTTCAAGAACTAGCCAAATGGGAGAACCCTTCAAGCCATGTTGTTGTATAA >FVE18237 ATGGCTCCATCCTCTCCAACAATGGGGAACGAAATCCATCCCTTATGGCGCCTGCGCTTAGCCGCTGCTCTCCGGACTGCCTTCGCCTGCACCATAGTCGGCTGCACCACCTTCTACAGCCCGAAACCTATCCGCAATTTCTTAACCTACCCATCGTTTTCTTACATGACAACAATCCTTATAGTCTCGGACGCAACCCTAGGCCAGACCCTTATGAGCTGTTGGCATGTGCTCTACGCTACATGCCAGGTGATGGCTTCTTCCGTGCCGGCCCTGTGGCTGATTGGACCAGCACGGTTCACTAACGAGGTGGCGGCCGGGGCGGTGGCTGTCAGTGTGTTTATGGTGGCGTTGCCGGGGTCGACGCACTTGATGACCAAAAGGATCGCGTTTGGGCAGTTTGTGAATGTTTACGTCGGTACTGTTGTTCAAGGTGCTGGTACTAATATTGTCTTGCACCCAACTGAGGTGGTGGCGAGTACAGCGCTTGGAGCTTTGGCTTCTGTTCTTGCTATGATGTTTCCATATCCTCGGCTAGCTTACTATGAGGTTAAGAAATCATGGCGACTCTATGCTGAAAATGCCTCCAAGAGGTTAAGTCTTTTTGTTGAAGCGATATCTGCCGACGACAATAGAGTAGCACTTGACTCCATTTCTCAAGGAAAATCTCTTTCCAAAGCAGCAGCTAAGCTTCTTCAAAGTATCAATCATAATCTGGAAGGTATGTTGTGGGAGAGACCAGATATCAAATTTCTAAGACCAAACCATAGAGACTTGGGACTTAGGTTGCAAGAAATGGAGATTCCAATTAGGGGGATGGAGATGGCTTTATCTTCTTCTTCTTCCTTTCCTCCTGATATGATCGACGAAGGGCTGAGAGATCATTTACGTAACTCACAACTACAGATAAGCCTAAAACTGCAATCTAAGTACTCCGTGCCTTCTGAGGCAACAACAGTTCCAGAAGGTGAGAGAGAAGTCTTGGACAAGCCCCTTTTAACTAACAAAACCACCACAACAACCCATCAAGATCTTCCAGCTTTGTTCTTCTTGTACTGCATGGAGCTTCTCTTAGGTGACCTCCCTATTGCTCGGAGTCCCGGGAACAACCCAAATTGCAAAGGAAAAACAGGTGATTCACAAACTCAAGCGCAGTGTATCTGTAAAAGGGTCTGGAGAAGCATAAGTCCAAGCCTCCCCAATTTTATTTTTGCCCTCAAGTGCTCAATCGCATTAGGGTTTGCTGTGTTACTTGGTTTGATTTACAACAAGAGGCAAGGATACTGGTCAGGCCTCACCATCGCCATTAGCTTCGTAACAGGAAGACAAGCGACATTTACAGTTGCGAATGCTAGAGCACAAGGAACAGCATTGGGATCAGTCTATGGAATCATATGCTTCTATCTTTTTCACAGCGTTAGCGAGCTGAGGCTCTTAGCCATCTTACCTTGGGTTGTCTTCACTCATTTTCTTAGGCATAGCAAGATGTATGGCCAAGCTGGTGGGATCTCCGCGGCAATTGGGGCGTTGCTAATCTTGGGTAGAGAACATTATGGTCAACCAAGTGGCTTTGCAATTGCAAGACTTGCGGAGGCTTGCATTGGATTGATCTGTTTTACTGTAGTAGAGGTTCTCTTTTATCCTATGAGAGCAGCGACCCTAGCCAAAAATCAATTTGCGCAAAGCTTGGGGGCACTCAGAGACTGTGTCCAAGACATAAACCTATGTGTACCAGCTTCTACTGGACTGAGAGAAAAGCACAAGAAGCTAAAATCTCATGTCAATAAGTTAGAGAACTTCATTGAGGAAGCTAAAACAGAGCCTAATTTCTGGTTCTTGCCCTTTGAAGGTGATTGTTACGGTAGGATCCTAGAATCCATGTCGAAAATGGCGGATCTTCTACCCTTTGTGGCACACAATGCAGACTTCATCTCACAGAAATCTGGAGGTGCTTCACTGGAGCTAAAACAACATTCCAATACTGATCTGCAGCATCTAAAAGAGAAAATCGGGAATTCACTAAAGTGCCTTGAGCAGCTGACTTCGATGAAATCCGTTGCAGCATTTGATACAGAGGCGCAGAGCGTATACGATAGCGAAATGGGCGTATCACCAAACCCGTTCATGATTTTGGGTACATATGATGATCATGCTGAGGCTACTGTAAGTACTTTCGTTCAACATATCCAAGAAGCAGTTGTCAAAGTACGTAATGGTGATGATGAAGTTAAGGATGTGACCCAAATGGTTCTTTGTTTGAGCAGCCTGGCATTCTGCATCCGTAGTTTGAGCGAAGAAACGATGAAGATCAAGGAAGAAGTAAGAAAACTAGTCAAATGA >Mapoly0005s0035 ATGAAATCAGTGTACGTGAACCGCTTTTTGCAAAGAGTAGCATGCGGCACGAGAACCGGATTGGGAGTTCTCATCGTCGGGCTGCTCCTGCAATTTGTGAAGGGCTTGCAGGATTTAGTCATCTTCTCGACCTTCGCACCGGTGATGACAATTTGCATTTGTGACACAACAGTCGGCAAGGCTTTGCGGAATTCCATAACTGTTGCCGTTATTTCAGTTTTCAACATCGCCACGAGCATCGTGGTGTATCGATTTCTGAAACCTCCCATGCACCTCGGCGTGTCTATCGTGTGCATTGGCCTTTTCAGCTTCATAGTGTCCTATCCAAGCAGCGTGCATTTGCTCTCTAGAAAAATCGGGCTTGCTCAGGTTGGTGTGCTGTACGTCTATGCACACGTCGTTCCGACCATGGATGTCATCATGGTCCCGCTCAAGTTGCTCTTTTCGACCACTCTCGGATCATTTGCTGGAGTCGTGGCAATCATCATTCCCTATCCTCGATTCGGCGTTCGGGAGGTGCTCCGGGGTGCTGAATCTACAGCGCGCAGCACATCTGAATTGTTGAAGGCAGCCGTCAGGGCATTTGCTGCACCTGATGAAGGGAGTTTCTCGGCCATCAGGCTTCATGCTAAGATGCTGAGGAAAGCTGCTTTGGAGTCACTAGCAGAACTCAAGGAAAAGCAGGCAGAGATATGGTGGGAGTTGAAGGCCAGTTGTTCCAAACGATCACGTTTCACAAATATGACAAGAGGGCTAAGTGGGCTGAATCAACATCTGACAGGGATGGAAGTGGCTTTACAGTCCGGCTACACGCTACAATGTCCAGAAGTGATGAGGAAAACGCTGGAGCAGCCCCTTCTGAAGGTTGCAGATTATTGCGGTCGCCTCCTGGAGGTGGCGACCAAGACCTTGACATCGTGCACCGTGTGCAGTTGCGCCTACAACTTACAGGCGGAAGAACGCCAGTTACTGATGGACGAAGGGAAGCTGGCACTGAAATTGTTCGATCTTGCACTCCTGGAAGCGCGCAAGAGTGCGTACTACTCGGCTCCACCGATCGATGAGTCTGTCCAGACTGAAGGAGCTGAGCATGCCTCCGGGTCTCCCGATGCTGAAGGTCATATTTTGAAGCAGGTGCCGGCCATGGTGGCACCTGTGCATCGTCGATTCATGGCGAGGTTGACGGGAAATTTCTTCATGTTCAGCTTGAGATTGTACTTTGTGGAAGCAATGCTTCTGGTGGACGCCGACTTCAGAATACACACCAGCATGCACGAGATCGCAGGAGCACGCTTGCTTAACTGGATTCCAAAACGCATGTCCAAGTTCCAAGTCATGCCTCCGAATCCGATCTTCGAACCACCGCCCGCAGATCGGATCAAGTCCTCGATCGACTTGTCCGTCATCGAAGAAGGCGACTCGTCCCCTCCCTCTACAGGCACCAGTCCAGAAGCCGAGGCAGGAGCAACAGCAGAAGCAGCAGCTGCTCCCGGAGAGTCTTCGGAGTCCAGCCCTCAGCTGTCCGACACGCAGTGCAGTCACTGCAAATCCAGTCTCCGGGCGTCATCTCAAAGCCCGGCACCGGACATTCGGACGCGCTGGTGGACGGTGATGAAGCCCAACAAAGCTCAGGTCGTGAAATCTGCCAAAGTGTCCATGATAATGATGCTGGCGACCGTGTTCGGAGTCCATGCTCTTCCGAATGACATCCATGCCTGCTGGGCTCCTATTACCGTGAGCTTCATCATCGGCAACCTGCAGGGCGGAGCATTCCGGCTCGCGAGTCTGCGTATTCAAGGCACGGCCGTGGGGTCCATCTTCGGGTACCTGGTCGTGAGCGAGCTGTACAACCATAAGTATATCTTGCCCTTGATTTTGGCAGGCTGGGTCTCGTTTTCGGACTACATTCGTTACAGCAAGACCCACGGATACTCGGGACTGGTGTCAGCCCTGACGGCAGCGATCCTGATGGTCGGAGATTTTGATGGCCAGGACATCAAAGCATTCGCCATGGATCGAATCGCAATGACGTTCATCGGTGTTGCGTGTTTCGTTTTGGTCGAGACGCTTTTGCTGCCCGAGCGGGCGGTCGTGCTCGTGAGGGAGGAGCTGCTGCAGAGTCTGAAACGGCTCAGGGACTGCGTGGCGGCCATCGTTGCAGTGTACACGAGCCATGAAGTGTGCTTGAAGTGTCGAACTTCTGCCGTGAAAGACATGCAGAAGCTCGAGCAGCAGATCACGGCTGGTTTGGTAGCACAGACTTCGCTGAACAACGAGGCAGTGTTGGAGCCCGATCTGTGGTTCGTGCCACATCCCGGGGAAGTGTATACTCGAGTGATCTCGATCCAGAAACGGATGCTGGACCTTCTGTTCTTCATGGTGTGCTCCTTGCAAGCCTCGACGGAGGACTGGTCGGACGAGCACATGCAAAAGCTCCTGAAGCCGCTCAGATCTTCCTTGACTGCGCTGGAAGACGAGGTCCTGGCGACGGTCGACTCTCTCCAGAAGCTGCTCGAGAAGACGAACAAGTCGTGGGATTGGCTGCCGAGTCCCAAGACTCTCCTGTCCGCCTTCCGAGGCGGAGTCCCTTGTGCTGGCGATGTGGAGAGGCAGAGGCCCGGCCGACGGCGGCGCTTGGGCTCGGTGGCCGAGGTTTTCCAGCCCTCTCGAAGAGCTTCTCGTGCTCTCCTGGCCCTCGGGCACCGACGGCGTTCTATCGGTGGTACTCCCATCAGGCTCAAGACCACCATGGACCGCTTCGAGCAGACGTTTGAGAGCGTGCTCGACGAACTCATGGCAGCTCATTCCAAGACAGTGGAATCTGGCGGCGGCGGTGACGGCAACGTTGTGAGCAATTCAGTGATGCTGTCCATAAGTTCGCTCAGTTTTTGTCTCCATTCCCTTTTGAAAGAGACTGTCGACCTCGAGAAAGCTGTCTGGGAATTGCTGCAGGCCGAGAATCCTCTGAGCATTCTGGATTTCTGGGACGAGTTTGGACCTGCGTCTCCGCTGTACCGTCAACAGCCAGAGGAGGATCCGCTGCCGCCACAGAGAAAAAATTCATGGTCATAA >Mapoly0183s0021 ATGAGGCTCGTCAGACGGCTGAAGCTTCTGTTGTGCGGTGATGGAAAATTCTTGTACTGGAATGGGTTCGTCGACAAGGCGACGGCGGCGTTGCGGGCCGCGCTGGGGATTTTGATGATCGCTGCCGTGGTGGATTACGTGCCGGATCATGATCTCAAGGTGTACTGCGCCTCGTTCACCACATTCGCGCCGATGATCGCTGCCAACGCTGGCGAGTCGTCGCTGGGCAAGGTGCTGCAGAACATCGTGGCCGTGTTCGAGACCTCGGTGATCACCATGTGCGTCACGATGCTCGTCCTCCGATTCATCGTCCCCCCGTTCCATTTGGGCGTGACGGTGATTTGCATCGGAGTCAGCTCCTTCGCCATCGCCTACCCGACTCGCATCTCCGTCTTGGGCAAGAAGGTCGGCCTCGCTCAGATCGTCATCACGTTCGTCTCCGCCCACCTGAACCCCGATCTCGACGTCGTCCACATGCCCGTCAAGTACCTGTCGTCCATCACCGTGGGATCTGCTGCCGCACTGGTCGCGTACTCCTTTCCCGCTCCCCGGCTCGGCGTCGTCCAGGTCCAACGGAGCGCGAATTCGGCGGTGCGTTGCCTCACGGAGCTCTTCAAGACAGTCACGTGCGGATTTTCCACGAACGATCCCAACTCAATGTACTCCGTGAGCGTGCACACGCGAGCTCTGCGCAAGTCTGCCAACGATGTGGTCAAGCAGCTCCACTCCATCCAGGCGGATCTCTGGTGGGAGCTGAGGGCTTGCTGCTCGATGCCAGCGCTCAACAATTTGATCGACGGATTGAGTAGATTGAACTTGCACATCGCGGGCATGGAGTATTCGCTCCAGTCGGACCATTTGCTACGAAGCCCTCCGACGCTGCGAGACACGATGAAGGAGTCGCTCTTGGTGCTGGCCGAGGAGAACAGCCACTTGCTGGCCAGGGCAACGGGGGTGACGGTTTTCTCCCACTGGTGCCTCAATTCCCAGGAGCCCGCTCGGATCGAGGACGGCAAGGAGGCGCTGTTTTTGTTCGAGGAGACTTTCATGTACGCCAGGAAGAAAGCCTTCTACACGTCGGACGAGCCCACCATGGTCGACAACATCTTGAGCGGAGCTTGCGTCCTCGACGGGCTGCCCATGCGAGGGATGGCGAACTCTCGCTGCAGCAGCACCGACACCGACGACATCCCCTCGTCCTCGAAGGGCAGATTCATGGCCAGAGCCACCACCTACTTCTTCCTGTTCAATGTCAAGCTGTACACCGAGCAGGCTATGCAGCTGGTGGATCCTTTCTACAGGCCTGTTCGTGAGCACAAGGCTCCCGGTCTGAAGAAGTGGATTCCCGGGCTCGAGCAGCGCTTGAGCCTCGCTAATGCTGCTGCTGCTTCTGCGGATTCTTCGAGAGCTACGGAAAGCTCTGGATCCGGATCAGCAGCAGCAGCAGCAGAGATGGCTCACGGTCGAGCCCCTGCAGCAGCACAAATCGGGTGCAACCTGTGCACTCAGGTCCGGGTGCGCAAGGATTTGGAGTCGGGCTTCTCATTCAGGTTCTACCGAGCATTCAGATCGTGCATACAGCCAAACACGAAGCAGATGAAGGGAGCTCTGAAGATCTCCATCGCCTTGATGCTGGCGACCGTCTTCGGAGCCTTGGACCTCAAGGGAGACTCGCACCAGGTCTGGGCGGCCACCACCGTGTGCTACATCATCGGCTACCACCAGGGAGGCGCATTCCGGATCGCTCTGCAGCGATTCCAGGGCACGACCATCGGAGCGATTTTTGGGTACCTGGCCATCCGAGGCTCGGGCTCGCAGGGCTTCGTTATCATGATCGTCATCACCCTGTGGACCGTGTGCACCAACATCGTCAAGCACAGCAAAATGCATGGCTACTCTGGCGGCTGTGCTGGGTCTACGGCCGTGGGCATGATGCTGGGAGATCCACCGGAAGATATTCAAACCTACGCCGTGCAGAAGATCACTCAAACCTTCATCGGAGTGCTGAGCTACGTGCTGGTGGAGCTCTTGGTGTTCCCGGACCGAGCCAGGAATTTGGTCAAGACAGAGCTGGTGCATAACATCGTGCGCTTGAGAGATGCCGTGGCCGAGGTCGTGGACATGTACACGGGAGCCAGAGCCGGATGCTTGGAGTGCCGCCACCGACGAGTGGACGAGATAACGAAGCTGGAAAGGCACCTGAGGAAGGATTTGGATCACCAGACTCACTTGCAGGAGGAAGCTGGCCTCGAGCCCGATCTGTGGTGGGTTCCTTTCCCCGGAGACGTGTACTCGAAGATCGCTGCCATCCAAGGCCGCATGCTGGACCTGCTCGTCTTCATGCTCTGCTGTCTGCAGGCCTCGTCGGACGAGGAGTACGATGACCATATGCAGATGCTGCTGGAACCGCTGCAGATCTCGCTCACGATGTTGAAGGACGAGGTGGCCAGCACCTTGAATCTTCTGCACAAATTGCTCGACGATCACAGCAGAAAGCGTCCGGGAATGTTGGAGAGGAACTGCTGCTGCTGCAGAGTTTCTGTCACCTTCCAAACGGCCGATGATTTGGAGAGCTCGCTTAGCACTTCCGAGCCCTCGGAGCCGACCATGCATCCGATCCGGGTGCTCGACAATCGCCGAAGGACCGTCGAGGGAACTCCTCTGACTCTCAAGTCCAGCATGGAGAGCTTCGAGCATGTGTACGAGAGCGTGTTCGAGGAAATCATCGCGGACAGCAAGAAACAAGGCGGCCGGATCGTGAACAACTCCGTCATGCTGTCCATCAGCTCGCTCAGCTTCTGCTTGCATGCTCTGCTGCGAGAAACCGTCGAGCTAGAGAAGGCCGTCTACAATCTGCTTCAGGCCGAGCAGCCCTGGAGCGTTCTGGACTTCTGGGACGCTTATGCCCCCAACCGATTTTGGCACCGAGATTCTTCTAACCAGCGGCCCGAATGA >Mapoly0039s0105 ATGCATTTGACATACGAGAAACGCTTCTGGTCGAGAGCCGGGGAGGCTCTCAGGACAGGATTTGCCTGCCTGCTCGTGGGGATCATGCTAGAGTACGTGCCTGCAGTGAAGGACCTTATGGTGGTCTCAGTTCTTTCCTACGTTATCGCCGTCTTGGTCAGTGGACCTACATTAGGTACTGTTATACATAACGCGCTGGGGCTGCTGGCAGTGGCTGTTCCCGGGTTACTGTCTACTCTGATCGTCCTGCAGGTGCTGAGACCACCGATTTCCAAAGTCACTGCCGTCGCATGCATTGGAGTCAGCAGCTATTTCATAACATATTTGTCGAATACAAATCTACTGGGGCGGAAATCTGCGCTAGCTCAAGTCAGTATCGTGTACATTTACGCGCACTATGACAGTGGGATGAATGTTGTGACCTTCCCGTTGAGGATGATAGGGCCCGACATTCTTGGTGTTGCTATGGGCATCGTTGCGACCCTCATACCCTTTCCTCGCCTCGCCGTGTGGGAGGTGCGCAGCAGTGCGAAGTCAGCTGCCAGAGGAACTTCAGAAGTTTTGAATTCGGTTGTGAGCGCTTTTTCTGCAGCCGATGCGAGCAGCTTTGGATCCATGTACTTGCATTCGAAGATGCTGGCGAAAGCTTCTCGAGAAATTCTAGCTACTTTGAAAACAAAGCAGATAAATCTGACCTGGGAGCCAGGATCAAAGAGAACGAGATCTAGTTTAAAACGAACGACAAAAATACTATCGGGCCTGAACCAGCATCTGACCGGGATGGAAATGGCGATGGAGTCAGGCCACTTTTTACAAGCCCCAGCCACGCTGCGTACCTTGCTACGCAGCCCTCTCGAGAAAGTAGTAGCCGTCTCGAAGGCCTTGCTCCAGTGCGGAGCGAAAATGGCTGAGCTCGATCCTTCCGAGCGCAAGCTTCACAAGCACAGGCTGCTCGACGAAGCGAAGGCGGTGCAGAATCTGTTTGACCAGGCTCTCTCGGACGCGAGACGGAAGGCGTTTTACGAAGGGGGCGCGATTGAGGGCGAGGGGCCCCGGGCCCCAGAGATCCAGCGCGTCAATGGGAATGCAAATGGGCATGGCGGTGGCGGCGGCGGCGAGGGAATTTTATGGATCGACCATCGGGAGAGCGGCGACTCCGGTTACGTCAAACGCAAGTTCCGAGGTCGCGTGTCGTCCTACTTTTTCCTCTTCAACATGCAGCTCTACCTCTCGGAAGCATTGAATTTGGTGGACACGGACCACAACACGGCCACGAAGATGCACCAGATCGCCATGTTCGGGCCTTCGATGCCGGATTTGGAAGAGTCCATTCACGGTCGCACCAGCGCTCTCGAGTCGATGGGTCTGTCTCGCGCTGTCGGTCAGGCACCGTCGAGCAATGGCGGCGGCGCTGGCGGCGAGGAAGCGCCGTCGCCGTCTCCAGACGGTAAGGAGTCCGGTAACCGCCGTCGCAGCGCAGCCATTTTCTCAGAAGACGCCGTCGTGGTCGAGGACCAGCGCCTCGTGTCGCTGAAACGGCAGTGCAGTCACCGTCACGGTGTGCTGCCGTCGAAGCTCAAAAAAGGGACCGCCCCCGTCAATCCGTCGGCGGTCTCGAGATTCTTCAGCAAAGCTCACGAGATTTTGCACAAGTGCGGGGCGAGCAGGGCGCAGGCTCGACGGTCGTTCAAAATCGCCCTGTCGATGGTCATGGCGGCCACGTTCGGGAATTTGATCGTCAGCCAGGAAGCGCACTCGTTCTGGGCCACGGTCACCGTGGGCTTCATCATCGGGAATTATCAAGGAGGGTCGTGGCGCATCAGCAGTCTGCGTTTGCAGGGGACGGTGCTGGGAGCGATCTATGGCTACCTGGCCTTGCGGGTGTCGAAGAATCACAGCTGGGCCAACCTCTTAGCTCTCATCCCCTGGGTCGTTCTCAGCAGCTTCGTGCGCTACAGCACTGCGTATGGTTACTCGGGCCTGGTGTCGGCCTTCACTGCCGCGGTTTTGATCCTGGGCGGATTCGAGAACGATATTCGCAAGTATGCCATGGACCGCATCACCGAAACTTTCGTCGGCGTGCTGTCGTTTGTGTTCGTGGAGACGGTCGTGTTTCCGGAGAGAGCGGTGCTGTTGGTCAGAAAGGAGCTGGTGTCGAGTCTGATCGGGCTGCGGGATTGTGTTGCGGCAATTGTGGCCGTGTACACTGAACAGGAGTGCCTCGACTGTCGGAGCATAGCCGTGCACGAGATAAAGGAGCTGGAGCAGCAGCTGCGGGCGAGCTTTGTCAAACAGTCTGCTCTCCGTGCTGAGGCCTGTCTCGAGCCGGACCTTTGGTTTGTTCCGTTTCCTGGAGAGGTTTACTCCAATCTGATCGCCATCGAAGGCCGGATGCTGGACTTGCTGTTTTTCATGGTCTGCTCGCTGCACGCCACCACGGAGGATTGTCTGACGGAGCAAATGCAGAAGCTGCTGGAGCCTCTGCGGACTTCTTTGACCGCCTTACAAGAAGAAGTCCTGTCCACCATCGACTCACTGCAACAGGTTTTGCAGCTCAAAGTCCAAGGGACTGGCAAGTGGAGTCGTATGAAGGAATTTTTAAAAGATCTCAAAAGGGGCAGCTCCTTCAACTCAGATGTGGAGGATCAACAACAGCAGCAGGAGCAGCAACCACCGCATCCTCTCCTGGTTCTCAACCATCCTTACCGACACGTCGATGGAAGCCCTCTGAATCTCAAATCTACCATGGACCGCTTCGAACAAAGTTTCGAGGACACTGTCGAGGATTTGATCGCATCGACCAAACTGCTGCCGGGCGCTCCGATTATCAGCAACTCAGTCATGCTGTCATTTGGATCGCTCACTTTCAGTTTGCATTCTCTACTGAGAGAAACCGTTCAGCTCGAGAAAGCAGTTCATGAGCTGGTCCAAGCCGAAAATCCCTGGAGCGTTCTGGATTTCTGGGACACTTATTCCGTCACCCAGCTTTGGGAGCAACATAGTAGTGTGAAGGCTTGA >Mapoly0047s0049 ATGTGCTCTGAACAGGACTCGCAGTCCGAGCTAATCACGGCGGAGGTCTCAGTATCTCGCCCGCCCCGACTTCGCGTTCTTAAATTAGTTCCCGACCCTGTGAGCACTGTGGGCACGACTCGCAGGCTCGAGCCCGAGGAATTAGCGAACGACGTAGCAGTCGCGAAGAACAGGTCGACGGGGGTGAAGAATTCGAGCGACAGTGGGCCATGGGACGGGTACTCTCATGGCAGCCGATCGACGTCGACGGCTGTGAAAGGCTGTCAGGGGCGGTGTCCGAAGGTCACTCGCTCTGTAGAACTGAATTTAGAAGCGTCGAGCATCTCTGGCTGTGGGAATCTACCATATCTGGGCCAGCTCGCAGAGGTCGTCCGGAAGATTCCTGTCAGGGACACAAGGCGAGAGAGGCTCGGAGGCTCGGAGGCGGACGGAATGGAGGTTAAGGCCAAGTACGAGGGCGTCATGGCGCGTCTCAAATCCCGCTTGGAATTGTCTCTTTACGGCAAGAGATTTTTCCAGCGAATGCAGGTGGCGCTGCGAAGTGGATGGGCGTGCTTGTTTGCAGGATGCGTCGTGCAATTCGGCTCGCCCATGAACCACTGGCTGGCCATTCCCTTCTTCTCTCTAGTCATCTGCCTGAATATCATCGACTCGAGCATTGGCGCAGTTCTGCGAACTTCTGTCAGTGTCGTGGTCGGGATGCTGGAAGCCATGACGGCCGGGACTCTCCTTTATTTGATTCTCGGGACCGACATGTCGCTGGTGTTGACCATTTTTTGCGTCTTCGTCTGCAGCTTCTGCGTAGCTTATCCGACGAGGCTGGTCGGAATAATTTTCACGGGCGCATACAATGGAATGAACGACGGGAGCCTTTTATTTCTCGTCCGACTGATGTGCACGACGATGTTTGGAGTTTTTTGCGCCCTTCTCGCGGTTTGCATTCCAGTTCCCGGGCTAGCCTTTTGGGAGGTGCGGGACAGCGCTAAGTCCACTGTGAAGGGAGCCTCGAAACTCTACAGGACGTTGACGGAGGCATTTTGCGCCAAGGAAGTGAGCAAGATGTCGTCAATTTTTCTGCACGCTAAATTCCTGGCGAAAACAGCTGCAATCAGTCTGGAGGATCATAATAATAAATTGGGCGATGCCTACTGGGAGTTGCGAGGGCTGAACATAATCCCATCACTGAAGCGGATGACCGAGGGGCTGAATGTGCTCAAACTGCACATGATGGGCATGTGCATGGCCCTGCAGTCAGGACTGATTTTGCAGTACATGCCCGGGACGATGGTTGTGATTCTGAAGGACAACTTGAAACGCCTCGTAGATCGCAGCAAGCAGATGCTTGATCTCACAGTGAGGTTGAAGAAGTCCAAGTCGGCACTGATCCTCAAAGAATCGCTGCTGGAATTGGCTAAGAAAGATCTGAACTCTTTTGACCATACCCTGAAGGAAGCTAGAGAGAAGAGTTACTACATCAAGCTCAAAGACGAGGATGAAAGCCTCCACAAGATCATCACCAACGCCAATCCAGAGGAGCAAATCACTGCTGCCGACAAGGGAGTGAAAAACCTCTTCCAAAGCATGGTGCCCACTTACTTTTTCCTCTTCAACCTCAGACTCTACTACACGGAGACGATGCAGATGCTCGACTGCGGAGAGGTGGCCGACCCCATCCAAGACATCGGCAACACAAGCTTCCACATGCCCGTGCTGCACCACGAGGTCCAGGACGGGCTTGCCGATACAGTGCAGGTGGTGGTGACTCCCGTGTCCGAGGAGGAGGCCAGAGAGCCGCTCAAGAATCCCATGCATAGAGCGGAGCATGTAGTTCCTCTGGGCGACGAGAAGGATGCCGGACTAGCAGCAGATCCACAGCACGCGACGTTCAGCAGGACTCTGTCCAACCCCATCACATTCAAGTGCATGGTGTGCCAGCGCCTGAAGAAAGAGCAGGCGGCCGCAGGACCTCAGGAGGACATAGCGGATGCTCCTTTGACGTGGTTAGTGAAGCAAGGGTGGAAGCGGTTCAAGCGAGAGCAGGCCCTCAGGGCTTTCAAGGTCTCGTTGGCTATGTCGCTTGCCGCCCTGGCAGGCTGCATGTACAACGAGGCCTACGCATTCTGGGCCATGGTGTCGGTGGCCTTCATCATGCAGAACCAACAGGGCGGATCGTTCCGCATGGCTAATCTCAGGCTTCAGGGGACCGTGCTCGGGTCCATTTACGCGTATTTGATGTTGAATCTGATGAGCAAGCATCCCCAGCTGCTGCTCCTGGCCCTGGTTCCGTGGGTTGTGCTGCTCAGCTATCTTCGGTTCAGCAAACTGTTCGGAGCATCCGGGGTCATCGCCGGTCTGACGGCAGCCATCGTCATGCTGGGAGCGGAGGGAGGAATGTCCATCCAACAACTGGCGGTTGTCAGGATCACCCAGAATTTTATCGGAGTGCTGGCTCTGATCCTCGTAGAAACGATTATTTGGCCGGAGAGAGCAGTCATTTTGTCGAGGAGAGAGTTGGTCTTGAGTTTGATCGACCTCAGGGACTGCGTCAAGGCCGTGGTCGCGGTGTATACCGGGCATCATTGCCCCGAGCATAGGAAACTCGTGGTCCTGGACATCAAGAAGCTGGAGGGCCAGATTCGTGCCAGGATTGCTGATCAGACGATACTTCAGAGCGAGGCGGTGATGGAGCCCGAATTGTGGAGCCATCCGTTCCCGGCAGAAATATATTCCAAGCTGTTGCACATCCAAAGCCGCATGCACGATTTGCTCCACTTCATGGTGTGCTCGCTGCACGCTGCCACCGAGGAGTGCTTGAGCGAGCAGATTCGCAAGCTGGTGGGCCCTCTCCAGACTTCGCTCGTCGCATTGGAGGACGAGGTGCTGTCGTCTCTGCATCTCCTGCAGGAGCTCCTGCAAATCGGCCCCAACACGCTCGATGTCCTGTCCAAGGCCTCGGGCTGTGACGACGAAGAAAGGCAGTTGTGTCGAATCCCATCCCGTAGCGATAAGTCTTTCAAGGATCTGCGCAAGATGCTGGGGCGAGTGCATCCTCTGCTGGTGCTGGAATGCGAGGAGAGAAACATCGATGGAACTCCGATGTCCCTGAAGAGAACGATGGATGCCTTCGAGGCCAGCTACGAGCAGGTGGTATCGGGTTTCATCGCCAACAAGAAGGCCAATCCGGAAGCTTCCATCTTGAGCAACGCTGCCATGCTTTCTTTCAGTGCCCTCACCTTCAGCTTACAGTCTCTTCTGGGCGAGACGGTGGAGCTGGAAAAGGCAGTGCACGAGCTTCTACACTTCGAGAATCCTTGGAGCGTTCTGGACTTCTGGGAATCCTTTCCAGGTGCGGACGAAGAGTGCCCCATTTGTGTCAACGCTAATGCGCATGCACCCCACGATCATGCTCCACATGAGTGA >Mapoly0047s0051 ATGAACGACGGGAGCCTTTTATTTCTCGTCCGACTGATGTGCACGACGATGTTTGGAGTTTTTTGCGCCCTTCTCGCGGTTTGCATTCCAGTTCCCGGGCTAGCCTTTTGGGAGGTGCGGGACAGCGCTAAGTCCACTGTGAAGGGAGCCTCGAAACTCTACAGGACGTTGACGGAGGCATTTTGCGCCAAGGAAGTGAGCAAGATGTCGTCAATTTTTCTGCACGCTAAATTCCTGGCGAAAACAGCTGCAATCAGTCTGGAGGATCATAATAATAAATTGGGCGATGCCTACTGGGAGTTGCGAGGGCTGAACATAATCCCATCACTGAAGCGGATGACCGAGGGGCTGAATGTGCTCAAACTGCACATGATGGGCATGTGCATGGCCCTGCAGTCAGGACTGATTTTGCAGTACATGCCCGGGACGATGGTTGTGATTCTGAAGGACAACTTGAAACGCCTCGTAGATCGCAGCAAGCAGATGCTTGATCTCACAGTGAGGTTGAAGAAGTCCAAGTCGGCACTGATCCTCAAAGAATCGCTGCTGGAATTGGCTAAGAAAGATCTGAACTCTTTTGACCATACCCTGAAGGAAGCTAGAGAGAAGAGTTACTACATCAAGCTCAAAGACGAGGATGAAAGCCTCCACAAGATCATCACCAACGCCAATCCAGAGGAGCAAATCACTGCTGCCGACAAGGGAGTGAAAAACCTCTTCCAAAGCATGGTGCCCACTTACTTTTTCCTCTTCAACCTCAGACTCTACTACACGGAGACGATGCAGATGCTCGACTGCGGAGAGGTGGCCGACCCCATCCAAGACATCGGCAACACAAGCTTCCACATGCCCGTGCTGCACCACGAGGTCCAGGACGGGCTTGCCGATACAGTGCAGGTGGTGGTGACTCCCGTGTCCGAGGAGGAGGCCAGAGAGCCGCTCAAGAATCCCATGCATAGAGCGGAGCATGTAGTTCCTCTGGGCGACGAGAAGGATGCCGGACTAGCAGCAGATCCACAGCACGCGACGTTCAGCAGGACTCTGTCCAACCCCATCACATTCAAGTGCATGGTGTGCCAGCGCCTGAAGAAAGAGCAGGCGGCCGCAGGACCTCAGGAGGACATAGCGGATGCTCCTTTGACGTGGTTAGTGAAGCAAGGGTGGAAGCGGTTCAAGCGAGAGCAGGCCCTCAGGGCTTTCAAGGTCTCGTTGGCTATGTCGCTTGCCGCCCTGGCAGGCTGCATGTACAACGAGGCCTACGCATTCTGGGCCATGGTGTCGGTGGCCTTCATCATGCAGAACCAACAGGGCGGATCGTTCCGCATGGCTAATCTCAGGCTTCAGGGGACCGTGCTCGGGTCCATTTACGCGTATTTGATGTTGAATCTGATGAGCAAGCATCCCCAGCTGCTGCTCCTGGCCCTGGTTCCGTGGGTTGTGCTGCTCAGCTATCTTCGGTTCAGCAAACTGTTCGGAGCATCCGGGGTCATCGCCGGTCTGACGGCAGCCATCGTCATGCTGGGAGCGGAGGGAGGAATGTCCATCCAACAACTGGCGGTTGTCAGGATCACCCAGAATTTTATCGGAGTGCTGGCTCTGATCCTCGTAGAAACGATTATTTGGCCGGAGAGAGCAGTCATTTTGTCGAGGAGAGAGTTGGTCTTGAGTTTGATCGACCTCAGGGACTGCGTCAAGGCCGTGGTCGCGGTGTATACCGGGCATCATTGCCCCGAGCATAGGAAACTCGTGGTCCTGGACATCAAGAAGCTGGAGGGCCAGATTCGTGCCAGGATTGCTGATCAGACGATACTTCAGAGCGAGGCGGTGATGGAGCCCGAATTGTGGAGCCATCCGTTCCCGGCAGAAATATATTCCAAGCTGTTGCACATCCAAAGCCGCATGCACGATTTGCTCCACTTCATGGTGTGCTCGCTGCACGCTGCCACCGAGGAGTGCTTGAGCGAGCAGATTCGCAAGCTGGTGGGCCCTCTCCAGACTTCGCTCGTCGCATTGGAGGACGAGGTGCTGTCGTCTCTGCATCTCCTGCAGGAGCTCCTGCAAATCGGCCCCAACACGCTCGATGTCCTGTCCAAGGCCTCGGGCTGTGACGACGAAGAAAGGCAGTTGTGTCGAATCCCATCCCGTAGCGATAAGTCTTTCAAGGATCTGCGCAAGATGCTGGGGCGAGTGCATCCTCTGCTGGTGCTGGAATGCGAGGAGAGAAACATCGATGGAACTCCGATGTCCCTGAAGAGAACGATGGATGCCTTCGAGGCCAGCTACGAGCAGGTGGTATCGGGTTTCATCGCCAACAAGAAGGCCAATCCGGAAGCTTCCATCTTGAGCAACGCTGCCATGCTTTCTTTCAGTGCCCTCACCTTCAGCTTACAGTCTCTTCTGGGCGAGACGGTGGAGCTGGAAAAGGCAGTGCACGAGCTTCTACACTTCGAGAATCCTTGGAGCGTTCTGGACTTCTGGGAATCCTTTCCAGGTGCGGACGAAGAGTGCCCCATTTGTGTCAACGCTAATGCGCATGCACCCCACGATCATGCTCCACATGAGTGA >Mapoly0055s0015 ATGGACACAGGAATGGCAGCGAGGATTGTCGACACCCGATTGGACCTCGAGAGTCCGGGATCTGGAAACTATGGACACTCGGGAGACTCTGAAGCCTATGCTCCAGTTGGAGTAGTCGCCGCATGCCACGCTATGATGAACCGAGTGAAGGCTCGAATGAAATCCCTCTACGGAAAGCGGTTTTTCCAGCGGCTGCACGTCGCATTGAGGAGTGGATGGGCCTGTTTATTCGCTGGAGTAGTGTTACAATTCGCCACCCCCGTGACCGACTGGCTGGCGATCCCATTCTTTTCACTCGTCATCTGTCTGAACCTCGTCGAGTCCAGCCTCGGGGCAGTGATCAAGAATCTTGTCGGTGTGGTGATAGGCTTAGGACAAGCCTTGAGTGTCGGGAGCTTAGTGTACCTGATCTTCGGATGCAGCCTGGATCTCGTACCAACGATAGTCATAATATTTTTCAGTAGTTTCTATGTAGCATATCCCGCAGGACTTTTGGGGCAGGAGATGTCCAGGAAGGTGGCTCTCGCTCTCATAGGGATAATCTTCACTTCGGCACACTCTGGAGCCAACGAAAACAGCATGTTCTTTCTGATCCGTCTCGGAGCAACCACGCTGTTCGGAGCAGGGTGTGCTCTTCTCGCTGTTATTGTACCGTTTCCAGGGCTCGCATACTGGGAGATAAAAACAAGTGCCAAAGCCACTGTTAGAGGAGATGCCGAGCTTTTCAAGACTAATTGCGAGGCTTTTTGTGCTAGAGAAGTTAGTAAGCTGTCATCTGTATTTTTACACGCCAAATATCTCTCCAAAACGGCGTGTATTACTCTTGACGATCTGAACAGCAGAATGGCTGATGTTTACTGGGAGCTTCGTCCACTAGGGAAGATGTCTGCCTGCAAGCGAATGTCGGAGGGTCTGAACGTCATCAGACTGCACATGATGGGCATGGGCATGGCGCTGCAGTCCGGGCTGATTTTGCAGTACACTCCCGCAAAGATGACAACAAATTTAAGATATTCGTTGACATGTCTCGCTGAACGTAGCAAGGCGATGCTCGAGCTGACGGCCAAAATGGGGAGCGGCGAATCGATGGTGCAGGAGAAAGAGCGGCTTCTTGCAAAGGCTAGGGAAGATCTGAAAACCTTTGATCAGGTCCTGAGAATAGCTCGAGAAGAGTCTTATTACTTTAAAAACGACGAAGAAGTTACTTTGGGAGAATTGGTCACTACGGGTGGCCAGGCACCACCATCACCCACAAGTGAGAAATGTATCAAGCACCTGTTCCAGAGCATGGTGCCCACATACTTCTTCCTCTTTAACCTCAAGCTGTACTTCTGTGAGACAATGAAGATGCTGGACCCAAACTCCACAGGCAAAGTCGCCAACGAAATGCACAAGGTAGCAAATGCCGGTGGCCATGTACCGATGATCTCGTACGAGCTCGACAAGCATGCAGTACCCATAGCTGTTGTAGTGTCCCCCGTAGCCGACGAGGCTTCCAAGCCACCCAAGGTGCCAAAGCCTGTCAGCGGTCTCCTCACATCTCAACCCACATTCAGGTGCTCAGTATGCGACAAGCAGAGAAGGGAAGAACCTTGTGTCATCAAGGACACAATGATACAAAACATTTGGGCACGAGTTTGCGAATCGTTCTGCTCGTTCAAGTACCAGCAGGTCGTTCGAGCCTTGAAAATCTCGCTGGCCATGGCTATTGCAGCTCTGGCAGGTATCCTCTACAACAAGAAATTCGCCTTCTGGGCGGTGGTAACCGTAGGATTCATCATTCAAAACCATCAGGGAGGCTCCTTCCGCATGGCAAACCTTCGACTTCAGGGTACAGTAATCGGATCCATCTACGCTTACCTCATGGTCATCGTCATCCACGATCACCCGGACTTCGTGCTGGTGGCGCTTATTCCGTGGGTCGTGGTACTCAGCTACCTAAGATTCAGTAAACTGTTCGGAGCTGCCGGAGTAATAGCAGGCTTAACTGCAGCTATTGTCATGCTGGGTTCCAACGGAGCACCCATCCAGGAGCTGGCAGTGACCAGAATCACTGAGAATTTCATCGGAGTTTTGGCCCTGATCTTCGTCGAGAGTTTAGTCTTCCCTGATCGAGCCGCGATACTGTGTCGGAAGGAGCTGGTCTCGAGCTTAGTTGATCTAAGGGATTGCGTGAAAGCTGTGGTAGCTGCTTACACTGGCCACTTCTGCGATGAGCACAGAAGAATCGTGGCATCCGATATCAAAAAACTGGAAGCCCAGCTTAGATCCAGAATCGCTGAGCAATCCAAGCTCCAAGCCGAAGCAGTCATGGAACCTGAACTGTGGAACGTGCCTTTCCCAGCGGAAATCTACGGGCAGCTGGTCAACATTCAAACTCGGATGCTGGATCTGCTCCACTTTATGGTACTTTCACTTCACGCAGCCACTGAAGAGTGCCTGGGATCTCAGATTCGGAAGCTAGTGGGTCCACTTCAGGGAAGTTTGGACGCGCTGGAAGAGGAGGTTTTGTCATCACTGCATCTTCTACAAGGGCTCCTGCAATGCACGCGGTACAAGATCGATCTGATGTCCAAGAATTCAGGCAGTTGGCACCATGAAGCAAAGAGTGAGCTACATCGAGCTACCTCTCGTCACGATCATGGAGCTCCGAATGATGACTTGCAGGACATGGTGGGCAAGGTGCATCCGCTGTTGGTTTTGGAGTGCATTCGACGAGACATCGATGGGACTCCTCTGTCTCTGAAGAATAGGATGAAGGATTTCGAGGCTAGCTACGAGACAGTGGTCGAGGAGTTTATCGTGAAAAAGAGGGCGGATCCTAATTCCCCAGTTCTCAGTAACCCTGCCATGCTCTCTTTCAGTGCCCTCACCTTCAGCTTGCAAACTCTGCTCAAGGAAACAGTGGAGCTCGAGAAAACCATCCACCAGCTCCTGCACTTTGAGCATCCTTGGAGTGTGCTCGAATTTTGGGAATCAGTGGACGAAGAGAAAGAATTGCTTTCTGTGCCTCCATCTCCAGGTGTCCATAACCAGAACCGCCACAACTTCCCATAA >TCA.TCM_021963 ATGGGGGACGATCAGCAATCTGTCGCCAACCAGGAAAGTGGTTGGTTTAGCATCTTCCAGGGTATTCTGCTTCAACCTTTTCCCAGTCCGCAACAAGTGCCACCATTTGCATACATGGAAGGCAAAGAGGAACTTATTCCAAATGCAAGACAAACAAAAGCAACGGGGGACAATATTCCAGATTCTCTCATTCGTGCTAAAAGCTACAAGGCCAACAGGGAGATAGTCACAGAAGCATCAAATTCATATGTGATGACGATTAACAGCAAAGGCCTGCTGCAAGAAACCAACATGGATACTCCCAAAGCTCTGTGGCGTGTACGCCTAGGATCTGCGTTCCGGACTGTGCTAGCCTGCACAATAGTGGGTTGCACCACCCTCTACGGGCCAGAACCTGTCCGGCGTTTCTTAACATTTCCTGCCTTTTCCTACGTGACAACTATCTTAATTGTCTCGGATACTACGCTTGGTGATGCCCTGAGAGGTTGCTGGCATGTTTTATACGCAAGCATTCAAGTACTGCTCCCTTCTATGCTCAGCCTCTGGTTGATCGGACCAGCCAGGTTCAGCCATGGACTAGCTGCTATGGCTGTTGCACTTAGTTCTTTCGCGATTGCGTTGCCTGATTCCACACATTTGATGGCGAAGAGGATTGCCTTTGGGCAGACTCTGATTGTTTATGTAGATGCAGTCATTCAAGGAGCAGAAACTGGAGTCTTAATGCACCCAATTCATGTGGCGTCGAACTCAGCTCTTGGTGCCTGGCTTCTGTTTTGGCAATGTTGTTTCCATACCCTCACCTACCCTACCTCGAGGCAAGTAGCTAATTAA >TCA.TCM_021965 ATGAGGATATCAAGATTTAGTGATTTAAAAGAAGGGAAAAAAGTGCATACAGTAGCTTCACTCGTGGCCAAGCTGGTTGCTAATATTATGCCTGTACAGGTCAGAAAGACATGCAGATCTTATGCAGAAAATGCTTCAAACAGGCTGAATCTCTTAGTGGAAGCTTTCTGTGCACGAGACAACGTCGCAGCACTTGATTTAATCGCAGAAGCAAGGTTATTTTCTAAAACAGGAGCCAAGCTTCTTCGAAGTATCAAAGGCAAACATGAAGGCATGCTTTGGGAGAAACCTCGGTTCAGATTCTTGAAACCTAAGCGCTCGGACCCTGGAGAGAAATTACAAGAGATGGAAATGCCAATTCGAGGGATGGAAGTGGCCTTATCTACTTGCATCTCCTTCCCCGTCAGAATGTTGGATGAAGAGCTCCAAGGTGTTCTACAAATTTCAAAGAAACAGATAGCTCTAAAACTTGAACAAGCCAAGTGTTCCGTGCCTTTCGATGCAGCAACAGCTCCGGAGACGAAAGGAGAATACACAGACAGGTCCTCCTGGACCCAGAAAGCCATTTCAACATCCCATGAAGATCTGTCACCCTTCTTCTTCTTGTACTGTATGGAACTCCTTCAGGATGATCCTGAGTGCATTGTAGAGAATGAGGAAGGTAAAAGTAAAAAACAAGAATCAAGTCAGCCAAAGAAGCAAGGAAAAAGTAGAGTGGAACTGATCTGGTGCAGCCTGCTGAGTTTCAGCAGGCGGCTAAGCAGTGAAAGATTGGTTTTTGCAATCAAGTGCTCATTTTCTCTAGGTCTTGCTGTGCTGCTTGGTTTGATATATAACAAAGAGAACGGATATTGGTCAGGACTAACCATTGCAATAAGTTTTGCAACAGGGCGACAAGCAACATTTACAATGGCTAATGCACGAGCACAGGGGACGGCAATGGGATCAGTATATGGAATTCTATGTTGCTTTATTTTCCAAAAGCTCGCGGATTTAAGGTTCTTCCTTCTACTTCCTTGGATCATTTTCACCAGTTTTCTGAGGCATAGTCGCATGTACGGCCAAGCTGGTGGGATTTCAGCGGTTATAGGGGCATTACTGATCTTAGGAAGGAAAAATTATGGCACACCAAGCGAATTCGCAATTGCTAGAATCACAGAGGCTACCATTGGACTAATCTGTTTCATTACAGTGGAAATTCTCTTGCATCCAGCGAGATCTGCTACCCTAGCAAAAACAGAACTTTCAAGGACCATAGGAGCACTTCAGGATTGCTTTGAGGTAATAGGTCTTTATAACAGACAAAAGGAAATTTCGACGGAACAAAGAGAAAAGCTGCAGAAGCTGAAATATCATGTCAGTAAATTGGAGAATTTCATTGCAGAGGCTGAGTTGGAGCCTAATTTCTGGTTCCTGCCTTTTCATTGCAGTTGCTACAAAAAGCTTCTAAGCTCTCTATCCAAAATGGCAGATTTATTACCCTTTGCGATCCATCAAATTGAATTTCTCTCACAAGCATCCCAGAGGTTGGGAATTCATTGGGAGGAGATCCAAGAACAGATTAACAATGATCTAGAACATCTCAGGGACAAAATTGGCTCTTTAGTGAAATGCCTGGATGAAGTGTTACTAATCAAATCCCTAGAAGAGCTTGAAAATGAGTTGCAAAAGGAAAATGCATCCCATGACCTCGAGTTGGGCAAATCAGCAAATGGAGATTTCTCTATCCGTTTGGGGCATGAAAGAAACAGCATCGCCGAGATTGTATGGCCTTCCCTTCAACATATGATGGAAGTTGCCAATGAGACCGAGGGTAATGAAGTTGAAGCGAAGCTTAAGAGCCAAGTGCTTCTCTGCCTGTGCAGCCTAGGGTTCTGCATTAATAATATGAACAGGGAAGCAATAGAAACAGAGGGAACAATTGGGGAACTACTGAAATGGGTGTATCCAGCAAGGCATGTAAATTTGCATGAACTGTTACCTAAGCTCAAAAAACTAGGGAGTGGCTTTGCAGCAACCTAG >TCA.TCM_041877 ATGCCGACCGCACCCCAGCAACCGAACAGAGCCAGAGCCTTATGGCGGACCTGCCTGGCCTCCGCCTCCCGCACCGCCTTAGCCTGCATCATAGTTGGCATCGCCACGTTGTATGGACCAGCTTCGCTCCAACGCCAAGTAGAATTCCCAGCATTTTCCTACGTGACCGTCATCCTCATTATGACAGACGCCACGTTGGGTGACACGTTGCATGGCTGCTGGCTGGCTCTCTATGCATCCGTCCAGAGCCTGGGGCCTGCCATGTTGAGCCTGTGGCTGATAGGACCAGCCAAGCTTACTGATGGAACCACGGCGCTTGCGGTAGCTTTAGGAGGGATGGTGGTGGTGTTGCCCGAATCGACTCACTTGGTAGCAAAGCGAATAGCGTTGGGCCAAATCGTTATAGTTTATGTTATCGGCTTCATTAATGGTGGGCAAACCGAGCCTATCATGCATCCGGTGCACGTGGCGGCTAGCACTGCTGCTGGGGTCTTGGCTTGCGTTTTGGCCTTATTGCTACCCTACCCAAGATTGGCTTGTTGCGAGGCGAAGAGAAACTGCAAGCTACTGGCGGAGAACGGTTCACAGAGGCTGAAGCTGTTCGTCAAGGCGCTATGCGCAGAAGACAACGCAGCGGCATCTGCTTCCATCTCTCAAGCGAAGATGTTGACCGCAGCCGGAACCAAACTTCTTCAACGTATTAAACGCTTCCAAGGAAGCATGAAATGGGAGAAACTTCCGTTCAAGTTTTTGAGACCCTACTATATGAACTCAGGGGAGAAGTTGCAAGATATAGAGATAGCTTTAAGAGGAATGGAAATGGCTTTGGAAAGTACCCCATCATTTCCAGGGAGAATGTTTGATGGAGAACTCAAAGATGGGCTGCTTAAGTTGGAAGAGCACATTAGCTTAACGATAAAACAGGCAAAGAGTTTCTTACCTGGTGATTCCTTAACTATTCCGGAATCAAATGCTGAAGACATTACGAAGTTCCTCCAAACTCTTCAAACAATCCCACCAACCCACCAAGATTTGCACTTTTTTTTCTTCTTGTTTTGCATGAAACTCCTTCATAGTAAGTCGTTGCCAAATCCAACGACTAAGAATCCGGTTCAGAAAGATGGAGGATCGTCACCCATTTCATCGAAAGAAAACGGGTTCTCCTCCAAAGAGGTTTCGAGCAGCTGCGGCCTTAAGATCAAAAGGCTCATTCCAGCTTTCAAGTTCTCACTTTCTTTAGGATTCTCAGTTCTATTTGGGTTGATATACAGTAAGCCCAATGGATTCTGGTCAGGACTCTCAGTTGCTGTCAGCTTTGCCGCGGCAAGAGAGGCTACATTTAAAGTTGCAAACGTTAAAGCACAAGGGACAGTTTTGGGGACTGTCTATGGAGTTATAGGGTGCTTTCTTTTTGAAAGGTTCTTGGCTATTAGGTTCTTGTCTCTTCTTCCTTGGTTCCTCTTTTCAAGTTTTCTAAGGCAAAGCAAGATGTATGGTCAGGCTGGTGGGATTTCTGCTGTCATTGGTGCCGTTCTGATTTTGGGAAGGGAAAATTTTGGTCCCCCAAGTGACTTCGCCATAGCAAGAATCATGGAAACATTCATCGGATTATCTTGTTCAATTGTGGTAGAGCTTCTTTTCCAGCCCACAAGAGCTTCAACTTTGGCTAAAATTGAGCTCTCCAAAAGTTTGGAGACATTGCATGAATGTGTTGGCTCGGTGAGCCTCCAAGTCAGCGAAGCCAACCTTGTAGAGAACCAGAAGAAGTTAAAAATTCATGTAAATCAGCTAGGAAAATTCATTGGAGAAGCCGAGGTGGAGCCCAATTTCTGGTTTTGGCCTTTTCATAGTGCTTGCTACGGTAGGCTTTTGGGGTCTTTGTCAAAGATGGTGGATCTCCTGCTTTTTGGTGCTCATGCGATAGGATTCCTTGAACAAGAGTCACAGAAACTTGAAACTTCTTGGAAGGAAACTGTAAATAAACTAAACGGTGACCTTAATCTCTTCAAGGAGTCCGTTGGCTCTTTAGTACAATACCTTGCAAAGATATCCTCGATCAAATCACTCACCATACTTGACAAGGAGCTTGAAAAGAACAACATTTCTTATGATATCGAGATGGGAAAATCACCAAGCCCGAACTTTTTTAGGGTTTCTGGTTCAGATGAAGATGATGAGATGAACAAGATTTTGAGTTCATTTCTTCAACATTCCCAAGAAGTTGTCGATATCATCCATGGCATTGAAGGTGGGAAGGAGCTTAAGAGCCAGATGGTATTAAGTTTGAGTGCCCTGGGGTATTGCATGGAAAGTTTAATAAGAGAAACCCGACAGATTGAAGAGGGGATACGGGAACTTGTGCAGTGGGAAAATCCTTCAAGCCATGTTAACTTGCATGAAATCTCATGTAAAATACGTGCTTTATACAGTTATCTTGTTGTACCATGA >AUR62009604 ATGCTAGCTATGTTTAGCACCGTGCAATCTAAGAGAGCATGCGAGTTTTGGAAATCAGGCCTAGTCGCGGCCTCAAGAACAGCCTTGGCTTGCATTATAGTAGGGTGCTTAACCCTCTATGGCCCTGCCTCTTTCAAGAGGGAAGTAACATTCCCTGCATTTTCATATGTCGCGATGATTCTTATTATAACCAATGCTACCCTAGGAGACACAATCCGAGGTCTCTGGCTTGCATTTTATGCTACTCTTCAAACTGTTTGCCCTGCTATTTTGTGCCTCTGGCTCATAGGAGGACCTTCTAGCCTTACCGAGGCATCTACCTCTTTGGTCGTTGCTATTGCTGCTTTCTTTATCGCGTTGCCTCAATCAACCCATGTTGTAGCCAAGAGGATTGCTTTGGGCCAACTTATCATCATCTATGTTGTTGGTTACATCAATGCTCATCAATTTGATGCTGTCATGCATCCTGTCCATGTTGCTGCTAGCACCGCCGTTGGTGCTGTCGCTTGTTTCTTAGCTCTATTGCTTCCTTACCCTCACCTTGCTTCCTCCCAGGTGACCAAAAATAGCAAATTATTTGTAGAGAACGCGACAGATAGGCTAAAGCTGTTTGTCAAGGCATTTTGTGCTCAAGATGATGTAACTTCTCAAGCATTAATCTCTCAAACAAGGTGTTTAGCTGGTAAAGCCAAGAAATTTATCCAGTGCATTAAATCCAAACAGGAAAGCATGCAGTGGGAGAGATTTCCCTTGAAATTTATCAGACCTTATTGTACGAACCCAGGGGACCGGTTCCAGGAACTAGAGACGCCACTAAGAGGGATGGATATCGCGCTAAGTAACACAAAAGTACCTATTTCAATTGTTGATGAACAATTGAAAGATGGTATGGACTTAATAGAAGGTGAAATAAGCCAAAATTTACACCAACTTAAGAGCCATACACCTAGTGAAACAATAACTGTCCCAGAATCCACTGAAGGACAAGTCATGGGCTTCCTTCAAAAACTCGAAACACCGCCATCAAACGAGAAAGACTTACCCTCTTATTTCTTCTTCTTCTGTATGAAACTCTTGCACTCTCATAAGCCCAATGGATATTGGTCTGGGCTTCCTGTAGCTGTGAGTTTTGCAGCAGCTAGAGAAGCCACATTTAAAGTTGCCAATGTTAAGTTCCAAGGGACAGTCATTGGCAATAGCAAAATGTATGGGCAAGCAGGTGCTGTTTCTGCAGTTATAGGTGCAATTCTGATTTTGGGCCGAAGAAATTTCGGCCCACCATCAGATTTTGCTATAGCTAGAATAGTGGAAACCTTTATTGGTTTGTCCTGTTCTATTGTTATTGATTTGTTGTTACACCCTACTAGAGGAGCCACCCTAGCCAAAGTTCAACTTACCAAGACTCTAGGGACACTCGAGGATTCGATCTCTTCTATTGATCTCGTTACTTCTTCCAAGGTCGAGTTACTTGAGAAGGCGAAAAGCATCAAAGCTCAAGTTAATGAGCTAGATAAATATGTTGGTGAGGCTGAGGCAGAGCCCAATTTTTGGTATTTGCCATTCCATACTTCTTGTTATAGGAAATTGATGGGTCCTTTCGCGAAAATGGGTGATCTCTTGATATTCACAGCTCATGCTATTGGGTTCCTAGAAGAGCATATCCAAAGCATTGAATTGGAGAGGATGAACGATGATCTAAGGCATGTAGTAAAAATGGTAGCTACTTCGATGAAATCCTTCCAAGAAGTTGCTTCTATCAAGTCATTGATAGTTCTTGAAAATGACCTTGCCAAAAGTGGTAAAAGATGTGATCTTGAGGTGGGAAAATCGGCCAACTTTCCATTAATGAACTTGGGTGAGAAAGATATGGAGAAATTCATAAGCTCGTACCTTGATCATTCCAAGGAAGTATTCGAGGAAATCGAGTTCCCTGAGGGAGATGAAGAGATCAAGAGTCAAGCTATCATGAGTTTAAGTGCACTTGGATTTTGCTTAAGCTGTTTGATGAGGGAAACAAAAGAGGTTGAGAAAGGAATTAAGGAACTTGTTCAGTGGGAAAATCCTACTAGTCAAATAAATCTACATGAGATGTCATGTAAAATTCATGCATTATACGATTGA >AUR62001818 ATGCTAGCTACGAGAACAACCATGTTTAGCACCGTGCAATCTAAGAGAACATGCGAGTTTTGGAAATCAGGCCTAGTCGCGGCCTCAAGAACAGCTTTGGCTTGCATTATAGTAGGGTGCTTAACCCTCTATGGCCCTGCCTCTTTCAAGAGGGAAGTAACATTCCCTGCATTTTCTTATGTCGCGATGATTCTTATTATTACCAATGCTACCCTAGGAGACACCATCCGAGGTCTTTGGCTTGCATTTTATGCTACTCTTCAAACTGTTTGCCCTGCTATTTTGTGCCTCTGGCTCATAGGAGGACCTGCTAGCCTTACCGAGGCATCTACCTCTTTGGTCGTTGCTATTGCTGCTTTCTTTATCGCGTTGCCTCAATCCACCCATGGTGTGGCCAAGAGGATTGCTTTAGGCCAACTTATCATCATCTATGTTGTTGGTTACATCAATGCTCATCAGTTTGATGCTGTCATGCATCCTGTCCATGTTGCTGCTAGCACCGCCGTTGGTGCTGTCGCTTGTTTCTTAGCACTATTGCTTCCTTACCCTCACCTTGCTTCCACCCAGGTGACAAAAAATAGCAAATTATTTGTAGAGAACGCGACAGATAGGCTAAAGCTGTTTGTCAAGGCATTTTGTGCTGAAGATGATGTATCTTCTCAAGCATTAATCTCTCAAACAAGGTGTTTGGCTGGTAAAGCAAAGAAATTTATCCAGTGCATTAAATCCAAACAAGAAAGCATGCAGTGGGAGAGATTTCCCTTGAAGTTTATTAGACCTTATTGTACGAACCCAGGGGACCGATTTCAGGAACTAGAGACGCCACTAAGAGGGATGGATATCGCGCTAAGCACCACACAAGTTCCTATTTCGATTGTTGATGAACAATTGAAAGACGGTATGGACTTAATAGAAGGTGAAATAAGCCAAAATTTACACCAACTTAAGAGCCATACACCTAGTGAAACAATAACTGTCCCAGAATCTACTGAAGGACAAGTTATGGGCTTCCTTCAAAAACTCGAAACACCGCCATCAAATGAAAAAGATTTACCCTCTTATTTCTTCTTCTTCTGTATGAAACTCCTACACTCTCAGTCAAGGGCCATGACCATCCGTCCAAATCAACAAAAAACTGACCAAAACACCCCTCAAAAAAAGAACCAACAACACCTAAATAAAAACAATGATCACCTAAATGGGCTTTCTTTCAAAAGTGTTTGGGCCAAGAATTGGCCCACTGCTAAAGAAAGACTTACTATAGCAATAAATTGCTCGCTATCGTTGGGCTTTGCCGTGTTATTTGGGCTTTATTACAGTAAGCCCAATGGATACTGGTCTGGGCTTCCTGTAGCTGTGAGTTTTGCAGCAGCTAGGGAAGCCACATTCAAAGTTGCCAATGTTAAGTTCCAAGGGACAGTCATTGGCAATGTATATGGAGTATTAGGCTGTTTTATTTTTGAAAGATTTGTACAAATAAGGTTCATATCACTTCTTCCTTGGTTCATTTTCACCAGTTTTCTTCAACAGAGCAAAATGTATGGTCAAGCAGGTGCTGTTTCTGCGGTTATTGGTGCAATTTTGATTTTGGGCCGAAGAAATTTTGGCCCACCATCGGATTTTGCTATAGCTAGAATAGTGGAAACCTTCATCGGTTTGTCCTGTTCTATTGTTATTGATTTGTTGTTACACCCCACGAGAGGAGCCACCCTAGCCAAAGTTCAACTTACCAAGACTCTAGGGACACTCGAGGATTCGATCTCCTCTATTGATCTCGTTACAACCTCCAAGGCCGAGTTACTTGAGAAGGCGAAAAGCATCAAAGCTCAAGTGAATGAGCTAGACAAATATGTTGGTGAGGCTGAGGCAGAGCCAAATTTTTGGTATTTGCCATTCCATACTGCTTGTTATAGGAAGTTGATGGGCCCTTTCGCGAAAATGGGTGATCTCTTGATTTTCACAGCTCATGCTATTGGGTTCCTAGAAGAGCATATCCAAAGCATTGAATTGGAGAGGATCAACGATGATCTAAGGCATGTAGTAAAAATGGTAGCTACTTCGATGAAATCCTTCCAACAGGTTGCTTCTATCAAGTCATTGATAGTACTTGAAAAAGACCTTGCCAAAAGTGGTAAAACATGTGATCTTGAGGTGGGAAAATCGGCCAACTTTCCATTAATGAACTTGGGTGAGAAAGATATGGAGAAATTCATAAGCTCGTACCTTGATCATTCCAAGGAAGTATTCGAAGAAATCGAGTTCCCTGAGGGAGAGGAAGAGATCAAGGGTCAAACTATCATGAGTTTAAGTGCACTTGGATTTTGCTTAAGCTGTTTGATGAGGGAAACAAAAGAGGTTGAGAAAGGAATTAAGGAACTTGTTCAGTGGGAAAATCCTACTAGTCAAATAAATCTACATGAGATGTCTTGTAAAATTCATGCATTATACGATTGA >Cla008257.g ATGGCGTCGTTGTGGCTCACGTGCTTGGCTGCCGGTTGCCGTACGGCGGTGGCATGCTCTATAATCGCTGCAGCCACCGTGTACGGCCCGGTTGTTTTACGTCGGCAAGTGACGTTTCCGGCATTTTCTTACGTCACCGCCATTTTGATAGTGACGAACGCAACTCTTGGCGACACCGTGCGCGGCTGCTGGCTGGCACTCTACGCCACGCTGCAGACTGTCTGTCCGGCCATGGCGGTGTTTTGGTTTATCGGACCGACGAAATTCTCTTACGAAACAATTGCTTTGACGGTGGCGCTGGCGTCGGTTGTGGTGGTGCTGCCGAGCTCCAGCCATGTGTTGGCTAAACGGATTGCTTTGGGTCAGATTGTGATTATTTATGTGGTGGGTTTCATCGGCGGCGTTCACACTGAGCCAATTATGCACCCTGTTCATGTCGCTGCTACGACGGCAATGGGTGTCGCTGCCAGCATCCTTGCCACCCTACTTCCCTTTCCTCGCTTTGCTTCTCTTGAGGTGAAAGAGAAGAGCAAAGCAATGGTGGACAACGTGGCAGAGCGGTTAGGGCTGTTGGTGAAAGCACTTCTTGCTGACAATGACACAGTGGCTGTTGGGTCCCTTTCTAAAGCTTCACTATTGTCCACGTCAGCAACCAAGCTCCTCCAACCCATAAAACAATACCAAGAAAGCATACAATGGGAGTGGATTCCATTGAAAATGTGCAGATTGGGATGGTTAAGCAGCAGCCAAAAGTTGCAAGATTTAGAAAGGCCCATAAGAGGAATGGAATTAGCTTTATCGAGCATTTCTTCATATCCAATAGAACCACTTCAAAATCAAGCACTTCAAAAGGGTATTAATGTCTTGGAGAATCAAATCACCCAAGCTTTAAACCAAGGCATTGCTTATTCACCGTCCGATTCACATACTTTCCCTGAGTCAAACCCAGATGAAGATCCAATCAACACAATTCAATCCATCCAAATAATCAACCCAACAAATCACAAAGATCTTCCCTCCCTTTTCTTCCTATTCTGCATGAAACTCCTTCAAGAAAAATCTCAAAACAACAACAAATTACCAAACCCCAAGAAATCAGAACAACAACAAGAAAAAACAGATCAAACAAATCAGACAAAATGGGTAATTCCAAGTGCAATTTGGAGCAGCAAAAGAGTAATGGGAGCTCTAAAATCAGCAATTTCATTGGGAATTGCTGTTTATTTGGGATTGATTTACAGCAAAGAGAATGGATTTTGGGCAAGTTTAGGAGTGGCTGTCAGCATTGCTTGTACTAGAGAAGCCACTTTCAAAGTATCAAATGTTAAGCTTCAAGGAACAGTTATTGGATCAGTTTATGGTGTTTTGTGCTTTGTTATATTCGAAAAGTTTTTATTAGGAAGACTTCTCTGTCTTCTCCCCTGCTTTGTCTTCACCAGTTTTCTTCAAAGAAGCAAAATGTATGGCCCAGCTGGAGGAGTTTCAGCCATTATTGGAGCTGTCATCATATTGGGAAGAACAAATTATGGTTCTCCAAAAGAACTTGCTTTGGCTAGAATTGTGGAGACTATTATTGGAGTTTCATCTTCCATTATGGTTGATATCATTTTACATCCAACAAGAGCTTCTAAATTGGCCAAATTTCAACTCACTTCCACTTTAAGAGTGCTTCAAAAATGCATCGAGTCCTTGAGTTTTCGAGGGGAAGATTTGGAGGGAAGTCTAAAAGAATTGGGAGGGCATGTTGGTGAGCTGAAGAAGCTGATTGATGAGGCTGAGATGGAACCCAACTTTTGGTTTTTGCCATTTCAAAGTGGTTGCTATCGGAAGCTGTTTAAGTCGTTGTCAAAAATGGTTGATTTTTTTTCTTTCGTTAGTTGTTCGGTTCAAGGGGTACGACAGAATCTTCCGGTAGTAGTACTGGAAGATTCATCGTGGGCGAAAATTGGTGAAAATTTAGAGGAGGATGTTGAGGATTTTAAGGAAATGGTGAGTGGGTTGGTGAGATGTTGTGTGGATGTGAGTTCTTTGAAATCATTGGAAGTGCTTGAGAAGGAAGCAGAGAAGAAGAAGGGTGAGGATGGTTTAGGGGATGTTGAAATGGGAGAGGGAAAAAGGGTAATTGAGATAGAGGAAATGGAGAAGGAAAAATGGGTCTGTTCATTTATGCAACATTATATGGAAGTTGTTGAGCAAAGAGGTGAAAGTGAAGAAGGTAAAAGAGAAGCAATTATGAGTTTCAGTGCTTTGGCTTTCTGTTTAAGTAGTTTGATGAATGAAATTGAAGAAATTGGGAAGGCAACTAGAGAGTTGATTCAATGGGAGAATCCTACTAGTCATGTTGATTTCAATGAAATCACATCTAAAATTCTGGCTGTACAAAAGGGTATGAAGTAA >Cla008258.g ATGGTGGAGAACATGGTAGAAAGGTTAAGTGTAATGGTGAAGGCAGTCCTTGCAGAAGATAGCACAGTGGCTGCTGCTTCCATATCTAGAGCTAACTTCTTGTCTTCTTCAGCAACTAAACTTCTCCACTCCATAAAACTTTACCAAGGAAGTAAGCAATGGGAGAAGCTTCCATTCAAAATCTGCAAAATGGGATGGTTGAGTAATAGTGAGAAATTAGAAGATTTAGAATTGGCCTTAAATGGAATGGAATTGGCTTTATCCAAAATTCCTTCATATCCAATTCAAAATAATCCTCAAAATTACCAAACCCTCAAACATGATCTAAATAATTTGGAGAGGCAAATTTCCCACTCTTTAAAGCAAGCCAATTCTTGTTTTCCACCGTCCGATTCGGTGACTTTTCCAGAAGTCAACGTAGATGATAAAACAATAATAATCAACACCCTCAATTCCATTCAAATTATTCCCACAAACCGCCAAGATTTGCCCCATTTTTTCTTCATATTCTGCATGAAACTCCTCCTCATTAAAACCCAAATAAAAACTCCAACAAAGCTACAAGAAGAATCAAAGAAAAAAAAAATTGAAAATTCCATCGACAAAGAAAAAAACAGAACATGGGTTTCCCCGATGAACAGTCAAAGGGTAATCCCAGCCTTGAAATGTGCAGTTTCATTGGGGATTTCAGTGATTTTGGGACTGATTTACAGTAAGGAAAATGGGTTTTGGGGGAGTTTGGCAGTGGCTGTAAGCATTGCTTCAGACAGAGAACCAACATTTAAAGTTGCAAACTTTAAGGTTCATGGAACAATGTTGGGTTCTGTTTTTGGAATTTTGAGCTTTGTTCTTTTCGAAAGGTTTTTAATTGGAAGGCTTCTTTGTCTTCTTCCTTGGTTTCTTTTCACCAGCTTTTTACAACATAGTACAATGTACGGTTCAGCTGGTGGAATTTCCGCCATTGTTGGAGCTTTAGTAGTTTTAGGAAGAACAAACTACGGTTCCCCAAGAGAATTTGCTTTTGAGAGAATGATTGAAACTTTTATTGGGATTTTGATATCAATTGTAGTTGATATCATTTTTCAACCAAAAAGAGCTTCTAAGTTGGCGAAAATTCAGCTCATTGTGAGTTTACAAATGCTACAAAAATGTATTAATGATTCATTTTGTTATGAATCAAACACAATAATGGAGGATTATTTGCGAAGTTTAAGAATTCAAGTTATCAAGCTGAAGAAGTTGATTGATGAGGCTGAGGTTGAACCCAATTTCTTGTTTTTGCAGCCATTTCATGGTAATAGCTATGTGAAGATGTTTAATTCCTTGTCAAAAATGGTTGGTTTACTAGCTTTGAATGGTGAAGCAATGAATAATCTTAAAGAGAATGTGAGAGAGGATTTGTGGAGAAAGGTTGTGGAGAACTTAGAGGGGGATTTTGAGAAGTTTAAGGAAATTATGGCCAATGGTTTTGTGACATTTTATGAGGATTTGAGTTCTTCATTGAAGTCTTCGAGAGGGATTGAAATTAAGGACGATAATTATGATGATATTGAGATGGGAAAGCCACAAAGGATTAAAATATTAATGGATGAAATTGAGAAGGAAAAGTTGGTTAATTCCTTTTTGCAGCACTTGGGAGAGGTTGTTGAAATTAAAGATGGTAAAAGTGAAGAAATTTTGAGTTTGAGTGCTATGGTGTTTTGCTTGAGTAGTTTGATGAAAGAGATAGAAGAGATTGGAAAGGCAACTAGAGAACTCATTGAATGGGAGAAATCCTTTTTCTAG >Cla008259.g ATGGCCGCCGCCTCCACCACCACCAACCACGACGGCCGAGCCATGTGGTTCACACGGCTGGCCTCCGCCTTCCAAGCGGCTCTTGCCTGCTCAGTAGTGGCCTGCACCACCTTGTACGGCCCGGCTACTCTCCGCCGCCTTGTGGCCTTTCCAGCCTTCTCCTATCTCACAGCTATTCTTATAGTCACCAACGCTGCCCTCGGCGACGCCGTCCGTGGCTGTTGCCTAGCTGTCTTCGCCACCGTCCAGACCGTGTGCCCGGCCATGTTCCTGTTTTGGTTCATTGGTCCGACCAAATTCTCCCACATCACCACCGCCGTCACGGTGGCGTTGGCTTCTGTGGTTGTGGTGGTCCAAAGCTCAACCCATGTGCTGGCTAAGAAGATTGCTTTGGGTCAGATTGTGCTCATTTACGTTGTGGGTTTCATCGGCGGCGCCCACACTGACCCACTCATGCACCCACTCCATGTCGCCGTCACCACCCGGGGGCCCCCCCGCTAG >Cla018222.g ATGGCGGTGACGGCGGCCTCGACGATAATCTGGCGAATGCGCCTAGGCTCGGCTCTACGAGCGGCTTTGGCATGTGGCATAGTCGGCGCCGTCACAATTTTCGGGCCCGCGCCGGTCAGACGGTTACTAGCGTTCTCGGCTTTCTCTTATGTCACCACCATTTCCATAGTACTTTCCGACGCGGTTTCGGTCGGCGACGCTGTAAGGGGTGTGTGGCACGTGATGTGGGCGGTGGCGTCGGTGATGGTCTTGTCTGTGCCGTGCTTGTGGCTGATCGGACCGGGACGGTTCACGGGAGCTGCGTCGGCGGCGGTGGCAGTGGCTGTCAGTGCGTTTGTGGTGGCGCTGCCGGAGCGGACCCACTTGCTGACGAAGCGATTAGCGTTTGGGCAGCTGGTGATCGTGTACGTCGGGACAGTGATTCACGGCGGTCAGATCAGTTTTATTATGCACCCAATTCGTGTCGCGTCCAGTACGGCAGCCGGAGCTCTCGCTGCCGTCGCCGCCATGATGCTTCCTTTCCCACGCCTCGCCTTCTTCCAGATAAGGAAACTTAGTAAGGGTTATTGTGAGAATGGTTGCGAGAGAATGGGAGCAATGGTGGAAGGAGTGGGTGCGAAGAGCAAAGCAGAGGCAGTTGCATTAATGGTTGAAGCCAAGTCCCTATCAACAAATGGAACAAAGCTTCTTCAAAGTATCAAAGCCAATATGAGAGGAATGATTTGGGAGAGGCGACAGATGAGCTTCGACATTGAAGAAAAATTGGAAGAAATTGAAGTTGCAATGAGTGGAATGGAAGCCGCTTTAACTTCTCCTTCAATGGCCTTAGGAACAATGGATGAACAACTCTGTAATTTCCTCAACAATCTCAAACCCAAAGCCATCTCAAAGTTACAGCAATTCAAGATCTCCGTTACTCCTTCTTCCACCACCGCGCCGGAGACAAAGCCCACCTTCTCAATCCCTTTGCCTCTCAACATTTCTCCCATTACCCCTCAGATTCTTCCCGCTTCCTTCTTCTTGCGTTGTATGGATATCCTTTTGTACGACTCAACCGCCGCCGCCACCGGTCGGAATCTCATCTCCAAGGTGGAAACCGGTCGGAGAGCCAACGAGGAAGAAGCAACGGAGTTCGGAGTCCATTGTACCAAAAAAACTCGTTGGGGCATTTTGTCGAATATGTTGCCTACAAACCAGAGTTTGCGCTTTGCGCTAAAATGCTCGATTACATTGGCGCTTGCTGTGTTTCTGGGCCTGACTTACACAAAGCCAAATGGGTATTGGTCAGGTTTGACGGTCGCCATCAGCTTTGCAACGGAGAGACAAGCCATATTTACCGTTGCAAACGCTCGCGCTCAAGGGACGGCAACTGGGTCAATCTATGGTGTTATATGCTGTTTTATTTTAAAGAAATATGAGTATTTATGGCTCTTACCTCTTCTCCCTTGGGTTGTTTTTACCAGCTTTCTTGTTCATAGTAGAATGTATGGTCAATCTGGTGGGATTGCATCAGCATTAGGTGCATTGCTAGTTCTTGGGAGGAAGAATTATGGCATTCCATCTGAGTTTGCAAATGCTAGAATCACAGAAGCTTGCATTGGATTGCTCTGTTTTTTGACAGTGGAGATTGTGTTCAACCCAACAAGAGCAGCAACTTTAGCAAAAACAGAATTCTCAACAAGTTTGGTGGCTCTTCAAGCTTGCATCAAAAGGGTAATCCTCATTCCCCAAAAAAACTTGAATGAAACATCTAATTTCATTTCATTGATAGAACACCATAAAATTCTGAAATCCCATGTTAGTCAATTAGAAAAATTCATTGTTGAAGCTGGGTTTGAGCCTAACTTCTGGTTCACACCTTTCCAAGGTGGCTGCTATGAGAAACTTCTGAAATCCCTCCAGAAAACAGTGGATATCTTACAATTTATGGTGCATGAAATGAGGTTTCTGTCTCTGGAACTCAATAGGTCTGGATTTGTCGTGAAGGAACTCCATGATAGTTTAAGTGAAGACATTGAAACTTTCAGCAAAAAACTTGGATGTTCTCTGAAGTTCATGGAGAAGATGAGTCTAATAAAGTCCTTAAAAGAATTGCAGAACAGAAACCAAAGCCAATGTTCTTCTGAAATGGAGATGGGGAAGAAGGTTTCAAATGATGGATGCAGAGCTTTTGCTTTCAATGAAGAAGATGTTGAGAAAATTGTGGGTTGTTTCTGCCAACATTCAAATGAAATACTGAGCAAAGCTTACACAAATGATGAAGGTGAGGGAAATTTGAAAGGCCAAATGTCATTATGTTTGAGTTCCATTGGGTTTTGTATGGAATGTTTGATGAGAGAAACAATGGTGATGGAGAAAGAACTGCATCAGCTGCTGAAACTGGAGAATCCATCCATTCATATTGATTTGCAAGAACTTTCAACAAAAGTAAATGCTTGCTGTACAAAATAA >Cc01_g12590 ATGTCAATCCTACAATTTCAATCCGATCATGCTGGAGCAGCATGGAGATCATGCGTAGCTTCAGCCTTCCGAACAGCCTTAGCTTGCACAATTATTGGCTGCATCACCCTCTTTGGCCCGCCTTCATTTAAGCAACAAGTAGCATTTCCTGCTTTTTCCTACGTGACAGCAATTCTTCTTGTCACAGATGCCACGGTGGAGGACACCTTCCGTGGCTGTTGGCATGCCTTGTATGCTTCCGTCTTTGGTGTCTGCCCTGCCATCCTTAGCTTATGGTTAATGGGGCCAGCCCAGCTAACCATTAGCACCACCGCCGTTGCGGTGGCGCTCACCGCATTTGTGGTGGTGCTGCCTGAAAACAGTCACCTGATATCAAAGCGTATAGCACTCGGCCAGACTGTTGTTCTTTACGTTTTAGCTTTCGTCAATGGTTCCAAAACTGACCCTATTATGCACCCCATCCACGTCTTAGCCAGTACGGCTGTTGGAGCCGTGGCTAGTGTTCTGGCCTTGTTGCTTCCTTACCCAAGCTTGGCTTGTTGCGAGGTAAAGAAGAAATTCAAGCTTTACGCTAAGAATGCTTCGGAGAGGGTAGGGGTCCTTATGAAGGCGTTCTCTGCACAAGACAAAACATCAGCACAAGCACTGATTTTGCAATCCAAGTCCTTGGCTCGCACGGGAACCAAATTGCTTAGGAGTATCAAATCCAAGCAAGAAAGCATGCTATGGGGAAGGCTTCCACTCAAATTTTTGAAACCTTATTGCATGAATCCAGGACAGATATTGCAAGAAATTGAGACACCTTTAAGAGGGATGGAAATTGCCTTGTCCAATGGTGCTGTACCATTTCCAGAGCGCAAAGATGATCTAGCAGGAATTGAGGAGCATATTTCGCGTCAAATTAAAAGCATGCCCCTTGTTTTAGCAACTACTGTCCCCGAAGCAAATGCAGAAAACGTTGCTGAGTCCCTCCAAACTCTTCAAACCGTCCCAACAGACCATAGACAATTGCCCTCTATTTTCTTCTTTTTTTGCTTGAAGCTGCTACAAGCAAAATTAGTTACCACCTCAGCAATCAGTTCTATCAAAGAAGGATCAACTGGTCCAGAAAAACAGGAGAAATGGTTCTTCATTCGGATATGGAGAAATTTGTCCATCAACATAAACAAAAGCAGGCTTATGCCAGCTTTCAAATGCTCACTTTCATTAGGCCTAGCTGTGTTCTTTGGATCATTATACAGCAAGGAAAACGGAATTTGGGCAGGATTGCCAGTTGCCATAAGCCTTGCATCAGCCAGAGAAGCAACATTTAAAGTTGCAAATGTTAAGGCACAGGGAACAGTAATAGGAACGGTGTACGGAGTATTCGGTTGCTTTATTTTCGGAAAATATGTTCCGATACAGCTACTATCCCTTCTTCCATGGTTCATTTTCTGCAGCTTTTTACGGCGCAGCCGCATGTACGGTCAGGCGGGAGGAATTTCAGCAGTCATAGGGGCAGTACTATTATTAGGAAGGAAAAATTTTGGTCCCCCAAGTGAGTTTGCAATAGCAAGAATCACAGAAACTTTCATTGGACTATCTTGTTCAATCGTGGTAGAACTTGTTTTACAGCCCACAAGAGCTTCTGCTCTAGCGAAAGTTCAGCTCTCCAAGAATTTTGAAGCGATGCGAAATTCTATTGGTGCGGTTAGTCTCACTGCCAGCAAGGCCAACTTGGAGGAAAGCCTGAAAAGGCTTAAACTCCAAGTGAATGAACTAGGAAAGCTCATCGGTGAAGCTGAGGTGGAACCCAATTTTTGGTTTTTGCCTTTTAACAGTGCTTGTTACCGTAAGCTCTGGGTGTCCTTGTCCGAAATGGTGGAGTTCCTACTTTTCATCACTCAAGCAATTCAATTTCTCCATCAAGAATCAGGAAGAGTGGACACCAATTTGTGGAAGGAAAGTATGAGCAAGATAAATGCTGATCTCAAAAATTTCAAGGAAACGGTTGACTCTTCAATAAAGTGTTTTGAAGAGGTCAGTCTGGTAAAATCACTTGTGTTATTGGACAAAGAGATGGAAAGGAAAAACATCTCTCTTGATCTTGAATCGGGGAAATCACCAAAAATCCCTTCTATGATGAAACTACCAGGTTCAGATGAAGAAGTGATCATTGACAAAACTCTAAGCCATTATCTCCAGCATTGCAACGAATTCCTTGAGGCTATTCGTGCTGATAAAGGTGAGAGGGAGCTCAAGAGCCGCATTGCATTGACTTTGAGCTGTATTGGTTTCTGTATGAGGGGGCTTGTAAGGGAGACCAGAGAGATTGAGAAGGCTATTAAAGAACTTGTGCAGTGGGAGAACCCGTCAAGCCTTGTGAATTTGCATGACATTTCTAGCAAGATACGTGCTTTAACAGCAGCTGCTGCAGACACCGACATGTATGAAGAACTGCAGCTAAACCATAGCAATGATTTGATTCCAAGGAAATGA >Cc06_g02820 ATGGCAGCAAGAGTTGCAGGCAGAATCCGGGCTCTGTGGTGGGTGAAGCTGCAGTCGGCCTTTCGGACCGCCCTAGCTTGCACCATCGTGGGCTGCACCACCCTCTACGCTCCAGCCCATTTCACAAGGCAGATAACGTTCCCGGCAATTTCTTACGTTACAGCCGTACTAATTGTGTCTGATGCCAACTTAGGCGACGCCATAAGAGGCTGCTGGCATGCATTTTATGCCACTCTTCAAATGCTGCCGCTTTCCATATTAGGCCTACGGATCATCGGGCCGGCGAGGTTCTCCCCTAGCATCGCTGCTGCGGCGGCGGCTCTAGCCTCTTTCTTGGTGGCTCTGCCAAATTCTACACCTCTGATGTCTAAGCGTATTGCTTTTGGGCAGATAGTGATTGTTTGTGTGAATGCTGTCATTCATGGCAAGCAAAGTTCAAGTGTGGTGGTGCACCCGGTTCATGTTGCGTCCAGTACAGCACTTGGAGCAGCCTCTGCTTTCCTGGCTTTGTTGCTTCCCTACCCTCGGCTTGCCTATTACGAGGTTAGAAAACTTAGCCGATTGTACGCTGAAAATGCTGCTGAGAGGATCAACCTTTACATGAATGCATTCCTCGCTGAAAATCATCTCAATGCTGTGGAGCTAATCTCTCTAGCCCATCCCTTGGCTGCAACAGGAAAGAAGCTCCTCCGCACTATAACTCTCATGCAGGTGACTCCATTTTGTTCATTCAGTTCTCAGGAAGGTATTTTGTGGGAGATGCCTTGGATCAGATTCTCAAAACTCCATTTTGCGAATCCAGGAGACAGATTGCAAGGAATGGAGACATCGATGGAGGGAATGGAAATTGCCCTAAAATTCTGTCCCCTTTCATCTGCCGGCTTGGCTACTCAAGAACTTACTGATACCATCCGGCATTTGTCCGTGCAACTTGGTCAAAAACTAAAGCAAGCTAGATGCTTTCAACCTTTTAACTCGACAACCGTCCCGAAGCCTAAAGGAGGATGCCTAGACAACCTCATCTTGCCCAGCTGCGACACGATCCCATTGAACAATAAACATCTGTCAGCGCTTTTCTTCTTGTCTTGTTTGGAACAGTTTCTCAATGACTCGACCATGGTACAAAAACCGGAGCCCAATTTAGAAAGTCTGGCAGCTGAAGGAGAAGAACTAAAAAACTCACAAAAGCATGCACAAATTAGCTTCAAGGAAACGTGCAGAAAATGGATCGGAAATCTTAGAAATGAAAGATTACTATTTGCGTCCAAATGTTCACTATCTTTAGGTTTGGCTGTTCTGATTGGTCTCATATTTAACAAGGAAAATGGTTATTGGTCAGGCCTTACAATTGCAATCAGTTTCACAACACGAAGGCAAGCAATTTTTACAACTGCAAATGCTCGGGCACAAGGCACAGCAGTTGGATCAGTCTACGGAGTCTTAGGATGCTTCGTCTTCAGCAGGTTAGCAGAAATAAGATTCGTGGCTCTTATCCCTTGGATCATTTTTACCAGTTTTCTAAGGCACAGTCGGATGTATGGCCAAGCTGGCGGAATTTCGGCAGTTATAGGAGCTCTATTGGTCCTTGGTAGAAATAATTACGGACCTCCAGATGACTTTGCCATTGCCAGACTAACAGAGGCTTTCATTGGTCTATGTTGTTTCATTCTAGTGGAGCTCCTCTTACAACCAACAGGAGCATCCACTCTAGTCAAGAGGCATCTTCATCTAACACTGGGTATTCTTCAAGAATGCATAACACAAGTAATTACCTACTCAAAGGGAAAGGATCAAGCATCTATGGATCTACAAGCACTTAAAGGAAAGCAGAAACATCTGAAGTCCTATGTCCATGAGTTTGAGAACCTTATAGGGCAAGCTGAGCTGGAACCCAATTTCTGGTTCTTGCCATTTAGGAACACTAGCTACTGGAAGCTCCACAATTATTTGTCAAATACAGCCGATCTGCTACACTGTATGGCCTACAGCCTAGAATACCTTCTACAAGTACCAAAGAATCATTTTGCTCTCTGGAAGGACCTTCAAGAATACATACATCATGACCTGGAGTTGTGCAAAGACAACTTAACCTCTTCATTAAGGTGCCTCGAGAAAGCTAAAATGGTAAAGTCATTAGAAGTAACTCAAGAAGTTCAACAGGGGGGTATGTATAATGATCTCGAGAAAGCATTTTTCGCCAGGGAAAACAGTTTCAGTACTTTGACTACAACGGACCAACAAATTAGAAACATTGTAAACTATCTTCTTCAGCGGTCCAAGAAGGGTGAACATGAAATCAAAGAAAATGAAGGTGAGGATGGAGTTGGAGAAAAGATGGCTCTTGCTCTCTGTTCCCTGGGCTTTTGCATAAGTGGTTTCATGAGAGAAATAAAAGATACTAAGAGTGTAATCAAAGATGTAGTAGCATGGGAGACAAAGCTAAATGTAGATTCTCGCCAAACATCATGCAAATTTTGTCCATTTTAG >Cc08_g08670 ATGGAAATTGCTTTGTCCAATGGTACCGTACCATTTCCAGAGCGCAAAGATGATCTAGCAGGAATTGAGGGGCTTATTTCGCGTCATATTAAAAGCATGCCCCTTACTGTCCCCGAAGCAAATGCAGAAAACGTTGCTGAGTCCCTCCAAACTCTTCGAACCGTCCCAACAGACCATAGACAATTACCCTCTATTTTCTTCCTTTTTTGCTTGAAGCTGCTACAAGCAAAATTAGCTACCACCTCAGCAATCAGTTCTATCAAAGAAGGATCAACTGATCCAGGAAAACAGGAGAAATGGTTCTTCATAAGGATATGGAGAAGCTTATCCACCAACATCAACAAAAGCAGGCTTATGCCAGCTTTCAAATGCTCACTTTCATTAGGCCTAGCTGTGTTCTTTGGATCATTATACAGCAAGGAAAACGGATTTTGGGCGGGATTGCCAGTTGCCATAAGCCTTGCATCAGCCAGAGAACCAGCATTTAAAGTTGCAAATGTTAAGGCTCAGGGGACAGTATTAGGAATGGTTTATGGCGTATTCGGTTGCTTTATTTTTGGAAAATATGTTCCGATACAGCTTCTATCCCTTCTTCCATGGTTCATTTTCTGCAGCTTTTTACGGCGCAGCCATATGTATGGCCAGGCGGGAGGAATTTCAGCAGTTATAGGGGCAGTACTATTATTAGGAAGGAAAGATTTTGGTCCCCCAAGTGAATTTGCAATCGCAAGAATCACAGAAACTTTCATTGGAATATCTTGTTCAATCGTAGTAGAACTTGTTTTACAGCCCACAAGAGCTTTTGCTCTAGCGAAAGTTCAGCTCTCCAAGAATTTTAAAGTGATGCGAAATTCTATTGGTGCGATTAGTCTCACTGCCAGCGAGGCCAACTTGCAGGAAAGCCTGAAAAAGGTTAAACTCCAAGTGAATGAACTAGGAAAATTCATTGGTGAAGCTGAGGTGGAACCCAATTTTTGGTTTTTGCCTTTTTACAGTGCTTGTTACAGTAAGCTCTCCGTGTCCTTGTCAGAGATGGTGGAGTTCCTACATTTCATCACTCATGCAATTCAATTTCTCCATCAAGAATCAGGAAGGATGGACACCAATTTGTGGAAGGAAAGTATGAGCAAGATAAATGCTGATCTCAAGATTTTCAAGGAAATAGTTGACTCTTCAATAAAGTGTTTTGAGGAGGTCAGTCTGGTAAAATCACTCGTGTTATTGGACAAAGAGATGGAAAGGAAAAACATTTCCCTTGATCTTGAATCGGGTAAATCACCAAAAATCCCTTCTACGATGAAATTACCAGGTTCAGAAGAAGAAGTGACCATTGAGAAAACTCTAAGCTATTATCTTCAGCATTGCAACGAATTTCTTGAGGCTATTCACGCTGATAAAGGTGAGAAGGAGCTCAAGAGCCGCATTGCATTGATTTTGAGCTGTATTGGTTTCTGTATGAGCGGCCTTGTAAGGGAGACCAGAGAGATTGAGAAGGCTATTAAAGAACTTGTGCAGTGGGAGAACCCGTCAAGCCTTGTGAATTTGCATGACATTTCTAGCAAGATACATGCTTTAGCAGCAGCAGTAGATACCATGCCAACGCAAGTTGGATCAGTTGGCAATAACGAGTCACTTTCTCACAAAAAGCTATGTATTCGAATTCCGCTACCGATGTGA >Cc08_g08680 ATGTCAATCCTACGATTTCAATCGGATCATGCTGGAGCAGCATGGAGATCATGCATAGCTTCAGCCTTCCGAACAGCCTTAGCTTGCACAATTATTGGTTGCATCACCCTCTTTGACCCGCCTTCATTTAAGCATCACATAGCATTTCCCTCTTTCTCCTACGTGACAGCAATTCTTCTTGTCACAGATGCCACGGTGGAGGACACCTTCCGTGGCTGTTGGCATGCCTTGTATGCTTCCGTCTTTGGTGTCTGTCCTGCCATCCTTAGCTTATGGTTAATGGGGCCAGCCCAGCTAACCATTTGCACCACCCCCGTTGCGGTGGCGCTTAGCGCATTTGTGGTGGTGCTGCCTGAAAACAGCCACCTGATATCAAAGCGTATAGCACTCGGCCAGATTTTTGTTGTTGTCTACGTATTAGCTTTCATCAATGGTCCCAAAACTGACCCTATTTTGCACCCCATCCACGTCTTAGCCAGTACGGCTATTGGAGCCGTGGCTTGTGTTTTGGCCTCGTTGCTTCCTTACCCAAGCTTGGCATGTTATGAGGTAAAGAAGAAATTCAAGCTTTACACTAAGAATGCTTCGGAGAGGGTAGGGGTCCTTATGAAGGCGTTCTCTGCACAAGACGAAACATCAGCACAAGCACGATTTTGCAATCCAAGTCCTTGGCTCGCACCGGAACCAAATTGCTTAGGAGCATCAAATCCAAGCAGGAAAGTATGCTATGGGGAAGGGTTCCAGTCAAATTTTTGA >Gorai.001G108600 ATGCCAACAGCACAACAGCAATCGAACCGAGCCAGGGCGTTATGGCTCACCTGCCTAGCCTCCTCCTTCCGCACCGCCTTAGCCTGCACCATAGTAGGCATCATCACCTTGTACGGTCCATCTTCCGTCCAACGTCAAGTGGCATTCCCTGCATTTTCCTACGTGACAGTCATCCTAGTGGTCACGGACGCCACGTTGGGTGACACTTTGCACAGCTGCTGGCTGGCTCTTTACGCCTCCGTCCAGAGCCTTGGACCAGCCATGTTGAGCCTGTGGTTGATACGACCAACCAAGCTAACGAGTGGAACCACGGCCCTTGCGGTGGCTTTAGGGGGGTTGATAGTGGTGTTGCCGGAAGCAACTCACATGGTAGCCAAGCGAATAGCGTTGGGCCAAATTGTTATAGTCTATGTTATTGGTTTCATTAATGGTGGTCAAACGGAACCAATCATGCATCCGGTGCATGTGGCGGCTAGCACTGCGGTCGGGGTGTTGGCTTGCGTTTTAGCCTTAATGTTTCCTTACCCAAGATTGGCTTGTTGCGAGGCCAAGAAAAGCTGCAAACAACTGGCGGAGAACAGCTCGGAGAGGCTGAAGCTTTTCGTCAAGGCATTTTGCGCACAAGATAAAGCAGCGGCATCTGCTTTTATTTCTCAAGCAAAGCTATTAAACGCCGCCGCAAACAAACTTGTTCAAAGCATTAAACGCTTCCAAGGGAGCATGAAATGGGAGAAACTCCCGTTCAAGTTTCTGAGACCCTATTACATGAACTCAGGGGAGAACGTGCAAGAAATGGAGATGGCTTTAAGAGGAATGGAAATTGCTTTGGAGAGTATTCCTTCATTTCCAGGGAGTTTAATGGTGGATGATGGAGAACTCAAAGACGGCTTGCTCAGGCTAGAAGATCACATTAGCTGTACCATAAGACAGTCCAAGTGTTTGGTCCCGGGTGATTCCAGTACTGTTCCGGAATCAAATGCTGAAGATGTTGCCAAGTTCTTCCAATCTCTCCAAACAATGCCACAATCCCACCAAGATTTACCTACTTTTTTCTTCTTATTCTGCATGAAACTCCTCCATAGTAAGTCGTTGCCGGAGCCAAGGACCAAAAAACCGGTCCTGGAAAATGGGAAGTCGAAACAAAATGGGTTTTCCTTCAAGGAGGTTTGGAGCAGCTGTGGTCTTGATAGCCGAAGGGTGAAGCCGGCCTTGAAGTTCTCACTTTCTTTAGGATGTGCAGTTCTATTTGGGCTGAAATACAGTAAGCCCAATGGATTCTGGTCGGGACTCCCGGTTGCTATCAGCTTTGCTGCCGCAAGAGAGGCGACATTTAAGGTAGCAAATATTAAAGCACAAGGGACAGTTCTAGGGACAGTGTATGGAGTTATAGGGTGCTTTCTTTTCGAAAGGTTCTTGCCAATCAGGTTTTTGTCTCTTCTTCCTTGGTTCATCTTCACAAGTTTCCTAAGGCAAAGCAAGATGTATGGTCAGGCAGGTGGAATATCTGCTGTCATTGGAGCCCTACTGATATTGGGAAGGAAAAACTTTGGTCCACCAAGTGAGTTCGCCATTGCAAGAATCATTGAAACATTCATTGGATTGTCTTGTTCGATTGGGGTAGAGCTTCTTTTCCAACCCAAAAGAGCTTCAACTTTGGCCAAAATCGAGCTCTCTAAAAGTTTGGGGACATTGCATGAATGCATCGACAACCTCTCTCTCCAACCCAATCATGTAGAGAGTCACAAAAAGTTGAAATTCCATGTGAATCAGCTAGGGAAATTCATTGGAGAAGCTGAGGTGGAACCTAATTTTTGGTTTTTGCCATTTCATAGTGCTTGCTATGGTAAGCTTTTTGGGTCTTTGTCAAAGATGTCGGATCTCCTGCTTTTTGGCACTCATGCAATAAGGTTCCTCCAACAAGAGTCACAAAAACTCGAAACTTCTTGGAAGGAAACTGTAAATAAACTAGACGGTGACCTTAAACTCTTCAAAGGGTCAGTTGGGTCTTTAATAAAATGCCTCGGAAATATCACATCGATCCCTATGCTTGACAAGGGACTTCAAAAGGATGGCATCTCTTATGATATCGAGATGGGAAAACCCCCATGCCCGAATTTTTTCAGGGTTCCCGATTCAGAAGAGGACGAAGATGAGCTGAACAAGGTTTTGAGTTCATTTCTTCAACATTCGAAAGAAGCAGTGGATATGATCCATGGCATTGAAGGTGAGAAGGAGATTAAGAGCCAAACGGTGTTAAGTTTGAGTGCCATGGGGTATTGCATCAAAGTTTTGATAGCAGAAACCCGAATGATTGAAGAAGGAATAAGGGAACTTGTTCAGTGGGAGAATCCTTCGACCCCTGTCAACTTGCATGAAATCTCATGCAAAATACGTGCTCAATACAGTTAA >Gorai.002G258600 ATGGATAGCTCACAAGCTCCATGGCGTTTACGCCTAGGATCTGCTTTGCGGACTGTGCTAGCTTGTTCCATAGTGGGTTGCACTACCCTCTACGGGCCGGAATCTGTCCGGCATACCATAACGTTTCCTGCGTTTTCCTATGTGACAACTATCTTAATAGTCTCGGATGCTACACTTGGTGATGCCCTGCGAGGTTGTTGGCATGTTCTATGTGCCAGCATTCAAGTAATACTGCCTTCTATGTTGATTCTCCGGTTGATTGGACCATCAAGGTTCAACTTTGGACTAGCTGCTGTAGCAGTGGCACTTAGTTCATTCCTGATCGCGTTACCTGGTTCCACGCATTTGACGGCTAAGAGGATTGCCTTCGGTCAGACTGTGATTATTTATGTAGGTGCAGTTATTCAAGGTGCAAAAACTGGAATTATCATTCATCCGATTCATGTCGCAGCGAGCACAGCTCTTGGCGCCGTGGCATCTATTCTAGCCATGTTGTTTCCGTACCCTCACTTAGCCTACCGTGAGGTAAGTACCGAGCTGGAATATGAACTTGCTTTGTTTTGCATGGACCTGCATCTATTTTGCATCAAGATTTATGTATTGCATAAGCATAACGAAATAGTGCAATGTTTAGGGTCAAGTTTCATGGTGTTCATCCTCACCTAG >Gorai.002G258700 ATGGATGTACAGGTAAGAAAGATATGCAGATTCTATGCGGAGAATGCTTCAAACAGGTTTAATCTCTTAGTGGAAGCTTTTTGTGCAAAAGGGGACATGGCAGCGCATAATTTAATAACAGATGCAAGGTTACTCTCTAAAGCAGGAGCCAAGCTAATTGGAAGTATCAAAGATAAACATGAAGGCATGCTTTGGGAGAAACCATGGTTGAGATTCTTGAAACCAAAGCGCTCAGATCCCGGAGAGAAACTGCAAGAGATGGATATGCCGATTCAAGGGATGGAATGGGCCTTAACCACTTGCACTTCCTTCCCCGTCAGGATGATGGACGAAGAGCTCGTAGATGTTCTACAAATTGAAAAGAAACAGATCGCTCTAAAACTTGAGCAAGCTATGCGTTCCGTGCCTTTTGATGCAGCAACAACTCCAGATATGAAGGGAGAAAATACTGACAGATCTCCGTGGACCCAAAAAGCCATTTCAACAAACCGTGAAGATCTGTCATCCTTCTTCTTCTTGTATTGTATGGAACTCCTACAAGACGGTCCTGCATGCATTTTAAAGAATGGCGAGGAAGCTAAAATACAAGAATCGAGTCAGCCAAAGAAGCAAGGAAAAAGCAGAATGAAACAGATGCAGAGTTTCCACAGGGAAAACTTTGTTTTCGCAATCAAGTGCTCACTTTCTCTAGGTCTCGCTGTGCTATTCGGTTTGATATATAACAAAGAGAACGGATACTGGTCGGGACTAACAATTGCCATTAGTTTCGTAACAGAGCGACAAGCAACATTTATGGTGGCTAATGCCCGAGCGCAGGGGACAGCCATGGGATCAGTATATGGAATACTATGCTGCTTTATTTTTAAAAAGCTTACAGATTTAAGGTTCTTACTTCTACTTCCTTGGATCATTTTCACCAGTTTTCTGAGACATAGTCGCATGTATGGCCAAGCTGGTGGGATTGCAGCGGTTATAGCGGCATCGCTGATATTGGGAAGGAAAAACTACGGCACTCCAAGTGAATTTGCAATTGCTAGAACCGCAGAAGCTACCATCGGATTACTATGCTTCGTCGCAGTGGAGATTCTGTTCCATCCTTCAAGATCTGCAACACTAGCAAAAACAGAACTCTCAAGGACCTTAAGAGCAGTTCAAGATTGCTTTAAGGTAATAAGTCTTCATACTGATCGAAAAGAAAATTTGATGGAACTAATGCGAGAAAAGCAGAAGAAGCTGAAATATCATGTCAGGGAACTGCAAAATTTCATTGCAGAAGCTGAATTGGAGCCGAATTTCTGGTTCCTGCCATTTCATTGTGGTTGCTACAATAAGCTTCTAATATCTATTTGCAAAATGACAGATTTGCTACACTTTACTATCCATCTAATCGGATTTCTCTCAGCAGCATCCCAGATGCTGGGAGTCACTTGGGAGGAGATCCAAGAACAGATAAAGAATATCCTAGAACATCTCGTGGACAAAACAGGCTCTTTATCAAAATGCCTGGATAAGGTATTACTAGTTAAGTCTCTGGAAGAGATTGAAAAACAGTTGCAAATGGAAAGTGTATCCCAAGACCTTGAGTTGGGAAAATCACCAAATGCAGATGTCTCTACACGATTGGGGTATGAAGAAACCAGCATTTCTGAGATCGAAAAGTCTTTTCTTCAATATACAATCAGAGTGGCAGATAAGACCGAGCGTAATGAAGTCGAAGAGATGCTTAAGAGCCAAATGGTTCTATGTCTAAGCAGCCTAGGCTACTGTCTTAATGATTTGAAGAGAGAAGCCACAGAAACAGAGAAAGAAATAGCTGAACTACTGAAATGGGAGAATCCAACAAGGCATGTAAATTTTCCTGAACTGTTATCTAAGCTTCATGCCACATGA >C.cajan_09735.g ATGCCAACAACATCCTCCTCAATCGCCGCCACCAGAGCGGAGGAGTGGCGAACTCGAATAGGCTCCGCCCTACGAACCACCGTGGCATGCACCGTAGTAGGCCTCACCTCCCTCTACGGCCCGGCGCCTCTCCGCCGCTACCTGGAGTTCCCATCCTTCACCTACGCCACAACGCTCCTCATAGTGTCCGACGCAACGCTCGCCCAAACCCTAAGGGGATGCTGGCGCGTGCTGTGTTCCAACGTCCAGGTCATGATCCTGTCCCTGCTGAGCCTGCACCTGATAGGGCCGAGCAACTTCACGAACGCGGTGGCGGCGCTGGCCATGGCGGCCTCGGTGTTCGTGGTTGCGCTCCCGGAGCGGAGCCACTTGGTGACTAAGCAGCTTGCGTTTGGACAGCTGGTGAATGTGTTCGTTAGCACCGCCGTGGATGGCGGAAAAACAGGCGTGGCCGTGCACGCGATTCACGTGGTGTGCTCCACCGCCTTTGGAGCTCTCGCTTCTCTCGCTTCTTTTGTCGCCACGCCCTTTCCCTATCCTCGACTTGCCTACTATCAGACAAAGAAGTTATACCGATTATACGCTGAGAATACTTGTGAGAGGTTCAATTGCATCATAGAGGCCATCTCTGCCTCAGACAACTCAACTGCTACAGGTTTCTTCACTCAAGCAAAGTCCCTTTCCACAACAGGAGCCAAGCTTCTCCAAAGTATTAGAACCAAACTGGATGGCATGCATTGGGAACGGCCACAAACAAAAATTTTCAACCCCCATTGGATTGACCCAGAAGAAAAACTGCAAGACTTGGAGCTACCAATAAGAGCTATGGGCATTGCTTTATCAACTTTTACTTCTTTTCCTGTTGGGGTCATTGATGAGGAGCTCAGAGGTGTCTTGCTGAATTGCAGAGGACAATTCAGCAAAAAATTAGGTCAGCAAGCCAAGTGCTTTGCACCTTTTGATACAACCATAAATTCAGAGATAAAAAAAGACATTTTGACCAAAAACCTGTCGGTAGCCTATAAAGATCTACCAACCTCGTTCTTTTTATACTGTGTCCATCTTCTCCTAGATGACTCACCCATTGCAAAGAAAAATGACCATTTGCTGGGGAAAACTCAGAAAAGTGGTGATCCGAATTGGAGCACCAGAGAGGTTGTGATGAACTTGATTCCCAGCAACCACAACTTGGCTTTTGCATTCAAGTCCTCTCTTTCGCTAGGCCTCGCTGTGTTTTTCGGTTTGACATATAACAAGGAAAATGGATACTGGGCGGGACTCTTAATCTCCCTATGTTTCGTGACTGGACGCCATCCAACATTCTCACTAGCAAATGCACGAGGGCAAGGAACAGCAATGGGATCGATCTACGGGATCCTTTGTTGTTTCATTTTCCAAAAAAATTTGCGTTTCAGTTTCTTAGCTCTTTTACCATGGGTCTTTTTTTCTTCTTTTCTCAAGTATAGTAGAATGTATGGTCAAGCTGGTGGGATTTCAGCAGCTACAGGGGCCTTATTGGTCATTGGTATGAAGCACAATGAACCTCCAATTCAATTTGCACTTGCTAGAATGGTCGAGGCCACAATTGGACTCCTTTGCTTCGTTATTGTAGAGATTGTTTTTAATCCTTGCAGAGCTGCAACTCTTGCAAAATTTGAACTTTCTCAATGCTTGAAATCACTTCAAGATTGCATTGAGCAGATTGACATTAGTACTCCAACCAAGAAAGAGATGTCATTTTCAAGCTGTCCAGCATTGAGAGAATGCCAGAAAAAGCTGAAATCTCTAGCGGATCAATTAGAAGAGTTCACAGCAGAGGCTGAATTGGAACCAAATTTCTTGTTCGTTCCATTCCATAATGAATGCTACAAAAAGATGCTGGAATCACTATCAAAGATGGCAGATCTCTTAATTTTTGTGGCATACTCAATGGAAAATGTCATGCTACTGTCACAGAAAAATGGAGCATTTTGGAAGGATCTCCATGATCAAGTAAATGAGAATGTGAGGACTTTTAATAACAAAATTAGCCCCACATTGAAATGCCTTGAAGAGATAACAAGGATAAAATCTCCTAGGAAGCTTGAAAATGACAACCTTCCTTGTGATGTTGAGACACAAGAATATCCAAATACAAATGCATTTGGGGACTGGAGTGGAGAAGAAGAGGTCAATAGCATTACAAGCTCTTTTATCAAACATCTGGAGGAGATGGCTACCAAAACTCACACCAACATAGATGAGGAGATGCTTAAAGGTCAAATGGTTTTCCATTACAGTTGCTTAGGTTTCTGTACTAGTAACTTGATGAGAGAAACAATGAAGATTCAGAGTGAAGTAAAAGAACTACTTAAGTGGGAGAATTCAAGTCAAACAAACTTCGACAAATTTTTTTGTTAA >C.cajan_13554.g ATGGGACGACCCTTGTGGCGAGAGTGTCTCTCATCTGCGTTGAGAACAGCCCTAGCGTGCACCATAGTGGGGTGCGTCACCCTCTACGCTCCCTCCTCGCTCTGCAACCTCATAGCCTTCCCTGCATTCTCCTACGTCACAGCCATTATCATCATCATCAACGACGCCACCTTCGGACACGCCTTGCGAGCGTGCTGGCTCGCGCTCTACGCCACCCTTCAGGGCATTGGCCCCGCCCTCTTCGCCTTCTGCCTCCTCCCACCCAGCCGCTTCAACAAGTTGACCACCGCCGTGGCGGTGGCGCTCGCCGCGTTCGTGGTGGTTCTGCCTTCGCCTCGCTGCACGCACTTGATAGCTAAACGCATATCGTTGGGTCAGATAGTGCTCGTGTACGTTGTGGCGTATGATAATGGCGTTCACACTGATCCTATCATGCACCCTTTACGATTAGCGGCTAGCACTGCCTTAGGTGTTCTTGCTTGCGTTCTGGCCTTGATGCTTCCATACCCGCGTCTTGCATGCTACCAGATGAATCAAAGCTACAAGCTATTAACAATGAATACCTTGAAGAGATTGAAGCTTCTTGTAAAAGTGATATGCGAGGAGGACAAGACCATTGCTGTCGGATTAATCTCCCATGCCAAGTCATTGGTAACTAAGCGAACCAAGCTCGTTTCAATCATCATGCACTACCAAGAGGGCATGCAATGGGAGAGACTTCCAATAAAAATTTTCAGATCACACTGCTTGAGCCTAATAGAAAGACTTGAAGAGGTAGATACCAATCTAATAGGGATGGAGTTGGCTTTGACTTGCACCAATTCATTCCCATTCAACACTCTCGACGAAGACCTCAAAAAAGGTCTTAATAACCTTGAGAAGCACGTTAGCCTAACCATAAAACAAGCCAAACAAACCTTAAGAGGTGGTTCACTAACCGTTCCCGAATCCAACGCAGAAAACATAACTCAACTTCTCCAATCCCTTCATGCCATTCCAACAACTCACCAAGAGTTACCCATTTTCTTCTTCTTATTTTGCGCCAAACTCCTCCACGAGAAATCATTGACCGAACCTCCAACTTGTGCTCAAGACAAAGTTCATGGAACTTCCAATTCTCCCAAAGGCAAAGAAAAATGGGCCAATTGGGTAGCAACATTAAGAAGTACAAATGTTATGCCAGCAATTAAGTTCTCTCTCTCTTTGGGCCTTTCAGTGTTCGTGGGCTTAGTATATAGCAAGGAAAATGGGTTCTGGGCTGGGCTTTCAGTGGCCGTGAGCTATGTTTCGGGGAGGGAAGCCACGTTTAGAGCAGCGAATGTTAAAGCCCATGGGACCGTGTTGGGTGCTGTGTATGGAGTATTGGGCTGCTTCGTATTTGAGAGATTCTTGCCCATTAGATTCTTGTCTCTCCTTCCTTGGTTCATTTTCACAAGCTTCCTTCAGCGAAGCCGAATGTATGGGCCTGCTGGTGGCATTTCTGCAGTTATTGGGGCCATTCTAATTCTTGGTAGGAAAAACTTTGGGCCACCGAGTGAGTTTGCTATAGCCAGAATCATCGAAACCTTTATTGGGCTTTCATGTTCTATTTTCGTGGATCTTATTTTTGGGCCCAAAAGAGCTTCCACGTGCGCCAAAATGGTACTCTCTCAATGCTTGGCCACACTTGGTGGGTCCATAGGGAGTTTGAGTCTACTTGCTGGCAAAACCGATTTGGAAGATAACCAAAGGAAATTGAAAATGCAAGTTAACGAGCTTAGGAAATTTGTTGTGGAAGCTGAAGCAGAACCCAATTTTTGGTTTCTACCATTTAATAGTGCTTGTTATAATAAGCTTTTGGAGTCATTGTCAAGAGTGGTGGATCTCTTGTGGTTTGGAGAACATGCATTGAAGTTTCTTCAACAAGAATTCCAAAGAATTAGGGTTTGTGGGACAGAGGGTGTGCACACGCTAGAGGTTGAACTTGGACATGTTAAGAAGTTGATTTGGTCTTCAATCAAATGTCTTGAGGAGATTTCAAGAATAAAATCACCTAGGAGTATTGGAAAAGAGGTTGAGAAGATGAATAACTCTTATGATCTTGAAACAGGAAAGTCAAGTGAGTGTGATATCTGCATGGTTTCGAGTATAGGAGAAGAAGGAATAGAAGAAACTATTGACACTTTTCTACAACAATCTAAAATTGTTGTTGATAACTTATATGATGATGAAGGTGACAAGGAATTGAAGAGTCAAGTTGCTCTAAGTTTGAGTGTCTTAGGGTTCTGCTTGTATGCATGTATACGAGAGACGATAAAAATTGAAGAAGCAATCAAGGAACTTGTTCAATGGGAAAATCCCTTTAGTGAAGTTAATTAA >C.cajan_41841.g CTGCTGAGCCTACACTTGATAGGGTTGCGCAACTTCATCAACGCGGTGGCGACATTGGCCATGCCAGCCTCGGTGTCCATGGTTGCACTCCTAGAGCGGAGCCACTTGGTGATTAAGCACCTTGCGTTTGGACAGCTGGTGAATATGTTTGTTAGCACCATCGTGGATGGCGGAGAAATAGGCGTGGCCATGCACACGATTCACGTGGTGTGCTCCATCGCCTTTGAATATAATTTTTTAATTTTTTTTGAAAAGTAA >C.cajan_46603.g ATGCTCGCCCAAACCCTAAGGGGATGCTGGCATGTGCTATTTTCCAACGTCCAGGTCATGATCCTGTCCCTACTGAGCCTGCACCTGATAGGGCCGCGCAACTTCACCAACGCGGTGGCGGCATTGGCTATGGTGGCCTCGGTGTCCGTGGTTACGCTCCCAGAGCGGAGCCACTTGGTGATTAAGCAGCTTGTGTTTGGATAG >Achn290031 ATGGAAAGCTCCAAAACTTACCGTTTTGAACGAGCCCAAGAAGCGTGGAGGAGCAACCTCCTCACCGCCTTCCGAACCGCCCTAGCCTGCATCATAGTTGGCGGTGTCACCCTTTATGGCCCAGCATGCATCACGCGCCAAGTGACATTCCCGCCTTTTTCTTATGTGACGGTGATGCTAATACTTACTAACGATCCTACTTTAGGCGAAACTTTGCGAGGTAGTTGGTATGCATTCTATGCCACTATCCAGGGAATAGGCCCGGCCATTCTAAGCCTGTGGCTCATTGGGCCAGCCCGGTTGACTACTACCACCACCTCCCTCGCAGTGGCGGTGAGCGCATTTGTGGTGGTGCTGCCGGAGTCCACCCACTTGGTGGCCAAGAGAATAGCTCTTGGACAAATTGTGATTGTGTATGTGATGGCTTTTATAAAAGGTGGGGACACTCAGGCTGTGATGCACCCTCTCCACCTGGCAGCGAGTACGGCTTTGGGAGTCCTGGCTTGTGTTTTGGCCTTGTTGCTTCCCTACCCTACCCTGGCCTATTGCCAGGTGAAAAAGAAGTGCAAGTTTTTTGGAGACAATGCTTCAGAAAGGCTACAGCTCTTTGTGAAGGCATTTTGTGCAGAAGACAAACCAAATGCTCTTGCATTGATCTCTCAAGCCAAATTATCTGCTCTAAGAGGAACCAAATGTCTCCAAATCATCAAATCCAAGCAAGAGAGCATGCAATGGGAGAGGCTTCCGATGAACTTCTTCAGACCATATTGCATGAACCCAGGAGACAAATTGCAAGAATTAAACATGCCCTTAAGAGGCATGCAAATTGCTATAACAAATACTAGTTCATCTTCAAAATTCCCAATCCAAATTCTAAACCAAGAGCTTAAAAATGATGTTCTTAAACTAGTGGACCACATTTCCCAAACCCTCAAGAAAGTTTCACCTTTTGATCAATATTCATCACCAAGCACTGTCCCAGAAGCACCAAATTCAGAAGATTTAATCAAGTCCCTCCAAACACTTCAAATCCTAAAAGACCTCCCCTCTTTCTTCTTCCTATATTGCCTCAAACTCCTCCACAAGAAATCAACATTACCCACTTCATCAACAAAAGAAGTACCAAACACTAACTCAAGCAAACAAAACAAGTACTTTTTCAAGGAAATTACAAGCAAAAGGCTAATGCCAGCCTTCAAATGCTCGCTTTCGTTAGGCCTCGCTGTGCTATTTGGCCTAATGTACAGCAAGAAAGATGCCCACTGGTCAGGCCTTCCTGTAGCGATAACCCTAGCCGGTGCAAGAGAGGCCACATTTAAGGTTGCCAATGTTAAAGCCCAAGGGACAGTTTTAGGGACTGTCTATGGCGTATTAGGTTGTGTTGTTTTTGGAAAGTTTGTGCAAATAAGGTTTTTCTCTCTTCTCCCTTGGTTCATCTTCACAAGCTTTTTACGGCAGAGCAAGATGTATGGCCAGGCTGGTGGAGTGTCAGCTTTTATTGGGGCAGTGCTAATCTTGGGGAGGGAAAATTTTGGGCTCCCGAGGGAATTTGCTATTGCCAGAATCGTTGAGACCTTCATCGGACTTTCTTGTTCAGTCATGGTAGATATGCTGTTGCAGCCCACAAGAGCTTCTACTCTTGCTAGAGCTCAGCTTTCCAAGAGCCTTGGGGCGGTGGGAGAGTGCGTGGGAGAGATGAGGATTGGCGATAGCAAAACCAGCCTTGTCGATAGCCAATATAGGCTGAAAAGTTGTATTGAGGAATTGTTGTTTTTTGGTGCCCATGCAATAGGGTTTCTTGAGCAAGAAGGTGTGGATAAAGTACTAGAAGGTGCTCATATTGAGGCTTTGAAGAGAATTGTTTGTTCTTCAATGAAGTGCTTTGAGGAGGTCATTTTGGTCAAATCACTCCCACTCCTTGATAAGGAGCTTGAAAAGAATGGCATTTCTCATGATGTTGAGTTGGGAAAATCTCCAAGTGCTTTTGGAAATGTTGAAGATGAGATTGAGAAGGCTATGAGTGCTTTTCTTCAAAGTTCAAGAGAGGTTGTTGATAAAGTTTGTGTTGTTGAAGGTGAGAATTGTGAGCTCAAGACCCAGGTGGGGTTAAGTTTGAATGCCTTGGCCTTTTGCATGGGTAGTTTAGTGAGAGAGACACAAGAGATTGAGAAGGGTATTAAGGACATTTTACAGTGGGAGAACCCTTCAAGCCACATAAATTTGCATGAAATTTCATGTAAAATACATGCTTTGTACAATTAA >Achn337061 ATGGACCGTGCCCGATCTGTGTGGCAGGCCAGGCTCGGCTCTGCGTTCCGGACCGCACTAGCATGTGTCATAGTGGGCTGCACCACTCTTTATGGTCCGGGACTATTTAAGTCTCAACTAACATTTCCCGCTTTTTTTTACGTGACAGCTATACTAATCGTGTCCGATGCTACACTTGGTGACACCCTAAGAGGGTGCTGGCACGCAGCTTGGGCCACAGCCCAGGTGGTCCCGCCCTCCATGCTGGTCTTGTGGTTGATCGGACCAGCCTGCTTTTCCGCCTGCATGGCGGCCGTGACGGTGGCAGGCACCGCCTTTGTGGTGGCGGTGCCGGAGGGGACCCACCTGATGGCTAAGAGGATTGCTTTTGGGCAGATTGTGATAGTGTACGTTGGTGCTGTGATACATGGGGAGAACACCGGAGTTATCATGCACCCGATACACGTGGCAGCGAGTACGGCCTTAGGGGCATTGGCTTCGGTTTTGGCTCTGTTGTTGCCGTACCCAAGGCTTGCCCATTTTGAGGTGAGGAAACTATGTGGAATGTACACACAAAATGCTGCACAAAGGATTAGCCTCTTCGTGAAGGCATTCTCTGCCCAAAACAACACAATTGCATTGGAAGCAATCTTTCAAGTCAATATCTTTGCAGAAACAGCAGCCAAGCTTCTTCATAATATCAAACTCATACAGGAAGGTGTCCTGTGGGAGAGGCCTCAAATCAGAACCTTGAAGCCCCATTTCACAAATCCTGGAGACAGATTGCAAGACATGGAAATTCCAGTCAGAGGAATGGAAATGGCACTAACTTCTTCTCCTTCCTTTCCTCTTAGCTTCATAGATCAAGAGCTCGGTGAGGTTTTAATGGGATTGGAAGTGCAAATTGGCCTAAAACTTGAGCAAGCCAAGTGTTTTTTACCCATCAACGAAATGACGGCTACGAAGCCAACGAAGGGAGAACTTTTCAACAAGTTTCTTGAGTCCATTAGAATCACCAACCCTACTAGTAAAGATCTACCGACAATTTTCTTCCTTTCTTGTATAAAACTACTCCTAGATGACTCATCTGCCACTCAAAACCCTAAACGATTTGTAGATTCACCAGAAGAAACCACGTCTGGCTTCTTTAAAAGGTTCTGTAGTAGCTGGTGCACAAGACCGAAGAACGAAACACTGGTTTTTGCGTTGAAGTGTTCTCTCGCTCTAGGTCTTGCAGTGTTCTTAGGGTTGACATTCAACGAAGAAAACGGGTACTGGTCGGGGCTAACCATCGCTATTAGCTTCAAAGCAGAGAGACAAGCAACATTTACCATTGCAAATGCTCGAGCACAAGGAACAGCAATGGGGTCAGTCTACGGTGTCCTGGGATGCTTTTTCTTCAGAAAATTTGATGAGGTAAGGGTTCTAGCGCTTCTACCGTGGATAATATTTACCAGTTTTCTGAGGCACAGTCGGATGTATGGCCAAGCCGGTGGGATTTCAGCGGTCATAGGAGCATTACTGATCCTAGGCAGGAAGAACTACGGTGCTCCAGCTGAATTTGCTATTGCTAGACTCACAGAGGCTTTCATTGGATTGTTTTGTTTCATCATGGTTGAGCTTCTCATGCAACCCACAAGAGCGGCAACTCTAGCAAAAAACCAACTCTCAGGGAGCTTGGGAATGCTTCGAGAATGCATAAGGGAAGTAGGACTTCCTCCAAACCAGAAAGACATGGATTTAGTCTTTCCAACATGGAGAGCGAAGCAAGAGAAGTTAAAAGATCATGTCAATGAGTTGGAGAAGTTTGCTGGAGAAGCTGATTTGGAGCCTAATTTCTGGTTCTCGCCTTTCCGAATTGAGTGTTACAATAAGCTGCTCGTCTCTATATCTAAGATGAAGGATCTCCTCCTTTTCACGTCCTATATAATGGAGTTCCTGGTAGAAGAATCACATAAATGTGGGGTTGTTTGGAGGGAGCTTGAAGAACACGTCAATAGTAACGTACTGCTTTTCAAGGAAAATGTAAGTTCCTCGCTGGACTATCTAGAAAAGATCACTTTGATCAAGTCTTTCGCAATCACCATAAGAGATGCCCAAGCGAGGAAAATATATGATGACCTTGAGTTGGGAAAATCACCAAATGCAGATGCATGCAAAATGCACACGGATGAAGAAGAAGCTGGCAAGATTGTAAGTTCCTTCCTTCAGCGTTCAAAGGAATTGACTGACAAAATTGAGGCTCAAGCAGGTGAGAGAAGAGCTGGCCAAATCGCTCTTTCTCTGAGTGCCATAGGATTTTGCATCGGTGGTTTAATGACAGAAACAAAAGCGATTGAGAAAGGAATAAAAGAATTGGTTCAATGGGAGAATCCTTCAACTCGCATAGATTTTTATGAAATTTATGGTAAAATAAATGCTCTGTTTCCTAGGGGATTTAGCTACACAAAACTTAATCCATCTGAGAAAACTGCTTACTTATCAAAACTGAACTCAGATGACATCCCTACCGCACGTACAGGTCAGAAAGAACCCCTCAGTTGCCTTCATATTTCGGATCAGCCATCACCGAAGCGGCACCGGAAGGTGTTGCGCGACAACATCCAGGGCATCACGAAGCCGGCGATCCGGCGCCTGGCTCGGAGGGGTGGGGTTAAGAGGATCAGTGGCCTCATCTACGAGGAGACTCGCGGCGTCCTCAAGATCTTCCTCGAGAACGTCATTCGCGACGCTGTGACCTACACCGAGCACGCCCGGAGGAAGACTGTGACTGCCATGGATGTGGTCTACGCTCTCAAGAGGCAGGGCAGGACTCTCTACGGGTTTGGTGGTTGA >ZJU.LOC107411123 ATGGCCTCCATCTTCGAGCACTCCAGCCCAGCCAGAGCGCTGTGGAGGACCTGCCTGGCCTCGGCCTTCCGTTCCGCCCTCGCCTGCACCTTAGTGGGCTTTACCACCCTTTATGGGCCGGCCTCTCTCCGACGACAAGTGGCTTTCCCAGCATTTTCCTACGTCACCGTCATTCTCGTCATCACTGATGCGACGCTGGGCGACACATTGCGGGGCTGCTGGCTTGCGCTTTACGCCACAGTCCAGAGCCTCGGCCCCGCCATGTTGAGCCTTTGGTTGATCGGACCGGCTCGGTTGTCGAGCAGCACCACCGCTACTGCGGTGGCGCTGGGTTCATTTGTGGTGGCGATGCCGGAGAGAACGCACTTGGTTGCTAAACGAATAGCTTTGGGACAGATTGTAATAGTGTATGTGCTAGCCTTTATCAATGGCGTCCACACTGATGCTGTGATGCACACTTTGCACGTTGCTGCCAGTACGGCCGTTGGGATATTGGCTTGTGTCTTGGCCTTGCTGGTTCCAATCCCTCGACTGGCCTCTCAGGAGGTGAAACACAACTGCGAGCTCCTCATAGAGAACGATTCAGAGAGGCTAAAGCTCCTTGTGAAGGCATTTTGTGCAGAGGACAACACATCCGCACGTGCATCCATCTCTCAAGCAAAGTTAGTGGCTTCTTCCGGAAACAAATTTCTGCAGGGTGTCAAAAAGTACCAAGAAAGCATGCAGTGGGAGAGACTTCCATTGAAGTTTCTGAAGCAGTCCCGGTACACGAACTCGAAAAACAGAATGCAAGATGTAGAAATACCTCTAAGGGGTATGGAGATGGCTTTGAACAATAACCACACATTTCCGGTTACAATGATAGATGAGGAGCTCAAAGATGGACTAGTAAGGCTAGAGAAGAACATGAACGTGGGCACAATCTTTCCCTGTGATTCATCAACTACGGTTCCTGAATCATTGGCTGAAGATATGAAATTCCCTCAAACACTTAAAACTAGGCCACTAACTCATCGGGATTTACCTCCATTTTTCTTCCTTTTCTGTACCAAAGTCTTGCAAAGTAAATTACTATCCACCAAAGCATCTTGTACTAGTGTACAGGAAAATTTGATCCCCAATAATGGAAAACTAATTGATTTTTCTAAGCACAATAGCACTTCCAAATCATCAATATGGTCTGCTTTGGGCTTGAAAGTGAAAAGCCAAAGGCTTATGCCGGCGTTCAAATGCTCTCTTTCTGTTGGGTTTGCAGTGCTATTTGGGTCATTATACAGCAGAGAAAATGGTTATTGGGCAGGACTACCTGTTGCTATAAGCCTTGCAGCATCAAGAGAAGCAACATTCAGAGTAGCAAATGTTAAAGCACATGGAACGGTCTTAGGAACCGTTTATGGAGTTCTAGGTTGTTTCGTTTTTGAAAGGTTTTTTCCCATAAGATTCCTATCTCTTCTTCCTTGGTTCGTCTTCACGAGTTTTCTTCAGCGTAGCCGGTTGTATGGTCAGGCTGGTGCTATCTCTGCTGTCATTGGAGCTATATTGATCTTGGGGAGAAAGAACTTTGGCCCTCCAAGTGAATTCGCCATAGTTCGAATTGTCGAAACCTTTATTGGATTATCTTGTTCAATTGTGGTGGATCTTGTTCTTCAGCCTACAAGATCTGCTACTCTTGCAAAGATTCAACTCTCTAAATGCCTTGAGACATTGCAGGATTGCATTGACTCGGTGAGTCTTCAGGCTAGCAAAGATTGCTTGGGAGAGAAGCAGAAGAAGCTGCGAGAGTGTGTTAATGAGCTCAGCAAGTTCATTGGAGAAGCTGAGGTGGAACCCAACTTTTGGTTTTTGCCTTTTAATAGTGCTTGCTATGGTAAGCTCTTCAAGTCATTGTCAAAGATAGTGGATCTACTGCTTTTTAGTGGTTATGCTGTGGAGCTTCTTCAAGAGGACTCGCAAGCTTCTCGGAAGAAAATTGCGCATTTAGTGGATGCTGATCTTGAACATTTCAAGGAAGTGGTTGGTCCTTCAATAAAGTGTTTTCGAGAGGTTGTTGCAATAAAATCAGTGAGTTTTCTTGAGAAGGAGCTTGGAAAGAGAAAAATATCCTACGATGTTGAATTGGGAAAATCAAGTAAGACAAATGGTTTGGCTAATGAGGAAGGGATTGACAAGGTTGTGAATTCTTTTCTTGAGAATTCACAAGGAGTTGTCGATAAAATCCATGGTGTTGAGGATGAAGAGGAGCTTAAAAGCCAGATGGTTTTAAGCTTAAGTGCTCTTGGATTTTGCATGAGTAGTTTAATAACAGAAACAAGAGAGATTGAAGAGGGTATCAAAGAACTTGTTCAGTGGGAAAATCCTTCAGTTCAGGTTAATTTGTATGAAATCTCATCTATGATACATGCCTTGCACAATAACTAA >ZJU.LOC107430559 ATGAGGTACCAAAATTACCATGCATGGTTGTGGCGCAAACGCCTAGGCTCCGCACTGCGGACGAGTTTGGCTTGCATCATAGTAGGCTGCACCACACTCTATGGTCCGGTACCTCTCCGGCGGTTATTAACCTACCCGGCTTTCTCTTACGTGACCACCATATTGGTTGTTTCGGAAGCAACACTTGGTGACACCTTGAGAAGCTCTTGGCATGTTCTCTATGCCACGGTTCAGGTTGTGATCCCTTCTATGCTTAGTCTCTGGCTGATTGGACCGGCAAGGTTTAAGAACGAATTGGTGGCAGCAGTGGCAGTGGCAATCAATGCGTTTTTGGTGGCGTTGCCGGAATCAACACACTTGATGTCAAAGCGGATTGCTTTTGGTCAGATCGTGATTGTTTATGTAGGCACTGTGGTTCATGGTTCGCAAACTGGTGTTTTCATGCACCCAATTCATGTAGCATCAAGCACTGCTGTTGGAGCTTTGGCTTCTGTTTTGGCTATGTTATTTCCATATCCTCGGCTAGCTTACTGTGAGCTTAGGAAAACATGTCGGTTGTATGCCGAAAATGCATCCGAGAGGATGACACTTATGGTGGAGGCCATATCTGCCCAAGACCAGACAGCTGCAAGGGAATTAATTTGTCAAGAAAAGGCTCTCTCCAAATCTGGAGCTAGACTCCTTCAAGATATCAAAAATAATCTGGGAGGCATGAAGTGGGAAAGACCACAGTTGAAATTTCTAAAAGCTAATGACATAGACTTGGTAAAGAAATTGCAAGAAATGGAATTACCTTTAAGGGGGATGGAGATATCCTTATCTTTTTGCCCTTCAATTCCTGTTCAAATGATGGATGATGGACTAAAGCATGTGTTACATGTTTCTAAAGTACAAGCTGGCTTAAAATTAGAGCAAGCCAAGTGCTCAGCACCTTTTGATGGAACTACAGCTCCAGAGGGCAAGGGAGAAACTTTAGACAGACCTATTTGGACAACTAAAACGACCTCCACAACCCAAGAGGATTTGTCAGCTATGTTCCTCTTATACTGTATGGCACTTCTCACAGATGGACCACCAGTTTCCCAAGATCTTCCAAACAATCTAAACGAGGACAGTGAAGAATCAAAGGAAATACTATACAACTTCCGAAAGGCCTGGAGCAATCTCAATATAAGAGCAAGAAGCCAGAAATTCAGTTTTGCACTCAAGTGCTCACTGTCATTAGGTCTTGCTGTATTCTTTGGATTGCTTTACCAAAAAGAAAATGGATATTGGTCAGGACTCACGATTGCTATCAGTTTTGTAACAGGAAGGCAAGCCACATTTAATGTTGCAAATGCTAGGGCACAAGGAACGGTGATGGGATCAATCTATGGAATTCTATGTTTATTTGTATTCCAAAGATTTTTGGAGCTAAGACTCTTAGCCCTACTTCCTTGGATCATTATCTCCAGTTTCCTAATTCATAGCAGAATTTATGGCCAAGCTGGTGGGTTTTCAGCAGCTATAGGGGCACTATTGATTGTGGGTAGAAAAGATTATGGCGCTCCAAGTGAGTTTGCAATTGCTAGAATTATAGAGGCTTCAATTGGATTACTCTGTTTCATTTTAGTAGAGATACTCTTGAATCCTGTGAGAGCAGCAACTCTTGCAAAAACTGAACTTTCACAGAGCATAGGAGCACTTGGAGATTGCATCAGAAATATAACTCTTTGCAGCCAGCAGAAAAACATGCCAGCCTCTAAGCCATTGAGTGATAAGCAGCACCAGCTTACACATCATGTCAATGAACTAGAAAAGTTCATTCAAGAAGCACAACTGGAGCCTAATTTTTGGTTCTTGCCCTTCCATGGTGCTTGTTACACTAAGCTCTTGGAATCTTTATCAGCAATGGTGAATCTTCTACTTTTCATTTCCTATCAAATAGAATTCCTCACAGAAGCATCACAGAATTTTGAAGGTCCTTTAAGGGAGCTACTACAGCACATGAATGATGATCTAGAGCGTTTCACTAAGAAAGTTGGCTCTTCCTTGAAATCCCTTCAAGAGGCTACTTCAGCATCCTTTCAAGTATTCGAGGAAGCCTCACAAAGGGATAATACATCTCATGACATTGAGCTTGGAAAGTCATCAAATAGAAATGCATTTAAGCGTTTGACTACAGAAAATAGAGAAGTACAGAACATTTTAAGTTCTTTTCTTCAACACTTGGACGAATTTGATAAGATATGCATAGAAGAAGGTAAAGAGCCTAAGAGCCAAATGGTTCTCTGTTCGACAGGCCTGGGGTTCTGCATCCAAAATGTAGCAAGGGAAACTATGGAGATCGAAAATCAAGTGAAAGAACTGGTTCAATGGGAGAATCCGTCAAGTCAGAGAAATTTATACAAAATTCTCTGTAAAATAATTTGGATGCATACCTAA >Tp3g07830 ATGCGTGACACAACATGTCTCGAGCGACTCGGGCTGGCTTTGAGAACCGCCATGGCTTGTCTCATCGTGAGCTTGACCACTCTGTACGGTCCCAAACCACTAAGACACTTCACAACGTTTCCAGCCTTTTCTTACCTGACCACAATCTTAATCTGGCTATCCGACGCTGAACCAACATACGGTGAAGTTCTCAAGTGCTGTGTTGATGTCTCTTACGCCACTTTTCAGACGATTGCCATTGTGCTAGTGAGTGTCTTGGTGGTTGGACCAGCCTCGCTAGGAAACGTCGTGGTGGCTTCAGTTGCTGTGGCTGTAGCTTCATTCATCGTGGCTTTCCCAGTGTCCACGAGTCTTCTTACTAAACGAATTGCCTTTGGGCAAATTGTTGTTGTATATGTAACATTTGTGGTGTTCAACGGAGAGATGGCTCATGTTGTCATGCTCCCGCTTCATGTGGCGGCTAGTACAGCACTTGGAGCCATTGCTTCTCTACTCGCAGTGCTTCTCCCGTTTCCAAGATTGGCTTATAGTCAGATGACCAAGGGTTGCAAATTATATGCTGAAAATGCTCTTGAGAGGTTGAATTTATTCGTCGAGATCATGATGGCTCGAGACAACAACACAGCTCAGGTGTTAATCGCAAAGGCCGCTTCATTGTCTGGAGTAGCAAGAAACACACTCAAGAGCATCCAAATCCACCATGAGCGTATTGCATGGGAGCGACCAGATACAAGATTGTTGAGAAGGAAACAGAAACACCAAGGGGAGAAACTGCAAGCCACAGAGTTTCTGATGAGGGGGATGGAGATGGCGTTGGAATCTTGCAGTTCTTTTCCTCTAGGCATGAGCCGCGATGAACTGACACATCTTTTAGAAGTTCCCAGAACACAGATTGCTCCTGAGTCAGCATCTACTCTCAAGCCTGAGGACAGGCTGAGATGGCATCCTGAGGCTGGTTCCCTTTCTGCTGCAGCTTTACCGGTTTGTTTCTTCCGGTACTGTGTGGAACTCTTCAGAGGAGATTTCTTATCTGTGAGACAAGACAGTAAATGTGTAGATAAGGTTAATACCGAGGAAGAAACTCACCAAGAACCCGAAGGGTTGCCCACGACCAAAAGGTTTTTGGATTTTCTCAGTGTCTGGATGGCTAGAGAAAGGTTTGTTTTTGCATTCAAGTGCTCATTTTCTCTTGGCCTTGCCGTACTGTTTGGTATACTGTATAACAAACAAAACGGTTATTGGTCGGGTCTAACCGTAGCCATTAGCCTTGTTTCCGGTAGGCAAGCAACATTCACAGTAGCGAATTCTCGTCTACAAGGGACCGCAATGGGATCAGTCTACGGTCTGTTATGTTGCTCTGCTTTCCAGAGACTGGAAGAGTTCAGTTTCTTACCTCTGCTCCCTTGGATAGCCATCACTGTCTTCATGAGGCACAGCAGAGTCTATGGCCAACCTGGAGGAGTTACAGCTGCCATTGCAGCACTGTTAATAATCGGAAGGAGAAACTATGGAGCTCCGACTGATTTTGCGATCACTCGAATTGTTGAAGCTTCAATCGGGTTGCTCTGTTTTGTCTTTGGGGAGATTCTGGTCACCCCAGCAAGAGCATCAACTCTTGCAAGATCCGAACTTTCACACTGTCTCGATGCGGTCTTAGATTGCATCCGGTCACTGGTTTTTTGTTCTGAGCAAAAGAATCAGCAAATAACAGATTTAAGAAGCAAGCAGGCGAAACTCAAATCTCGTGTTGAAGCATTGGAGAAATTCACAGCAGAAGCCTTAACAGAGCCTGATATTCCGTTCCTCCGCCCTCTTAACGCGGTCAGTTACAACAAGCTTTTGGTTTCTTTCTCGAAGATATCTGATCTTTGTCTCTATGTATGTGATGACCTCAAAAACTTATCTGGAGCTCAACCAACACTTGGGTATCCTTTGTACAACATCACTCATGACCTGAAAGTCTTCCAAGAAAAGCTTCACTCTTCGGTGAAATGCTTAGATGAGATCGCATCGATCAAGACTCAAGCAAGACTCCAAAAAGAGTTGCAGAAGAGAAAGATATGCCATGATGTTGAAGCAGGAATAACATCCAACGACAACCACTCAAAGATGGAGTTGGGTCCAAGCCAAGATGATGCAGAGAGGTTTTCGGTTTCTTTTGTAAGGCTACTGAAGGAAGCAACAGAGATGATAAGTGGTAGCTCAGCTGAAGAGATGCTGAAGAATGAAACTACTCTATGTCTGAGCAGTCTTGGGTTTTGCATTACCAGATTGGTCCAAGAAACAGTATGTATTATGACAGAAATAACTCATACAACTTGA >Tp4g11620 ATGCAAATGACTGAGAGAGGCCGAGCCATGTGGCGCACGTGCCTAGCCTCAGCGTTCCGTACGGCTCTAGCTTGCACAATCGTTGGCGCTGCTACACTTTACGGTCCTGAATGGATCCTCCGCCACGTGGCATTCCCGGCGTTTTCTTATGTCACGGTCATTCTCATCATTACAGATGCTGCGCTCGGTGACACGCTACGTGGCTGCTGGCTCTCGCTTTACGCCACGTGTCAGAGCGTTGGACCAGCAATCATTACACTAAGGTTTATAGGACCAGCTCGTCTCACGGCCGGAACTACTGCTCTAGCCGCGGCTCTAGCAGCGTTTGTGGTGGTGCTACCAAATGGTTCGACCCATTTGGTGGCTAAGCGAATCGCTCTTGGCCAGATTGTTCTTATTTATGTTATTGGTTATATAAAAGGAGCTGAGACTGACCCAGTTATGCACCCTCTTCAAGTTGCTGCTAGCACCGCGCTTGGTGTTATAGCTTGCGTTCTTGCACTTCTTGTTCCACTTCCTCGTTTGGCTACTTGTGAGGTGAAACAAAGCTGCAAAGAGATTGGCCAAAATGTAACGACGAGAGTGAAGTTATACATGAAGGCTTTTTGCTCAGATGATGCCACGTCATCAATGGCTTTTGTCTCACAGGCTCGAGAGTTGTCTCGTATCTCCTCCAAGCTTTATCAAACCATCAAACGCTACCAACCTAGCATGACATGGGAGAGGCTTCCATTTAAGATATGGAGATGGCAAAACGTGAACGATAACAAAGGAGAGAAACTACAAAGCATGGAGATTGCTCTTAGAGGAATGGAAATGGTAGTAGCAAGCAAATCTCCTGTTCCTGCGAGCTTACTTGCGGGAGAAGTAAAAGACGGTCTCAAGAACATACAAGAACGTGTGGTTCTCTCAATCAAACGGGTAAACAACGTCCGTCAACCGTCGGTAACTCCAGAGACCGATCTAGAGAAACCCGATGAGTGCCTCCAAACACTTCAAGAAACCCCAAAAACACCTAAAGATTTGCCCTTTTACTTCTTCTTGTTCTGCCTTAGGCTCCTTGAAACCATTTCAATGGTTAAACCGGAGGAGAACACAGCAAAACCGGAGGAGACAAAAAGCTCGGAAAAATCCAAGAGTAGGTCTTGGAGAAGTGATTGGGAAATCAAGAAGGTTATGCCGGCGATAAAGTTGTCGCTTTCATTAGGTTTAGCGATTTTTCTAGGGTCATTGTACAGTAAGCCAAACGGGTATTGGGCTGGTTTACCGGTGGCGATCAGCTTTGCGGCTGGAAGAGAGGCGACGTTTAAAGTGGCGAATGTTAAGGCTCAAGGCACAGTGATAGGGACAGTGTACGGAGTGATGGGTTGTTTTGTGTTTCAGAGGTTTCTGACGGTGAGGTTTCTTTCATTGCTTCCATGGTTTATCTTCTCTAGCTTCTTGAGCAAGAGCCGGATGTACGGACAAGCGGGAGGAATATCCGCGGCGATCGGAGCCGTTTTGATTCTTGGAAGGAAGAATTTCGGACAGCCAAGCGAGTTTGCGATCGACAGAATCATCGAGACTTTTATTGGGTTGTCTTGTTCGATCATGGTGGAGCTTATCTTGCAGCCCACTCGAGCCGCTAATGTTTCGAAACTTGAGCTCTCTAGAAGCTTCCATGCTTTATACGAGTGTGCAAGCTTGTTTGGAGCTAAAGCGAGTAAAGCGGACATAATGGAGAGTCAAAAGAAGCTGAGAGGTCATTTGAGTGAGCTCAAGAAGTTCACGGAAGAAGCCCAAGCAGAGCCTAGTTTCTGGTTTACGCCTTTTAACGCATCCTGCTACGAAAAGCTCTTCAAATCGTTGTCTAAGATGGCTGATCTTTTGCAATTCAGCGGTCATGCGATAGGGTTTCTTGGAGAACAAGTAAAAGGAAAATCATCACACTGCAAGGAGATCCTGAGTGAGGTCGACAAAGATCTCAAGAGTCTAACAGAAAGCATAGGTCTTTTAGCCAAATCATTAGAAGAAATCACTCTGCTCAAATCACTCGACGCCCTCGAAAAGGCACTCACCAAAAACGACAACAGTTCATGGGACATTGAGTTGGGGAAGAGACCAAACCCTAGTTTCTCACGCCCCGAGAGCGAGCCAGAAAATATTATAAATACGTATCTCCAGCATTGCAGAGGAGTCGCGGATGGTATATTCCGTGCGGAAGAAGAAGGAGAAGAGGTTAAAATGGACAAGAGTGAGGTTGTGTTGAGTTTGAGTGCATTAGGGTTTTGTGTGGAGAAAATGGAGAAAGAGACAAGAGAGATTGAGGAGATGGTTAAAGAGGTTGTGCAATCGGAGAATCCTTCAAGCCACGTTAACTTGCATGAGATCTCTTGCAAAATACGTTCTTTATACAAATAA >Ca_11960.g ATGTCAAAAACATCAACAATTGCTAAAACAAGGTCAGAGATATGGCGAACTCATCTTGGCTCTGCTCTAAGAACGACCTTAGCATGCACCATAGTTGCTTGCACTTCCTTATATGGCCCTCAACCTCTAAAACGTTACATTAGATTCCCAGCATTTTCTTATGTGACAACAATTCTCATAGTGTCGGATGCAACACTTGGTGACACACTTAAAGGTTGTTGGCACGTTCTTTGTGCAACAATTCAAGTTATGACCCTTTCTCTAATAAGTCTTCAGGTTATAAAACCTGAAAACTTCGGCGGCAACCGCACGGCTGCGCTTACGCTAGCCGCAAGCGCATTTGTGGTTGCGCTGCCGGAATCGACAAACTTGATGACTAAAAGGATTGCATTTGGACAACTTGTGATTGTATATGTGAGCACAGTTATACATAGGGAAGATGGAGTGGCTGTACATTCAATTCATGTTGCATGCTCAGCAGCACTTGGAGCTCTAGCTTCTGTTCTGGCCATGTTCTTACCATATCCTCGCCTTGCATATTATGAGGCAAGGAAGTTGTACCGATTATACGCTGACAATACATCGGAGAGATTAAATTGCAATATAGAGGCCATCTCTGCCTCAAACAACTCCACTGCTGTTGGTTTTATAACTCAAGCTAAGTACCTCTCCACAACAGGAACCAAGCTTCACCAGAATATCAAAACTAAACTGGATGGCATGCATTGGGAACGACCTCAATCAATAATTTTCAACTCCCATTGCATTGACACAGAAGAAAAACTGCAAGACTTGGATATACCAATAAGAGGGATGGACATTGCTCTGTCAAGTTGCAAGTCTTTTCCTGTGGGTGTCATTGATGAGGAGCTCAGAAGTGTTCTGCTAAATTGCAGAGGACAGATCAGCCAAAAACTAGATCAGCAAGCTAAGTGCTCTGATCCTTTTGATTCACAGACAACTCGAGCAACGAAACAAAACATTTTCAACAAATACCTTTCCATAGCCTACAGAGATCTCCCAACCTCATTCTTTTTATACTGTGTGCAACTTCTCCTAGATGACTTGTCTATATCAGACAAAATTGACAATGTGTTGAAAAAATCTCAGAAAAGTGGTTATTGCCAATGGAGCTACAACAAGATCAGAGAGCTTTTGACGAACTTGATTCCCAGCAACCAAAGCTTGACCTTTGCATTCAAGTCCTCTCTGTCATTAGGCCTTGCTGTATTCTTAGGTTTGATGTATGACAAGGAAAATGCACTTTGGTCAGGACTCACAATTGCAATAAGTTTTGTGACTGGACGACAACCAACTTTCTCAGTTGCAAATGCTCGAGGACAAGGAACGGCTATGGGGTCAATCTACGGGATCATTTGTGCCTTCATTTTCCGCAGTTTTGTGAATTTAAGATTCTTAGGTCTTATACCATGGGTCATTTTCGCTTCTTTTCTTAGGCATAGTAGAATGTATGGTGAATCTGGGGGGATTTCAGCAGTCATAGGGGCCTTATTGATCCTTGGTAGGATGAACTATTATGTTCCCCCAATTCAATTTGGTGTTGCTAGAATGGTCGAAGCCACAATAGGACTCACTTGCTTCGTCATTGTAGAGGTTCTTCTAAGTCCCTCAAGAGCTGCAACTCTAGCAAAATCAGAACTTTCACGAACCTTGAGAACGCTTCAAGATTGCATTAAGCAGATTGCTATGATAACTCCTAGCGAAAGAGACATGTTACCTTCAAAATTTACAGCAGAAGCTGAGGTGGAGCCAAATTTCTGGTTCATACCATTTCATACTACTTGCTATAGTAATATGCTGAAATCTCTATCAAAGACTGCCGATCTCTTGCTTTTTGTGGCATACTCAATGGAGCATGTAACCCAATTGGCACAGAAAGATGGAGTAATTTGGACGGACCTCCAAGATCGAGCGAACGAGAATGTGAAGGTTTTTAAGAACAAAGCTGACCCCATATTGAAAAGCCTGGAAGAGATAACAAGGATCAAGTCGTTTAAGAAACTTGAAAATGAGTTGAAGAGCGTAAATGTTCCTCAGGATATCGAGTCACAAGAATCTCCCAATGCCAATGCATTTAGAAACTTGAGCAGAGATGAAGTGGTTGACAGCATTACAGACTCTTTCCTCCAACATCTAGAGGAAATTGCTAGCAAAACTCATACCAACAAAGATGAGGAGACGCTTAAAGTTCAGATGCTCTTACATTACAGCTGCTTCGGATTCTGCACTGCTAGCTTGATGAGAGAAATAGTGAAGATTGAGAGTGAAATAAAAGAATTACTTATATGGGAGAACTGA >Ca_11961.g ATGTCAGAAACATCAACAATTGCTAAAACAAGATCAGAATGTTGGCGAACTCATCTTGGCTCTGCTCTAAGAACAACCTTAGCATGCACCATAGTTGGTTGCACTTCCTTATACGGTCCTGAACCTATAGAACGTTACATTAAATTCCCAGCATTTTCTTATGTGACAACAATTCTCATAGTGTCGGATGCAACACTTGGTGACACACTTAAAGGTTGTTGGCACGTTCTTTGTGCAACAATTCAAGTTATGATACTTTCTCAAATTAGTTTTCAGGTTATAAGACCTGAAAACTTTAGCAATCGCATTGCTGCGCTTGCGCTAGCCGCAAGCGCATTTTTGGTTGCATTGCCGGCATCGACAAACTTGATGACTAAAAGGATTGCATTTGGACAACTTGTGATTGTATATGTGAGCACAATTATATATAGACAAGAAGGAGTGGCTGTACATTCAATTCACGTGGCATGCTCTGCAGCACTAGGAGCTCTAGCTTCTGTTCTGGCCATGTTGTTACCTTATCCTCGCCTTGCCTATGATGAGGCAATGAAGTTCTACCGAATATACACCAAGAATACATCTGAGAGATTAAATTGCAATATAGAGGCTATCTCTGCCTCAGACAACTCCACTGCTGTTGGTTTTAAAACTCAAGCCGAGTACCTCTCCACAACAGGAACCAAGCTTCACCAGAGTATCATAACTAAACTGGATGGCATGCATTGGGAACAACCTCAAAGGATAATTTTCAACTCCAATCGAATTGACACAGAAGCGAAACTGCAAGACTTGGATATAACAATAAGAGGGATGGACATTGCTCTGTCAAGTTGCAAGTCTTTTCCTGTTGGTGTCATTGATGAGGAGCTCAGAGGTGTTCTGCTAAATTGCAGAGGACTGATCGGCCAAAAATTAGATCAGCAAGCAAACTGCTCTGTTCCTTTTGATGCAACCACAATTCAAGAAATGAAACAAGACATTTTCAACAAATACCTTTCCATAGCCTACAAAGATCTCCCAACATCATTCTTTTTATACTGTGTGCAACTTCTTCTAGATGACTTGTCTATATCAAACAAAATTGACCATGTGCTGAAAAATTCTCAGATAAGTGGTGGTTCCAAATGGAGCTACAACAAGATCAAAGAGCTTTTGATGAACTTGATTCCCAGCAACCAAAGCTTGAACTTTGCATTAAAGTCCTCTCTGTCATTAGGCCTTGCTGTGTTATTTGGTTTGATATATGACAGGGAAAATGCACTTTGGTCGGGACTCACAATTGCAATAAGTTTTGTGACTGGACGACAACCGACGTTCACAGTTGCAAATGCTCGAGGACAAGGAACAGCTATGGGATCAATCTACGGCATCATCTGTGCCTTCATTTTCAGTAGTTCTGTGGATTTAAGGTTCTTATGTCTTATACCATGGGTCATTTTCGTTTCTTTTCTCAGGCATAGTAGAATGTATGGCGAATCTGGGGGGATTTCAGCAGTCATAGGGGCCTTGTTGATCCTTGGTAGGATGAACTATTATGTTCCCCCAAGTCAATTTGGAGTTGCTAGAATGGCTGAGGCCGCAATAGGACTCACTTGCTTCATCATTGTAGAGGTTCTTCTAAGTCCCTCAAGAGCTGCAACTCTAGCAAAATCGGAACTTTCACGAACCATAAGAACGCTTCAAGATTGCGTTAAGCAGATTTCTATGATAAATCATAGTGAAATAGACATGTCATCTTCAAGTTACCAAGCACTGAGAGAAGAACAGAAGAAGCTTAAATTATTTGTGTGTCAATTAGAGGAATTTACAGCAGAGGCTGAGCGGGAGCCAAACTTCTGGTTCCTACCATTCCATACTGCTTGCTACAGTAATATGCTGGAATCTCTATCGAGGACGGTTGATCTCTTGCTTTTTGTGGCATACTCAATGGAGCATGTCACCCAATTGGCACAGAAAGATAGAGTAATTTGGATGGACCTCCAATATCGAGGGAACGAGAATGTGAAGATTTTTAAGGACAAAGCTGACCCCATATTGAAAAGCCTGGAAGAGATAACAAGGATGAAGTCATTTAAGAAACTTGAAAATGAGTTGAAGAGCGTAAATGTTTCCAAGGATATCGAATCACAAGAATATCCCAACGTCGATGCATTTAGAAACTTGAGCAGAGATGAAGTGGTTGACAACATTACAAACTCATTCCTCCAACATCTAGAGGAAATTGCTAGCAAAACTCATACAAACAAAGATGAAGAGATGCTTAAAGTTCAGATGATTTTACATTACAGCTGCTTTGGATTCTGCACTAGTAGCTTGATGAGAGAAATAATGAAGATTGAGAGTGAAATAAAAGAACTACTTATATGGGAGAACTCAAACAAACTTCAAAGAAATTTACTCTAA >Ca_02605.g ATGAAATCATTCAAGTTTGTTGAAAAAGACCTTGAAAAAAAGAACATTTCTTGTGATATAGAATTGGGAAAGTCAAAAGAGTGTGGTATGTGGCTTTCGGACATGGGAGAAGATGGAATAAGAGAAACTATAGAGTCTTTTCTCCAAGGGTCAAGAGATTTTATTGATAATTTGTATAGTGATGAAGGTGAGAAGGAGGTGAAGAGTGAAGTTGTTTTGAGTTTGAGTGCTGTTGGGTTTTGCTTGAATGTGTGTATGCAAGGGACAATAGAGATTGAAGAGGCAATGAGGGAACTTGTTCAATGGGAGAATCCTTCTTGCAATATTTAA >Peaxi162Scf00009g02017 ATGGCTGATTTATTGTACTTCATGGTCTACAATATCAACAACATGTCATATGATTTGCAAAGCTGTAATAATGTTGATTGGAAAGAGCTCCAAGAATGTATAAATGATGAATTGGACCATTTGAAAGAAACTGCAATTTCGTCGCTAAGTGTTGTTCTTGATCACAAGACTAGTTTGATCAAGATCATCCCAGATGATCAAGAAGAGAAAATAATGACTGATCTTGAGGAAGGGAAATTGAGTAAAAAGAATGATCAAACTGCTGAAAGTGACTTTAAATCAAAAGAGGTGATTGATAGAATATTGAGTAGCCAAGGACAAGAGGAGCTTAAAGGAAAGTCGAATCTTTCTTTGTATGCTTTGGGATTTTGTATAAGCAGAATACCGAAAGAGATCAAAGATATCAAATTGGCTATGAAGGAATTAGCATAA >Peaxi162Scf00009g02023 AGGTCTAATGTGGGAAACACCTTGGATCCAATTTTTCAGATCTTGTTCCAAATTTCCACTGGCCTGGTGAATGAAAATTTTAAGGGGGCGTTGCTACAATTAAGTGAGCAAATCGGTCGAAAATCAGACCAATCTACTCAGCAAGAAACAAAAGAAGACTTTGCATATGGATCTCTCTTTCTCCATGATGACACTATATCTCCTGTATCTCAAACTCAAAAAAACCTGCCTGTATTTTTCTTCTTATTTTGTGCCAAATTCTTGCTCAATAATTTATCCTTGTCACATTCTAATGATTCCAAAGCTAATAAAGAGCTTCATTCAAGGATTTTCCACAGCATCTTGATAAAAATACCAAGAAAAGAAACATTGGCATTTGCATTAAAATGTTCTATTTCTTTAGCTATGTGGCTTGGCCTACTATTTGATAAAGAAAATGGTTTTTGGGCAGGCCTCACAGTAGCCTCTAGCTTATCACTAGGCAAATTAGCAACATTTACAATTTGGATCACATTTACAATTTGGATCACCAGGCCTCACAGTAGCCTCAAGCACAAGGAATCACATTTGGATCAGTCTATGGAGTCTTGGCTTGTTCTTAGCACTTCTCCCTTGGATTATGTTCAGCATTTTTCTCAACATAGCCGGATTTATGGCCAAGCAGGAGCAATTTCAGCATTATTAGAAGCCGTGATGATACTAGGACGAAAAAATTATGGCCCTCCGAATGACTTTGCCATTATAAGACTAACAGAAACTTTTATTGGATTGTCCTGTTTCATTGTGGTACAGTTTCTCTTTAGTCCAAAAAGAACAGCTAATCTTGCAAGGAATCAATTATTTTCCACTATGGATATTCTCAAAGATTGCATGAACCATATACACAAAGATCACCCAGCTGCTACTGGATTGCAAGGATTAACGGAAAATCAGAGGAAATTAAAATCCCATATCATGGACTTGAATATATTCTCTCATAATGAAGAACTAGAGCCTGATTTTTTGTTTCTTCCATTTAATGCAACATGCTACAAGAAGCTCCAAGGTTTG >Peaxi162Scf00009g02110 ATGTTACACAACTTATTAACATCATCTGCAGGAACAACACCTGCAGTGGCCTCAACTAATACCCTGTCGGGGGTGGAGCACAACCACGTTATGTGGCGGATGAGGCTGCACTCAGCACTTCGGACTGTGTTGGCATATAGTATAATTTGCTGCTCCGCGCTTTATGGACCACATTGGTTAAGAAAATTTGCAGCATTTCCAGCATTCTCATATGTAACAGCCACTATCATCACAAGTGACTCTACGTTAGGTGACACATTAAGGGGCAGTTGGCATGCAATTCTTGCCACAGTTCAAACCATGCCACTGTCCATGCTTGGTGTATGGATAGCAGCCCAAATTGGCTCGTGTAATTGCAGGTTGTCGCCCGTCATGTCGTCCCTAGCATTGGCAATAACTTCATTGTTTGTGGCTCTAGTGGAGAAAACACATTTTAGGTGCAAAAAGATTGCTTTTGGCCAGTTAGTGCTTAGTTTTGCTGATGCTTATATTCATGGAGTACATACAAGTGCTGCTGTCCACCCTCTTCGTGTTGCATGGAGTACGGTCCTTGGGATCATCGCTTCACTTCTCGCGTTATCGCTTCCTTATCCGAGGCTAGCTTACTTTGAGGTCAGAAAACTATACGGATTATATGCTGAAATCTTAAAAGAGATAGTGGGCGTATATTCAAGGGCAATCACTTCCCAAGACAATATCAAAGCAGTTGAATTATTGTCCAAAGCCAAGCTCCTTGCTCAGATAGGAGCCAAGCTTCTCCAAAGCACCAAACTTTTGAAGGAAGTCCAAAAAACGGAAATATCTGTAAGAGGAATGGAAATTGCTCTATCTTCATGTCCTTCTTTTTCCACTGACTTGGTGAATGAAGAATTAAAGGGTGCCTTACTACAAATATCTGAGCAAATTAGTCGAAAATCAGACCAACATACTCTGCAAGAAACAAAAGAAGACATTGCAAATGGATCCCTATTGCTCCCTGATGATACTATATCTCCAACTCAAAAAAGCCTGCCTGCATTTTTCTTCTTATTTTGTGCAAAATTCTTGCTCAATAATTCATCCCCGTCACAATGCAATGATTCCAAAGCTAATGCTGAGCTTCATTCGAGGAGGAGTTTCCATAACATCTTGATGAAAATACCAAGAAAAGAAACATTGGTGTTTGCATTAAAATGTTCTATTTCTTTAGGCCTAGCTATGTGGCTAGGCCTATTATTTGATAAGCAAAATGGTTTTTGGGCAGGCCTCACAGTTGCCGCTAGCTTATCACCAGGCAACTTAGCAACATTTACACTTGCTAATGCTCAAGCACAAGGAATCACATTTGGATCAGTCTATGGAGTCTTGGCTTGTTCAGTTTTCAAACATATCGACAACTTAAGGTTCTTAGCACTTCTCCCTTGGATTATGTTCAGCAGTTTTCTCAAACATAGCCGGATTTACGGCCAAGCAGGAGGTATTTCAGCACTATTAGGAGCTGTGATGATTCTAGGCCGAAAACATTTCGGCCATCCCAGTGAATTTGCCATTATAAGACTAACAGAAACTTTTATTGGGTTGTCCTGTTTCATTGTGGTACAGTTTCTCTTTAGTCCAAAAAGAGCAGCTAATCTTGCAAGGAATCAATTATTTTTCACTATGGATACTCTCAAAGATTGCATGAACCAATTAGTCCAATCTCCAATGAAGCAAAAAGACCAACCAGCTGCTATAGAATTGAAGGGACTAACGGAAACACTGAGGAAACTAAAATCCCATATCATGGACTTGAATAAACTCTCTCATAATGCAGAACTAGAGCCTGATTTTTGGTTTCTTCCATTTAATGCTACATGCTACAAGAAGCTCCAAGGTTCGTTGTCGAAATTGGCCGATTTGTTGTACTTCATGGTGTATAACATCAACAACATGTCACGTAATTTCAAAAACTGTGATAATGTTGACTGGAAAGAGCTCCAAGAATGTATAAATGATGAATTGGAGAACTTGAAGGAAACTGCAATTTCGTCGCTAAGTGCTGTTTTTTATCACAAGCCTAGTTTGATCAAAATTATCCCAGATGATCAAGAAGAGAAAAGAATTAATGATCTCGAGGAAGGAAAATTGAGTAAAAAGAATGATCAAACTGCTGAAAGTGACTTAAGTTTTTTCCTTGAGAGATCAAAAGAGGTGGTTGAAAAAATATTGAGTAGCCAAGGAAATGAAGATCTAAAAGGGAAGTCAATTCTTTCTATGTATGCTCTTGGATTTTGTATAAGTAGCATATTGAAAGAGATCAAAGATATCAAAATGGCTATGAAGGAATTAGCACAGTCGGAAAATCCTTGA >Peaxi162Scf00094g01919 ATGGCGATTGCTGTGACTAAACGAGCTCGAGTCATGTCGCAAATGAGGGTGCACTCAGCCACTCAGACCGCCTTGGCATGCATGATAATCGGCTGCACCACCCTACTAAGTCCGCCCTCTTTGACAAAACAACTAGCATTTCCCGCCTTTTCGTACGTAACAGCCATACTTATTGTGCCAGATGCCACCCTTGGAAAAGTTTTAAGGGGCTCTTGGTATGCATGTTATGCCACAATTCAAGCCATGCCACTTTCCATGTTAGGCCTATGGATTCATGGCTCCGCTACTACCAGCAACATCTCACCCCTAGTAGCTGCTGTAATGGTGGCCATAAGCGCGTTTTTGGTGGCGTTGCCGGAGAGTACATCTTTGATGTCCAAGCGGATTGCTTTTGGACAACTCGTAATAGTATATGTTGATGCTGTTGTTCATGGAATACATGTCAATATATTCATGCACCCTCTTCGAGTTGCATCCAGCACTGCTCTTGGATCTGTGGCTTCTTTCCTAGCTTTGTTGCTTCCCTATCCCTGGCTAGCTTATTTTGAGCTGAGGAAACTTTACAGTATGTATGCTGAAAATGCTTCAGAGAGAATAAATCTCTACATCGAAGCCGTCCATACTCGAGATGTCCAGATATCTCTCGACTTACTATCTCAAGCCAAGCCCATCTCTGAAACAGGATGCAAGATCCTTGAGAGTATCAAACTTCTGGAGGAAAGTTTGCAGTGGGAGAAACCATGGTTAAGACTCTTAAGTCGCTACTCCAAAGATCCAGGACGTGGTTTGCATGACATAGAACATCCAATGAAGGGAATGGAAATTGCCTTAACTGCAGCTTCTCCTTGTTTACTATCTAGAATGGTAGATGAAGAACTCATGAGTGTCTCACATCGAGTGCTACTGCTCCTTCGTCTAAAAATGGAGCAAGCTAGGTGTTTTTTCCCATCCCATTCAATGATAGTACCAGAAGCAGAAGGAGAATATGAGAAGCAGTTTTCCAGTTCACCCCCCGAGCCAATTTTCCCCACGAACCTAGATCAACCAGCACTTTTCTTCTTGTCTTGTGTAAAAATGTGCATAAATGATTTAACCATGAACAAACCTATAACTAAAGGATCCAAAGATTCACAAGGAAGTGATGGAACTAGCTCAAAACGAGTCTGCAGCAATTGGATTAGGCCAATAAACATCAAAACACTGGTATTTGCATGCAAGTGTTCAATTTCTTTAGGTCTAGCTGTGTTACTTGGTTTGCTATTTGATAGAGAAAATGGATACTGGTCAGGCCTTACCATAGCCATCAGCTTTGAAACAGGAAAACTAGCAATCTTTACGGTTGCCAATGCTCGTGCACAAGGAACAGCTCTAGGATCAGTATATGGAATACTAGGCTGCGCTGTATTTGAAGGAGTTGCAGAACTAAGGTTCTTAGCTCTGATCCCGTGGATTGTTTTCACTTCATTTCTAAGGCACAGTAAGATGTACTCTAGAGCAGGAGGAGATGCAGCAGTTATAGGAGCCTTACTGATTTTGGGCAGAAAGGGTTATGGTTCGCCGAGAGAATTTGCCATAGCTAGACTCACCGAGGCCTTCATTGGATTATCATGTTTCATCATCCTAGAGCTTCTTTTGCAACCTACAAGAGCAGTCACTCTCGCAAAAAATCAGCTTTATCTGTGCCTGGGGACACTTAAAGATTGTACTAAACAAATTGTCCTGGATTCGAGGCAGAATGGCTTTATAGAGAAGCAAACACATCTGAATTCTCAAGTCAAAGATTTACAGAAGTTCATCACAGATGCAGAGTTGGAACCTGATTTCTGGTATACACCGTTTCCTATTTCCTGCTACCAAAAAGTCCATAAATCTCTATCAAATGTGGTGCACCTACTGTATTTCATGGCCTACAGTACAGAATCCCTCTCACAAGCATTTGATAGCTTTGACGCTGACATAGAGGAGATTAAAGAACACATAACCAGGGACATAGAACTTCTCGAGGAAGCTCTAAGCTCTTCAATAAGCTGTATTGAGAAAACCATTTCTGCCAGACTATTAGGAGCGTTTCAAGATCAGCCAGAAGAGCGGAAAATCTTTTATGACCTTGAGGAGGGAAAAGAAGTAAAAGAGATAGAGAAGGGTATAAAAGACATGGTGAGTTGGGAAGATCCATTAGACCACCCAGTTCATTAA >Peaxi162Scf00165g01846 ATGGCAACTACCATGGTGGCGAAACGAGCTCGAGCCATGTGGTGGATGAGGCTACACTCCGCCATAAGAACTGCCATGGCATGCACCATAATAGGGTGTGTCACACTTTATAGTTCACCTTTTCTTGGTAAAATACTAGCATTTCCTTCATTTTCCTATGTTACAGCAATATTCATTGTGTCCGATGCCACTTTAGGCCATGCCTTAAGAGGATGTTGGCATGCATTTCTTGCAACACTTCAAGTCATGCCACTTTCCATATTAGGCCTATGGCTTCATGGCTATGTCACCACCGACGACTTTTCGCCCGAAGTAGCCGCCTTAATGATGGCGGTAAGCGCATTTTTGGTGGCGTTGCCGGAGAGTACAGACGTAATGTGTAAGAGAATTGCTTTTGGACAACTTGTTATAGTGTATGTTGATGTTGTTATTCATGGGGTTTATGCCAATTCTGCTGTCATGCACCCTCTTAGAATTGCTGCTAGTACTGGAAATGCTTCAGAGAGGATAAATCTATATTTAAAAGCCATACATACTCAAGATGATCAGAAGGCTATGGAGCTAATATCTCAAACCAAGCCCTTAACTAAAACAGGAACTAAGCTTCTTGAGACTGTTAAATTCTTGGAGAAACCTTGGCTGAGATTCTTGAATCCCTATTTCACAGATCCAGGACATGGTTTGCAAAACTTGGAAGTTTCAATGAAAGGAATGGAAATGGCCTTAAATTCTTGCCCTTCTGTTCCCACTGGACTGATAGATGAAGAGCTTGTTAATGTCTCATACCATGTTCAAATGCTTCTTGGTCAAAAAATGGGACAAGATAGATGCTTTTTACCACATCATTCAGTGACAGCTCCTGAAATTACAGCATGGGATTTTATGAATGAGTCTTCTAGGCTGCCACATGAACCAATTTTAGCATCCAAACAAGATCAACCAGCACTTTTCTTCTTATCTTGTTTAAAAATGTGCACGAATGATTCCAACACAATAACTGAAGGCTCAACAGAATCAAAGGGAAGAAGCAACATCTCGTGCTACAAACGACTCTGCATCAATTGGAGTGTGGCAATGATCAATGAAAGAATGGTGGTATTCGGGTTTAAGTGTTCATTTTCGTTAGGCCTGGCCGTGCTACTTGGTCTTCTATTTAATACAGAAAATGGATATTGGGCAGGTCTTACCATAGCTCTCAGCTTTGTTACAGGAAAACAAGCAATTTTCACAGAAGCTAATGCTAGAGCACAAGGAACGGCTATAGGATCAGTCTATGGTGTACTTGGCTGCACTATTTTTCAAAAAGTCGCGCAAATAAGGTTCTTATCACTCCTCCCTTGGATTATATTCACCACATTTCTAAGGCATAGTAGGATGTTTACTCAAGCTGGAGGAACGGCAGCAGTGATTGGTTCATTACTGATACTGGGACGAAAAAGTTATGGTCCTCCTAGTGAATTTGCAATTTATAGACTCACTGAGGCCTTCATTGGACTAGCTTGTTTCGTCGTAGTTGAACTTCTTTTACAACCTACAAGTTCATATACTTTAGTCAAAAAGCACCTATATCTGATCCAAGGAACACTCAAAGAATGCACCAAGTACATGGTCATTGAATCAAGGCAAAAGGGGTTAATTGAGAATCAAAGAAAACTGAAATCTCAAGTCCATGATTTGGGAAAGTTCATTAAAGATGCAGGGTTGGAACCTAGTTTCTGGTTTTCTCCTTTTCCTATTTCTTACTATCAGAAGGTCCAAAACTCTTTCTCAAAAATGGCAGATATTCTGTTTTTCATGGCCTATGATATCGAATTCCTTTCACAAGTATTCAATAGCTATGCTCTTGATAGAAAAGAGCTTCAAGAATACATGAACAGGCTAGAGTGTCTCAAAGAAGCTTTACACTCTTCAGTGAACTATTTTGAGAAAACCATTTCTACCAGATTGTTAAAAGCTTCTCCAAAACAACAAGAGCAAAAACTCTTGAATGATCTTGAAGAAGGGAATTCACCATGTTCAAGTGAGTGTATCATTTCTTCTACAAGTGATGAGGAGATGGACAAGATTCTTAGTTCTTTTGATGAGCACTCAAAGGAGATTACTGATAAAGTGAGGGCTAATGAAGGAATAGAGCTTAGAGGGAAGATTGTTAGTTGTTTGTGTTCCTTAGGATTCTGCATGAGCCTTTTGGTGGGAGAAATAAGAGACATAAATAGAGGTATAAAAGATTTGGTGAGATGGGAAGATCCTTTAGGTGAACCTAATAGTTTATAG >Peaxi162Scf00406g00316 ATGGCAACCTCTAGCTTTGAATCCATTCGAGCTAGAGCTATGTGGCGAACCTGTCTAGCCTCCGCCTTTCGAACCGCCTTGGCATGCTCCATAGTTGGCGTTGTCACTCTTTTTGGGCCGGAATGTTTCCGAACACAAGTCGCATTCCCAGCTTTTTCGTACGTTACAGTTATTCTTATTGTAACTAATGCCACGTTAGGTGACACGTTACGAAGTTGTTGGCTCGCGCTTTACGCCACAATCCAAGGTGTTTGTCCTGCTATATTGAGCCTTTGGATAATTGGACCAGGCCGCCTCACGGCCAGTACCACGGCTATGGCCGTGGCACTGAGCGCGTTTGTGGTGGTTTTACCGGAACATACTCACTTGATAGCAAAACGAATCGCTTTGGGGCAACTTGTTATTATTTATGTTATAGGTTATATTAATGGTGGAAAAACTGAACCTGTTATGCACCCGATTCATGTTGCTGCTAGCACGGCTGTTGGAGTGGGGGCTTGTGTTTTAGCATTGCTGTTTCCTTATCCAAATCTTGCATGTTGTGAGGTGAAAGAGAAAAGCAGGCTCTTCATCGAAAATGCTTCCGAGAGGATTAACCTGTTTGTGAAGGCATTCTCGGCTGAAGACAACACTTCTGCACTTGCTTTAATTTCTCAAGCCAAGTCCTTAGTTAAAAATGGACCCAAACTTCTCCAAGTCATTAAATCCAAACAAGAAAGCATGAAATGGGAAAGATTTCCATTCAAGTTTTTAAGACCATATGGAGAGAATCCAGGAGGCAGATTTCAAGAAATTCAAATACCCTTAAGAGGAATGGAAATTGCATTGGAAAAATCTCCTTCATTTCCAGTTGATATTCTCAACTCAGAGCTAAAAGATGGTCTAGAAACACTAGGTGATCACATTTCAAAGCAAATTAAGAACATGTCCTTAGAATCATCCACTGTCCCAGAATCAAATGCAGAAAATGCCCAAAAGTTCCTCCAAACACTTCAAACAATTCAACCAACAAAAAAAGATTTACCCTCTTTATTCTTTCTTTTTTGCCTGAAAGTACTTATGAACAAACCAATCTTCCCTTCACCACCCAAAGAAGAATCCAAAAAACAAGAAGCGAAAGGACTATCTATGAGAAAAACATTGAGCAATTTGGCAATTACTGTAAATAGCCGAAGATTTATGGCAGCTTTTAAATTGTCACTCTCATTAGGCCTTGCTATATACTTTGGATCAATTTATAGTAAGGAAAATGGATTTTGGGCTGGGCTACCAGTAGCTATAAGCCTTGCAGCAACAAGAGAAGCAACATTCAAAGTTGCTAATGTTAAAGCACAGGGGACAGTGTTGGGAACAGTTTATGGTGTTTTAGGATGTTTTCTCTTTGAGAGATTTGTGCAAATAAGGTTCTTGTCTCTGCTTCCTTGGTTTATTGTCAGCAGCTTTTTGAGCCGTAGCCGGATGTACGGCCAGGCAGGCGGTATTTCTGCTGTTATTGGGGCAGTACTAATTCTTGGTAGAAAAGGGTTTGGTCCACCAAGTGAATTTGCCATAGCAAGAATCACTGAAACTTTCATTGGATTATCATGTTCCATTATGGTGGAAATTTTGTTACAACCAACAAGAGCTTCAACATTAGCTAAATTCCAGCTTTCCAAGAGCTTTAAGATATTGCATGAATGCATGGACTCAATAAGCTTTGGTTCTTTTAGCAAAAATGAATTGTTAGAAAGGCAAAAGAATTTAAAATTACAAGTAAATGAGTTGGGAAAATTCATTGCGGAAGCTGAGGCAGAGCCCAATTTTTGGTTTTTGCCTTTTAGTAGTGGTTGCTATGGTAAGCTCATGGGGTCCTTATCAAAAATGGTGGAGTACTTATTTTATGGGTCACAAGCACTAAGATTCCTTGAACAAGAATCTGGAAGAATTGACAAAGCAGTTGTGAAAAAACTAGATGATGATCTCATGCTTTTTAAAGATTTAATTGGATCTTTTACAAAATGTTTTGAGGAGGTTAGTTTGGTAAAATCACTAGTGGTACTTGACAAGGAATTTGAGAAGAAGAAAGCTGCAATTGATCTTGAGTTGGGAAAATCAAAAACTCCTTATAATATAAGGTCCTCAAGTGAAGAGGAAATTGAGAAAAACTTAGTTGCTTATCTTCAACATTCCAATGAACTTGTGGAACTTATTGTCGATGATGGTAAAACTGAGAAGAGTAAAGGACCATTGGTTTTAAGTTTGAGTGCCTTGGCTTTTTGCATGGATAGTCTTGTGAAGGAGACTAAAGAAATTGAGAAGGCAATTAAAGAACTTGTACAGTGGGAGAATCCCTCATGCCATGTAAATTTGTATGACATTTCTTGTAAAGTAAGGGCTTTAGCCAATACTGAAACAAATTGA >Peaxi162Scf00679g00213 ATGGCAACACCAAGCTACGAATCGAATCGAGCTCTAGCTATGTGGCGGACTTGCCTAGCCTCCGCCCTTCGAACCGCCTTGGCGTGCACTATAGTTGGTGGTGCCACCCTATTTGGTCCGAAATATCTCAAAAGTCAAGTGGCATTCCCAGCTTTTTCCTACGTAACTGTTATTCTCATAGTGACTGATGCAACCTTAGGTGACACTTTTCGTGGCTGTTGGCATGCACTTTACGCTACTATTCAGGGAGTTTGTCCTGCTATACTTAGCCTATGGTTAATCGGGCCGGCCCGGCTCACGGCTAGCACCACCGCTATCGTGGTGGCTCTAAGCGCCTTCGTGGTGGTTGTTCCCGAAAATACTCACTTGATAGCTAAGCGCATAGCTCTAGGGCAAATTGTTATTGTTTATGTTGTAGCTTATATAAATGGTGGCCAAACTGAAAGTATTATGCATCCTGTTCATGTGGCTGCTAGCACTGGGCTTGGAGTGGTGGCTTGTGTTTTGGCCTTGATTTTTCCTTACCCGAGCCTGGCATGTTGCAAGGTGAAACAGAATTGCAAGCTCTTTGCTGAAAATGCTTCCGAGAGGTTTAACTTGTTTGTGAAGGCATTCGCAGCTGAAGACAACACTTCTGCACTTGCTTTCATTTCTCAAGCCAAGTCCTTAGTTAAAACAGGAGCCAAACTTCTCCAGAGCATTAAGACCAAGCAAGACAGCATGAAGTGGGAGCGATTTCCATTCAAGTTTTTAAGACCATATGGAGAGAACCCTGGTAGCAGATTTCAAGATCTTCAAACACCCTTAAGAGGAATGGAAATTGCCTTGGATAATTGTCCTTCATTTCCAATTGGTCTTCTTAACTCAGAACTAAAATCTGGTCTACATATTCTAGGAGAGCACATCTCAAAGCAAGTCATGAACATGTCACAAACTGTGCCAGAGTCAAATCCAGAAAATACCCAAAAGTTCTTCCAAACTCTTCATAACATTCAACCAACCAAAAATAATTTACCCTCTTTATTCTTTTTATTTTGCTTAAACCTCGTCTTGAACAAACCAATGGCCAAAGAATTAGGATCATTAAATTCGAAGAAACAAGATCAAGAAGGATTTTCGAAAAAGACATGGACCAGCTTATCAATTACCATAAATAACAAAAGGTTTATGGCAGCTTTCAAATGTTCACTTTCTTTAGGCCTAGCTATTCTATTTGGATCAATTTATAGCAAAGAAAATGGATTTTGGGCAGGGTTACCAGTTGCTATAAGCCTAGCAGGAACAAGAGAAGCAACTTTCAAGGTTGCAAATCTTAAAGCACAAGGGACAGTGTTGGGAACAATATATGGTATCATAGGATGTTTTGTCTTTGAAAAGTATGTCCAAATTAGATTCTTGTCTCTGCTCCCATGGTTCATTATCAGCAATTTTTTGAGACAGAGCCAAATGTATGGTCAAGCTGGTGGAATTTCAGCAATTATTGGTGCAGCATTAATACTTGGTAGAAAAGGTTTTGGTACACCAAGTGAATTTGCTATAGCAAGAATAACCGAGACTTTTATTGGATTGGCATGTTTCATCATGGTAGAAATTTTGTTACACCCCACAAGAGCTTCAACATTAGCAAAATTCCAACTTTCCAAGAGCTTTGAGATATTGCATGAATGCATTGGCTCAATAAGCTTTGAATCAAATTTTGTGGCAAGCCAAAATAAACTAAAATTCCATTTACATGAGATGGGAAAATTTATTTGTGAAGCTGAGGCAGAGCCAAATTTTTGGTTTTTGCCTTTTAATAGTGCATGCTATCATAAGCTTATGGAGTCATTATCAAAGATGGTGGAATATTTGCATTTTGGGTCTCAAGCTTTTAGATATCTCGAACAAGACTCCACAAGAATTGACAATATTGTTTGGAGAGAAATTGTAAATAAGCTAGATGGTGATTTCAAGATTTTCAAAGATATAATTGGCTCTTCTATGAAATGTTTTGAGGATGTCAGTTTGGTCAAATCAGTAGCATTACTTGACAAGGAATTTGAGAAGAAGAAACTTACAGTTGATGTTGAATTAGGAAGATCATCAGCTAGTTATCTTAATATAACAAGTACTACTAATGAAGAGAAAATTGATGAAAAGTTCAGTTCTTATTTTCAACATTCAAGAGAACTTGTGGACCAAATTGTCAATGATGAGGAGTTTAAGGGCCAGACTGTATTAAGTTTGAGTGCCTTGGGTTTCTGCATGGATAGACTGGTGAAGGAGACTAAAGAGATTGAGAAGGCAATTAAAGAACTCATACAGTGGGAGAATCCATCAAGCCATGTTAATTTGCATGACATTTCTTGTAAAGTAAGGGCCTTAGCCAATAATATAGAAAATTAG >HBR2349G002 ATGCCAGCCCCAGCTAACAGCCCTAAACGAGCCCGAGCCGTCTGGCGGTGGTGCCTAGCCTCCGCCTTCAGGACAGGTTTGGCATGCACAATTGTAGGCTGCATCACCCTTTATGGTTCCACCTCTGTCCACCACCAAATAGCCTTCCCAGCATTCTCTTACGTGACTGCCATACTTATTGTCACTGATGCAACTCTAGGTGACACTCTTTATGGTTGCTGGCTAGCACTCTACGCCTCAATCCAACGTCTGGGTCCTGCTATGCTGAGCCTTTGGCTGATTGGCCCAGCTCGGTTCACTATTGGCTCCACAGCCCTGGCAGTGGCTTTAGGTGCATTTGTGGTGACACTTCCTGAGTGGACTCATTTGATAGCTAAGAGAATTTCTTTAGGTCAGATTGTTATTGTGTACGTTATAGCCTTTACCAATGGTGTGCACACTGAGACTATCATGCATCCTTTGCATGTGGCGGCCAGTACCGCCCTTGGAGTCTTAGCTTGTATTCTTGCCTTGTTGCTGCCATATCCAAGATTGGCCGGTTGGGAGGTGAAAGAAAATTGTAAGCAGCTGGCTGAAAATGCTTCAGAGAGGCTGAAGCTCTATGTGAAAGCATTATGTGAAAAAGACAGTGCATTGGCCTTATCGTCTCTGTCTCAGGCTAAGTCATTGACCATTTCTGGAACCAAACTTCTCCAAAGCATTAAACGTTACCAAGGAAGCATGAAATGGGAGAGACTTCCATTTAAGTTTCTGAGGTCTTATTCCACGAATCCGGGACAGAGATTGGTAGAACTAGAGTTATCCTTGAGAGGGATGGAAATGGCTTTGACAAGTATCTCGTCATTTCCTGTGAGAATGATGGAAGAAGAGAGCAAAGAAGGCCTGCAATTGTTAGAGGAGCATGTGAACCTGATCTTAAGGCAAATCAAGAATCGCTCGCCTTGTGATTCTTTAACTGTTCCTGAATCAAATGCTGAAAATATAATCGAGTCCCTCCAAACTCTTCAAATAATCCCAACAGATGATCAAGATTTATGCTCTCTTTTCTTCTTATTTTGCATGAAACTCCTCCACTGCAAACCATTGGCTAAACCAATCACTTCCAAAGAAGACAATGAAGGCTCAAGCAATTCAAGTAAGCAAAATGGTTTCTTTAAGAGCATTTGGAGAAAATGGGCCATGAATCTAGGCAGCAAAAGGCTTATGCCAGCTTTCAAATGTTCTCTTTCTTTGGGCCTTGCAATCCTATTTGGTTTGTTATACAGCAAGGAAAATGGTTACTGGTCAGGACTCCCAGTGGCCATTACCCTAGCCACAGCAAGAGAGGCGACATTCAAAGTTGCCAACGTTAAAGCACAAGGGACAGTTTTGGGAACTTTCTATGGAGTACTGGGCTGCTTTGTCTTTGAAAGGTTCTTGCCAATAAGGTTCTTATCTCTCCTTCCTTGGTTCATTGTCACCAGTTTTCTAAGGCGTAGCAGAATGTATGGCCAGGCTGGTGGAATTTCTGCGGCCATTGGTGCCGTACTAATATTGGGTAGGAAAAATTTTGGTCCACCAAGTGAATTTGCTATAACAAGAATCACTGAAACCTTCATTGGATTATCTTTTTCAATTATGGTGGAGCTATTGTTACAACCCACAAGAGCTGCTTCTCTAGCCAAAGTTCAACTCACTAAAAGCTTGGGGTCCGTGTCTGCCTGCGTTGGCTTAATGAGCCTTGAAGCCGACCAAGCCATCTTGCTAAAGAACCAAAGAAGACTAAAATTGGAAGTTAGTGAGCTAGAGAAATTCATTGGAGAAGCTGAGGTGGAGCCCAACTTCTGGTTTCTGCCTTTTCATAGTGCTTGCTATGGTAAGCTCTTGGGGTCTTTGTCAAAGATGGTGGATCTCTTGTATTTTAGTGCTCATTCAGTTGAATTCCTCCATCAAGAATCACAAAAATTTGGGACTTTTTGGAAGGAATATGCAAATAAACTAGAAGGTGACTTTGAACTTTTCAAGGAAATGGTTGGTTCCTTAATAAAATGTTTTGAGGGTCTCACCTTGTTGAAATCCCTGAAATTTCTTGACAAGGAACTTGAAAACAAAAGCATCTCTTATGATCCTGAATTGGGAAAATCACCAAAACCAAATATTTTCAAGGTTCCAAGTTCAGATGATGAAAATGAGATAGAGAGTATCATCAAATCTTATCTCAAACATTCAAAAGAAGTTATAGATAAGTTCCATGAAGAGGAGCAGAAGAGCCAGATGATTTTAAGTTTGGGTGCCATAGGCTTTTGCATGAGAAATTTAATAAAAGAGGCTAGAGAGATTGAGAAGGGAATCCAGGAACTTGTCCAATGGGAGAACCCTGGAAATGACATAAATCTGTGCGAAATTTTATCTAAAATTCGTGCTTTATATAATTGA >Potri.001G237300 ATGCTAGCCACAACAGACCGTGCCCGAGCAGTGTGGCTCCGTTGCCTGGCCTCGGCGTTCAGGACTGCTCTGGCATGTACCATAGTTGGTTGCACCACCCTTTATGGTCCAGCTGCTGTCCAACACTATATAGCCTTCCCTGCATTCTCTTATGTGACTGTGATACTCATAGTCACTGATGCAACTTTAGGTGACACTCTTCATGGTTGCTGGCTAGCACTCTATGCCACGATCCAGAGCGTAGGGCCGGCTCTGCTGAGCCTTTGGCTGGTTGGTCCAGGTCGGTTTACAAATGGCACCATATCCTTAGCAGTGGCCCTGGCTGCATTTGTGGTGGCATTTCCTGAGGGGACTCATTTGATAGCAAAGCGAATTGCACTGGGTCAGATTGTTATCGTGTACGTTATAGCTTTTATCAATGGTGTGGATGCTGAGGCTATTATGCATCCTTTGAATGTAGCCGCTAGTACAGCTATTGGAGTCTTAGCTTGTGTTATTGCCCTGCTCTTACCATATCCAAGACTGGCTTGTTGGGAGCTGAAACAAGATTGTGGAAAGCTAGCTGAAAACGTTTCCGAGAGGCTGAACCTCTATGTGAAAGCTTTCTGTGCAGAAGACAATGCATTGGCATTGACATCTATCTCCCAAGCCAAGCCATTGACTATTGCTGGTGCCAAACTTCTCCAGAGTATCAAACGCTACCAAGAAAGCGTGAAATGGGAGAGGCTTCCATTGAAGTTTCTGAGAAACTTTTACTTGAATCCGGGAGAGAGATTGCAAGAGCTAGAGATACCATTGAGAGGGATGGAAATAGCTTTAACCAGTACCAGTTCATTTCCTATAAGAATGCTCGAGGCAGAGACCAAACAAGGTCTAGTTCAACTAGAGGAGCATGTTAGCCTGACCCTAAAACAGATCAAGAATTGTTTTCCTAGAGATTCTTTTACTGTTCCAGAATCAAATGCAGACAAAATAATCGAGTTCCTTCAAACACTTCAAGCAACGATCCCAACAAACCATGAAGATTTGCCCTCTTTTTTCTTCTTATTTTGCATGAAACTCCTCCAAAGAAAATCACTGGCGAAACCAATCACCTCCATACAACAAAAAGAATCAAGCACTCCATGTCAAAAGAATGGGTTCTTCAAGAGCATGTGGATGAGCAACTGGTCCACAAGTGTAAACTGCAAAAGGCTTATGCCAGCATTCAAATGCTCTCTCTCCTTGGGCCTTGCTGTCCTGTTTGGTTTGATATATAGCAAGAAATATAGTTATTGGTCAGGCCTCCCTGTAGCCATTAGCATGGCTGCCGCAAGGGAGGCGACGTTCAAAGTTGCTAATGTTAAAGCACAAGGGACAGTCTTGGGGACTGTATATGGAGTATTTGGCTGCTTTGTGTTTGAAAGGTACTTTCCAATAAGGTTTATCTCTCTCCTTCCTTGGTTCGTCGTTATCAGTTTTCTGAGGCACAGCCAGATGTATGGTCAGGCAGGTGGTATTTCTGCAGTGATTGGAGCTGTAATAATATTGGGCAGGAAAGATTTTGGACCACCAAGCGAATTTGCTATAGCAAGAATTGTGGAAACTTTTATTGGATTATCTTGTTCAATCATGGTAGACCTTCTCTTGCAACCCACTAGATCTTGTTCTCTAGCTAAAGTTCAACTTTCTAAATGTTTCGGGACATTGTCTGCTTGCGTTGGCTCAATGAGCCTTGCAGCCAACAGCAAAACCAACTTGCTAGAGAAACAAAGGAGACTAAAATTGGATGTTAGCGAACTAGGGAAGTTCATTGGAGAAGCTGAGGTGGAGCCCAACTTCTGGTTTTTGCCTTTTCATAGTGCTTGCTATTGTAAGCTCTTGGCGTCTTTGTCAAAGTTGGTGGATCTCTTCCTTTTTAGTGCTGATGCAGTGGGACTCCTTGAACAAGAATCACAAAAACTTGGAGCTTCCTGGAAGGAGTCTGTAAATAAACTACATGGTGACGTTGAAATTTTCAAGGAAATGGCTGGTTCCTTGGTTAAATGTTTTGAGGATGTCACATTGTTGAAATCGCTAACATTTCTTGAAAAGAAACTTGAAAACAAGAACATCTCTTATGATCTTGAACTGGGAAAATCTTCAAACTGGAACATTTTTAAAGCTTCCAGTTTAAAAGACGATAAGATAGATAGCATCATCAGCTCTTACCTCCAACATTCAAAAGAAATTGTAGACAAGTTTCACGCAGCTGATCATGAAGGGGAAAGGGAACTGAAGAGCCAGGTGGTCTTATGCTTGAGTGCTCTAGGTTTTTGCATGAGCAACTTAATAAAAGAGACAAGAGAGATTGAGAAGGGAATCATTGAACTTCTTCAATGGGAAAACCCTTCAAAACACATAAATTTGTACGAGATTTCATGTAAAATTCATGCTCTAAACAATTGA >Potri.006G082000 ATGGTGGCGCTGCCAGAATCAACTCCCTTGATGGCTAAGCGGATTGCATTTGGGCAGGCTGTGATTGTGTTTGTAGGCGCAGCTATCCATGGTGCAGAAGAAGGAGTAGTCACGCACCCAATTCATGTGGCTTCAAGTACAGCCTTGGGAGCATTAGCTTCTGTTTTGGCCATGCTGATTCCATACCCTTGGCTAGCGTACTGCAAGGCTAGGAAAACGTGCAGACTATATGTTGAAAATGCGTCAGAGAGATTGAATATCTATGTAGAGGGCTTAACAGCCCAAAACAAGCAAGCTGCAGCTGACTTGCTTTCCCAAGCAAAGTTCCTCTCAGTAACAGGAGCCAAGCACCTTCAAACTATCAAAGATACTCGAGGAGGGATGGCATGTGAGAAACCACAAATCAGAAAGCTTAACGCAGGAGAAAATTTGCAAGACATCGAAATACTAATGAAAGGCGTGGAAATTGCTCTTGATTCATGCCCTTCTTTTCCTGTTAGCATGATAGATGAAGGGATCAAACAAGCATTACTCGATATGAAAGAAAAAATAGGCCTAAAGCTGCAGAACGCCAAGTGCTTAGCTCCTTTTGATGCGACATCAGCTCCGGAAGCAAAGGATGGAGAAAGTTATGTTTTGGCCCCAAAAATTGGTGGCACAACGCAGGCAGACCTACCAGCTTACTTCTTTTTGTATTGCCTGGAACTCCTCTCGAGGGAATTGCCAGTTGGTCAAAATCCAGAGTGCAATTCAGAGAACACTAACAAAACTGATACTAGAGATGTAACCAGTAAAAGAGATCAAGAGAAGGCAAACCTTAGAAAGACTTGGGATTGCTCAACTATAAAACTACCAAACATGGAGAGGTGGACTCTTGCAACCAAGTGTTCACTTTCTATGGGTTTTGCTGTGCTATTCGGTTTGATATTCAACAAAGAAAACGGGTATTGGGCAGGACTCATCATTGCCACCAGTTTTGTCACGGAAAGACAAGCAACTTTTACAGTTGCGAATGCTCGTGGGCAAGGGACAGCGATAGGATCGGTTTATGGGATCCTGTGTTGCTTCATTTTCCAAAGATTTGTGGACTTACGGTTTCTATCTCTTCTTCCATGGATCATTTTCACCGGTTTTCTAAGGCACAGCAGGATGTATGGCCAAGCCGGCGGGATTTCAGCTGTGATAGGAGCATTATTAATCCTGGGTAGGAAAAATTATGGCCCTCCAAACGAGTTTGCAACTGCAAGACTCGTAGAAGCTTGCATAGGATTGATTTGCTTCATTATGGCAGAGATTCTATTGCAATCCGCGAGAGCTGCAACTCTAGCAAAGACTGAATTTGCAGGGAGCTTGAGGGCACTCCGAGATTGCATTGACGATGCATTCCAGCTCTGTGCCGGCCAAAAGAGTGCGTTGTCATCTTCGATTCCAGCATTACGAAGAAAGCATCAAGAGGTGAAATCCCGCATCAACAACCTGGAGAAATTCATTGCTGCAGCCGAATCAGAGCCTAACTTCTGGTTCTTGCCTTTTTATGGTGCTTGTTATCGCAAATTACTGGTTTCTTTAAGAAAGATGGAGTGCCTCTTGTTGTTCGTGGCCATTGAAATCGGAACTCTATCACAAGTATCAGATAGGTTACAAGTACTCATCAACAATTATCTACTTCCTTTGGGGGAAGAAGTAGGCTTTTCATTGAAATGTATTGAAGAGTTGGTTTCGATGAATTCCTTGGCGCTCCTGGAAAGGGGGGTGCAAAAGATAAGCATATCTCATGATGACACGGAGCTAGGAAAATCATCACCAAGTGCAGATGAAGTATTTAGGACTTTGAGTCTAGATGAAGAAGAAGTTGAGAATTCCATTTCCCAACATTCAAAAGAAGAAGCTGACGGTATTGAAAAACGCGAAGGTGCACAGGAGCTCAAGAGCCGGTTGATCCTTCGCATATACAGCCTAGAGTTCTGCATCAGTAGCCTGATAAAAGAAACGCGAGAGATTGAGAAACAAGTGAAAGAATTAATTACTAGGGAGAACCCAGAAAGCCAATTTTCCACAAAAGAAGGATCCCCCGGTGGCGGTTGA >Potri.009G028600 ATGTCAGCCGCAACAGACCGAGCTCGAGCTGTGTGGCTCCGATGCCTAGCCTCGGCGTTCAGGACTGCCCTGGCATGTACTATAGTGGGTTGCACCACCCTCTATGGTCCAGCTTCTATCCGACACCATATAGCCTTCCCTGCATTCTCTTATGTGACTGTAATACTCATAGTCACTGATGCAACCTTAGGTGACGCTCTTCATGGTTGCTGGCTAGCACTCTATGCCACGGTCCAGAGCGTGGGGCCGGCTCTGCTGAGCCTTTGGCTGATTGGTCCAGCTATGCTTACTAGTGGCACCATATCTTTAGCAGTGGCTCTGGGTGCATTTGTGGTGGTTTTTCCTGAGGGGACTCATTTAGTTGCAAAGCGAATTGCATTGGGTCAGATTGTTATCGTGTACGTTATAGCTTTTATTAATGGTGTGCATACCGAGGCTATTATGCATACTTTGCATGTAGCCGCTAGTACTGCTATTGGAGTCTTAGCTTGTGTTCTTGCCTTGCTGTTACCGTATCCAAGACTGGCTTGTTGGGAGCTGAAACTGAATTGTGAAAGGCTAGCTGAAAATGTTTCTGCGAGGCTGAACCTCTATGTAAAAGCTTTCTGTGCGGAAGACAGCGCTTTGGCGTTGACATCTATCTCTCAAGCCAAGCCATTGGCTGTTGCTGGAGCCAAACTTCTTCAGAGTATTAAACGCTACCAAGAAAGCGTCAAATGGGAGAGACTTCCATTGAGATTTTTGAGAAACTTGTACTTGAATCCGGGAGAGAGATTGCAAGAGCTCGAGATACCATTAAGAGGGATGGAAATGGCTTTAACCAGCTGTACCACCTCATTACCTGTAAGAATTCTCGATGGAGAGACCAAACATGGTCTAGTTCAACTAGTGGAGAATGTTAGCCTTATCCAAAAACAGATCAAGAATTGTTTGCCTAGAGATTCTTTAACTGTTCCAGAATCAAATGCTGATAATATTGTCGAGTCCCACCAAACACCTCAGACAATCTCAACAAGGCACCAAGATTTGCCTTCTTTTTTCTTCTTATTTTGCATGAAACTCCTCCACTGCAAATCACTGGGGAAACCAATTACCCCCACGCAACAAAAAGGATCGAGCACTCCATCTAAGCAAACTGGGTTCTTCAAGAGCACGTGGATGAGCAACTGGTCTACAAGTGTAAGCAGCAAAAGGCTTATGCCAGCATTCAAATGCTCTCTCTCCTTGGGTCTCGCTGTCCTGTTTGGTTTGATATATAGCAAGAAAGATGGTTATTGGTCAGGCCTCCCTGTAGCGATTAGCTTAGCTGCTGCAAGGGAGGCAACATTCAAAGTTGCTAATGTTAAAGCACAGGGGACAGTATTAGGGACTGTATATGGAGTATTTGGCTGCTTTGTGTTCGAAAGGTACTTGTCAATAAGGTTCATCTCTCTCCTTCCTTGGTTCGTTATTACCAGTTTTCTGAGGCATAGCAAGACGTATGGCCAGGCAGGTGGAATTTCTGCGGTGATTGGAGCTGTGCTAGTACTGGGCAGGAAAAATTTTGGCCCACCAAGCGAATTTGCTATAGCAAGAATTGTGGAAACCTTTATTGGATTATCTTGCTCAATCATGGTAGACCTTCTCTTGCAACCCACCAGAGCTTCTTCTCTAGCCAAAGCACAACTTTCTAAATGTTTCGAGACGTTGTCTGCTTGCATTGGCTCAATAAGCCTAGCAGCCAACAACAAAACCAGCTTGCTAGAGAACCAGAGGAGACTAAAATTGGATGTTAGTGAACTAGGGAAGTTCATTGGAGAAGCTGAGGTGGAGCCCAACTTCTGGTTTTTGCCTTTTCCTAGTCCTTGCTATTTTAAGCTCTTGGGGTCTTTGTCAAGGCTGGTGGATCTCTTGCTTTTTAGTGCTGATGCAGTGGGACTCCTTGAACATGAATCACAAAAATTTGGAGCTTCGTGGAAGGAGTACGTAACTAAGCTAGATGGTGACCTTGAAATTTTCAAGGAAATGTCTGGTTCCTTGGTTAAATGTTTTGAGGATGTCACGATGTTGTTATCCTTAGAATTTCTTGAAAAGGAACTTGAAAACAAAAACATCTCTCATGATCTTGAAATGGGAAAATCTTCAAACAGGAACATTTTTAAAGTTTCCGGTTCAGATGAAGACAAGATAGATAGCGTCACCAGTTCTTATCTCCAACATTCAAAGGAAATGGTAGACAAGTTTCACGCAGCTGATGAAGGGGAAAGAGAACTGAAGAGCCAGGTGGTCTTGTGCTTGAGTGCTCTAGGTTTTTGCATGAGCAATTTAATAAAAGAGACCAAAGAGATTGAGAAGGGAATCATTGAAATTCTTCAATGGGAAAACCCTTCAAAACACATAAATTTGTACGAAATCTCATGTAAAATCCGTGCTCTATACAATTGA >Araip.8I0RX ATGGCAGCAGCCACTAATGGAGGCAAATCCATGTGGCAAGCATGCCTAGCCTCAGCCTTCCGTACAGCTCTAGCCACCACCATAGTGGGCTGTGTAACTCTCTTGGGCCCCCATTCCCTAAAAAAGCTTATCGAGCTGCCTTCATTCTCGTATGTCACGGTGGGAATAATCATCCTCAACGATGCCACCTTCGGAGACTCCTTGAGAGGCTCGTGGTATGCTCTTTATGCAACAATTCAGAGCATGGGCCCAGCCATGCTCAGCTTCTGGATCATTGGGCCCAGCCGCTTTACTAAGGAGACGATAGCGGTGGCGGTGGCCCTGGCCGCCTTCGTTGTGGCGCTACCTGGAGAGATTACGCATTTCATAGCTAAGAGGATAGCGCTTGGTCAGATAGTTCTTCTCTATGTCACAGCTTACATCAATGGTGCTCGTACTCAGCCTCTCATGCACCCTCTCGGCGTGGTCGCTAGCACCGCCCTCGGAGTGGCGGCCTGCATTCTCGCCTTGTTGTTTCCCTCTCCGCGTCTTGCATGCCGTCAGGTGAAAAAGAATTACAAGCTACTAACACAGAATACGATTAAGAGGGTGAAGCTTTTGATGAAGGCAATATGTGAAGATGACAAGGCCTCTGTATTGACGTCAGTTTCTCAAGCCAAGTGTTTCTCAACTACCAAGCTTCTCCAAATCATCACACACTACCAAAAAGGCATGAGGTGGGAGAGACCTCAAACCAAAATCTTCAGATCCAATTGCTTATATGCTGTAGAGAAGCTTAAAGAAGTGGATACCACACTAAGAGGAATGGAACTGGCTCTAAGAAGCATCAATTCATTTCCAATAAGCATGATCAATGAAGACATGAAACATGGTCTTAATAGCCTCATGCAACAAATTAGCTTAACCATAAAAGAAACCAAACACAATTTGCATGGTGCTTCGCTAACTGTCCCTGAACCAAGTGAAAAAACCATAACCAATTTTCTCCATTCCCTTCAAACTATTCCAACAACCCTCCAAGATTTACCCTTTTATTTTTACTTGTTTTGCACTAAACTCCTTTACATGAAATCTTTAGCCGAACCTACTCCTACTCCACCTACTATTCAAGACCAACCTACTGAAAAAAATGGAAATCCAAATTTAAATTCTCCTGAGGGTAACAAAGAAAATTGGGCTAAGTCTTTGGTGACAACATTAACAAGCCCAAAACTCATGGCATCATACAAGTGCTCTCTCTCTTTGGGCCTTGCTGTTTACTTGGGCTTAGTATACAGCAAAAAGGATGGATTTTGGGCTGGGCTTCCTGTGGCTGTAACCTATGCATCTGACAGGGAAGCCACATTTAGGGAAACAAATCTCAAAGCCCAAGGAACAGTGTTGGGAACAGTGTATGGAGTTCTCATTAGCTTTGTCTTTGAGAGGTTCTTGGTGCTCAGATTCTTGTCTCTTTTTCCATGGTTCCTTTTCACAAGTTTCCTCCAAAGAAGTCAAATGTATGGGCCTGCTGGTGGAGTATCTGCAGCTATTGGGGCCCTTTTAATATTGGGTAGGGAAAATTTTGGCCCACCAAAAGAGTTTGCTATTACAAGAATTGTTGAAACGTTTATTGGGCTTTCTTGTTCAATTTTTGTGGATATTCTTTTCAGGCCCAAGAGGGCCTCAACATGTGCAAAAGTTGAGTTGTCCAATAGTATTGCCACACTAGTTGAGTCCATTGGATCCTTGTCCATGCTTCATGATTCATCAAAAACCAAGTTAGAACAAAACCAAAAGAAGCTAAAGGGTCATGTTAATAAGCTAAAGAAATTTGTTGTTGAAGCAGAAGCTGAGCCAAATTTTTGGTTCTTGCCATTTCATGGTGCTTGCTATAACAAACTCTTAGGATCTTTGTCAAGATTGGATGATGTATTGCAACTTGGTTCTCAAGCATTGAAGTTCCTCCAACAAGAGGTACAAAGATGTGAGGCATGTTGGAAAGAGCATGTGAATTTGATAGAAGGTGACATTGGACATTTGAAGGAACTCATTTGCAATTCAATGAAGAGTTTTGAGGAGATCTCTAAATTGAAATCTCTTGGGTTTCTTGAGAAGGAGCTTGAGAAGAAGAAGAAGAACACCACTAGTGATGTTGAAGTGGGAAAGTCAACACCGAAGTCAAGTATATGCATGGTTTCTGGCTTAGGAGAAGATGACCTTGAGAAAACTTTAGGATCTTATCTCCAACATTCAAGAAATGCTGTTGACCATTTATATGATGATGATGATGATGTTGATGATGAGAAAGAGTTGAAGAGCCAAGTTGTTTTGAGTTTGAGTGCTTTGGGGTTTTGTTTGAGTGCAATCATGAAAGAGACAATGAAAATTGAAGAAGCAATCAAGGAATTGGTTCAATGGGAAAATCCATCTAGTGTGATTAATTTGTATGAAATATCTTGCAAGCTACATTCCTTGCACAAATGA >Araip.3S709 ATGATGTCAAATAAAACTATAATAACTACAATTACTAGCACAAAAACAGAGATGTGGCGAAGTCGTTTAGGCTCTGCTTTAAGGGCCGCCATAGCGTGCACCATAGTTGGTTGCACCTCAATCTATGGCCCCAAACCTCTCCGGCCCTACTTTGAGTTTTCGACTTATTCTTATGTCACCACTGTTCTAATAGTCTCAGATGCCACACTCGGTGAAACACTAAGAGGTTGCTGGCATGTCCTATGTGCCACCATGCAGGCTATGATCATTTCACTTCTTAGCCTCCTTGTGATAGGACATGGCAACTTCAACAACCGTGTGGCCGCGATGGCAGTTGCGGCTGGCTCCTTTTTCGTGGCGCTGCCGGAATCAGTGGAACTTAGGACTAAGCGGATTGCGTTTGGGCAGCTAGTGATTGTTTATGTGAGTGCAGTGATAGATGGTAAGAAAGAAGCAGTGACAGTGTTCCCAGTTCATGTGGCAACCTCTACTGCTCTTGGAGCTGTGGCTTCAGTTTTGGCCATGTTGTTGCCATACCCTCACCTTGCATATTTAATGGCGAGGAAATTCTACCAATTATACATTGAGAATACTTCTGAGAGGCTAAATTGCAACATAGAAACCATCTCTGCCTCAGACCACTCAACTGCTGTTACTTTCTTCAATCAAGCCAAGTCCCTCTCCCTAGTAGGACCCAAACTTTTCCAGAGAATAAAAAGCAACCTGAATGGAATACATTGGGAAAGGCCTCACAATCCCCATTGCATTGATCCAAAGGAAAGACTGCAAGACTTGGAGGTACCAATCAGAGGGATGGACATTGCTTTATCAAGCTGCACTTCTTTTCCCATCAGTATCATCGATGAAGAGCTCAGGGGTACCTTGCTCAATTGCAGAGGAAGATTCAGCCAAGAATTAGATCAGCCAGATAAGTTATTTGCACCTCTTGATACAAACACCACCTCTGAAAGCAAGAAGGAAATTTTGATTAAAAGCATTTCCAAAACCTATAAGGATCTGCCAACCTCATTCTTCTTGTACTGTTTGCAACTTCTCTTCGAGAACTCCCCTGTAGCAAAGAAAACTAACCATGTGGCGGAAAGCCCTCCGAAAGATGATGATTTCAAAGGGATTTTCAGAAAGATAAGAGAGGTTTCTATGAAGTCAATCCCCAGCATGGACAGCTTGGTTTTTGCATTCAAGTGCTCGCTTACATTAGGCCTTGCTATGCTATTTGGGTTGACATACAGCAAGGAAAGTGCATATTGGTCAGGGCTTGCGGTCGCCATCAGTTTTGATCCTAGACGTCAACCAACATTCTGGGCTGCAAATGCACGTATGCAGGGAACTGCAATGGGTTCAATCTATGGGGTTCTATGTTGCTTCATTTTCCAAAAATATGTGGATTTAAGGCTCTTGCCTCTTTTGCCATGGGTGGTTTTTTATACATTTCTAAGGCATAGTAGAATGTATGGGCAAGCTGGCGCAATTTCAGCCGTTATAGGGGCCTTACCTATCCTTGGTAGGGAGCACTATGGCCCTCCAAAACAGTTTGCAATTGCCAGAATAGCTGAGGTCACAATTGGACTCATTTGCTTTGTCATTGTAGAGATACTAATGAGTCCTTCAAGAGCAGCAACTCTTGCAAGAACTGAATTTTCTCGAACCTTGAGAGCACTTCAAGATTGCATTGGCAAGATCGCTATTATTGTCCCTAGAGAAAACGACAAATTGTCTTCAAGTTCTCAAGTACTGAGAGCAGCACAGAAAAATATGAGATGTCTGGTGTCTCAAATGGAAGCATTCATAGTAGAAGCTGAGTTAGAACCAAACTTCTGGTTCGTTCCATTTCATGGTGCCTGCTACCGAAAGATGATCCAATCGCTGTCAAGGATGGCAGACCTCTTTCTATTTGTGGCATACTCAATGGAAAATATCTCACAGTTGTCACAACAGGAAGGAGGATCATGGGTGAATCTCCAAGATCAAATGCATGAGAATATAGAAATTATTAAGAACAATGTCTGTCCTACACTGAAATTCTTTGAAGAGATAACCAAAATCAAGTCTCTCACAGAACTAGAAAAGGAATGGACGAAAAGAAACGTTCCTTGCGACATTGAATCAGGAGGATATCCCAATGCAGATACATTTAGGACCATGTCTGGGGATGAGGAAGTGCATAGCATCACGGGCACTTTCCTCAAACACCTGGAGGACATAGCTACCAAAACTCACGCCAACACAAATGAAGAGATGGTTAAATGCCAAATGCTTTTTCATTACAGTTGCTTAGGATTCTGCACTAGTAACTTGGTGAGAGAAATAATGAAGATTGAGAGTGAATTAAGAGAACTACTAATTTGGGAGAATCCATCAAGTCATGCAAACATGAAAGAAATTTATTGTAAGATCAGCACACTCTGTTCGTGGTAA >Araip.57MS8 ATGTCAAAGATTATAAACACAATTAGTAGCACAAGGGCAGAGGTGTGGCAAGCACGCTTAGGATCAGCCCTAAGGACCACTCTAGCCTGCACCATAGTAGGTTGCACCTCCCTCTACGGCCCCGAACCCCTCCGGCACTATCTCGAGTTCCCGGCCTTCTCGTATGTTACCACAATCCTCATAGTCTCGGACGCAACACTCGGTGACACCCTAAGAGGTTGTTGCCACGTCCTCTTTGCCACTGTCCAGGTCATGATCGTTTCTCTTCTTAGCCTTCATGTGATAGGACCTACCAACTTCTCTAACCACACGGCCGCGATGATGGTCGCGGCCGGTTCATTTTTAGTGGCGCTTCCTGGATCGTTGGAGTTGGTGGCTAAGCGGATTGCATTCGGGCAATTAGTGATTGTTCATGTAAGCGCCGCGATAAATAGCGCGGCGGAAGCAGGGGTGACGGTTTACCCAATTCATGCCGCATCCTCCACAGCCCTTGGAGTTGTGGCTTCAATCCTTGCCATGTTGGTACCATATCCTCGCCTCGCCTATTATGAGGTGAGGAAACTCTACCGATTATACACTGATAACATATCTGAAAGGTTAAATTGGAATATAGACACCATCACTGCCTCAGATAGTTCAACTGCTGTTGGTTTTTTCAATCAATCCATGACCCTCTCTACAATAGGAGCCAAGCTTTTCCGGAGAATCGAAGTTAACATGTTTCCTAGTAACAGCTATGAATTAATTATAATATTTGGTCATCTTTTTCTCACTAAAAAGAAAGGCATGCATTGGGAAAGGCCTCGTAATCCTCACTGCATAGACCCAAAGGAGAGACTGCAAGACTTGGAGGTACCAATCAGAGGGATGGACATTGCTTTATCAAGTTGCACTTCTTTTCCCATTGATGTCATTGATGAAGAGCTCAGAGGTGCCTTGATCCATTGCAAAGGAAGATTCAGCCAAAAATTAGATCAACAAGGCAAGTGTTTTGCACCTTTTGATGCAACCACCAACTTAGAGACCAAGAAGGAAATTTTGAACAGAAGCATTTCCAAAGCCTATAAAGATCTTCCAACTTCATTCTTCTTGTATTGTTTGCAACTTCTCCTAGACAATTCACCTGTGACAAAGAAAATTGACCACATGGTGGAGAAAACAAAGAAAATTGGTGATTCCAAAAGGATCTTCAGAAAGATAGCAGAGGTTGTTATGAACTTTATGCCTAGCACTCACAACTTGGTTTTTGCATTCAAGTGCTCCCTTTCATTAGGTCTTGCTGTCTTCTTCGGTTTGACATATAATAAGGAAAATGGATATTGGTCAGGACTCACAATCGCTATCAGTTTTGATACTAGACGCCAACCAACGTTCTCGGTTGCAAATGCGCGCGGACAGGGAACAGCAATGGGATCAATCTATGGGGTTCTTTGTTGCTCCATTTTCCATAAATATGCGGATTTGAGGTTGTTGCCTCTTATACCATGGCTGGTTTTCTATACTTTTCTTAGGCATAGCAAAATGTATGGGCAATCTGGTGCGATTTCAGCTGTTATAGGAGCCTCACTTATCCTTGGTAGGAAGCATTACGGCCCTCCAACTCAATTCGCAATAACGAGAATCACCGAGGCCACGATAGGACTCGTTTGCTTCATCATTGTAGAGATTCTAGTGAGTCCCTCAAGAGCAACTACTCTAGCGAAAACTGCACTTTCGGAAAGCTTGGGAACACTTGAAGATTGCATTAACAAAGACATGCCAATGCCATCTATAAGTTCTCAAGCACTAAGAGAAGGACAAAATAAGATGAAATCTCTGGTGTGTCAACTGGAAGCATTTATAGCAGAAGCTGATTTGGAGCCAAATTTCTGGTTCCTTCCATTTCATGGTGCTTGCTACCGAAAGATGCTCGAATCTCTATCAAGGACAGCAGACCTCTTACTCTTTGTGGCATACTCAGTGGAACAACTCACACAATTATCACAGAAGGGTAATGGAGGATCCGAGGTCGACCTACGAAACGGAATGAATGAGACTATAGAGAATTTTAAGAACAAAGTTGGCCCGACATTGAAATGCCTCGAAGAGATAACAAAGATGAAGTCGCTTAAGAAACTAGAGAAAGAGTTGAAGAAAAGAAATCTTCCTTGTGATATTGAGTCAGGAGAATATCCCAATGCAGAAACATTCTTGATTGGAGATGAGGACGTGGAAATCATTTTGGGGACTTTCTTCAAACACCTGGAGGGCGTAACTAGCAGAACTCACACTAACAGAGATGAGGAAATGCTTTTTCATTACAGTTGCTTGGGATTCTGCATTAGTAACTTGGTGAGAGAAATCATAAAGATTGAGAACCAAGTAAGAGAACTAATTATGTGGGAGAATCCATCAAATCAAGCGAACATGAAAGAAATTTATTGTAAGATTAGCACCTTGTGTTCACTGTCATAA >Araip.P1R6Y ATGGCACGGTTCCAATTCCCAGCATTATGGCAAGCATGCCTAGCCTCAGCCTTCAGAACCGCCCTAGCATGCACCATAGTGGGCTCCGTTACCCTCTTGGGCCCACCCTCCATTCAAACCCTCATAACCTTCCCTGCATTCTCATACGTCTCTCTCGTTCTCATCATCATCAACGACGCCACCTTCGGAGACACCTTTCGAGCATGCTGGCTCGCCCTCTACGCCACCATCCAAGCCATCGGCCCCGCCATGCTCACCCTCTGGGCTGTGCACCCAGCCCGCTTGTCCAATGCCACCACCGCTGTCGCGGTCGCTGTCGCTGCCTTTGTGGTGGTTCTTCCTTCGGATCGGTCAACGCATTTGTTGGCAAAGAGAATATCGCTTGGTCAAATAGTGCTTGTTTATGTGACAGGTTATGCTAATGGAGTCCACACCGATCCTCTCATGCACCCTTTACGCTTGGCTGCAAGTACTGCACTTGGCGTCATCGCTAGCCTTCTTGCTTTGCTTCTTCCCTATCCTCGTCTTGCGACTTCTGAGGTAAAGAGAAATTACAAGGTATTAAGGAAGAGTATGTTGAAGAGAATGCAAGTGCTAATAAAGGTAATATGCGAGGATGACATCAATTCTGCATCTTCACATGCATTAGTCACTCATGCTAACTCTTTCGTAACTACTCAAACCAAGCTCTTTCAAGCAATCGTTGGCCGTCAAGATAGCATACGGTGGGAGACACCTCTACTTAAGGTTTTCAGGTTGCATTGCTGGGTCCCAATGAAGAGGCTTCAACAGATAGATACCAACCTCAGAGGGATGGAATTGGCTTTGAAAAGTACCAACTCATTCCCAGTCAACATTGTTATTCTCAATGAAGACCTTAAACATGGCCTTAGTACACTAGAGGAACATGTTACCTTAACCACAAAACATGGGGCTTCCCTAACTGTTCCTGAATCAAGCACAAAAGCCACAACAAATTTCCTCCAATCATTTCATACCATGCCAACAACCCACCAAGATTTACCCACTTATTTCTTCTTATTTTGTGCCAAACTCCTTCACAACACATCCTTCACTACTACGTCTTGTGTTGTACACAAAGACAAAGCTCAAATTTCCCCAAACAGTAAAGGAAACTGCTCTAACTACTGGGCCATAATAATGGGAAACACAAACCTTGTTCCAGCAATTAAATTTTCAATCTCATTGGGCCTTGCAGTGTTCATGGGATTAACCTACAGCAAAGAGAATGGGTTCTGGGCCGGGCTTCCTGTTGCAGTTAGCTATGTTTCAGGAAGGGAGCCCACATTCAGAGCAGCAAATGTAAAGGCCCAAGGGACAGTGTTAGGAACTGTGTATGGAGTTTTGGGCTGTTTTGTCTTTGAGAAATTTTTGCCCATTAGATTTGTTTCTCTCCTTCCGTGGTTTGTTTTTGCAAGCATCCTTCAGAGAAGCCGAATGTATGGCCCAGCAGGTGGAATATCTGCGGTTATTGGGGCTGTTCTAATCCTTGGTAGGAAAAACTTTGGCCCACCAAGCGAATTTGCCATTGCAAGAATCATTGAAACTTTTATTGGGCTTTTATGTTCTATTTTTGTGGACCTAATATTCATGCCCAAAAGGGCTTCTACTTTAGCCAAAGTTGGGCTCTCTCAAAGTTTGGTCACAATTGGTGAGTCCATTGGGTCATTAGGCCTAATTGGAGTTGCAGGCAAAACTGATTTGGAAGATAACATAAGAAAGTTTAGAATGCAAGTTAATGAGCTAAGGAAGTTTGTGGTGGAAGCAGAGATTGAGCCTAATTTCTGGTTCTTAAAATTTCATAAAGAGTGTTATAATAAGCTTTTGGGATCATTGTCAAATTTGGTGGATCTCTTGCACTTTGGAGATCATGCATTGAAGTTTATCCAACAAGAATTTCATATGGAGGATGAGATATATGATGAGAAAGAGGATGTGAACATGCTACAAGATGAACTTGGACACATTAAGGAGTTGATTTGCTCTTCAATCCAACATTTGGAGGAAATATCTAGAATGAAATCTCTTAAGATTCTTGAGGAGGAGATTGAGAGAAAGAGAATCTCTAGTGATCTTGAACATGGAAAGTCAACCAAGTGTGATGCATGGATGCTTTCTATTTTGGGCAAGGAAGGAATAGAGAATAAGATAGACTCTTTTCTTCAAAGGTCAACAAGTGTTGTTGAGAGCTTGTATGATGGTGAAAATGAGAAAGAGTTGAAGAGCCAAATTGTGCTGAGTTTGAGTGCTTTGGGTTTTTGCTTGAAGACTATTATGCAAGAGGTGATGCAAATTGAAGAGTGCATGAAAGAACTTGTTCAGTGGAACAATCCCAATAGCGAGATTAATTTGTATGAGATATCATGTAAATTATATGCTTTGTACAAATGA >RCO.g.29876.000012 ATGCCAAACCTAACTAATCCTCCGGCCGATCACACCCGAGCCGCCTGGCGGTGGTGTCTAGCCACCGCCTTCAGAACAGGGCTGGCATGTACAATAGTGGGTTGTCTCACGCTCTACGGACCATCATTTCTCCACCAACAAATAGCCTTCCCAGCATTTTCTTATGTGACTGTGATACTTATAGTTACTGATGCAACTTTCGGTGACACACTTCACGGTTGCTGGTTAGCACTCTATGCCACGTTTCAGAGTTTGGGTCCTGCTATGTTGAGCCTGTGGTTGATTGGTCCAGCCCGGTTCACTAGTGGCACTATATCTTTGGCAGTTGCTTTAGGTGCTTTTGTTGTTGCACTTCCTGAAGGGACTCATTTGATAGCTAAAAGAATTGCATTAGGTCAAATTGTTATCGTGTACGTGATTGCTTTTATCAATGGCGTTCATACTCAACCAATCATGCATCCTTTGCATGTTGCGGCTAGTACTGCCGTTGGAGTTTTAGCTTGTATGCTTGCCTTGTTGTTACCATATCCAAGATTGGCCTGTTGGGAGGTGAAAGAGAATTGCAAGCTGCTTGCTGAAAATGCTTCCAAGAGACTGAAGCTTTATGTGAAAGCATTTGCTGCAGAAGATGGTGCCTTGGCATTATCGTCTATCTCTCAGGCTAAATTATTGGCTAGTGCTGGAACCAAACTTCTTCAAAATATTAAACGCTATCAAGGAAGCATGAAATGGGAAAGACTTCCATTCAAATTTTTGAGGCATTATTACATGAATCCTGGAGAGAAATTGCAAGAACTGGAGATACCATTGAAAGGAATGGAAATGGCTTTAACTGGCATCTCTTCATTTCCGGTGAAAATGGCGGAAGGAGAGACCAAAGAAAGCCTACAATTAGAGGAACATGTTAGCCTGACCCTGAAACAAATAAAGAACTGTTTGCCTTGTGATTCTCTGACTGTTCCGGAATCAAAAGCTGAAACGATAATCGAGTCCCTCCAAACTCTTCAAATAATCCCAAAGGCCACCCAAGATTTATCCTCTCTTTTCTTCTTATTCTGCATGAAACTCCTCCATTGCAAACCATTACCAAAACAAACCTCTTCAAAACAAGAAAGTGAAGGATCAACCACTTCAAGCAAGAAAAACAGTTTCTTGGACAGTATCTGGACCAATTGGGCAATGAATGTAAGAAGCAAAAGGCTTATGCCAGCTTTCAAATGTTCTCTTTCTTTAGGCCTTGCAATCCTTTTCGGTTTGTTATACAGCAAAGAAAATGGTTTCTGGTCAGGACTTCCAGTAGCCATTAGTCTAGCTGCATCAAGAGAGGCAACATTCAAAGTAGCCAATGTTAAAGCTCAGGGGACAGTGTTAGGAACTGTATATGGAGTATTGGGTTGTTTTGTCTTTGAAAGATTCATGCCAATAAGGTTCCTATCTCTTCTTCCTTGGTTCATTCTTACCAGTTTTCTAAGGCGGAGCAGAATGTACGGCCAAGCTGGTGGAATTTCTGCTGCTATTGGTGCCGTACTAATTTTGGGCAGGAAAGGTTTTGGTCCTCCAAGTGAATTTGCTATAGCAAGAATTACTGAAACTTTCATTGGGTTATCATGTTCAATTATGGTGGAACTTATACTTCAACCAACAAGAGCAGCATCACTGGCCAAAGTTCAACTTACTAAGAGCTTAGGGTCATTATCTGCTTGCATTGGCTCAATAAGCCTTGAAGCCAATTTGTTAGTAGAGAACCAAAGGAGACTAAAATTGGAAGTTAGTGAGCTAAAGAAATTCATTGGAGAAGCTGAGGTGGAGCCCAACTTCTGGTTTTTGCCTTTCCATAGTGCTTGCTATGGTAAGCTTTTTGGGTCTTTGTCAAAGATGGTGGATCTTCTACTTTTTAGTGCTCATGCTGTTGGATTCCTTCAACAAGAATCACAAAAATATGGGGCTTCTTGGAAAGAATTTGTTAATAAACTAGATGGTGACCTTGAGCTTTTCAAAGAAATGGTTGGTTCCCTAATTAAATGTTTAGAGGATGTCACTTTACTCAAGTCCCTAACATTTCTTGACAAGGAACTTGAAAATAGAAAACTCTCTTATGATCCTGAGTTAGGAAACAAACCAAACTCGAACATTTTTAGGATTTCGGGTCCAAATGAAGAGGATGAGATAGGGAGCATCATGCATTCTTATCTTCAACATTCAAAAGAAGTTGTAGATAAGTTGCATGCAGTTGAAGACAAGGAGCAGAAAAGCCAAATGGTCTTAAATTTAGGTGCTCTTGGCTTTTGTATGAACAATTTCATAAAAGAGGCAAGAGAGCTTCAGAAGGGAATTCAGGAACTTGTTCAATGGGAAAATCCAGGAAAAGATGTAAATTTGTTGGAAATCTCATGTAAGATTGCCGCCTTGTACAGTTGA >RCO.g.30025.000019 ATGTGGACAGCAGCAAGGGGCCTAACCAAGGGACTGTGGTCTGCGCACCTGAGTACAGCCTTAAGGACAACAGTTGCATGCACCATCGTGGGATGCACCACCCTTTACGGCCCTGCGCCACTCAAGCACTTGCTATCATATCCTGCCTTTTCTTATGCGACAGCCATCTTAATTATATCGGATGCTACGCTTGGACACACTCTTAGAGGAGCTTGCCATGCTCTCTATGCTACTATTCAAGTAATGGTCCCTTCTATTCTGACCTTGTGGGTGATTGGACCGGCCAGGTTGAACAGTGGCCTCGCTGCAGTGGCAGTGGCAGTCACTGCCTTTATGGTGGCGTTGCTGGAGCCAATACCTTTGATGGCCAAAAGAATTGCATTTGGGCAGATGGTGATTGTGTATGTAGGAGCAGTTATTCATGGTGCGGAAACGGGAATAGTGATGCACCCACTTCATGTGGGTTCCTGTACAGCTCTGGGGGCTTTAGCTTCTGTTTTGGCTATGCTGGTTCCATTCCCTTGCCTAGCCTACTCCGAGGTAATTATTCACTAA >RCO.g.30025.000020 ATGATGAAACTTAGCAGCGAAAGATGGAATTTCGCGTTGAAGTGTTCACTTTCTCTGGGTTTTGCTGTGCTATTTGGTTTAATATTCAACAAAGAAAATGGATACTGGTCAGGACTAACAATTGCCACCAGTTTTATAAAAGGAAGACAAGCTACATTTACAGCTGCAAACGCCCGCGCACAAGCAACAGCTCTGGGATCAGTCTATGGAGTCCTGTGTTCCTTCATTTTCCAGAGATTTGTGGACTACAGGTTTTTACTTCTTTTCCCTTGGATCATTTTCTCTAACTTTCTAAAGCATAGCAGAATGTATGGCCAAGCTGGTGGAATTTCAGCTGTCATAGGGGCTTTATTAATACTGGGCCGGAAAAATTATGGCTCTCCAAGTGAGTTTGCAATTGCCAGAATCGTTGAGACTTTTATTGGATTAATCTGCTCTGTTACGGTAGAAATTCTATTCCAACCAGCAAGAGCAGCAACTCTGGCAGAAACCCAATTTATTTGGAGTTTGAGAGCACTCCAAAGTTGCATCGAGGATATTGTTCTTTTAGCAGGCCAAAAGAGCATGTCTGAATCAGTTCCTCTAGGTTTAAGAGAAAAGCAGAAGACGCTGAAGTCCCACATTGATCAAATGGGTAAATTCATTGGTGATGCCACACTGGAGCCCAATTTTTGGTTCTTGCCTTTTCAAGAAGCCATTTACGAAAAATTCCTTAGATCTTTAAGAAAGATGCAGGACCTGATACTATTTGCAGCCTATGCTGTAGAAATTCTTTCAGGAATATCAGAGAAGTTAGGACTAGATTGGGAGGAGCTAGAAGAATACATTGATATTGATCTAGATCATTTTCAGGAAAAAGTTAAATCTTCTCTAATATGCCTTGAAGAGGTGCTTTGTGTGAAGTCTATTGCAGTTTTTGAAAATAAATGGCAGAAGAGTCCTGATATTGAATCCGGAAAATCAGACATTAAGGGTCTAGACGTGGAATCAGTTCTGGAAATTGTGAGTTCTTTTATGGAAAACTCAAAGGAAGTAGTTAGCATGGCTAATGCCTCCAAGGGTGAGCAGAGGTTAAAAAATCAGATGATAATTTACTTAAGTGGTTTAGGGTTCTGCATCAGCAATTTGATGAGAGAAACAATAGAGATTGGGAAAGGAGTAAAAGAACTAATCGCAATGGAGAGTCCAGCAATGCAAATTAATTTGAATGAAATTCTATGTAAATTTAAGGATTTTCCATGCTAA >RCO.g.30025.000021 ATGTCAGCAACTACAGCAAAGGATCCAACCAAGGGACTGTGGCTTGTGCATCTGGGTTCAGCCTTAAGGACTACAGTTGCCTGCACCATTGTGGGAGGGACCACCCTTTATGGCCCTGCACCACTCAAGCACTTGCTATCTTACCCGGCTTTTTCTTACATGACAACGATCCTGATAGTATCTGATGCTACACTTGGTGAAACTCTTAGAGGCACTCTCTATGCTCTCTACGCTACCATTCAAGTAATGATCCTTTCTATTCTGCCCTTGTGGGCCATTGGACCAGCCAGGTTCAACAGTGGCGTCGGGGCAGTGGCAGTGGCGGTAACTGCCTTTGTTGTGGCATTGCCGGAGTCGACACCCTTGATGACCAAAAGAATTGCATTTGGGCAGATCGTGATCGTGTATGTAGGAGCTGTTATTCATGGTGCAGAAACTGGAATAGTGATGCACCCACTTCATGTGGCTTCATGTACAGCCTTGGGGGCTTTTGCTTCTGTTTTGGCTATGCTGGTTCCATTTCCTCACCTAGCATATAATGAGGTGAGGAAAGCATGCAGATTATATGTTGAGAATGCTTCAGAGAGATTGAATCTCTTTATGGATGCTTTCACTGCACAAGACAACCGGGCCGCAACTGACTCGATTTCTCAAGCAAAGTTCTTAACTAAAATAGGAATGAGACATATTCAGAGGATTAAAGAGGTTCAAGGAGGTATGACCTGGGAGAAGCCACAGATATTATTCTTGAAGCATAACTGCATGGAATTAGGACAGGTATTGCAAGACCTGGAAATTATGATACGGGGAATGAAAATTGCTGTGACTTCATGCCCTGCCTTTCCTGTTAGCATGATTAATGAGGAGCTCAGACAAGTATTAATAAGCATGAAAGGCAAAATACGCCTAAAGCTAGAGCAAGCAAAGTGTTTTGTGCCTTTTGATGCTACAACAGCTCCAGAGACAATAGAAGAAGAAGTTTCAGACAAACTCTTGTGGACTCTCGAAACTAGTGCCACAACCCAAGAGGAACTTCCAGCTTTCTTCTTCTTCTACTGTCTGGAACTTATCCGAGGGGAATCACCTGTCAGTCCATGTCTAGAGGGCAGTGGAAGGAACACAAAGGAAATAGAAGGTGAAGAAACTAATGATGTGAAAAATCAAGCAAATGGTAGCCTCAGAAGGATTTGGAATGGGTTGATGATGATTAGACTTGGTAGTGAAAGATGGAATTTTGCCGTCAAGTGCTCACTTTCTTTGGGTTTTGCTGTGCTATTTGGTCTGATATTCAACAAACAAAATGGGTATTGGTCAGGACTAACCATTGCCATCAGTTTTGTAACAGGAAGACAGGCTACTTTTGTAGTTGCAAATTCTCGTGCACAAGCCACAGCTATGGGATCAGTTTATGGAATTCTAGGTTCCTTCATTTTCCAAAGATTTGAGGACCTCAGGGTCATACTTCTTCTCCCTTGGATCATTTTCACCAGTTTTCTAAGGCACAGCAGAATGTATGGCCAAGCTGGTGGAACTTCAGCTGTCATAGGGGCTCTATTAATCTTGGGTAGGAAAAATTATAGCAATCCAAACGAGTTTGCAATTGCAAGAATTACAGAGGCTTGTATCGGATTGATTTGTTTTGTAGTGGTAGAGATTCTATTCCAACCAGCACGAGCAGCAACTCTGGCAAAAACCCAACTTGCTTGGAGTTTAAGGGCACTCCAAGGCTGTATTGAGGATATTGTTCATTTTACACGCAGAAAGAGCATGTCCTTGTCAGTTCCTCCAGATTTAAGAGGAAAGCAGAAGGTGCTGAAATCCCACATCAATCAAATGGAGAAATTCATTGCTGAAGCCACACTGGAGCCTAATTTTTGGTTCTTGCCTTTTCAAGAAGCCAGTTATGAAAAATTCCTGAGATCTTTAAGAAAGATACAGGACCTGATACTATTTGCAGTCTATGATGTAGAAATTCTCTCAAGAATATCAGAGAAGTTAGGACTAAAATGGGAGGAGCTAGAAGAACACATTAATATTGATCTAGATCATTTTCAAGAAAAAGTTTACTCTTCACTAAGATGCCTTGAAGAGGTACTTTGTATCAAGTCCCTTGCAGATCTTGAAAATAAGTGGCAGAAGAGAAGCACCGATCATGACGTTGAATCCGGGAAATTCCAAAATAAGGGTCTAGATGAGGAAGCAATTTTGGAGATCGTGAGTTCCTTTATCAAAAACTCGAAGGAAGTAGTTGGCAAAGTTAATGCCTCCAAGGGTGAGCAGAAGTTCAAAAATCAGATGAAAATTTGCTTAAGTGGTTTAGGGTTCTGCATCAGTAATTTGATGGGCGAAATAATAGAGATTGAGAAAGAAGTAAAAGAACTAATCATAATGGAGAATCCTACAATGCAAATTAATTTAAACGAAATTTTATTTAAAATTAAGAATTTGCATACAAAATAG >RCO.g.31792.000001 GGCGGTATGTTGTGGGAGAAGCCGCAGATCAGATTCTTGAAGCCTAAATCTATGGAGCCAGTAGAGATATTGGAAGAAGTGGAAATATTGATAAAAGGAATGGAAATGGCTTTGACTTCTTGCCCTGTGTTTCCTGTTAGCTTGATGACTGACGAGCTTAGAGAAATATCAATGGGCATGAAAGGTAAAATACGCCTAAAGCTAGAGCAAGCAAAGTGTGTTGTGCTTTTTGATGCTGCAACAGCTCCTGAGTCGATGGAGGACTTTCAGACAAACTCCTGTGGACTCTCAAAACTGGTGCCACGACACAAGAGGACTGCCAGCTTTCTTCTTGTTGTACTGTCTGGAACTTCTGCAAGGGATGCACCAATCAGTCGATGTCTAGAGTGCAGT >Ciclev10011084m.g ATGGCAGCAATAACAAGAGCAGATAGTACTACAAAGGCGTTATGGCGTCGGCGCCTTGGCTCGGCATTACGGACTGCTCTAGCATGCAGCATAGTAGGCTTCACTACCCTGTATAGCCCGGAACATCTCCGGCACATGCCTGCGTTTCCGGCCTTTTCTTATATGACAACAATCTTGATTCTGTCAGATGCAACACTTGGTGACACACTTAGAGGCTGCTGGCATGCCCTCTATGCCACCATACAAATTATGATCCCCTCAATACTATGCTTGTGGTCAGTGGGACCAGACAGGTTCACCGCCGACGTAGCCGCGGTAGTTGTGACGCTTATGTCTTTTGTGGTGGCGCTGCCAGAGTCCACGCCGTTGATGGCTAAGCGGATTGCATTCGGACAGATTGTGATTGTGTGCGTTGGGACAGTTGTACATGGTGCAAAAACTGGAATTGTCATGCACCCAATTCATGTTGCATCAAGTACTGCACTTGGTGCTTTGGCATCTGTTGTGGCCATGCTGCTTCCATACCCTCGGCTAGCTTACCATGAGGTTAAAAAATCAAGCAAATTATACGCAGAAAATGCTTCGGAGATGTTGAATCACTTTGTCAAGGCCTTCTGTGCCCAAGACAACGCAGCAGCACTTGACTCAATTTCAGAAGCAAAATCCCTCTTTAAAGCAGGGACCAAGCAGCTGCTCAGTATCAAAGACAAACAGGAGGGCATGCTGTGGGAGAGACCTCAAATCAGATTCTTAAAACCTAACTACAAGGACCCCAGAGAGAAATTGCAAGAACTTGAGATCCCAATTAGAGGCATGGAACTGGCCTTAACTTCTTGCCCTTCCTTCCCTGTTGGCATGATTGATGAAGATTTAAGAGATGTTTTACAGAGCTTGAAAGCAGAGATAGGTCTAAAACTAGAACAAGCAAAGTGCTATGCTTCTTTCGATGCGACCACAGCTCCAGAGACAGAGAAAAATTGCAAAGACGAATCCCTATGGTCACTCAAAGCCATTTCCTCGACAGAAGATGTGCCAGCTTCATTCTTCTTTTACTGCATAAAGCTGCTCCAAGATGGCTTACCCGTTGCTCCAAATGCTGAGTTCGTTGTAAATGAAACAAGGGAAACTCACACTGAAGGATCAAGTGATTCCCAAAACCAAAATAAATTCAAGTGTAAACTCAAATGGATCAGCAGCAGTCTGTTCCTGTTACCAAGTCTTGAAAGCTTGGTTTTTGCTCTTAAATGCTCGCTTTCTCTTGGTCTTGCTGTGATCCTTGGTTTGATGTATAATAAAGAGAATGGATATTGGTCAGGATTGACGATTGCCATCAGTTTTGCAACAAATCGACAAGCAACATTCAAAGTCGCAAATGCTCGTGCTCAAGGAACAGCCATGGGATCAGTCTATGGGGTCATATGTAGCTTTTTGCTCCAAAAGTCGGTGAATTTCAGGTTCTTGCCTCTGCTCCCCTGGATTATCTTCTCCAGCTTCTTGAGGCACAGCCGAATGTATGAAGAAGCTGGTGCAATTTCAGCAGTTATAGGAGCATTATTGATCTTGGGTAGAAAAAACTACGGCACTCCAAGTGAGTTCGCAATTGCACGAATCACAGAGGCTTCCCTCGGACTAATCTGTTTCATCATTGTAGAAATTCTCTTCCAGCCTGCAAGAGCGGCAACTTTGGCAAAAGCTCAACTTGCACAGAGTTTGCAGGCACTTCAAGATGGCATTAAGGATATAGTTCTTTTTGCCGACCAAAAGGGCAAGCCGACTCCTACAGCCTTGAGAGATAAACAGAAGAGACTGAAATCCCACATCAATGAATTAGATAAGTTCATTGCAGAAGCTGAGATGGAACCTAATTTCTGGTTTTTGCCTTTTCACGGCAGTTGCTATGAAAAAATATTGGCATCTTTATCAAGGATGGCAGATCTCTTACTCTTTGTGGCCTACAAAACTGAATTTCTTTCACAATTATCAGAGAGATTTGGAGTTTCCTGGAAACAGATACAAGAGCCGATAAATGATGATCTCGAGCTTTTCAAGGAAAAAGTTGGCTATTCACTGAAATGCTTTGAAGAGGTGATTTTGATCAAGTCGCTTGCGGTACTTGCACCAGAGAGGCAAAACAGAAACATATCTCACGACGTTGAGTCCGGAAGATTACCAAATGAAGATGTGCCTAGGACTCTAAGTCCAGATGAAGAAGAAATTGAGGAAATTTTGAGCTCCTTCCTTCAACATTCGAAGGAAGTTGCTAATAGTATCAACGGTTATGATGGCGAGGAAAAGCATTTAAGCCAAACGGTTCTTGTGTTGAACGGCCTAGGGTTCTGCATTAGTAGTCTGATGAAGGAAACGACAAAGATTGAGAAAGAGATAAAAGAACTAATAAAATGGGAGAATCCCACAAGGAATATTAATTTGTACGAAATTTCCTGTAAGCTGAATGCTACGTACCCAAAATGA >Ciclev10030119m.g ATGCCATCCAATAATAAATATTCCAATCGAGCAAGAGCCATATGGCTCTCGTGCCTCGCCTCCGGGTACCGGACTGCCCTCGCATGCACGATAGTCGGCTTGATCACCCTTTACGGACCTGCTTCTCTGCTGCAACAAGTAGCGTTCCCAGCATTCTCCTACGTGACAGTAATCCTCATCGTCACAGACGCAACGTTAGGAGACACGTTGCATGGCTGCTGGATGGCGCTCTACGCCACTGTCCAAACCGTGGGGCCGGCCATTTTGAGCCTGAAGCTGATCGGTCCGGCCCGGTTCACTAGTACCACCACCGCTCTTGCAGTGGCCCTTGCTGCTTACGTGGTGGCGCTGCCTGAGGGAACTCACATGAAAGCAAAGCGTATAGCATTGGGACAGATTGTCATAACATATGTTATAGGTTTTGTTAATGGCGAACGCACTGAAGCTGTTATGCATCCTCTGCATGTGGCTGCAAGCACTGCGGTTGGAGTCTTTGCTTGTGTTCTTGCCTTGTTGTTGCCCTATCCAAGGCTTGCTTGTCGCCAGGTGAAAAAGAACTGTAAGCTACTTTCTGAAAATTCTTCCGAGAGGCTGAAGCTCTATGTGAAGGCGTTCTGTGCAGAAGACAACACATCAGCGCTTGCATCCATTTCTCAAGCCAAGTTATTGACCATTGGAGGAACCAAATTTATCCAGAACATCAAGCGCTACCAAGAAAGCATGAAGTGGGAGAGGCTTCCATTGAAATTCTTGAGATCCTATTACATGAACCCAGGAGAGAAATTGCAAGATCTAGAGATACCTTTAAAAGGGATGCAAATGGCTGTAACAAGTGTCACTTCATTTCCTGTACAGATTCTTGATGGAGAGCTAAAAGAATGTGTAAAGAAACTAGATGAGCATATTTCTCTGACCATAAAACAAGCTCAAAGCTGTGATTCATTGACTGTTCCGGAATCAAATGCTGAAGATATAATGAAGTTCCTTCAAACACTTCAAAATATCCCAACAACCACCCAAGAGCTATCCTCTTATTTCTTCTTGTTTTGCATGAAGCTCCTTCAATGGAAATCATCACCGAACCAAAGTACAAATTGTCTAAAAGATGATACTGTTAAGGAATATGAAGGATCAAGCAATGGATTCTCTTTCAAAGAGGTTTGGAGCAATTGGTCCATGAAGGTTAAAAGCAAGAGGCTCGTGCCGGCATTTAAATGCTCACTTTCACTGGGCCTAGCTGTGCTATTTGGGTTGCTTTATAGTAAGCCCAATGGGATTTGGTCAGGACTCCCCGTAGCCATAAGTTTTGCAGCGGCAAGGGAGGCAACATTCAAAGTTGCTAATATTAAAGCACAAGGGACAGTTTTAGGTACCGTGTATGGAGTACTTGGTTGCTTTCTCTTTGAAAGATTCTTGCCCATAAGGTTCCTGTCTCTTATTCCTTGGTTCATTTTCACCGCTTTCTTAAGGCGTAGCCGCATGTATGGCCAAGCTGGAGGAATTTCTGCTGTCATTGGAGCAGTATTGATACTGGGGAGAAAAAATTTTGGCCCCCCAAGTGAATTTGCCATTGCAAGAATTGTTGAAACCTTCATTGGATTATCTTGTTCGATCATGATAGACCTTCTGTTTCAACCCACCAGAGCCTCAACTCTGGCTAAAGTTCAACTCTCGAAAAGCCTCGCCACGTTGCACGATTGCATTGGTTCAATGAGTCTCCAATCAAGCCAAGCCAGCTTGCTTGAGAACCAAAAGAGACTGAAAATGCAAGTCACTGAGCTAGCGAAATTCATTGGTGAAGCAGAGGTGGAACCCAACTTTTGGTTCTTTCCTTTTCATATTGCTTGCTATAGTAAGCTCTTGGGGACTTTGACAAAGATGGTGGATTTGTTGCTTTTTGCTGCTCACTCAGTGGGCTTCCTTGAGCAAGATTCACAAAGAATTGCTACTTCTTGGAAAAATGAAGTTCATGAGCTGGACAGTGACCTTGAACTTCTCAAGGAAAAAGTAGGCCCCTCTATCAAATTCTTTGAAGATGTGACAACGATAAAATCACTAGCGACAATTGAAAAGGAGCTTGAAAAGAACAACATATCTTATGATCTTGAATTGGGAAAATCAAAAAATCCTAATGGGATTTCTGATTTAGATGAAGCTGCGATGGGAAAACTTATATGTTCATATCTACAACATGCAAAAGAACTTGTTGACAAAATCAAGGCTACTGAAGGTGAGAAGGAGCTCAGGAGCCAAGTTGTTTTAAGTTTAAGTGCCCTAGGGTATTGCATACAAGGCCTGATAAGAGAAACTAAACTGATTGAAGAGGGAATCAAGGAACTGGTTCAGTGGGAGAATCCTTCAAGCAACGTAAATTTGCTCGAAATCTCATGTAAAATAAACGCTTTGTACAACTAG >Bv7_174260_epza ATGAATAATACAACCATGTTCAACAGCGTGCAATGGATTCGAACCCGCGATTTTTGGAAATCGAGCCTAATAGCAGCTTCAAGAACAGCATTAGCTTGTGTTATAGTAGGATGCATTACTCTATATGGTCCAAACTCAGTAAAAAAACAAGTTACATTCCCTGCATTTTCTTATGTAGCTATGATACTTATTGTCACCAATGCCACCTTAGGCGACACCATTCGAGGCCTTTGGCTAGCGTTTTACGCGACGCTACAAACTGTTTGTCCGGCCATCTTGTGCCTTTGGATGATGGGCGGACCTACTAGCCTCTCCGTTGTATCGACATCCGTTGTGTTGGCTATTGCTGCTTTCTTTATTGCCTTTCCTCAATCCACTCATGCTGTGGCTAAGAGAATTGCTTTAGGCCAACTTGTGATTATTTATGTTATTGGTTATATCAATGCTCATCAACTTGATGCTGTCATGCATCCTATGCGTGTTGCTGCTAGTACTGCTGTTGGTGCTTTCGCTTGTTTTTTGGCCTTGTTGCTTCCATATCCTCACCTTGCTTCATCTCAGGTGAAAGAAAACAGCAAATTATTTGCAGAGAACGCGTCAGAGAGGCTAAAGTTGTTTGTGAAAGCATTTTGTGCTGAAGATATTACAACTTCACAAGCATTGATCTCTCAAGCCAAAAGCTTAGCTGGTAAAGCTAGGAAATATCTTCAATGTATCAAATCCAAACAAGAAAGCATGCATTGGGAGAGGTTTTTCATTCAGTATCTTAGAAACTATTGTAAGAATCCAGGGGATCGATTTCAAGAACTTGAGACACCATTAAGAGGGATGGAAATCGCGCTAATGAACGCGCGAGTTCCTGTTTCAATACTTGATCAACGGGTGAAAGATGGGATGGACATAACACAAGGAGAAATCAGCCAAAATCTATATCAACTTAGGAGTCATATGCCTTGTGAAACACTAACTTTCCCTGAATCAGGTGAAGGACAAGTTATGAACTTCCTTCAAAAACTTGAAACACTTCCATCAAATGAGTCAAATTTACCCTCTTATTTCTTCTTCTTTTGTATGAAACTATTACACTCTCAATCTAGAGCCATGACTATTCCTCAAAATTCACCAAAACTTGACCAAAAAACCTTAAAAAAACAACCATATGACAAGACTATAGAACACCAAAATGGGTTTTCTTTTAAATTGGTTTGGGCTAACTGGCCCACTTCACTCTTCAAGGAAAGACTTATCATTGCACTTAGATGCTCGCTATCGTTGGGCTTTGCCGTGTTATTTGGGCTTTATTATAGTAAGCCCAATGGGTTCTGGTCAGGCCTACCTGTAGCTGTGAGTTTTGCAGCAGCTAGAGAGGCTACTTTTAAGGTTGCCAATGTTAAGTTCCAAGGAACAGTTATTGGCAATGTATATGGAGTTTTAGGCTGTTTTATTTTCGAAAGATTTGTACAAATAAGGTTCATAGCACTTATACCTTGGTTCATTTTCACCAGTTTTCTTCAACAGAGCAAAATGTATGGGCAAGCAGGGGCAGTTTCTGCAGTTATTGGTGCAATTCTGATATTAGGCCGAAGAAATTTTGGTCCACCATCTGATTTTGCCATAGCAAGAATTGTGGAAACTTTCATTGGTTTATCTTGCTCAATTGTTATTGATCTATTGTTACATCCTACTAGAGGTGCAACACTAGGGAAAGTTCAACTAGCCAAAACACTCGGCGCGCTTCATGGCTCATTCATCTCCATTGATCTCTTTACAATGTCGAAAAACGAGCTACTTGTGAGCGCAAAAAACATCAAAGTTCAAGTCAAGGAGCTAGAAAAATATGTTGGTGAAGCTGAGGCAGAACCAAATTTTTGGTACTTGCCTTTTAATACTCCTTGTTACAAGAAGTTGATGGGTTCATTCTCAAATATGGGTGATCTCTTGCTTTTTGTGGCTAATGCTATTGGATTCCTAGAAGAGCAAATCCAAAGACTTGATGTGATTGGAATCAAGGATGAATTGGATAAGATTAATGGTGATGTTAAACATGTAGGAAAAATTATAGCCACTTTAATGAAATCCTTTCAAGAGACTACTTCTGTTAAGTCATTGTTAGTACTTGAAAAGGACTTCACTAAAAGTGGCAAAACATTTGATCTTGAGTTGGGAAAATCGACGAATTTCGCCTTGATGATTGTGGAAGATAAAGATGTGGAGAAGATCATAAGCTTGTACCTAGAGCATTTGAAGGATGTATTTGATAAAATTCAGTTTCCAGAGGATGAGGAAGAGATGAAGAGTCAGATTGTTATGAGTTTTAGTGCAATTGGATTTTGCTTAAGTTGTTTGATGAGGGAAACAAAAGAGATTGAGAAAGGAATCAAGGAACTTGTTCAGTGGGAAAATCCCACAAGTCATGTAAATCTTCATGAAATATCATGTAAAATTCATGCATTATACGATTAA >MDO.mRNA.g.1899.3 ATGGCTCCAGAGTTGAACAGAGAAACCTTCGACAAGCCTCTTTGGGCCGAAAAACCTACCACAAAAAACCGTGAGGACCTTCTGGCTTTCTTCTTCTTGTATTGCAAGGAACTCCTACTAGAAAACCAACCCATTACCCGAAATCCCAGAAATACTGGGAAACCTAACCAAGAACTGAGCGATTCACAAATCAACAACGGTGGAGCTTTAAAAAGGTTGGGAGAAACATAA >MDO.mRNA.g.1899.10 ATGTGCCAAAAATATGCCAAGAATGCTAGGAAAAGGTTCGACTTGTATTTAGATGCAATCTTGTCTCGGGACAGCTCTGCTGCACTTGACTTTATTTTACAGGCCAAGCCCTTGGCTGAAGCAGGAGAAAAGCTCCTTCGAAGGATCGAACATAAACAGGAAGCCTTACTGTGGGAGAGACCAACAATCAGAAGTATCCTCAACCGTAGTCGCTTCTCTGTTCGAGAAAAATTGCAGGAAGTTGAAATACCCTTGAGAGGGATTGCAATAGCTGCAACTTCATGCCCTTCCTTTCCTGTTGCCATGATTAAGAAACTGCAAATGGACGCTTTACACGACATGAAAAGGCAAATACATGACAAGCTTGAGCAACTCGAGCGCTTTGCACCTTTCTACACAAGAAACAAAAGGGAAAGATCTTTGGATGAGGCCTTCTGGTCCCTTGAAACCATATTTCCTGAAGATTTATTGGTTTTTTTTTTCATTGATTGTCTGAAAATTCTCCAAGAAAATACCGAGGCTGTTGAAGAATGCAAGCATGAGTGCTCCCGCATCGAAAGCTCAAGAGAGATTCTCACATCCCCTGCAAGAGCAGCAACTCTGGCAAAACTCAAACTTTTACTTGGACTGGGATCCCTTCAAGAATGCATCAAAGATTTAGTTCTTTTCGAAAACCAAATCACTTTAGTTGGTCCCAAGTTGAGACAGAAACAGTACAAGTTGAAATCTCATGTCAACAAGTTAGAGAAGTTCATTGAAGAAGCTCAGCTGGAGCCTAATTTCTGGTTCATCCCTTTCAATGGTGCCTGTTATGGCAAGCTCCTGAGATCTTTATCTAACACGGGGAATCTTTCGATTATCATGTCCAACATAATAGAATCTCTATCACTCGTATTACAGCGCTTCAAACCTGATTCGGAAGAACTCCAAAAGCCCATGAAGGGCATCCATTGA >MDO.mRNA.g.2876.16 ATGAAGTGGGAGAGAGTTCCGCTGAAGTTATTTTCGAGACGCGGCTATGTAAACCCAGGAGATAGATTGCAGGGCTTAGAGATACCCTTTAGAGGAATGGAAATGGCATTAACCTGTATTCCTTCATTTCCAGTTAAGGTGGTGAATGGAGAACTCAGTAAAGATGCTCTACTTAGACTAGTAGAGCATAACATGAGCCTAAACTTAAGCACGCCTTTTTGTTCAATAACTGTTCCTGAATCAAAAGCAGAAAATAATGGAGGAGCAACTAATTCGTCCAAACAAAATGGATTGTATTTCAAGATATGGAGTAACTTGTCCACCAAGGAGTGCATCAACTCGGTGAGTCTTCAATCAGGAAGAGCCAATTTGGAAGATAATCAAAAGAGACTGAAAATGCATACTGAAGAACTTGGGCAGTTGATTGGAGAAGCTGAGGGGGAGCCCAATTTCTGGTTTTTGCCTTTTCATAGTGCTTGCTATGGAAAACTCTTGAGGTCTTTCTCCAGAATGATGGACTTGCTAGTTTTAAGTGCTCATGCAGTTGGAATTCTTGAAGAAAATTCACAAACACTTGAGGCTTCATGGAAGGAAATTGTACATACATTGGAATGTGATCTTGAACATTTCAAGAAAATGGTTGGAAGTTTGATGACATGCTTCGAGGAGATCACCTTGATAAAATCAATCGCAGTTCTTGATCAAAAGAGTAACATATCTCCTGACCACGAGTTGGGAAAATCTCGAACACCGAATATTTTTAGGGCTTGTAGTTCAGAGATGGATAAGATTATGAGTTCTTATCTCCAACACTCGGAGGAAGTCGTTGATAAAATTGATGCTAAAAGTGAGGAGCTCAAGAGCCAAATGGTTTTGTGTTTAAGTGGTTTAGGATTCTGCATAAGTAGTTTAATAAGAGAAACAAGAGATTGA >MDO.mRNA.g.3474.1 ATGGTGTGGGAGAGACCGCTTATCAAATTTCAGAAACCAAATTATCTGGACTCAGAAGTAGAGGTTAGCCTAAGGCTTCTGCAAGCTAAGTACTCTTTGCCTTCCGATGCAACATTGGCTCCGGAGTCATACAGAGAAATCTTCGACAAGCCACTTTGGGCCGGAAAACCCACCACCAATAACCGT >MDO.mRNA.g.3474.3 ATGTCAGAAAGTGATTACCACGACAGTGAATTGGGCAAACCACCGAGGGGGATTTGCGACTTTGGTTGTACTGATGATAAAGAGGTTGAGACTATTGTGAGTAGCTTTCTTCAGCATTTGCAAGAAGTGGTTGACAAGGTAATACTAGTGACAGTGAAAGAGAAACAAGAGCCAAATGGTTCTTTGTTTGACTAG >MDO.mRNA.g.4254.1 ATGCAAACAATAATTCATCAAGACAAGCATTTTTCCAAGGGAAGCAGAGTTGTGCCACGGGAAAGTATGAAGTGGGAGAGAGTTCCGCTAAAGTTATTTTCGAGACATGGCTATGTAAACCCAGGAGATAGATTGCAGGGCTTAGAGATACCCTTTAGAGGGATGGAAATGGCATTGACCTGCATTCCTTCATTTCCAGTTATGGTGGTGAATGGAGAACTCAATAAAGATGCTCTACTTAGACTAGTAGAGCAGCACATGAGCCTAAACTTGAGCCCACCTTGTGATTCAATAACTGTTCCTGAATCAAAAGCAGAAAATGAAAATTATCATCCAGAGGTAGTATTGTACCTGAAAAATTATTGGTTCACCAAAATGAAGGAGCAATTAACTCTTCCAAACAAAATGGATTGTATTTCACGATATGGAGTAACTTGTCCACCAAGGACTCTTGGGACATTGCAGGAGTGCATCAACTCGGTGAGTCTTCAATCAGGAAGAGTCAATTTGGAAGAGAATCAAAAGAGACTGAAAATGCATATTGAAGAACTTGGGAAGTTGATTGGAGAAGCTGAGGCGGAGCCCAATTTCTGGTTTTTGCCTTTTCATAGTGCTTGCTATGGAAAACTCTTGGGGTCTTTCTCCAAAATGATGGACCTCCTAGTTTTAAGTGCTCATGCTGTGGATTTCTTGAACAAAACTTCCAAAGATTTGAGGCTTCATGGAAGGACATTGGCATGCAGTGGATGGTGA >MDO.mRNA.g.4254.2 ATGGTTGACTCTTTGATAACATTTTTCAAGGAGGTCACGTCGATAAAATTAATCTCAGTTCTTGATCAAAAGAGTGATATAGCTCATGATCTTGAGTTGGGAAAATCTCGAGCCCCGAATATGTTTGGGGTTTGCAGTTCAGAGGATGAAGAGACAGATAAGATTATAAGTTCTTATCTCCAACACTCAAAGGAAGTTGTAGAGAAAATTGATGCTAAAAGTGAGGAGCTCAAGAGCCAAATGGTTTTGTGTTTAAGTGGTTTAGGGTTCTGCATGAGTAGTTTAATAAGAGAAACCAGGGAGATTGAAGAGGGAATCAAGGAACTTGTTCAATCCCTCAAGCCACATTAG >MDO.mRNA.g.4254.3 ATGCATGTTGCGGAATTGGGGAAGTTGATTGGAGAAGCTGAGGCGGAACCCAATTTCTGGTTTTTGCCTTTTCATAGTGCTTGCTATGGAAAGCTGTTGAGGTCCTTGTCCATAATGATGGACTTGCTAGTTTTAAGTGCTCATGCAGTTGGAGTTGTTGAAGATAATTCACAAACACTTGAGGCTTCGTGGAAGGAAATTGTAAATGCATTAGAATGTGATCTTGAACATTTCAAGGAAATGGTTGGAAGATTGATAACATGCTTCATGGAGATCACCTTGATAAAATCAATCCCAGTTCTTGATCAAAAGAAGGATGAAGAGATGGATGGGATTATGAGTTCTTATCTCCAACATTCGAAGGAAGTTGTTGATAAAATTGATGCTAAAAGTGAGGAGCTCAAGAGCCAAATGGTTTTGTGTTTAAGTGGTTTAGGGTTCTGCATAAATAGTTTAATAAGAGAAATAAGAGAGATTGAAGAGAGAATCGAGGATCTTGTTCAACGGGAGAATCCCTCATGCCACATTAATTTGTACGAAATCTCTTGTAAGTTGCATGATTTGCAGAAGTAA >MDO.mRNA.g.4378.4 ATGCAATCTTGTCTCAAGACAGCTCTGCTGCACTTGACTTTATTTTACAGGCCAAGCCCTTGGCTGAAGCAGGAGAAAAGCTCCTCCGAAGTATTGAACATAAACAGGAAGCCTTACTGTGGGAAAGAACAATCAGAATGTCTCAACCCTAGTCGCTTCTATGTTCGAGAAAAAATTGCAGGAAAGTTGAAAATACCCTTGAGAGGGATTGCAATAGCTTCAACTTCATGCCCTTCCTTTCCTGTTGCCATGATGAAGAACTGCAAGCGGACTCTTTACACGACCTGA >MDO.mRNA.g.4949.5 ATGAAGGGGATCGAGAAAGATTTGGAGATTTTCAAGAAAAAAATTGGGAATTCTCTGCAATGCCTCCAAGAGCTGGCTTCCAATAAGTCTCTTGCAGTCCTTGGCAAACATGACATTGAGTCGGGAACATTATCAGCAAGAGAAATGGTTCTAGGGTTTCGGATTCAGACAAGGAAGAGACTGAATGCCTTGTAG >MDO.mRNA.g.4949.6 ATGTGCCAAAAATATGCCGAGAATGCTAGGAAAAGGTTCGACTTGTACTTAGATGCAATCTTGTCTCAAGACAGCTCTGCTGCACTTGACTTTATTTTACAGGCCAAGCCCTTGGCTGAAGTAGGAGAAAAGCTCCTTCGAAGAAGCCTTACTGTGGAGAGACCAAACATCAGAAATATCCTCAACCGTAGTCGCTTCTCTGTTCGAGAAAAATTGCAGGAAGTTGAAATACCCTTGAGAGGGATTGCAATAGCTGCAACTTCATGCCCTTCCTTTCCTGTTGCCATGATTAAGAAACTGCAAGCGGACGCTTTACTCGACCTGAAAAAGCGAATACATGACAAGCTTGAGCAACTTGAGCACTTTGCACCGTTCTACACAAGAAAGAAAAAGGAAAGATCTTTGGATGAGGCCTTCTGGTCCCTTGAAACCATTTCTCATGAGGATTTATTGGCCTTCTTTTTCATTGATTGTCTGAAAATTCTCCAAGAAAATACCGAGGCTGTTGAAGAATGCAAGCATGAGTGCTCTGGCATCGAAAGCTCAAGCGAGATTCTCACATCCCCTGTAAGAGCAGCAACTCTGGCAAAACTCAAACTTTCACTTGGACTGGGATCCCTTCAAGAATGTATCAAAGATTTAGTTCTTTTCGACAACAAAATCGCTTCAGTGGGTCCAAAGTTGAGACAGAAACAGAACAAGTTGAAATCCCACGTCAAAGTTAGAGAAGTTCATTGA >MDO.mRNA.g.5330.3 ATGAAGGCCTTTGAGAAAGATTTGGAGATTTTCAAGAAAAAGTTGGGAAATCTCTGCACTGTCTTCAAGAACTGGCTTCCAAGAAGTCTGTTGCTGTTCATAACAAACATGACATTGAGTTCGGAACATCAGCAAGGGAAAAATGATTCTAGGGGCTTGGATTCAGAGGAGGAAGAGACTGAAAGCATTGTAGACTCTTTTCTTCAAAATTCCATTGAATTATCCGAAAAAATTGCCGCCAGGACTGGATTAATAAAGGATCATCAGAAGCTTAGAGGGCAAGTAACTGTTTGTTTGGGTGGATTAGGGTTTTGCATCAGCAGTCTGCTGAGGGGAGTAAAGGAGATGGAGAAAGAGTTTCAAGAACTTATCAAATTGGAACACCCTTCAAGCCATGTAATTGTATGA >MDO.mRNA.g.5330.4 ATGAACCTAAAGGGAATGCCTGTAACATTTCAGGTGAGACAACTGTGCCAAAAATATGCCGAGAACGCTAGGAAGAGGCCAAGCCCTTGGCTGAAGCAGGAGAAAGCTCTCCGAAGTATTGAACATAAACAGGAAGCCTTACTGTGGGAAAGACCAACAATCAGGAATATCCTCAACCCTAGTCGCTTCTATGTTCGAGAAAAATTGCAGGAAGTTGAAATACCCTTGAGAGGGATTGCAATAGCTTCAACTTCATGCCCTTCCTTTCCTGTTGCCATGATGAAGAAACTGCAAGCGGACTCTTTACACGACCTGAAAAGGCAAATACATGACCAGCTTGAGCAACTCGAGCGCTTTGCACCTTTCTACAAAGAAAGAAAAAGGAAGATCTTTGAAAGAGGCCTTCTGGCCCCTTGA >MDO.mRNA.g.5373.3 ATGAAGTGGGAGAGAGTTCCGCTAAATTATGGTGTGAATGGAGAACTCAATAAAGATGCTCTACTTAGACTAGTAGAGCAGCACATGAGCCTAAACTTGAGCCCACCTTGTGATTCAATAACTGTTCCTGAATCAAAAGCAGAAAATGTTAGTTTCCTCCAGACACTTCAAACCATCCCAAATATCCACCAAGATCTACCCCCAATTTTCTTTTTGTTTTGTATCAATCTCCTCCAAGGAAAATTATCATCCAGAGGTAGTATTGTACCTGAAAAATTATTGGTTCACCAAAATGAAGGAGCAATTAACTCTTCCAAACAAAATGGATTGTATTTCACGATATGGAGTAACTTGTCCACCAAGGAGTGCATCAACTCGGTGAGTCTTCAATCAGGAAGAGTCAATTTGGAAGAGAATCAAAAGAGACTGAAAATGCATATTGAAGAACTTGGGAAGTTGATTGGAGAAGCTGAGGCGGAGCCCAATTTCTGGTTTTTGCCTTTTCATAGTGCTTGCTATGGAAAACTCTTGGGGTCTTTCTCCAAAATGATGGACCTCCTAGTTTTAAGTGCTCATGCTGTGGAATTTCTTGAACAAAACTTCCAAAGATTTGAGGCTTCATGGAAGGACATTGGCCATGCAGTGGATGGTGATCTTGAAAGTTTCAAGAAAATGGCTGACTCTTTGATAACATTTTTCAAGGAGGTCACGTCGATAAAATTAATCTCAGTTCTTGATCAAAAGAGTGATATAGCGCATGATCTTGAGTTGGGAAAATCTCGAGCCCCGAATATGTTTGGGGTTTGCAGTTCAGAGGATGAAGAGACAGATAAGATTATAAGCTCTTATCTCCAACACTCAAAGGAAGTTGTAGAGAAAATTGATGCTAAAAGTGAGGAGCTCAAGAGCCAAATGGTTTTGAGTTTAAGTGGTTTAGGGTTCTGCATGAGTAGTTTAATAAGAGAAACCAGGGAGATTGAAGTGGGAATCAAGGAACTTGTTCAATGGGAGAATCCCTCAAGCCACATTAGTTTGTATGAAATCTCTTGTAAGTTGTATGATTTAAAGAAATAA >MDO.mRNA.g.887.2 ATGCTTTCGCAGGTCTGTAATCGGCGGCTGTATGCCGGAAATGCATCCCAGAGGTTAACTCGCTTCATCGAGGCCATCGCTTCCCGGGACAAGAGCGGAGCACTCGAACTCCTTTCTCAAGGACAATCTCTCTCTAAAGAAGCTGCTAAGCTTCTTCATAACATCACTAATAATCTGGAAACCATGGTGGGAGAGACCACATATATCAAATTTCTGAAACCAAAATACATGGACTTGGGTGAAAGGTTGCAAGAAACGGAGGTTCCACTGAGGGGGATGGAGATAGCTTTATCTAGTTGCTCTTCACATCCTGTTAACCTGATTGATGAAGAGCTAAGAGGCAATTTACAAAGTTCAGAAGCACATGTTAGACTAAGGCTTCTGCAAGCTAAGTACTCTTTGCCTTCCGATGCAACATTAGCTCCAGAGTCGGACAGAGAAATCTTCGACAAGCCCCTTTGGACCAAAAAACCCACCACCAAAAACCATGAGGACCTTCCGGCTTTCTTCTTCTTGTACTGCATGGAACTCCTACTAGAAAATCAGCCCATTGCCCGAAATCCCAGAAACACTAGGAAACCTAACCAAGAACCGAGCGATTCACAAAATCAACATCTGTGGAACTTCAAAAGGAGCGGCGACCCTAGCAAAAAACAAGCTCTCACAAAGCATGGGGTGCTTCGAGATTCCATCGAAGGAGTAAATTTGTGTGCACCGGCTTCTACCGGATTGAGGGATAAGCAGAGGAAGCTAAAATCCCATGTCAAGGAACTAGAAAAGTTCATCCAAGAAGCTGAAACAGAGCCTAATTGCTGGTTCTTGCCCTTCAAGGGTTCCGGTTACAATCAGAACTTTGGAGGTGTTTGGGAGGAACTACGGCAACAAATGAATGCAGATCTAGGGCTACTAAAGGAAAAAATAAACTCTCCATTAAGATGCCTTGAGGAGGCCACTTCGATCAAGCCCTGCAGGTATCCGAGACAAAGTCGGAAAGTGATTACCATGATAGCGAATTGGCAACCCACCAAGGGGATTTGCAACTTTGGTACTGATGATGAAAGAGGTGGAGACTATTGTGAGTAA >Bo4g068130 ATGCAAATGACTGAGAGAGGCCGAGCCATGTGGCACACGTCCCTAGCCTCGGCATTCCGCACAGCTCTAGCTTGCACAATCGTTGGTGCGGCTACACTCTACGGACCCGAGTGGATCCTCCGTTTTGTGGCATTCCCGGCGTTTTCTTACGTCATGGTCATTCTCATCATTACGGACGCCACGCTAGGCGACACACTACGTGGCTGCTGGCTAGCCCTTTACGCCACATGTCAGAGCGTTGCACCGGCTATCATTACACTAAGGCTTATAGGACTAGCTCGGCTCACGGCCGGAACTACTGCTTTAGCCGCGGCTTTAGCAGCGTTCTTGGTGGTGCTACCAAATAATTTGACACATTTGGTGGCTAAGCGGATCGCTCTTGGCCAGATTGTTCTTATTTATGTTATTGGTTATATAAATGGAGCTGAGACTGAGCCAGTCATGCACCCACTTAGAGTCGCAGCTAGCACCGCGCTTGGTGTTATAGCATGCGTTCTTGCACTTCTTGTTCCATTTCCTCGCTTGGCTACTTGCGAGGTGAAACAAAGCTCCAAAGAGATTGGTCAAAATGTAACGACGCGAGTGAAGTTATACATGAAAGCTTTTTGCGCCGAGGATGCAACCTCCGCAATGGCTTCTGTCTCACAAGCTCGAGAATTGTCTCGTATGTCCTCCAAGCTTTATCAAACCATCAAACGCTACCAACCAAGCATGAGATGGGAGAGGCTTCCATTTAAGATATGGAGATGGCAAAATGTGAACGATAACAAAGGAGAGAAACTGCAAAGCATGGAGATCGCTCTGAGAGGAATGGAAATGGTATTAGCAAGCAAATCTCCTATACCTTCGAGTTTACTTGCGGGAGAAGTCAAAGATGGTATCAAGAACATGCAAGAACGTGTGATTCTCTCAATCAAACGAGTAAACAACATCCCCCAACCGTCGGTGACTCCAGAAACCGATCTAGAGAAGCCCGATGAATGCCTCCAAACACTTCAAGAAATCCCGGAAACATCTCAAGAATTGCCCTTTTACTTCTTCTTGTTCTGCCTCAGGCTCCTCGAAACCATCTCAACGGCTAAACCGGAGGAGAACAAGGGCTCAGTCAAATCCAAGAGTAGGTCTTGGGTCAGTGATTGGGACAGCAAGAAGGTTATGCCGGCGATAAAGTTATCGCTTTCGTTAGGTTTAGCGATTTTTCTAGGGTCACTGTATAGTAAGCCCAACGGGTATTGGGCTGGTTTACCGGTAGCGATCAGCTTTGCGGCAGCAAGAGAGGCGACGTTTAAAGTGGCGAACGTGAAGGCACAAGGGACAGTGATAGGGACCGTGTACGGAGTGATGGGCTGTTTTGTGTTTCAGAGGTTTTTGACGGTTAGGTTTCTTTCTTTGCTTCCGTGGTTTATCTTTTCCACCTTCTTGAGCAAGAGCCGTATGTACGGACAAGCCGGAGGAATCTCCGCGGCGATAGGAGCCGTTTTGATTCTTGGGAGGAAAAATTTTGGAGAGCCAAGCGACTTTGCGATCGACAGAATCGTCGAGACTTTTATCGGGTTGTCTTGTTCGATCATGGTGGAGCTTGTCTTGCAGCCCACGCGAGCCGCTAATGTGGCGAAACTCGAGCTGTCTAGAAGCTTTCATGCTTTGTACGAGTGTGCAAGCTTGTTTGGAGCTAAACCGAGTAAAGCTGAGATCGTGGAGAGTCAAAAGAAGCTGAGAAGTCATTTGACTGCGCTCAAGAAGTGTACAGAAGAGGCACAAGCGGAGCCGAGTTTCTGGTTTTCGCCTTTTAACGCTTCTCGCTACGAAAAGCTCTTCAAATCATTGTGTAGAATGGCTGATCTATTGCAGTTCAGCAGTCACGCGATAGGGTTTCTTGAGGAACAAGGAAAAGGAAATTCACCACAGTGCAAGGAGATTCTTAGAGACGTAGACCAAGATCTCAAGAGTCTAACACAAAGCATAGGTCTTTTAGCCAAATCTTTTGAGGAAATTACTCTTCTCAAATCACTTGACGCATTCGAAAAGGCGCTTGTAAAGAACGATAACAGCTCATGGGACATTGAGTTGGGGAAGACACCAAACCCTAGTTTCTCAAGCCCCGAGAGCGAGCCAGAAAAGATTCTAAATACGTATCTCCAGCATTGCAGAGGAGTTGCGGATGGTATGTTCCGTGCGGAAGAAGAAAGAGAAGAGGTTAAAGTGGATAAGAGTCAGGTTGTGTTGAGTTTGAGTGCATTAGGGTTTTGTGTGGAGAAAATGGGGCAAGAGGCAATAGAAATTGAGGAGATGGTTAAAGAGGTTGTACAGTCGGAGAATCCTTCGAGCCACGTTAACTTGCATGAGATCTCTTGCAAAATACGTTCTCTGTACAAATAA >Bo4g166770 ATGCAAATGACTGAGAGAGGCCGAGCCATGTGGCGCACGTGTCTAGCCTCAGCGTTCCGTACAGCTCTAGCTTGCACAATCGTTGGAGCGGCTACACTCTACGGACCTGAATGGATCCTCCGCTACGTGGCATTCCCGGCGTTTTCTTACGTCACGATCATTCTCATCATCACCGATGCTACGCTCGGCGACACGCTACGTGGCTGCTGGCTAGCTCTTTACGCCACATGTCAGAGCGTTGCCCCCGCTATCATTACACTAAAGCTTATTGGACCAGCTCGGCTCACGGCGGGAACTACTGCTCTAGCCGCCGCTCTAGCAGCGTTTGTTGTGGTGCTACCAAATGGTTCGACCCATTTGGTGGCTAAGCGGATCGCACTTGGCCAGATTGTTCTTATTTATGTTATTGGTTATATAAATGGAGCTGAGACTGATCCAGTCATGCACCCTCTTCGAGTTGCAGCTAGCACCGCGCTTGGTGTTATTGCTTGCGTTCTTGCACTTCTCGTTCCACTTCCTCGTTTAGCTACTAGCGAGGTGAAACAAAGCTGCAAAGGGATTGGTCAAAATGTAACAACGCGAGTGAAGTTGTACATGAAAGCTTTTTGTGCCGAGGATGCCATGACAGCAATGGCTTCTGTGTCACAGGCTCGAGAGCTGTCTCGTATTTCCTCCAAGCTTTATCAAACCATCAAACGCTACCAACCAAGCATGAAATGGGAGAGGCTTCCATTTAAGATATGGAGATGGCAAAACGTGAACGATAACAAAGGAGAGAAACTACAAAGCATGGAGATTGCTCTTAGAGGAATGGACATGGTACTAGCAAGCAAGTCTCCTATTCCTGCGAGATTGCTTGCGGGAGAAGTAAAAGACGATCTCAAGAACGTACAAGAACGTGTGATCCTCTCTATCAAACGAGTAAACAACATCCCCCAACCGTCAGTAACTCCAGAAACCGATCTACAAAAGCCCGATGAGTGCCTTCAAACACTTCAGGAAGTCCCGGAAACACCTCAAGATTTACCCTTCTACTTCTTCTTGTTCTGTCTCAGGCTCCTCGAAACCATCTCAACGGCTAAACCGGAGGAGACCAAAGTAAAACCGGAGGAGAACAACAAGGGCTCAGTCAAAACCAAGAGTAGGTCTTGGTTTAGTGATTGGGACAGCAAGAAGGTTATGCCGGCTACGAAGCTATCACTTTCGCTAGGTTTAGCGATTTTTCTAGGGTCATTGTATAGTAAACCAAACGGTTATTGGGCTGGTTTACCGGTAGCGATCAGCTTCGCGGCAGCAAGAGAGGCGACTTTTAAAGTGGCGAACGTGAAGGCACAAGGGACAGTGATAGGGACAGTGTATGGAGTGATGGGCTGTTTTGTGTTTCAGAGGTTCTTGACGGTTAGGTTCCTTTCTTTACTTCCGTGGTTTATCTTCTCTAGCTTCTTGAGCAAGAGCCGGATGTACGGACAAGCCGGAGGGATATCGGCGGCGATCGGAGCCGTTTTGATTCTAGGAAGGAAGAATTTCGGACAGCCAAGGGACTTTGCTATCGACAGAATCATCGAGACTTTTATAGGGTTAGCTTGTTCCATCATGGTGGAGCTGATCTTGCAGCCCACGCGAGCCGCTAACGTCGCGAAACTTGAGCTCTCTCGAAGCTTCCACGCTTTGTACGGATGTGCAAGCTTGTTTGGAGCTAAAGCAAGCAAAGGAGAGATAATGGAGAGCCAAAAGAAGCTGAGAAACCATCTAAACTTGCTCAAGAAGTTTACGGAAGAAGCACAAGCAGAGCCGAGCTTCTGGTTTACGCCTTTTAACGCTTCTTGCTACGAGAAGCTGTTCAAATCGTTGTCTAAATTGGCTGATCTATTGCAATTCAGCGGTTACGCGATAGGGTTTCTTGACGAGCAAGGAAGGTGGAAATCACCGCAGTGCAAGGAGATTCTTAGCGACATAGACAACGATCTCAAGAGTCTAACGCAAAGTATAAGTCTTCTAGCAAAATCTTTCGAGGAAATCACTCTTCTCAAATCACTAGACGCCCTTGAAAAGGCGCTCACCAAGAACGGCAACACTTCGTGGGACATTGAGCTGGGGAAGACACCAAACCCTAGTTTCTCATGTCCCGAGAGCGAGCCAGGGAAGATTCTAAATACGTATCTCCAGCACTGCAGAGGAGTCTCGGATGGTATATTCCGTGCTGATGATGAAGAAGGAGAAGAGGTTAAAGTGGACAAAAGTGAGGTTGTGTTGAGTTTGAGTGCATTAGGGTTTTGTGTGGAGAAAATGGGGAAAGAAACAAGAGAGATTGAGGAGATGGTGAAAGAGGTTGTGCAATCAGAGAATCCTTCAAGCCACGTAAACTTGCATGAGATCTTTTGCAAAATACGTTCTTTATACAAATAA >Bo5g139260 ATGCGTGATACAACATGTCTCGAGCGACTCAGCCTGGCTTTGAGAACCGCCTTGGCTTGTCTCATCGTGAGCTTGACCACTTTGTACGGTCCCAAACCACTAAAAAACTGGGCTACGTTTCCAGCCTTCTCTTATCTAACCACAATCTTAATCTGGCTATCCGACGCAGAACCAACATACGGTGAAGTTCTCAAATGCTGCGTTGACGTATCTTACGCCACTTTTCAGACAGCAGCCATTGTGCTTGTGAGTGTCTTGGTGGTTGGACCAGCCTCCCTAGGAATTAGCTTCGTGGCTCCAGTTGCTGTGGCTGTAGCTTCATTCATCGTGGCTTTCCCAGCGTCCACGAGTCTTTTAACCAAACGAATTGCCTTTGGGCAGATCGTTCTTGTCTATGTAACCTTTGCTGTGTTCAATGGAGAGGTTGCTCATGTTTTCATGCTCCCCGTTCACGTGGCGGCTAGTACAGCACTTGGAGCCATTGCTTCTCTACTCGCCGTGTTTCTCCCGTTTCCAAGACTGGCTCATAGTCAGATGACCAAGGGTTGTAAATTATACGCTGAAAATGCTCTTGAGAGGTTGAATTTGTTCGTCGAGGTCATGATGGCTCGAGACAACACCACAGCTCAGGTGTTGATTGCAAAGGCCGCTTCATTGTCTTCAGCAGCTAGACACACACTCAAGGGCATCAAAATCCACCATGAGCGTCTTGCATGGGAGAGACCAGATACAAGATTCTTGAAAAAGAAGCAAAAGCACCAAGGGGAGAAACTAAAAGCCACAGAGTTTCTGATGAGAGGGATGGAGATAGCGTTGGGATCTTGCAGTTCTTTTCCTCTAGGCATGAGCCGCGATGAAGTGACAAATCTTCTAGAAGCTCCCAGAACACATATCGCTCATGAGCCAGCATCTACTCTCAAGCCAGAGGACAGGCTGACATGGCTTCCTGAAGCTGGTTCTCTATCTACAACATCTTTACCAGTTTACTTCTTCAGATACTGTGTGGAGCTCTTCAGAGGTGACGTCTCATCTGTGAGACAAGACAGTAAACGTGTAGATGGGTCGTTCACGTCCAAAAGCTTTTTGGATGCTCTCTCTGTCTGGATGGCTAGAGAGAGGTTTGTATTTGCATTCAAATGCTCGATCTCTCTAGGCCTTGCGGTGCTGTTTGGTATACTCTACAACAAAAAAAACGGGTACTGGTCGGGTCTAACCGTAGCCATCAGTCTTGTATCCGGAAGGCAAGCGACGCTAACAGTAGCGAACTCTCGCTTACAAGGAACAGCCATGGGATCAGTCTACGGTCTGTTGTGCTGCGTTGTTTTCCAAAGACTAGAAGAGTTCAGGTTCTTGCCTCTCCTCCCTTGGATAGCCGCCACCGTCTTCATGAGACACAGCAAAGTCTATGGCCAGCCTGGAGGAGTTACATCCGCCATTGCGGCGTTGTTGATACTTGGAAGGAGAAACTACGGAGCTCCCACTGATTTTGCTATTACTAGAATTGTTGAAGCTTCGATAGGGCTGCTTTGTTTTGTCCTTGGGGAGGTTCTTGTCACTCCTGCGAGAGCGTCAACTCTCGCAAGAGCTGAACTTAAACACTGCCGCGACGCGGTCTTAGACTGTATTGGATCGTTGGTTCTTTGCTCTGAGCAAAAGAACATGCCGTTGTCGGATTTGAGAAGCAAGCAGGCGAAACTCAACTCTCACGTTGAAGCATTGGAGAGGCTAACGTCAGAAGCCTTGACAGAGCCTAATGTTCCGTTCCTCAAACCTCTCAACGCGGTTAGTTACAAGAAGGTTTTGGTTTCTCTCTCGAAGGTATCTGATCTCTGTCTCTATGTTTGTGATGGTCTCACAAACCTATCTGGAGCGCATCCTTGGGACCAAGCCATCACACATGATCTTAAAGCCTTTCAAGAAAAGCTTCACTCTTCAGTGAAATGCTTAGAAGAGATGGCATCGACCAAGACTCGAGCAAGACTACAAAAAGAGCTGCAGAAGAGAAAGATATGCCATGATGTTGAAGCAGGAACAGCATCAAACGACAACTATTCAAACATGGAGTTGGGTCCAAGCCAAGATGATGCAGAGAGGTTTTCAGTTTCATTTGTAAAGCTACTGAAGGAAGCAACAGAGAAGACGAGTGGTAGCACAACAGCTGAAGAGGTGGTGAAGAATGAAACTACTCTGTGTCTGAGCAGTCTAGGTTTTTGCATCAGCAGATTGATGCAAGAAACAGTATGTATTATGACAGAAATAACTCATACAACTTGA >Cpa.g.sc190.8 ATGGCAACAGCATCTGCGACCCGAGCCCGAGCCATTTGGCGCAAGTGTTTAGCCTCGGCCTTCCGCACCGCCCTGGCCTGCACCATCGTCGGCGTCACCACCTTATACGGACCCTCCAGCCTGACACGTTACGCCACCTTCCCGGCCTTCTCCTACGTCAGCACCATCCTCCTCGTCCCCGACAGCGCCACCCTTGGCGACACGCTGCATGGCTTCTGGCTGGCGCTATACGCGACGTGTCAGAGCGTGGGGCCGGCACTACTGAGCCTGTGGCTGATCGGGCCGACCCACCTGACCAATGGCACCACCGCGCTAGCTGTGGCAGCCGCAGGGTTCGTGGTGACGGTGCCTGAGTCGACTCACTTGAAAGCAAAGCGTATTGCGCTGGGTCAGATTGTGTTGATATACGTGGTGGCTTTTATCAAAGGGGAGAAGGCTGAGGCTGTTTTGAATCCTGTGCATGTGGCGGCGAGTACGGCGATTGGTGTAGCGGCTTCTCTTTTGGCTTTGCTTCTGCCATTTCCAAGGCTCGCTTGTTCAGAGGTGAAGGAGAGCTGTAAGCTGCTTGCCGAAAACACGTCAGCTAGGTTAAAGCTCTATATCAGAGCGTTCTGTGCAGAAGACAACGCATCAGCTGTTTCATCAATCTCTCAAGCTACGTTATTAGCTTCTTCCGCAACCAAACTCCATCAAACCATAAAACGTTACCAAGAAAGCATTAAATGGGAGAGGCCTCCATTTAAATTTCTGAGACCGTATTACTCGAACTTATCTGGGGAGAAGCTGCAAGACGTGGAGAGAAGCTTAAGAGCAATGGAAATGGCTTTAACCAGTACTAATTCTTCACTTCCTGTAAGAACCCTAGTCAACGGAGATATCAAAGAAGGTCTAAAGAAATTGGAAGAACACTTTGACTCCACCATGAAAATAGCTAAGGGCTATCTGTCTTCCGATTCATCAACCGTTCCCGAAGCATACGTTGCAGAAAACTCTTCCTTGGGGTCCTTCCAAACACTTCAGACCATCCCATCAACTCATCAAGACTTATCATCTTTCTTCTTCGTTTTCTCCATTAAACTCCTGCAATCCAAACTGTTTCCGAAACCCAGTTCGTGTTCTTCTCCAGACTGGCAAGATGATTTGGCAAAGAATAAAACAGATGCAAGAACTAAAATGTTTATGCCAGCTTTTAAATTATCTTTGTCCTTGGGTCTGGCAACTCTTTTTGGCCTGATCTACAGTAAAGAAAATGGCTATTGGTCAGGTTTGCCGGTGGCTATCAGCCTCGCTGCCGGACGAGAAGCCACCTTTAAAATAGCAAATGTGAAAGCTCAAGGGACGGTGCTTGGATCAGTTTATGGCGTATTGGGTTGCTTTGTGTTCGAAAGGTATTTGCCTGTAAGGTTCCTTTCTCTTCTTCCCTGGTTTATTTTCACCAGCTTCTTAAGCCGGAGCGTGATGTACGGCCAAGCTGGAGGCATCTCCTCCGCGATTGGCGCACTTTTGATACTGGGAAGGAAGAATTTCGGTCCTCCAAGTGAATTCGCCATTGCAAGAATCACTGAAACTTTCATTGGATTATCTTGTTCAATCTTCGTCGACCTTCTTTTTCAACCCACCAGAGCTTCTACGTTGGCAAAAGCTCAGCTCCCGAAAATTTTTGGAGTCTTGCACCGGTGTATCAATTCAGTGAACTTTGATACTAAAGTTGGTAAAAAAATCAGCTTAACTTCTTGCCAAAATAAGCTGAAAGCCCGAGTTGGTGAGCTGGAGAAGTTCGTAGCCGAAGCTGAGGTGGAGCCCAACTTCTGGTTTTTGCCTTTTCATAGTGCTTGCTATCGTAAGCTTCTGCGATCTCTGTCAGCAATGGCAGATCTTTTGCTTTTTGGGAATCTTGCCATTGGATTCCTCAAACAAGAATCAGAAAAATACAGTTCTGAATTGAAAGAGACTCTACAAAATAAGCTTGATGGCGACCTTAAGCTTTTCAAGGACCTAGTCGTCTCCCTGTTAAAGGACTTCGAACATATCACTTCGATAAAATCGCTCGCAGCTCTTGAAAAATCACTTGAGAAGAACAACGTGTCTTGGGATCTTGAGATGGGATCTTCGAAATCGGGTTTTTTTAAAGCTTCTGGTTCAGATCATAACGAAGAAGAAGATGAAGTTGACAAGATTTTGAGTCCCTTTTTGAGGGACGCCGCTGAAGTTGTGGAGAAAATCCATGGAGTGAAAGGTGACGAGGAAGATGACGACGAAGAAGAAGAAGAAGAAAGAGAAGTGATAATCCAAATGGTTGTGGGGTTGACTGCATTAGGGTTTTGCATGAAGGGGATTGTGAGAGAAGCGAGAGAGATTGAAGAAGGAATAAAAGAACTAGTGCAGTGGGAGAATCCTACGTATCATGTTAATTTGCATGAGGTTTCATGCAAAATACAAGCCTTATACAAATAA >LOC_Os05g41300 ATGCGGTCGGAGGCGGTGCTGCTGCATCCGGCAAACGTGGTGGCGTGCACGGCGCTCGGGGTTGTGGCGGCGCTGCTGGGCGTGCTGCTCCCCTGCCCGAGGCTGGCCACGCGCGACGCCACGGACAAGAGGCTCGCCTACTTGGAGGTGGCGGCAGAGAGGGTCATGCTGCTGGCCCACGCCTTCCAGTTGCACTTCTCGAGCGGCGATGCAGCAGACGGCGGCGGCAGTGCGTGGCCGCGTGCATCATGTCGCAGGCCGACCGCGCAGCCTCCGCCGGCCGGCGCCGTCCTCCTCCGCCGCATAAGCTCCGCCCAACTGGCTCCTTTCCTCTTCCTCTTATGCTTGGATCTCCTCCTCCATGGATCTCATCCGGCGGCGCCCCAACGTCCACCTAAGCTGCTGCTCTCTGTTGTCTGCACACTCAGACGCTGCTGCCTGCCTGCCTCCCAAGTCAAGGAGGCCGGCGGGACGATACGGGAGAGGAGGAGGTCTGGCGGCCTCTCGTCGTGGCTGTCGCAGCGATTGTTGCTAAGGAGGAGTAGGCGGTTGCTGCCAAGGCAAGGCTGTGTCGGGCAGGACACGGTAGCATGGACAGGGGCGGCGGAGACCATCCGACAGGCGGTCAATGGGGAGAAGGGCAGCCGACTGCAATGGTGGACGGATGGATTTGTGGTGGGAGGAGCGGGCAAGCTCACCGGCCTCCCTGCTCACCGGCCTCCCCGCTCCCCTCGCTGGACCCGTCTCCTCCCTCTCCATCACTCGTCGTTGGCCTCCCTGCGCCCCTCATTGGCCCCACCTCCCCCCTCGACGGCAGCTTTCCTCGATTGCTGCTAA >LOC_Os11g01030 ATGCCACCGTCGTCGGCGGCCACCACCGGCGGCGCCGTCCATAAACCAATTATCATGCCGCCCGAGTCGGAGAGGCAGATCAATAATCTTCCAGACGTACTGCAGCCCCGCCGGCGGTGGCGGTCCTCGCTCGCCACGGGCTTCCGCTCGGCCCTGGCCTGCACCATCGTCGGCGTGGCCTCCATCTACGCTCCGCTCGTCATCCGCCGCCACCTCACCTTCCCGGCCTTCTCTTACGTAGTCACCGTCATCGTAGTCACCGACGCCACGCTGGGCAGCTCCCTGCGCGGCGCCCTCAGCGCGGTCCACGCCACGGCCATGGGCGCAGTTCCATCGGTGCTGCCACTCTGGCTGGCGCACCGCACCGGCGCCGGGGAGTCGGTGCTGGCGACGACGGCGGTGGTGGCGCTGAGCACGTTCGCGGTGGCGGTGGCGGGGTCGGCGGGGACGGTGGCGAAGCGGATCGCGCTGGGGCAGATCATCATCATATACGTGGCGAGGTTCAGGGAGGAGAGAATGCGGTCGGAGGCGGTGCTGCTGCATCCGGCAAACGTGGTGGCGTGCACGGCGCTCGGGGTGGTGGCGGCGCTGCTGGGCGTGCTGCTCCCCTGCCCGAGGCTGGCCACGCGCGACGCCACGGACAAGAGGCTCGCCTACTTGGAGGTGGCGGCGGAGAGGGTCAGGCTGCTGGCCGACGCCTTCCAGTTGCACTTCTCCAGCGACGAGGCTGCAGGTGATGATGAGGAGAGAGCATCATCTTGTCGTTGCCGCAGACGGCGGCGGCAGTGCGTGGCCGCGTGCATCATGTCGCAGGCCGACCGCGCAGCCTCCGCCGGCGCCCTCCTCCTCCGCCGCATAAGCTCCGCACAAGGTGACTTGCAGTGGGAGCGAATGCCGGCGCTGCTGAAACGGTGGTGCAGCAGCAGGTGGGATGACGACGACGAACAAGCTTGTGCGCGGCTGCACGAGTTGATCGAGATGCCTCTGCGAGGGATGGAGATGGCCTGCACCCACATGCTGCAGCAGCCATGTTGGCCTAACACTAACACTATCAGCAGCATCTGCACGACACCAACATGGCTGCAGCACGCTACCGACCATGTACGCCTGGCTTTGCTCACAAAACGCATTCCCAGCTGCAGCAACACAGGCACAGGCAGCATGGAGATGGCCAAACTAGCGCCGGTCTCTGTTGGTGCTCTGGAGCAGCAGCAGCAGCTGGCTCCTTTCCTCTTCTTCTTATGCTTGGATCTCCTCCTCCAAGGATCTCATCCGGCGCCCCAACGTCCACCTAAGCTGCTGCTGTCTGTGTCTGCACACTCAGACGCTGCTGCCTCCCAAGTGAAGGTGATCCCAGCAGCAACAACAAAAGACGACGATGAAGAGCAACCGGAGCAGACGAGGAAGAAGAAACACCAGTGCCCTCGGCAAACGACAAGAAGCACCATGAGGAGGAGGCTGGTGGCCGCGGCCAAGTGCAGCTTCTCGCTGGGCCTCGCCGTCCTGCTCGGCCTGCTCTTCAGCAGCGACCACGGCTTCTGGTCGGGGCTCGTCGTGGCCACCACCATGGCCACCGGCCGCGAGTGGACCTGGGCTCTCGCCATTGCGCGTGCTCACGGCACCGCTCTCGGATCCGTATATGGCGCGCTGGCCTGCCTTGTCATCGATCGCATGGAGCTGCGCTTCCTCGCCCTGCTCCCCTGGCTCATCCTCACTGCCGGCTTCCTCAAGCGCAGTCGTGCCTACGGCCCCGCTGGCGCTGGGGGTGTAGCAGCTGCGGTGTCTGGCATCATCATCGTTGGCCGCCGCTACGACGAGCCGCCCATGGCCTTCACCGTCGCACGCCTGGTGGAGACCTTCATAGGCCTCGCCTGCATCATCGTGGCCGACCTCGTCTTCCAGCCCGCCGCCAGGCCGTCCACCAAGGCCACGGCACAGCTCGACCGCTGCCTCGCCGCACTCAAAGGCTGCTTCAGTCGGGGACGACAGACGACGACCAAAGTGAAGGTGAAGGCGGTGCAGGAGCAGGTGGCCCTGCTGGAGAGATGCGTGGCAGAGGCTGCCGGCGAGCCCCATTTCCCGTGGTCGCCGCCGTTCCCGGCGAGCTGCTACCACAAGGTGGCGGGGAGCCTTGGCAGGATGGCGCAGCTGCTCTACCTCTACACACAGGCACATCCAACTCCAATACCAGCAGCAGACGAGGATGCAACGCAGCGCTTCCACTGCCTCGTCTCCGCATCCCTGGAGCGAAGCGCCGACCTCCTCCTCCGACTCAGTCGTATCAGCAGCAGCAGCAGCAGAGACGAGGAGGACCTGGAGGCCGGCATCCGGGTCAGCAGCGGCAGTGACACCTGTTGCTGTGACGACGAGGATGCACCAGAGATGCTGGTGCGGTCGTTCCTGTCACAGCAGCAGCAGCAGCAAGATCAAGGAGTAGCATTAGCATTGGCTTCCATTGGGTTCTGCATGGGAGAGATGGCCAAGGAGGCCCTCCAGCTGGAGGCCTACATGCTCGACCTCATACTCCTCGCTCATTAG >LOC_Os12g01020 ATGCCACCGTCGTCGGCGGCCACCACCGGCGGCGCCGTCCATAAACCAATTATCATGCCGCCCGAGTCGGAGAGGCAGATCAATAATCTTCCAGACGTACTGCAGCCCCGCCGGCGGTGGCGGTCCTCGCTCGCCACGGGCTTCCGCTCGGCCCTGGCCTGCACCATCGTCGGCGTGGCCTCCATCTACGCTCCGCTCGTCATCCGCCGCCACCTCACCTTCCCGGCCTTCTCTTACGTAGTCACCGTCATCGTAGTCACCGACGCCACGCTGGGCAGCTCCCTGCGCGGCGCCCTCAGCGCGGTCCACGCCACGGCCATGGGCGCAGTTCCATCGGTGCTGCCACTCTGGCTGGCGCACCGCACCGGCGCCGGGGAGTCGGTGCTGGCGACGACGGCGGTGGTGGCGCTGAGCACGTTCGCGGTGGCGGTGGCGGGGTCGGCGGGGACGGTGGCGAAGCGGATCGCGCTGGGGCAGATCATCATCATATACGTGGCGAGGTTCAGGGAGGAGAGAATGCGGTCGGAGGCGGTGCTGCTGCATCCGGCAAACGTGGTGGCGTGCACGGCGCTCGGGGTGGTGGCGGCGCTGCTGGGCGTGCTGCTCCCCTGCCCGAGGCTGGCCACGCGCGACGCCACGGACAAGAGGCTCGCCTACTTGGAGGTGGCGGCGGAGAGGGTCAGGCTGCTGGCCGACGCCTTCCAGTTGCACTTCTCCAGCGACGAGGCTGCAGGTGATGATGAGGAGAGAGCATCATCTTGTCGTTGCCGCAGACGGCGGCGGCAGTGCGTGGCCGCGTGCATCATGTCGCAGGCCGACCGCGCAGCCTCCGCCGGCGCCCTCCTCCTCCGCCGCATAAGCTCCGCACAAGGTGACTTGCAGTGGGAGCGAATGCCGGCGCTGCTGAAACGGTGGTGCAGCAGCAGGTGGGATGACGACGACGAACAAGCTTGTGCGCGGCTGCACGAGTTGATCGAGATGCCTCTGCGAGGGATGGAGATGGCCTGCACCCACATGCTGCAGCAGCCATGTTGGCCTAACACTAACACTATCAGCAGCATCTGCACGACACCAACATGGCTGCAGCACGCTACCGACCATGTACGCCTGGCTTTGCTCACAAAACGCATTCCCAGCTGCAGCAACACAGGCACAGGCAGCATGGAGATGGCCAAACTAGCGCCGGTCTCTGTTGGTGCTCTGGAGCAGCAGCAGCAGCTGGCTCCTTTCCTCTTCTTCTTATGCTTGGATCTCCTCCTCCAAGGATCTCATCCGGCGCCCCAACGTCCACCTAAGCTGCTGCTGTCTGTGTCTGCACACTCAGACGCTGCTGCCTCCCAAGTGAAGGTGATCCCAGCAGCAACAACAAAAGACGACGATGAAGAGCAACCGGAGCAGACGAGGAAGAAGAAACACCAGTGCCCTCGGCAAACGACAAGAAGCACCATGAGGAGGAGGCTGGTGGCCGCGGCCAAGTGCAGCTTCTCGCTGGGCCTCGCCGTCCTGCTCGGCCTGCTCTTCAGCAGCGACCACGGCTTCTGGTCGGGGCTCGTCGTGGCCACCACCATGGCCACCGGCCGCGAGTGGACCTGGGCTCTCGCCATTGCGCGTGCTCACGGCACCGCTCTCGGATCCGTATATGGCGCGCTGGCCTGCCTTGTCATCGATCGCATGGAGCTGCGCTTCCTCGCCCTGCTCCCCTGGCTCATCCTCACTGCCGGCTTCCTCAAGCGCAGTCGTGCCTACGGCCCCGCTGGCGCTGGGGGTGTAGCAGCTGCGGTGTCTGGCATCATCATCGTTGGCCGCCGCTACGACGAGCCGCCCATGGCCTTCACCGTCGCACGCCTGGTGGAGACCTTCATAGGCCTCGCCTGCATCATCGTGGCCGACCTCGTCTTCCAGCCCGCCGCCAGGCCGTCCACCAAGGCCACGGCACAGCTCGACCGCTGCCTCGCCGCACTCAAAGGCTGCTTCAGTCGGGGACGACAGACGACGACCAAAGTGAAGGTGAAGGCGGTGCAGGAGCAGGTGGCCCTGCTGGAGAGATGCGTGGCAGAGGCTGCCGGCGAGCCCCATTTCCCGTGGTCGCCGCCGTTCCCGGCGAGCTGCTACCACAAGGTGGCGGGGAGCCTTGGCAGGATGGCGCAGCTGCTCTACCTCTACACACAGGCACATCCAACTCCAATACCAGCAGCAGACGAGGATGCAACGCAGCGCTTCCACTGCCTCGTCTCCGCATCCCTGGAGCGAAGCGCCGACCTCCTCCTCCGACTCAGTCGTATCAGCAGCAGCAGCAGCAGAGACGAGGAGGACCTGGAGGCCGGCATCCGGGTCAGCAGCGGCAGTGACACCTGTTGCTGTGACGACGAGGATGCACCAGAGATGCTGGTGCGGTCGTTCCTGTCACAGCAGCAGCAGCAGCAAGATCAAGGAGTAGCATTAGCATTGGCTTCCATTGGGTTCTGCATGGGAGAGATGGCCAAGGAGGCCCTCCAGCTGGAGGCCTACATGCTCGACCTCATACTCCTCGCTCATTAG >Medtr2g096670 ATGGAGAGATCACCACTAAACCTTATGGTGAGTTTCTTCAACATTCCACCATTGTGGAGAGAGTGTCTCTCTTCAGCATTTAGAACCGCCTTAGCTTGCACCATAGTAGCTGGTGCAACACTTTATGGACCTATTTCAATTACAAGCCTAATAACATTCCCTGCATTTTCATACGTGGTTGTGATTCTCATTATCATAAATGATGCTACTTTAGGTGACTCTCTACGTGGTTGTTGGCTAGGGCTTTATGCTACAATTCAAAGTTTAGGTCCAGCTATGTTGAGTTTATGGGCTATAGGTCCAAATCATTTCTCTAAAGGAACTGCTTCTATTGCTGTGGCATTGGCTGCATTTGTTGTGGTTTTACCTTCTCAATCAACACATTTGATAGCTAAGAGAATTTCATTGGGTCAGATTGTGTTGGTGTATGTGTTGGCTTATTCTAATGGTGCTCATATTGATCCTATTATGCATCCTATTCATTTGGCTGCTAGTACTGCTTTAGGTGTAATTGCTTGTGTGCTTGCATTGCTTCTTCCTTACCCTCGTTTTGCTTGCTACCAGGTGAACAAAAACTACAAGCTATTAACAAATAATGTGTTGAAGAGATTGAAGCTTCTTGTAAAGGTAATTAGTGAGGAGGAAAATACTTCTGCATTTGGATTAATCTCTCGTGCTAAGTCTTTGGCAACCAAGCGAACCAAGCTCCTTTTCACCATCATGCGATACCTTGATGGCATGAAGTGGGAGAGGCTTCCAATTAATTTTTTCAAACCACATTACAATAAATTGGGAGAGAAACTTCAAGAGGTAGATACCAATCTAATAGGAATGGAATTGGCTTTAAGTTGCTACAAATCATTCCCAATCAACATTCTTGACCAAGACCTTAAACATGGTCTAAACACACTTGAGGAGCATGTCAGCCTAACCATTAAAAATGCTAAACACACTTTCCTCGGTAGTGGTTCACTTACTGTTCCTGAATCCAATGCAAAAAACATAACACATTTTCTTCAATCCCTTCATACCATTCCAACAACTCACCAAGAATTACCCATTTTTTTCTTCCTATTTTGTGCCAAACTCCTTCACATGAAACCATCAACCGAAGGCCCAACAAATGTCCAAGCCCAGCCCATTCACAAAAAAGAAATTTCTCACGAAGATAAAGATAAATGGGCCAATTGGGCCACAAAATTGAAAAGCTCAAATCTTCTCCCGGCAATAAAGTACTCTTTCGCATTGGGTCTATCAGTATTCATGGGCTTATTGTATAGCAAAGAAAGTGGTTTCTGGTCTGGGCTTCCGGTGGCCGTAAGCTACGTTTCAGGTAGAGAAGCGACTTTTCGGGCCGCAAATGTTAAAGCCCAAGGAACGGTGATCGGAACTGTGTACGGTGTGTTGGGTTGTTTCGTGTTTAATAGATTATTGTCAATTAGATTCTTGTCTTTGCTTCCATGGTTCATTTTCACAAGTTTCCTTCAACGAAGCCGAATGTATGGGCCTGCGGGTGGCATTTCGGCAGTGATTGGGGCAGTTTTGATATTGGGCCGAAAAAACATAGGCCCACCAAGCGAGTTCGCCATAGAAAGAATCATCGAAACTTTTATTGGGCTTTCATGTTCTATTTTTGTGGATCTTCTTTTTTGGCCCAAAAGGGCTTCAACATGTGCCAAATATGAACTCTCCCAATGTTTGTTCACACTAGTTGAAACAATTGGAACATTGAGCCTAGTTGGCAAAACTGATTCACAATTGGAAGAAAATCAAAGAAAACTTAAGGCCCAAGTTAATGAGCTTAGAAAATTTGTGGTAGAGGCAGAAGCTGAACCTAATTTTTGGTTTTTACCATTTCATAGTGGTTGCTATAATAGGCTTTTAGGCTCATTATCGAAGTTAGTGGATGTTTTGCATTTTGGAGAACGTGCATTAAAATCACTTCAACAAGAGTTTCAAAGAAGTGACAATTTTGTGAATATGTTACAAAGTGAACTTCTACATGTTAAGGAAATTATTTGCTCTTCCATCAAAGGTCTTGAAGAAATTTCCAAGATGAAATCATTCAAGTTTGTTGAGAAAGAGATTGAAAAAAAGAACATGTCTAGTGATGTTGAAATGGGAAAGTCAAGAGAGGATGACACGTGGCTTTCGGGTTTGGGAGAGGATGGAACAAGAGAAATCATAGAGACTTTTCTTCAAAGATCAAGAGATGTTGTTGAGAAGTTGTATAGTGATGAAGGTGAGAAGGAGGTGAAGAGTGAAGTTGTTTTGAATTTGAGTGTTGTTGGGTTCTGTTTGAATGTGTGCATGCATGGGACAATAGAGATTGAAAAGGCAATGAGGGAACTTGTTCAATGGGAGAATCCCTCTAGCAGTATTTAA >Medtr7g063050 ATGGCTGCTGGTTATCTGTCAAGCTGTTTTCAGGTTTCCATGTTTTTAAGAACAAGTTTTCAGGTTATGATTTTTTCTCTAATTAGCTTGCAAGTTATAAGACTCGATAACTTCAGCAACTGTATGGCTGCGCTAGCCGTGGCTACCGGTGCATTTGTGGTGGCGCTGCCCAAATCGACACACTTGTTGACTAAAAGGATTGCATATGGACATCTTGTGATAGTATATGTGAGCACAGTTATACATGGTCCTCAAGAAGGAGTGGCTACGCATTCAATTCATGTGGCTTGTTCCACTGCACTTGGAGCTATAGCTTATGTGAACCAATATTGTTGTTTAATAACTTATGAAAATTGTTATAAGTTGTTTTCATAA >Medtr7g073075 ATGGCTGCTGGTTATCTGTCAAGCTGTTTTCAGGTTTCCATGTTTTTAAGAACAAGTTTTCAGGTTATGATTTTTTCTCTAATTAGCTTGCAAGTTATAAGACCCGATAACTTCAGCAACTGTATGGCTGCGCTAGCCGTGGCTACCGGTGCATTTGTGGTGGCGCTGCCCAAATCGACACACTTGTTGACTAAAAGGATTGCATATGGACAACTTGTGATAGTATATGTGAGAACAGTTATACATGGTCCTCAAGAAGGAGTGGCTACACATTCAATTCATGTGGCTTGTTCCACTGCACTTGGAGCTATAGCTTCTGTGAACCAATATTGTTGTTTAATAACTTATGAAAATTGTTATAAGCTGTTTTCATAA >Medtr7g099710 ATGTCAGGAACAACAACAATTGCAAAAACAAGGACAGAGTTGTTTCGAACTCGTCTTGGTTCTGCTCTAAGAACAACCTTAGCATGCAGCATAGTTGGTTGCACTGCCCTATATAGCCCTCAACCTATAAAGGGTTACATTAAATTTCCATCTATTTCTTATGTGACAACAATTCTCATAGTGTTGTCTGATGGAACACTTGGTGACGCCGTTAGAGGTTGTTGGCATGTTCTATTGGCAACCATTCAGGTTATGATTTTTTCTCTACTTAGCTTGCAAGTTATAAGACCCGATAACTTCAGCAACTGTATGGCTGCGCTAGCCGTGGCTACCGGTGCATTTGTGGTGGCGCTGCCCAAATCGACACACTTGTTGACTAAAAGGATTGCATATGGACAGCTTGTGATAGTATATGTGAGCACAGTTATACATGGTGCTCAAGAAGGAGTGGCTACGCATTCAATTCATGTGGCTTGTTCCACTGCACTTGGAGCTATAGCTTCTGTTCTGGCCATGTTGCTGCCCCTGCCCTATCCTCGGTTTGCTTACAATGAGGCAAGGAAGTTCAACCAACTATACATTGAGAATACATCTGAGAGATTAAATTGCAATATAGAGGCCATCTCAGCCTCAGACAACTCAACTGCTGTTGGTTTTATAACTAAAGCCAAGTACCTCTCCACAACAGGAGCCAAGCTTCTCCATAGTATCACAACTACACTGGATGGCATGCATTGGGAGAGACCTCAGACACTAATTTCCAACTCTTGTTGCATTGACCCGGAAGAGAAACTGCAAGATTTGGAAATACCAATAAGAGGGATGGACATTGCTCTATCGAGCGGCATGTCTTTTCCTGTTGGTGTTATTGATGAGGAGCTAAGAGGTGTTCTGCTCAATTGCAGAGAACAAATCAGCCAAAAATTAGACCAGCAAGCGAAATGCTTTGTTCCTTTTGATACAACCACAACTCAAGAAATGAAACAAGACATTTTCAACAAAAACCCTTCCATAGCCTACAAAAATCTCCCAACATCATTCTTTTTATACTGTGTGCAACTACTCCGAGATGACTTGTCTATTTCAAAGAAAACTGACCATGTGCAGAAAAAAGCTCAGAAAAATGATGATTCCCAATGTAGCTCCAACAAGCTCAGAGAGCGTTTGATGAACTTGATTCCCAGCAACCAAAGCTTGATCTTTGCATTTAAGTCCTCTCTGTCATTAGGCTTTGCTGTGTTCTTTGGTTTGATATATGATAGGGATAATGCATATTGGTCAGGACTCACAATTGCAATTAGTTTCGTGACTGGACGACAACCAACATTCTCAGTTGCAAATGCGAGAGGTACAGGAACAGCTATGGGATCAATCTACGGGATCATATGTAGCTTCATTTTCCAAAGATTTGTGGACTTAAGGTTCTTAGCTCTCATACCATGGGTCATTTTCTCTTCTTTTCTTCGGCAAAGTAGAATGTATGGCGAATCTGGGGCAATTTCGACAGTTATAGGGGCCTTGTTGATCCTTGGTAGGAAGAACTATAGTACCCCGACTCAATTTGGTGTTGCTAGAATGGCAGAGGCTACAATAGGACTCACTTGCTTCATCATCATGGAGATTATATTAAGCCCGTCAAGAGCTGCAACCCTAGCAAAATCAGAACTTTCTCAAACCTTGAGAACGCTTCAAGATTGCATTAAGCAGATTGCCATGATTACCCCTAACGAAAGAGATACGTCGCCTTCAAGTTATCAAGCACTGAGAGAAGAGCAAAAGAAGCTTAAGTCTCTTGTGTGTCGATTAAGAGAATTTACAGCAGAAGCTGAAATGGAGCCAAATTTCTGGTTCGTACCATTTCATACTACCTGCTACAGCAATATGCTGGGTTCTCTATCAAGGATGGTAGATCTCTTGCTTTTTGTGGCATACTCAATGGAGCATGTTTCACAATTGACACAAAAAGATGGAGTAATTTGGATGGACATTCAAGGTCAAGGGAATGAGAATGTGAAGATTTTTAAGAACAGAGTTGCCCCAATATTGAAAAGCTTGGAAGAAATAACAAGGACGAAGTCTATTAAGAAACTTGAAAATGAGTTGGAGAGCAAAAATGTTCCTCGCGATCTCGAGTCACAAGAATATCTCAATGCAGATGCATTTGGGATCTTGAACAGAGATGAAGAGGTTGATAGCATTACAAACTCTTTCCTCCAACATCTAGAGGAAATTGCTGACAAAACTCTTACCAACAAAGATGAGGAGATGCTTAAGATTCAGATTCTTTTTCATTACAGCTGCTTCGGATTCTGCACCGGTAGCTTGATGAGAGAAATAACCAAGATTGAGGGTGAAATAAAAGAACTGCTTATATGGGAGAACCCCGCAAGTCAAACAAACTTCAAAGAAATTCACTCTAAGATCAACGCTCTGCATTCATAG >AT2G28780 ATGCTAATGACGGAGAGAGGCCGAGCCATGTGGCGCACGTGCCTAGCCTCAGCGTTCCGAACAGCTCTAGCCTGCACAATCGTTGGTTCAGCTACACTATACGGTCCAGAATGGATCAACCGCCACGTGGCATTCCCGGCCTTCTCTTACGTCACGGTTATCCTCATCATCACGGATGCTACACTCGGAGACACGCTACGTGGCTGCTGGTTAGCTCTTTACGCCACGTGTCAGAGCGTGGGACCTGCGATCGTCACGTTAAAGCTTATAAGACCAGCTCGTCTGACAGCCGAAACCACGGCTCTGGCGGCGGCTCTAGCGGCGTTTGTGGTAGTGCTGCCTAACAGTTCGACTCACTTGGTGGCTAAGAGAATCGCGTTAGGACAAATCGTTCTTATATATGTTATTGGTTATATCAAAGGAGCTAAGACTGATCCAGTTATGCACCCTCTTCAAGTCGCGGCTAGCACCGCGCTTGGTGTTGTAGCTTGCGTTCTTGCACTACTCGTCCCACTACCTCGCTTGGCTACTTGCGAGGTGAAACAAAGCTGCAAAGAGCTTGGTCAAAATGTAACAACGAGAGTGAAGTTGTATATGAAGGCTTTTTGCTCCGATGATAGCATGTCAGCAACGGCTTCAGTCTCACAGGCTCGAGTGTTGGCTCGTTCTTCCTCCAAGCTTTATCAAACACTCAAACGTTACCAACCAAGCATGACATGGGAGAGGCTTCCATTTAAGATATGGAGGTGGCAAAACGTGAATGATAACAAAGGAGAGAAACTACAAAGCATGGAAATTGCTCTTAGAGGAATGGAAATGGTAGTAGCAAGCAAATCTCCTATTCCTTCGAGCTTACTTGCGGGTGAAGTAAAAGAAGATCTCAAGAATATACAAGAACGTGTGATTCTCTCAATTAAAAGAGTGAATAATAGTTCGCAACCGTCAGTAACACCAGAATCTGATCCGAAAAACCCCGATGAGTGCCTCCAAACACTTCAGGAAATCCCGGGAACGCCTCAAGATTTGCCCTTTTACTTCTTCTTGTTCTGCATCAGGCTCCTTGAAACCATCATAATAGCTAAACCGGAGGAGAACAAAGTCAAGGTCTTAGAAAACAAATTCAAGACGAGGTCTTGGATAAGTGATTGGGACAGCAAGAAAATTATGCCGGCGCTAAAGCTATCACTCTCATTAGGCTTAGCGATTTTGCTAGGTTCGATGTTTAGTAAGCCAAACGGTTATTGGGCTGGTTTACCCGTAGCAGTCAGCTTCGCAGCGGCCAGAGAGGCGACGTTTAAAGTGACGAATGTGAAGGCACAAGGGACAGTGATAGGGACAGTGTATGGAGTGATGGGCTGTTTTGTGTTTCAGAAGTTTTTGACGGTTCGGTTTCTTTCTTTGCTTCCATGGTTTCTCTTCTCTAGCTTCTTAAGCAGGAGCAAGATGTACGGGCAAGCCGGAGGGATATCAGCGGCCATAGGGGCCGTTTTGATTCTCGGAAGAAAGAATTTCGGGCCACCAAGCGAGTTCGCGATCGAGAGAATTATCGAGACTTTTATTGGGTTGTCTTGTTCGATCATGGTGGAGCTTGTCTTTCAGCCTACAAGAGCCGCTAACATAGCAAAACTTGAGCTCTCTAGAAGCTTCCACGCTTTGTACGAGTGTGCAAGCTTGTTTGGAGCTAAAGCGAGTAAAGCAGATATAATGGAAAGTCAAAAGAAGTTGAGAAGTCATTTAAATGAGCTCAAGAAGTTCACAGCAGAAGCCCATGCAGAGCCAAGTTTCTGGTTTTCGCCTTTCAACTTTTCTTGCTACGAAAAGCTGTTCAAGTCATTGTCTAAAATGGCTGATCTATTGCAATTCAGCGGTTACGCCATAGGCTTTCTTGGAGAACAAGGAAAAACAAAATCACCGCAGTGTAAGGAGATTCTAAGCAACGTAGACAAAGATCTCAAGAGTCTAACAGAAAGCATAGGTCTTTTAGCCAAATCATTCGAGGAAATCACACTTCTAAAATCACTAGACGCACTCGAAAAGGCGCTCGCCAAGAGCGACAACACCTCATGGGACATTGAGCTCGGGAAGACACCGAACCCTAGCTTCTCAACCGCCGTGAGCGAGCCGGAGAAGATTTTAGAAACGTATCTCCAGCATTGCAGAAGCGTGGCGGATGGACTATTCCGTGTGGAAGAAGATGGAGAAGAAGAGGTTGAAGTGGACAAGAGTGAGGTTGTGTTGAGTTTGTGTGCATTAGGGTTTTGTGTGGAGAGAATTGGGAAAGAGACAAGAGAGATTGAGGAGATGGTTAAAGAGGTTGTGCAATCGGAAAATCCTTCAAGCCATGTTAACTTGCATGAGATCTCTTGCAAAATACGTTCTTTGTATAAATGA >AT3G09450 ATGCGCGACACAACATGGCTCGAGCGACTTGGCCTGGCTCTGCGAACCGCCATGGCTTGTCTCATCGTGAGCTTAACCACTTTGTACGGTCCCAAACCACTAAGACACTTCACAACGTTTCCAGCCTTTTCTTACCTGACCACAATCTTGATCTGGCTCTCCGATGCTGAACCAACATACGGCGAAGTTCTCAAGTGCTGTCTTGATGTCTCTTACGCCACTTTTCAGACAATAGCCATTGCGCTAGTGAGTGTCTTGGTGGTTGGACCAGCTTCACTAGGGAATGGCTTGGTGGCTCCAGTTGCTGTGGCTCTAGCTTCATTCATAGTGGCTTTCCCCGTGTCCACGAGTCTGCTGACTAAACGGATTGCCTTTGGGCAGATTGTTGTAGTCTACGTGACTTTTGTGGTGTTCAATGGAGAGGTGGCTCATGTATTCATGCTCCCGGTTCATGTGGCAGGCAGTACAGCACTTGGAGCCATTGCTTCACTCATCGCAGTGCTTCTCCCGTTTCCAAGGCTGGCTCATAGTCAGATGAGTAAGGGTTGCAAATTATATGCTGAAAATGCTCTTGAGAGGTTGAATATGTTTGTGGAGATCATGATGGCACGAGACAACACCACAGCTCAGGTTTTGATCGCACGGGCTGCTTCATTGTCTGCAGCAGCTAAAAACACACTCAAGAACATCAAAATCCACCATGAGCGTATATCATGGGAGAGACCAGATACAAGATTCTTGAGCAGGAAGCAGAAGTTGGATCCTGCAGAGAAACTGCATGCAACAGATTTTCTGTTGAGGGGATTGGAGCTGGCTTTGGGCTCTTGCAGTTCCTTTCCTCAAGGCATGAGCCGCGACGAACTGACTCGTCTTTTAGAAGGTCCCAGGACACATATTGCTCCACGGTCAGAATCTACTCTCAAGTCCCAAGATAGTCTAGGGTGGCATCATGAGGCTGAGTCTCTGTCTACTGCAGCTTTACCGGTTTGCTTCTTCCGGTACTGCGTAGAACTCTTCAGAGGTGATTTCTTATCTTTGAGACAAGACAGTAAATCCGTAAATGGAAGGACCACGGAGGAAGAAATTCATCCAGCAAACGAAGGGTTGTCCATGGCCAGAAAGTTTTGGGACATTCTCTGTGTCTGGATGGCCAGAGAAAGGTTTGTTTTTGCATTCAAGTGCTCAATTTCTCTTGGCCTTGCGGTGCTGTTTGGTATACTGTATAATAAAAATAACGGGTATTGGTCGGGTCTAACTGTAGCCATTAGCCTTGTAAGCGGTAGGCAAGCAACACTAACAGTAGCAAATTCTCGTCTACAAGGGACAGCCATGGGATCAGTCTACGGTCTAATATGTTGTTCTGTTTTCCAAAGACTAGAAGAATTCAGGTTCTTACCTCTTCTCCCTTGGATAATCCTCGCCGTCTTCATGAGGCACAGCAAAGTCTATGGCCAGCCTGGAGGAGTTACGGCTGCAATTGCTGCACTGTTGATACTTGGGAGGAGAAATTATGGAGCTCCAACTGAATTTGCAATCGCTCGCATCGTTGAAGCTTCGATCGGGTTGCTCTGTTTTGTCTTCGGGGAGATTCTTGTCACCCCTGCGAGAGCAGCAACGCTTGCAAGAACCGAAATTTCACACTGTCTCGATGCCCTCTTAGATTGCATCCAATCACTCGTTCTTTGTTCTGAGCAGAAGAACCAGAAAGTGGTTGCAGATTTGAGAAAAAGTCAGGTAAAACTCAAATCTCATGTTGAAGCATTAGAGAGGTTTGCAGCAGAAGCCTTAACAGAGCCTAAGATTCCGTTCCTCCGCCGGCTCAACACGGACAGTTACAACAGGCTTTTGGGCTCTTTCTCGAAGATATCTGATCTTTGTCTCTATGTTTGTGATGGCCTCAAAAATCTATCTGGAGTTCAACCAACACTTGCATTTCCTTGGGACAACATCACTCATGAGCTTAGAGCCTTCCAAGAAAAGCTTCACCCTTCGGTGAAATGCTTAAAAGAGATTTCTCAAACCAAGTCTCAAGCAAGACTCCAAAAGGAGTTGCAGAAGAGAAAGATCTGCCATGATGTTGAAGCAGGAACAACATCAAACGACAACTACTCATACATGGAGCTGGGTCCAAGCCAGGCTGATGTGGAGAGGTTTTCGGTTTCTTTCGTCATGCTACTGAAGGAAGCAACAGACAAGATAAGTTGTAACACAGCAGACGATGCGTTCAAGAGTGAAACTGCCCTATGTCTGAGCAGTCTAGGGTTCTGCATTAGCAGATTAATGCAGGAAACAATATGTATTATGACAGAAATAACCCATACAACTTGA >COL.COLO4_14831 ATGGATGCTCCCCAAGCTTTGTGGCGTTTACGCCTAGGCTCCGCCTTCCGGACTGTGCTAGCCTGCACCATAGTAGGTTGCACCACCCTCTACGGGCCAGAACATGTCCGGTCTTTAATAACATTCCCTGCCTTTTCCTATGTGACATCTATCTTAATTGTGTCGGATGCTACACTTGGTGATGCCTTGAGAGGTTGTTGGCATGTTTTTTGTGCCAGCATTCAAGTAATGCTCCCTTCTGTGCTTGCTCTATGGATAATTGGACCGACTAGGTTCAGCAATGTTGGACTAGCTGCAATGGCAGTTGCCCTTTGTTCATTCTTCATCGCGTTGCCCAGTTCCACACATTTGATGGCTAAGAGGATTGCCTTTGGGCAGACTGTGATTGTTTATGTAGGTACAGTTATTCAAGGGGATGAAACTGATGTTTTGATGCACCCGATTCATGTGGCGTCGAGCTGTGCTCTTGGTGCCTTGGCTTCTGTTCTAGCTATGTTGTTTCCTTACCCTCACTTAGCCTACCGAGAGGCAAGTATTTCTAAATCTTGA >COL.COLO4_14833 ATGCTTTGGGAGAAACCCCGGTTCAGATTCTTGAAACCTAACTCTGGAGAGAAATTGCAAGAGATGGAAATGCCAATTCGAGGAATGGAATTAGCCTTAACTACTTGCACTACCTTTCCTGTCAGAATGATCGACGAAGAGCTGAAACGTGTTCTACAAGTTTGGAAGAAACAGATAGCTTTGAAACTTGAACAAGCTAAATGTTCAATGCCTTTTGATGTTGCAACTGCTCCAGAGACTAAGAGAGAGTATTCAGGCAGTTCCTTGTGGACCAAGAAAGCCATTTCAACAATCCATGAAGATCTGTCACCCTTCTTCTTCTTGTACTGTATGGAACTTCTTCAAGAACCTGATCATCACTGCATTGTAAACGAAGAAGCTACTAAAATGCAAGGATCAAAAGGAAAAAGTAGAGTGGATGTGATCTGGTGCAGCCTGGTGAAGTGGCTAAGAGGCGAAAGAATAGTTTTCGCAATCAAGTGCTCACTTTCTCTAGGTCTTGCTGTGTTCTTCGGTCTGATATATAACAAAGAGAATGGATATTGGTCAGGATTAACCATTGCCATAAGTTTTGTAACAGGGCGACAAGCAACATTCACAATGGCTAATGCCAGAGCACAGGGGACTGCAATGGGATCAATATATGGGATTATCTGTTGCTTTATTTTCCGAAAGCTGACAGATTTAAGGGTCTTATTTCTACTTCCTTGGATCGTTTTCACCACTTTTCTCAGGCATAGTCGCATGTATGGCCAAGCAGGTGGGATTTCAGCAGTTATAGGGGCATTACTGATCCTGGGGAGGAAAAACTATGGCACTCCTAGCGAATTCGCGATCGCTAGAATCACTGAAGCTACCATTGGATTGATCTGTTTCATCGCGGTGGAGATTGTCTTGAATCCAGTGAGATCTGCCACGCTGGCAAAAAAGGAGCTTTCAAGGACCTTGATAGCACTTCAAGATTGCTTTGAGGCCATAGGTCTTTATAAAGGCGAAAAGGGAGTTTTGACAGAAATGAGAGAAAAACAGAGGAATCTGAGATCTCATGTCAGTGAATTGGAGAATTTTATTGCAGAGGCTGAATTGGAGCCTAATTTCTGGTTTTTGCCCTTTAATTGCGATTGCTACAATAAGCTTCTAAGGTCTATTTCCCAAATGGCAGATTTATTGCCCTTTGTGATCCATCAAATTGAATTTCTTTCACAAGCATCCCAGAGGCTGGGATTTACTTGGGAGGAGATTCAAGAACCTATAAACAATGACCTAGAACATCTCAGGAAGAAAATTTACTGTTTGATGAAATGCCTGGATGAGGTGTTATTGGTCAAGACCCTAGAGGGGCTTGAAAAAGAATGTGACCTCGAGTCGGGAAAATCAGCAAACCCCAATGTCTCCACACGCTTGGGGCTGGAAAAAAACAGCATTGCAAGCATTATAGGGCCCTTTCTTCAATGTACAATGGAGGTTGCCAACAAGACTCAGGGTGATGAACTTGACGAAAAGCTTAAGAGCCAAATGGTTCTCTTTCTGAGCAGCCTAGGTTTCTGCATCAACATTTTCAAGACAGAAGCAATCGAAACAGAGAAAGAAATAGGGGAACTACTGAAATGGGAGAATCCAGCAAGGCATATAAATTTGCATGAACTATTATCTAAGCTCAATGCAACATGA >COL.COLO4_18477 ATGGCAACCGCAGCAGCCCAGCCGCAACACGACCGAGCCAGAGCCGTATGGTGGACCTGCTTAGCCTCCGCCTTCCGCACCGCCATAGCCTGCACCATAGTTGGCGTCACCACCTTGTACGGACCAGCTTCCATCCAACGCTATGTAACACTCCCTGCATTTTCCTACGTGACCGTCATCATCATTTCGACGGACGCCACGTTGGGTGACACATTGCATGGATGCTGGCTAGCTCTCTACGCCTCCGTCCAGAGCCTTGGACCTGCCATGTTAAGCCTTTGGTTGATTGGACCAGCCAAGCTGACGAATAGAACGACGGCGCTCGCGACGGCGCTAGGAGGGCTGGTGGTGGTGTTGCCGGAGTCTACTCATTTGATAGCGAAGCGAATAGCGTTGGGTCAGATTGTTCTAGTTTATGTTATCGGTTTCATAAAAGGCGGGGAAGCGCACCCTATTATGCATCCGGTGCATGTAGCGGCGAGCACTGCGGTTGGGGTGGCGGCTTGCGTTTTGGCCTTATTACTTCCCTACCCAAGATTGGCTTCTTGCGAG >Vradi03g02850 ATGTCAGAAACATCTTCTTCTTCAATCACTGACACAAGGTCAGAGGTGTGGAGAACACGTGTAGGGTCTGCACTAAGAACCACCTTGGCATGCACCATAGCAGGTTGCACCTACCTTTATGGGCCTGCACCACTCCGACGCTACCTCACATACCCAGCTTTCACATACTCAACCGCGCTCCTCATAGTGTCAGATGCTGCACTCGGTGACACACTAAGAGGTTGCTGGCACGTGCTTTGCGCGAGCATCCAGGTCATGATACTCTCCCTGCTCGCTCTTCAGTTGATTGGGCCACAAAACTTCACGAATCTAGTGGCTGCACTGGCCATGGCAATTTCTGGTTTTCTCGTTGCGTTGCCTGTTGAATCCACCCACTTGGTCACGAAGCAGATAGCGTTTGGACAGCTAGTAAACGTTTACGTTAGGACTGCCATAGATGGTGCTGAAGATAGAGTGGCCATGCACACAATTCATGTGGTCTGCTCCACAGCCCTTGGAGCTGTCGCTTCTGTTCTCGCCATGTTGCTTCCTTGCCCTTCCCCTCGCTTCGCCTACTCTCAGGTGATCTCTGCCTCAAACAACTCAGTTGTTGTTGGTTACTTTACTTTAGCCAAGTCTCTCTCTGCTACTGGAGTCAAGCTTCGACAAAGTATTAGGAGTAAACTTGACACAATGGATTGGGAACAACCACAAAGAAGAATTTTCAACTCCCATAAGATTGATGTACAAGATAAACTACAATACTTGGAGTTACCGATAAGAGCTATGGGCATTGCTCTGTCAACTTGTACCTTTCCTAAAAGGGTCATCGATGAGGATCTCAAAGGACTCACAGTTGCTCTCTGCTTCGTGACTGGACGACATTCAACCTTCTCACTAGCAAATGCACGTGGTCAAGGAACTGCAATGGGATCAATCTACGGAGTTCTTTGTTGCTTCGTTTTTCAAAGATGTATGGGTATAAGATTCTTACCTCTTCTACCATGGGTTTTTTTCTCTTCTTTTCTTATGTACAGTAGAATGTATGGTAGAGCTGGTGGCATTTCAGCAGTTGCAGGGGCTTTATTAGTTATTGGTATAAACCACGAAGAAAAACCAAGTAAATTTGCATTTGTTAGAATTGTTGAGGCCACAATTGGACTCATTTGCTTCGTTATTGTAGAGATACTTTTCAATCCTTTTAGAGCTTCAACTCTAGCAAAAGGTAAACTTTCAGAATGCTTGAGATCTCTTCAACATTGCATTGACCAAACTATCGTTATTCCTAGTGAAAAAGAGAAGTCGTCTTCTTACTATCAAGCATCACAAGATGAGCATTTGAAGCTGAAATCTGTAGTCGATCAATTAGAAGACGTCACGATGGAAGCTGAATTAGAGCCAAATTTTTGGTTCATTCCATTTCATAATGGTTGCTACAGAAACATGTTGGAATCCCTGTCAACAATGGTGGATCTCTTACTTTTTGTGGCCTACTCAATGGAAAAAGTTAGGCTAATGTTGGAGAAAGATGAAACATTTTTTGTGGATCTCTGCGATCGAGTTAACGAGAATGTGGGAAATGTCAAGAACAAAGTAGGCCTCATATTGAACTGCCTTGAAAAGATAACAAGGATAGAGTCTTCTAAGGAACTTGAAAATGAGTTAAAGAATATAAATCTTCCTGTTGATATTGATATAGAGGAATGCTCCAGGAAAGATGCATTTTGGATATGGAATGGAGATGAAGAGGTAAAAAATATTACTTATTCTTTTCTCCATGATCTAGAGAAGATGGCTAATAAGGCTTGCAACAACACAGATGAGGAGATGCTTAAAGGTCAAATGCTTTTTCATTATGGTTGTTTGGGATTTTGTAGTAGTAGCTTGATGAGAGAAACAATAAAGATTCACAATCAAGTAAAAGAGCTACTTGTATGGGAGAATCCCTTAAGTCAAACAAACCTTAATGGAGTATTTCCATAA >PGSC0003DMG400030403 ATGAAGTGGGAAAGATTTCCATTCAAGTTTTTAAGACCATATGGAGAGAACCCTGGAAGCAGATTTGAAGATGTTCAAACACCTTTAAGAGGAATGGAAATTGCCTTAGATAATTCTCCTTCATTTCCTGTTGAAATTCTTAACTCAGACCAAAAATCTGTTCTACATATGCTTGGTGAGCACATACCAAAGCAAGTCAACAACATGTCTCTTGAGTCATCAGCAACTGTGCCAGAGTCAAATCAAGAAAATACCCAAAAGTTCTTCCAAACACTTCAACCAACAAAAAAAGACCTTCCCTCTTTATTCTTTTTATTTTGCTTAAACCTCCTATTAAACAAACCAATTACCAATTCACCATCTTCCACTAATCCCAAGCAACAAAATCAACAAGGGTTCTTTCAAAATTACTTGTCAATTACCAAAAGTAACAAAAGGTTCATGGCAGCTTTTAAATGTTCACTTTCATTAGGCCTAGCTATATATTTTGGATCAATCTATAGTAAGGACAATGGATTTTGGGCAGGGCTTCCAGTTGCCATTAGCCTCGCGGGATCGAGAGAAGCAACATTCAAAGTAGCTAATGTTAAGGCACAGGGGACTGTTTTAGGAACAATATATGGTATTTTAGGATGTTTTGTCTTCGAAAAATACGTTCAAATTAGATTCTTGTCTCTTCTTCCATGGTTCATTGTCAGCAGTTTTTTGAGACAAAGCACAATGTATGGCCAAGCTGGTGGACTTTCAGCTATAATTGGGGCATTACTAATTCTTGGTAGAAAAGGTTTTGGTCTACCAAGTGAATTTGCAATAGCAAGAATAACAGAGACATTTATTGGATTGTCCTGTTCTATTATAGTGGAAATTTTGTTACAGCCTACAAGAGCTACTACATTAGCAAAATTGCAACTTTCCAAGAGTTTTGAAATCTTGAATGAGTCTATTTCGTTGATAAGCTTTGGATCAATTGGAAATTTAGTGGAAAGTCAAAATAAATTGAAATCGCACATAATTGAGATGGGGAAATTTATCGCGGAAGCAGAGGCAGAGCCAAATTTTTGGTTTGTACCATTTCATAGCGTTTGTTATCGTAAACTCATGGGGTCATTAACAAAAATGTTGGAGTATTTACATTTTGGGTCACAAGCTTTTATGTTACTTGAACAAGAATCAGGAGGAGCAATTGACAATTTTGTACATAAGCTAGATGGTGATATCAAGCTATTCAAAGATTTTGTTGGCTCTTCAATGAAGTGTTTTGAGGAGGTTAGTTTGGTCAAATCACTTGAAATACTTGATAAGGAATTTGAGAAGAAGAAACTTTCAGTTGATGTTGAATTAGGAACATCACAAAGTAGTAGTTATTGTAATATAATAAGGTATGCAAGTGAAGAGGAGATTGATGAAAACTTCAGATCTTATTTTGAACATTCGAAAGAGTTTGTGGACCAAATTGTCAATGGTGAGGAGTTGAAGGGTCAAGTTGTATTAAGTTTGAGTGCATTGGGTTTCTGCATGGATGGACTTGTGAAGGAAACAAAAGAGATTGAGAAGGCAATAAAAGAAGTTGTACAATGGGAGAATCCTTCAAGCCATGTTAATTTGCATGATATTTCTTGTAAAGTAAGGGCTTTAGCAAATATTATTGTAGCTAATTAG >PGSC0003DMG400008846 ATGGTGGCGAAACGAGCTCGTGTCATGTGGTGGATGAGGCTACACTCAGCTATTCGAACCGCCTTAGCATGCATCATAGTAGGGTGTGTCACCCTCTATAGTCCACCTTCTCTTGCGAAGCAACTAGCATTTCCTTCTTTTTCCTACGTGACGTCGATATTCATAGTATCCGACGCCACGTTAGGCCATGCCCTAAGGGGATGTTGGCATGCATGTCTTGCCACACTTCAAACCATGCCACTTTCCATGCTAGGCCTATGGCTTCATAATTATGTCGCCACCGACCACTACTCGCCCGAGGTAGCCGCCCTCATGGTGGCGGTGAGCGCGTTTTTGGTGGCGTTACCGGAGAGTACCGACTTAATGTGCAAGAGAATTGCCTTTGGACAATTTGTTATAGTGTATGTTGATGCTGTTATTCATGGGCTTTATGTCAATTCTCCTATGATGCACCCTCTTAGAATTGCTTTTAGCACTTTACTTGGAGCTTTGGCTTCTATCTTAGCTTTGTTGCTACCCTATCCTTGGCTAGCTTATCATGAGGTGAAAAAATTATACCAAATTTATGCAGAAAGTGCAACAGGAAGAATAAATTTATATTTGAAAGCCATTCATACTCAAGATGATCAAATAACCATGGAGCTAATTTCTCAAACAAAGCCCTTTACTGATACAGGAACTAAGCTTCTTGAAACTATCAAATTCTTGGAGGAAGGTTTGCAATGGGAGAAACCTTGGTTGAGATACTTGAATCACAATTTCACAGATCCAGGACTTGGTTTACAAAACATGGATGTATCAATGAAAGGAATGGAATTGGCTATAACTTCTTGTCCAATTTTTCCCACAAGAATGATAGATAAAGAGCTTTTTAAAGTCACACATCATGTTATGATGTTTCTTGGTCAAATAATGGGGCAAGAAAGATCATTTTTACCACATAATTCAGTAACAGAAGGGGAGTTTGAGAAGGAGTACTCTTCTAGGCATTCTAATGAACCAATCTTACCAACAAAACAAGATCAAGCAGCACTCTTCTTCTTATCTTGTTTCAGAATGTGCACGAGTGACTCTGAAACGATCACACCTATAAACGAAGGACTTAGAGCCACAACAGAAAGAAGTAGTAGTAGTAGTAACAGATCGTGTTGCAGACGAGTCTGCATTGATAGGACTATGCTAATAATCAATGAGAGAATGGTGGTATTCGCGTTCAAGTGTTCACTTTCATTAGGCCTGGCTGTGTTGCTTGGTCTGCTATTTAATATTGAAAATGGTTACTGGTCAGGCCTCACAATAGCCCTCAGCTTTGTTACAAGGAAACAAGCAATTTTCACAGAAGCAAATGCAAGAGCACAAGGAACAGCTATAGGATCAGTGTATGGTGTACTTGCCTGTACTATTTTTCAAAAAGTCGCGCAAATAAGGTTCTTATCTCTTCTCCCATGGATAATTTTCACCACATTTTTAAGGCATAGTAGGATGTTCACTCAAGCAGGGGGAACAGCAGCAGTAATAGGTTCACTACTGATTTTAGGCAGAAAAAGTTATGGTCCACCTAGTGTATTCGCAATTTACAGACTCACTGAGGCCTTCATTGGACTAGCTTGTTTCGTCGTTGTTGAACTTATCCTGCAACCTACAAGTTCAGCAACTTTAGTAAAAAAACATCTCTATCTAATCCAAGGAACACTCAATGAATGCACTGAACACATGGTAGTTGATTCAAGACAAAAGGGGTTAATGGAGAAGCAAAGGAATCTGAAATCTCAAGTCCAAGACTTGGAAAAGTTCATTAAAGATGCAGTCTTGGAACCTAGATTCTGGTTTATTCCTTTTCCAATTTCTTGCTACCAAAAGCTCCAAATGTCTTTGTCAAAGATGGCAGATGTTCTGTTCTTCATGTCCTGTGATATCAAATTCCTCTCTCAAGCGTTCGATAGGTATTATCCTGATAAAAGGGAGCTTCAACAATACATTAACAACAACTTACAGCATTTTAATGATGCTCTATGCTCTTCAGTGAGCTCCTTTGAGAAAATTATTTCTATCAGACTGTTAAAAACTTCTCAAATCCAGCCAGAGCAGAATATATTGAATGATCTTGAAGAAGGGAATTCATCATGTCCAAGGGGGGATGTAATGTATTCAAGAAACGACGAGGAGATGGAGATGATTCTGAGTTCTTTTCTTCAGAACTCAAACGAGGTCAATGGTAAAGTGAGGGACATTGCAGGTATAGAGCTTAGAGGAACGATTGTCGGTTGTTTGTGTTCTTTAGAATTTTGCATGAGCTTTTTGGAGAAGGAAGTAAGAGACATCGACAACGCGATAAAAGAATTGGTGAAGTGGGAAGATCCTTTGGGTGAACCAACTTGTTCATAA >PGSC0003DMG400011060 ATGGCTAAGCGAGATCAAGCCATGTGGCGAATGAGGCTACATTCGGCCATTCGTACCGCCTTAGCATGCATAATAATCGGCTGCACCACCCTACTCAGCCCGCCCTCTATTGCAAGACATCTGGCATTTCCCTCCTTTTCATATGTAACGGCCATAATTATTGTGCCAGATGCCACCCTAGGAAAAGTTTTAAGGGGCTGTTGGAGCGCGTGTTGTGCCACGCTCCAAGTCATGCCCCTTTCTATGGTTGGGTTATGGATTCATGGCTTCGCCACTGATGATATCAACTTCTCGCCCCTAGTAGCTGCTGTGATGGTGGCGGGGAGTGCTTTTTTGGTGGCATTGCCGGGGAATACGGATTTGATGTCTAAGCGGATTGCTTTCGGACAGCTGGTTGTTGTGTATGTGGATTCTGTTATTCATGGAATTCGTGTGAATATAGTGATGCACCCTCTACGAGTTGCATCTAGTACTGCTCTTGGAGCTGTGGCTTCTGTTCTTGCTTTGTTGCTGTTCTTCCCCTGGCTAGCTTATTTTGAGGTGAGGAAACTATATGGTATTTATGCTGAAAATGCTTCAGAGAGATTGAATCTTTACCTCAAAGCCCTCCATTCTCCAAATGAACAAATAGCTATGGAGATCCTATCACAAGCCAAACCAATTTCCGTAACAGGATCCAAGCTTCTTCAAAGTATCAAACTCTTAGAGTTACCTAAATATCCATTTGTACATGAGCAGGGAAGTTTACGATGGGAGAAACCTTGGCTAAGATTCATAGTCCCCTGTTTCACTGATCCTGGAAATGGTTTGCATGACATAGAAAGTCCAATGAAAGGAATGGAAATTGCTTTAACTTCTTGTCCTTGTTTTCAAACAACAATTATAGATGAAAAGCTCATACGCGTCTCACATCGCGTGCTACAGCTACTCGGTCTAAAACTGGAGCAAGCTCGTTGCCTTTTGCGAACACATTCAATGATAGCTACAGAAACAGAAGGGGTATTCGACAATGAGTTTACCAGTTTGTCCCCTGAGTCAATTTCCCTGACAAGTCTAGATCAACCAGCAATTTTCTTCTTGTCTTGTATCAAAATGTGCATAAATGATCTAATCATGACTAAAGGATCCAAAGATTCAGGAGGAAGTGATAAAGCTAGCTCGAAACGAGTCTGCATCAATTGGACTAACCTAATGAACCGTGAAAGCCTAGTATTCGCGTGCAAGTGTTCAATTTCGTTAGGTCTGGCTGTACTACTTGGTCTGCTATTTAACAAACGGAATGGATATTGGTCAGGGCTTACAACAGCCATCAGCTTTGAAACAGGAAAAATAGCAATTTTTACGGTTGCAAATGCTCGAGCACAAGGAACAGCTCTAGGATCAGTCTATGGAGTACTAGGCTGCACTGTTTTTCAAAATTTCGCGAGAATAAGATTCATAGCTATGATCCCTTGGATAATTTTCGCGTCAATTTTAAGGCACAGTAAAATGTACTCTACAGCAGGAGGAGATGCAGCAGTTATCGGAGCATTACTGATTCTAGGCAGAAAACGTTATGGTCCCCCGAGTGAATTTGCTATTGCTAGACTCACCGAGGCCTTAATTGGATTATCATGTTTCATCATCATAGAGCTTGTTATCCAACCAACACGAGCAGCAACAATCGCGAAAAATCATCTTCTTCTGTGCTTTGAAACACTTAAAAGTTGTACTAAACAAATTGACCTGGACTCAAGGAAGATCAATAGCTTTATGAAGAAGCAAAGACAATTGAATTCTCAAGTAGAGAAGTTGCATAAGTTCATAGTAGATGCAGAGTTGGAGCCTGGTTTCTGGTTTACGCCTTTTCCTGTTTCATGCTACCAAAACCTTCAACGATCTCTATCAAACGTCGTGCACTTACTGTATTTCATGGCCTACAGTATAGAATCTCTTATACAAGCATTAGATAGTTGTGATGCTGATAGAAACAAGATCCAGGAACACTTAAACAAAGACAGACAGATTGTCAATGACGCGATAACCTCTTCAATGAAATGTATCGAGACAACTATTTCTATCGGAATGTCAAGAGCTTTCCAAGATCAACCAGAAGATCATAAAATTGTTTATGACCTCGAGGAGGGAAAGTCACAACGCGATTATACAACTACTTCTACGAGCAATAAGGAATGGAAAGCTTCAAGTGATTTTCTTGAGCACTCAAAAGAAGTTGTAGATAACATGACATCACTTGAAGGAAAAGAAGAGGAATGGCTTCAGCCTTCTAGACAATATGATCTCGATGATTATGTTAATCCAAACGCATATGATGCATTGTTTAGACGCCCCAATTATCAGCCTTCTAGACAATATGATCTCGATGATTATGTTAATCCAAACGCATATGATGCATTGTTTAGACGCCCCAATTATCAGCCTTCTAGACAATATGATCTCGATGATTATGTTAATCCAAACGCATATGATGCATCGTTTGCTCAATATGAGTACATTGATCGACAATTTAGGAATGGCTATCATCAACAACGTCAACAACAACGATGCTATAATTCACGTAATGCTCCAAGACGCCCCAATTATCAGCCTTCTAGACAGTATGATCTCAATGATTATGTTAATCCAAACACATATGATGCATCGTTTACTCAATATGAGTACATTGATCCACAATTTAGAAATAGCTATCATCAACAACGAAGCTATAATACGCGTAATGCTCCAAGACACCACAATTATCAGTCTTCTAGACATTATGATCTCGATGATTTTATTAATCCACACCCAATTCATGCTTTTCAACCTCCTCTGCCCTACTATTATTCAGTCTTAGAATCACTTGGAGTAAATACCTATCCTCTCTCATATTATCAACGCATGGAAAATGCCAATAGGTCTCAACATGTCAACTTCTGGACTAGACTACTGAATTTTCGAGAGAGAAATTCGAGATTTCGTTTTCGTCCTCGAAATAATCATGATCATGGTGATGTACTGAAGTATTTGAAAATAAGAATCCATCATGCTCCTGAAGTAGTAGCACCTGATGTAGAATCAGATATCTGTGCTATATGTCAATCTGAATATGAAAACGAAGAGAATTTAGGAGCGTTGCAATGTGGACACGAGTATCATACAGATTGCATCAAACAATGGCTGATGAGGAAGACAGATTGTCCGATGTGCAGAGCTTCAGTTTTGCCTTCACAAGAACAGAAACTATAG >PGSC0003DMG400037745 ATGTTTTCGTTGAAGTGCTCTATTTCATTAGGCCTAGCTATGTGGCTAGGCATGTTATTCGACAAACAAAACGGTTTTTGGGCAGGGCTAACAGTAGCCAGTACTTTAGCACAAGGCAAATTAGCAACATTTACTCTTGCTAATGCTCAGGCACAAGGAATTACATTTGGATCAGTCTATGGAGTCTTAGTTTGTTCTGTTTTCCAAAAAATCGATAACTTAAGATTCTTACCTCTTCTCCCTTGGATCATTTTCAGCAGTTTTCTAAAACATAGCCGGATTTATGGTCCAACAGGAGGAATTTCTGCGCTATTAGGAGCCGTGATGATCTTAGGACGAAAAAACTATGACCCTCACAACGAATTCGCCATCATAAGACTAACAGAAACTTTCATTGGACTGTCTTGTTTCATCCTGGTAGAGTTTATACTGTACCCGAAACGAGCAGCCAATCTTGCTAGGAATCAACTGCATTGCACTTTAGATATTCTCAAAGAGTGCATGAACCAAATAGTACAAAAAGATCATCAAGAATTGCAAGAGTTAATGAAAAAACAGAGGAAATTAAAATCCAAAATCCAAGACTTGAAAAAATTCTGTTTTAATGCAGAATTAGAGCCTGGTTTTTGGTTCCTTCCTTTTAATGCAACATGCTACAAGAAGCTCCAAGATTCATTGTCGAAAATCGATGATTTATTTTACTTCATCATCTACAATATCAACAACATATCACATGATTTTCAAAACAGTGGTGTTGATTACAAAGAGCTACAAAAATGTATGAATGATGAATTGAAGAAATTGAAGGAAAGTGTGATTTCGTCGATAAGTACATTTCTTGATAAGCCTAGTTTGATCAAGTTGTTCCCAGATGATGATCTTGAAGAGGGGAAATTTAGTAAAATAAATGATCAAATAACAGATAGAGGAATAAGTTGTTGCTTTGAGAGATCAAAAGAAGTGATTGATAGAATATTGAGTAGACAAGAAAAAGAGGAACTAAAAGAAAAGTCAATTATTTCATTGTATGCTTTGGGATATTGTATAAACAACATGTTGAAAGAGATCAAAGATATTAAAATGGCTATGAAGGAATTGGCACAGTGGGAAAGGTAA >PGSC0003DMG400038189 ATGAGCTCCGCCGCAAGAACCACCGTGTCCGGGGCGGAGCACAACCGCATTATATGGTGGATGCAGCTGCACTCCGCGATTCGGACCGTGGTAGCATATAGTATAATCGGCTGCTCCACCCTATACGGACCACCTTGGTTAAAAAAATTCGCTACATTTCCAGCATTTGCATACGTAACAGCCACTCTCGTCACTAGCGAATCAACGCTAGGTGACACATTGAGTGGCTGTTGGGATGCAATACTCGCCATGGTGCAAACCATGCCGCTATCCATGCTTGGTGTATGGATAGCAACGACCAATGGACGCAACAGGCTGTCGCCTATTGCGTCCTCCCTGGCATTGGGGGTAACTTCGTTATTGGTGGCTATAGTAGAGTGCACACATATTAGGTGCAAAAAAATTGCTTTTGGGCAGTTGGTGCTTGTGTTTGCTGATGGTGTTATTCGTGGAGTGCATACGAGTGTTTTTGTTCACCCTCTTCATGTTGCATGTAGCACGGTACTTGGGATCGTTGTTTCACTTCTTGCTTTTTCGCTTCCGTATCTTATGAAGAATTTAATCAAGATCAGTATTGGGAAATTTTTTCTGTATTGA >PGSC0003DMG400000403 ATGGCAACAACTTCTAGCTTTGAATCCATTAGAGCTAGAGTTGTGTGGCGGACTTGCCTAGCTTCCGCCTTTCGAACCGCCTTGGCTTGTTCGATAGTTGGTGTAGCCACCCTTTTCGGCCCCGAAAGTTTCAAGACTCAAGTCGCATTTCCCGCTTTTTCCTACGTTACCGTTATTCTAATCGTGACTAATGCCACATTAGGTGACACTTTACGTAGTTGTTGGCTCGCGCTATATGCAACGATTCAAGGCGTTTGTCCCGCTATACTAAGCCTATGGTTGATCGGGCCGGGCCGACTCACGGCCAGCACGACTTCTACAGCTGTGGCGCTGAGCGCGTTCGTGGTGGTCCTGCCCGAAAAAACTCACTTGATAGCGAAGCGTATAGCGCTAGGGCAACTTGTGATTGTGTATGTCATAGCTTATATTAACGGTGCGAAAACCGAACCCGTTATGCACCCGGTTCGGGTCGCGGCTAGCACCGCCGTTGGAGTTGTGGCTTGTGTTTTAGCATTGTTGCTTCCTTATCCTAACCTTGCTTGTTGTGAGGTAAAAGAGAAAAGCAAGCTCTTCGTGGAAAATGCTACCGAGAGGATTAACTTGTTTGTGAAGGCTTTTTCAGCTGAAGACAACACTTCAGCACTTGCTTTAATTTCTCAAGCCAAGTCCTTAGTTAACAATGGACCCAAACTTCTCCAAGCCATTAAATCCAAGCAGGAAAGCATGAAGTGGGAAAGATTGCCTTTCAAGTTTCTAAGACCATATGGAGAGAATCCAGGGGACAAATTTCAAGAAATCCAAACACCTTTAAGAGGGATGGAAATTGCATTGGAAAATTCCCCTTCAATATTCCCAATTAGTATTCTCAACATAGAGCTAAAAGATGGTCTAGAAAAACTAGGAGATCACATCTCAAAGCAAATCAAGAACATGTCTCTAGACGAGTCGTCAGCAACTGTCCCAGAGTCAAATGCATATGATGCAGAAAAGTTCCTCCAAACACTTCAAACCATTCAACCAACAAAAAAAGACCTCCCCTCTTTATTTTTCCTTTTTTGCCTAAAATTGTTGTTACACAAACCAAGTTTCCCTTTATCATCCAAAAAAGGAGTTGACATTGAAATTGAATCCATTGGTTCCAACAAACAAGTTGATGAACATCAAGAAGGATTTATTAAAAAGACATGGAACAATTTGGCAATTACTATAAATAGTAGAAGATTTATGACATCTTTTAAATGTTCACTTTCTTTAGGCCTTGCTATATTTTTTGGATCAATTTATAGCAAGGAAAATGGATTTTGGGCAGGGTTGCCTGTTGCAATAAGCCTTGCAGCAACAAGAGAAGCAACATTTAAAGTTGCTAATGTCAAAGCACAAGGGACAGTATTGGGAACAGTTTATGGTGTCTTAGGATGTTTTCTCTTTGAAAAATTTGTGCAAATAAGGTTCTTGTCTTTGCTTCCTTGGTTCATTGTCAGCAGCTTCTTGAGCCGTAGCCGGATGTACGGCCAAGCAGGTGGGATTTCAGCAGTTATTGGGGCAGTACTAATTCTAGGTAGAAAAGGATTTGGTCCTCCAAGTGAATTTGCCATAGCAAGAATCACAGAAACATTCATTGGATTATCATGTTCCATCATGGTTGAAATTTTGTTCCATCCAACGAGAGCTTCAACATTAGCTAAAATCCAGCTCTCCAACACTTTCAAAATCTTGCACGAATGCATCGATTCAATAACCTTATCGTCCTCTAACAAAAACAACTCCGAGGAAATTCAAAAGAATCTGAAACTCCATGTAAATGAATTGGGAAAATTCATAGCGGAAGCTGAGGCAGAGCCCAATTTTTGGTTTTTACCTTTTAATAGTGGTTGTTATGGTAAGGTCCTGGGGTCCTTGTCAAAGATGATGGAGTACTTACTTTTTGGGTCACAAGCACTAAGATTCCTCCAACAACATTCAACAAGTTCAATCGACTGGAATAACTTAGATGCTGACCTAATGCTTTTTAAGGATTTAATAAGTACATCCACTAAATGTTTTGAGGAGGTTAGTTTGGTAAAATCACTCGCGATACTTGACAAGGAATTCGAGAAAAAGAAAAATTCAATGGATCTTGAATTGGGAAAAAAATCATCATCATCATATAATATAAGGTCCTCATCATCAAGTGAAGATGGAATTTTGACTTCTTATCTTCAACATTCAAATGAACTTGGGGATTATATAGTCAATGTTGGTGATAATAAAAATAGTGATGAAAAACTCAAAGGCCAATTGGTTTTAAGTTTGAGTGCTTTGGGTTTTTGCATGGAAAGTCTTGTGAAGGAAACTAAAGAAATTGAGAAGGTAATTAAAGACCTTGTACAATGGGAGAATCCATCATGTCATGTAAATTTGTATGACATTTCTTGTAAAGTAAGGGCTTTAGCCAATACTGAAACAAATTGA >MCO04G535 ATGCTGGACAAGCCCCTCTTCGGGCAGCAGCTCCCGTTCAAGACGTCGATCCCTCCCGCGCGGCTCGTGCCGTGGCCCGTCCGCGCGGGCCTCTCCGCGGGCCTCGCGTCGCTGCTCTCCCTGTTGAAAAAGACGCTGTTCAAGGACGTGGGATGGGACGACAACGTGCTGCCCGTGCCCGTGTTCGCCACGGTGGTCGCGATCGTGTGCACCGCCAAGACGCGCGGAGGCACCTACATGAACTGCTGGCACGTCATCAACGGAACCATCGCGGGCGCCCTCGGCTCCGCGCTGTTTCTCGCGCTCCTCGGTGACTCCGTCGCGGCGGTCATCGTCACCAACTCCCTCATCGGCGCCGGCGTTCTCTACCCCCGCGGCATCCCCGTGCTCGCGCAGAAGTTCGCGTTTGGCGGGTCCACCATCTGCGTCTGGGGCGTCTACGAGAACCTCGACTTCCGATGGCAGACCCTCGGGGTCCCGCTCTCCGCCGCGCTCGGCGCCCTCGCCGCCGTCATCGTCGCCCTCGCCCCGGAGACGTCCGCCATACGCTCCGTCAAGCGGGAGGCGGACAAAGTCGTGGATTTTCTCGAGGAGGCGCTCGACGACGCCGTCACCGCGTACGCGTGGCGATCGGACCCGTCCCAGCGCGAGATGCTCCGCGCCCGGGTGACAAACGCGTTGACGCAGGCGGAGGCGCACCTCTCGAAGCTCAAGGAGGCGGCGAGGGACGCGCGATGGGAGCGCAAGGTTCTGATCGGCATCGACATGGTGACCAAACCCGAGAAGGACCGCAAGAGCCACAAGAGCAAGGCGGAGGAGTTCATCCCGGTTTTGGCGGAGGTGAGCATGAGCCTCAAGGGCATGGAGCTCGCCCTCGAGGGATTGAACGCGGTTCAGGTGGACCGCTGGCACCTCCTCGAGGGCGGCGAAGACTCTGAGCGGGTGAAGGGCCGACCGGCGCCCATGTTCGACGGCGATCCCGAGGGTTCCCTCGCCGCCGTCAAGGACGTCGTGGTCCAGGCGATGCGCGACGCCATCAAGCCCAGGCGCCGCGACGACACGCAAACCTCCTCGCAGGTGGCGGCGGACCTCCGCGAATCCCTCACTCGGCTCGACGACGTCATCACCGAGGAGCGCAAGAGGCACTACGCGCCGAGCCAGGCGGCGAGTGACGCGAGGGAGACGGTGGCCAGGAAGGCTCTGCAGGCGAACCACCTGTGGATCTTCGCGTTCCAGAACCTCGCGGACAGGCTGCGGGCGCACCACGAGCCGACGTGGGCGTCGAGCCCGGGCGACACGTGCCAGACGTGCGCGCTCGCCGAGACGTCGCCGGCTAAGCCCAAGAAGGGGCCCAAGGGTCCTCTGGTGGATCCCCGCGACGAGATCTCCGCGCTGTTCAACTGCAACTTCAGGGCCAACTCCGACCAGGTGCTGTACGCGATGAAGCTCTCCACCGCGTGCGCGATCGCGGCGATCGTCGGCTGGATCGTGAGCGACAACGGCTCGTGGGCGGCGCTCGCCGTGTCGATGGTGGGCACTCGCGAGAGCCACGCCGTCGGCGGCTCCTTCAACGCCGCGCTCCTCCGCATGCAGGGCACCATCTTCGGCGCCATGTTCGCGTACACCATCATGTCGTGCGTTCAGGGCGAGCACGAGTCCTGGGCGGGCGGCGCGAGGCTCATCCTCCTCGCCGTCTTTAACTTTCTGTGCACGTTTCTCAGGCTCAACGCCGAATACTCCTACGCTGGCGTCGTCGCCGCTTTCACCGCGTACGTCGTGGCGCTCGGCATCCCCGACGGCGCGTCCACTTCCGAGGCGAGGGCGTACGCACACCTCCGCATCGAGCAGAACCTACTCGGCCTCGTCATCCTCGTCTTCATCGAGGTTGTCCTCCTGCCGACGTTTGCGCACGACGCCGCGAGGCGAGCGGCGAGCGAGGCGACCGCCGCCGCGGAACACGCCGCCGAGGTCATCTACGACGCCACCGTGGGAACTGACTGCATCATGTGCCGCGACCGCGCCGCCAAGGACGCGGGCGGCGCCCTCGATGACCTCCGCGATAAGCTCGCGACGCTCAACACCCTGCTCGTGCAAGCCGCGGCTGAGCCCCACCTGTGGTCGCCCAAGTTCCCCCTCGAGCCGTACCAGCGCATCGCGACCGAGACGGAGAGCGTGCGCAGGGTGCTCGGGCTGATGCGCGCGGCGCTCACGGCGATGGCCCACGGTTCACGCGGTGGAAGGACCGAGGGTAGCGGCGATCCGAGGCGCATGATCCGCGAGTTGCTGTCGCCCACGGATAGGTTCGTCACCGACCTTCGCAGGGCGGTCAAGCAGAGGCTCGGCCGCGCGTCGCACGACCTGGCGGAGGGCGAGGGTCACTGGGAGACGAAGAAGGCGGCGGCGTCCATCGCCCGCGCGCAGGCTTCGCTCCACCGCGCATTTATCCTGCACACGCTCGAGATTCGGGTGAGGTATCAGGCGGGCGAGGAGGACATGTTCCTCCCCAACCACCTCATGGTTCCCTGGCACGCGTTCATGTCCTGCACGGCCGTGCTCGCGCTCAACGTGGACAACCTGAGCCAGGCGTCGTGGGAGGCGCTCCTCGCGGTCAAGCCCCCCGTCGGCGGTGACGAGGAGGAGGATTGGGAGGACGAGCCCGAGGATGACGAGCCTTACTCGGGCGGCGGCGGAAAATACGACGACGACGACGACGACGTTAGACCGATCTCCGCCTCCCAGCCCTCGTTCAAGCGTTCGGGCAGCGGTAACAGCGGCAGGTCGGGCGATGCGCCGTACACCAACGGCGTCAAGTCCCCGGAGCAGTCCCTGGGAAGGCTGTGA >Migut.A00597 ATGGCGACCACTTCACAAATCCAATCCGACGACCGAGCAAGAGCCATGTGGCGGCGGTGCCTCGGCTCGGCCTTCCGTACCTCCCTGGCATGCACCATAGTGGGCCTAGCCACCCTCTTCGGCCCGAAGGCCTTCAACCGCCAGGTGGCGTTCCCGGCCTTTTCGTACGTGACGGTGGTTCTCATAGTCACGGACGCGACTCTAGGGGACACCCTGCGCGGTTGCTGGATGGCGGTGTATGCCACCGTGCAGGGCGTCTGCCCGGCCATCCTCAGCCTGTGGCTGATCGGGCCGGAGCGTCTGACCGCCACCACCACGTCCGTGGTGGTGGCGATCAGCGGCTTCGTGGTGGCTCTGCCGGAGAACACCCACTTGATATCGAAGCGCATCGCGCTCGGGCAGATTGTGATCGTGTACGTTATCGCTTTTATCAACGGGGCGGAGACGGAGCCCATTATGCACCCGATTCGTGTCGCGGCGAGCACCGCACTTGGGGTGGCGGCTTGTGTTTTGGCCTTGTTGTTGCCTTATCCTAGCTTGGCCTTTTGTGAGGTGAGAGAAAATTGCAAATTGTACATAGAAAATGCATCAGAAAGACTAAAGCTATTTGTGAAGGCCTTCTCAGCAGAAGACAAGTCATCACCCAAGGCCTTAATCTCACAAGCCAAGTCTTTGAACAAAACAGGAAATAAACTTCTCCACAGCATTAAATCGAAACAAGAAAGCATGAAGTGGGAAATAATACCGACGAGGTTTTTCAAATCACACGACGAGAATCCAGGGGAAACGTTACAAGGGCTCGAAACAATCTTGAGAGGAATGGAGAACGGTCTCGAAAACTGCTCCGAGTTTCAAGTCGGGCTACTGAATTCCGAGCTCAAAAAAGATTTAATTGGTTTAGAGGAGCAAATATTGAACCAAGTCAAAAGCATGTCGCCGAAAAACTCGAACGAAGAAGCAGAATTAAAGGGCAATAATAACAAGTTCCTCCAAACACTTCACGCGAACACGATAATCCCGTCGATTAGCTTCAAAGATTTGCCTTCTTTGTTCTTCATTTTCTGCCTCAAACTCCTCCAAACAAAATCGTCACAAGCACCGAATAATATTAACTCCCCGAAAAAGAAAGAATCATGGAGTAATTACAACCCGATCACCATTAACAAAAAAAGACTAATGCCCGCTCTAAAATGCGCGCTTTCGTTAGGGTTTGCGGTCTTTTTCGGATCGATATATAGCAAGGAAGACGGGTTCTGGTCCGGCCTGCCGGTAGCGATAAGCCTGGCGGCATCGAGGGAGGCAACGTTCAAAGTGGCGAACATCAAAGCACAAGGCACGGTTATCGGAACTGTGTACGGAGTAATAGGCTGCTTCGTTTTCGAGAAATACGTCAAAATCAGAATCGTTTCTCTCTTCCCGTGGTTTATTTTCTGCAGCTTCTTGCGGCAGAGCAAAATGTACGGCCAGGCTGGCGGAGTTTCCGCGGTGATCGGTGCGGTGCTGATTTTGGGGAGGAAGAATTTCGGCACGCCGAGCGATTTCGCTATCGCCAGGATCGTGGAAACGTTCATCGGGTTAACTTGTTCGATTATGGTGGATATTCTCTTGCAGCCTACGAGGGCTTCGGTTTTGGCGAAAGTCCAGCTCACGAAGAGCCTCAAGGCGTTGCACGATTCTGTCGGCTTCGTCGATCTCAGCTTCTCGAATAAATTCAGCTTCGAAGAAACGACGAAGAAGCTGAAATTCGAAGTGAGCGAGCTCGGGAAATTCATCGAGGAAGCTGACGTGGAGCCCAACTTCTGGTTCTTGCCTTTCCATAGTGGTGGATATAGTAAGTTAAAGGCGTCGCTTTCGAAGACGGTGGATCTATTGCTTTTCGGGAGCTGCGCGCTTAAATTCCTCGAAAACGAGTCGAAAGCAATCGACGGCGGGGTATGGAAAGTGGCCGCAGCGAAAATGGAGAGCGATCTCAACATGCTCAAAGACGCGGTTTGCTCGGGGATCAAGTGCTTCGAGGAGGTTAGTTTGGTAAATTCGATCGCGGCAATCGAGAAGGAGTACGGGAAGCGGAAAAGCGCGGTCGATCTCGAGATGGGGAAATCGGGGAGGCGGTACGCGATGCAGTGGACGGAAGCGAGCGACGACGAGATCAAGAAGAGCGTCGATTCGTTTCTCGAGAATTTGGATGGGCTTGTTGGGTGTATAGGGGAAGACTATCTGCTGAAGAATCAGGTGATATTGAGTTTGAGTTCGGTTGTTTTCTGCATGCATGGGATTTTGAAAGAGACGAGAGAGATTGAGAAGGCGGTTAAAGAAGTTGTGCAGTGGGAGAATCCTTCTTGCAGAGTTGATTTGCGTGACATTTCGTGTAAGCTACGCGCTTTGGAGAAGAGTGCGGCTGTTTGA >Migut.J00344 ATGAGAAGCCCGGCCAGGATCATGTGGGCCGCGCGGCTGCACTCCGCCGTAAGAGCCGCCTTAGCATGCGCCGTAGTAGGCGGCGCCACCCTCTATGGGCCCACATTCATCACAGACCAAATCAAATTCCCCGCCTTCTCATACGTAACAGTTATTCTCATAACATTCGACGCCGCCACCGTACTCGGCGGCTCACTCCGCGGCTGCTGGCACGCATTCTGTGCCACAGCTCAGGTGGTCCCGCCAGCCATGGCCGGGCGGTGGCTCGCCGGAGATAAGGCTGGTCTGTCCATCTGGATGGCGGCTCTGGCGACGGCAGCAGCCTCCTTCGTGATCGTGTTGCCTGAGTCGACGCATCTGACGGCTAAGAGGATCGCTCTAGGGCAGCTTGTGTTGGCGTGCACGGAGGCTGTTATTACAAGTGATGAAAGCAGTAGTGGATTTATGCACCCTCTACATATTGCTGCAAGCACTGCCTTGGGCGCATTGGCTTCCGTATCCGCTTTGTTGCTTCCGTTTCCTCGGCTCGCCCATTACGAGGTAGAGAAACTACGCCGAGTATATGCTGAAAATGCTCGTGAGAGAATGAATCTATACTTACGTGCTTTTAAAGCCAACAACAATCGGACCAAAACAGAGCTCTTATTACAAGCCAAGCCCTTTGCCGAAACAGGAAACAAACTTCTACAGAATATCACAATCTTACAAGAAGTAGTATGGTGGGAAAGACCTTGGAGCCATTACGTTATACACGACTTAATTAGCATCGAAGACCGATTAAGAAGCACGGAACTGACAATGAGAGGAATAGAATATTCCCTCGTTTATTCTCAAACATGTACACCAGATAATCAAGAACAACTCTCCAGTGTATTAGATAGTATTTCGTGTCAGCTTCACCACGAAATCGAGCATGCTATACTTCAAACGGAAGCCGCAGCACATGAAAAAAGAAGAGGAAGCACATTCATCGAAAAAAACCTCTCGTCACAACTCGCGCCTATACAAAACAAGCATGAATGGCTATGTTTCTTCTTCTCATGCAAAGATATATTGCTCAACGATACCAACGAAAATCGTAAACCCCAAACTCAACCTCAAAAAACAGAGTTCACCATCACCGAAAAAATCAAGAATTGGATCTTCAAACTCACCAGGAGTGACAGACTCGAATCGGCATTAAAGTGCTCGATTTCTTTAGGTCTTGCAGTGGTCACCGGTTTGATGCTAGAGAGAGAAAACGGGTGCTGGGCGAGCCTCACGTTAGCCACCGGCTTCTCCATAGGGAAGCAGCCCTTCTTCACAACAGCAAACTCTAGAGCACAAGGGACAGCTGTCGGATCGGTGTACGGCGTAATATGCTGCTTTATATTCCGTTACTTAGAACTACGGCTCGTATCCCTTCTCCCATGGATAGTTTTCTCCGTCTTTATAAGGCACAGCCGAATGTACGGCCAAACGGGCGGAATCTCAGCAGCTATAGGGGCTTCACTAATACTCGGGAGAAAGAAGTACGGCGCCCCGACCGAATTTGCTATTGCCAGAATCACGGCAGTTTTTGTCGGACTGTTATGTTTGCTTCTCGTTGAGCTTCTTATGCAGCCAAACAGAGCAGCCACTCTAGCCAAGAGACAGCTGTATCTGACATTGGAAGCCCTAAAGAATTCCTTAAACGAAACGGGATCTCGCAGAGTTTCCAAATTTTTACAAGCGAGAGAGAAAAATCAAAGAAAACTCGAGACCCTTTTCCAAGAACTGAGGAAATCAGTTGCGGATGCTGACTCGGAGCCCGATTTTTGGTGCTTGCCTTTTCAGACAACCTGCTACAAAAAGGTGGTGGCATCTTTGTCCTGTATAGAGAATATGCTGTACTTTCTCGAGCTCAATTTAGATTTAGTGTCGGAAACTTTAAGGCACGAGTTGAACGAGCAGGTTAATAATGAACTCGAACTACTCCAAGAATCTGTAAATTCTTTGCTGAAATATTTAGACAATGCTTCTTCGATCAAATCGAGGGATATTGAGGCGGGAAAGTCGCGAAACTCGGAGAAAGTAAACGCTTTGGTCGTAGAATATGAAGACAAGGAAAACGAGAAACGACGACAGGGCGAATGGGTGGTTCGATGTATCGGTGCTATAGGGTTCTGCATCGGTTCTATAAGGAAAGAAATAGATAATGTAGAGATCTGTGTAAAGGAAATAGTGCAATGGGAGAATTTTTCGACCAAATAG >Migut.J00345 ATGAGAAGCACCGCCCGGGTTATGTGGGCCATGAGGCTTCACTCCGCCGTAAGAGCCGCCTTACCCTGCGCCGTAATAGGCGGCACCACCCTCTACGGGCCCACATTCATCACAAACCAAATCAAATTCCCCGCTTTCACATACGTAACTGCCATTCTTATAACATTCGACGCCACCGTACTCGGCGGCTCCCTCCGCGGCTGTTGGCACGCATTCTGCGCCACAGCTCAGGTGGTCCCGCCAGCCATGGCCGCGTGGTGGCTCGCCGGAGACGGGGATGGTCTGTCCGTCTGGATTGCGGCTCTGGCGGCGGCAGCCGCCTCCTTCGTGGTGGCGCTGCCCGAGTCGACGCATCTGATGGCAAAGAGAATCGCTCTAGGGCAGATTGTGCTGACCTGCACAGATGCTGTTATTACAAGTGATGAAAGCATTAGTGGATATATGCACCCTCTTCATATTGCAGCAAGCACTGCCTTAGGCGCATCGGCTTCTGTTATCGCTTTGTTGCTTCCTTTTCCTCGGCTAGCCCATTTCGAGGTAGAGAAACTACGCCGAGTATATGCTAAAAATGCTCGTGAGAGGATGAATCTGTACTTACGAGCTTTTGACGCCAACGACAATCGGACGAAAACAGAGCTCCTCTTACAAGCCAAGCCCTTTGCTCAAACAGGAAACAAGCTTCTACATAATATCACTATCTTATTAGAAGTAATATGGTGGGAGAGACCTTGGAGCCATTACAGCAAACACGACTTAGTTAGCATCAAAGACCGATTAAGAATCACGGAACTCACAATGAGCGGAATGGAATATTCCCTGGTTTCTTCTCAAACACCAGATAATCAAGAACAATTCCCTAGTGTTTTTGATAGTCTTTCGAGCTATCTTCACCATAAAATCGATCAAGCTATACTTCCAATTGAAAAAGCACATGAAAAAAGAAAAGGAAGCACGTTCATAGAAGAAAACCTCTCTTTACCACTTGTGCCTATACACAACAAGCATCAATGCATCTGTTTTTTCTTCTCCTGCATAGATATGTTCATTAATAAAACCGCAGAAAATCATATTTCCCAAACTAAACCTCAAAAAACAGAGTTTCCCATCATCGAAAAAATCAAGAATTGGATCTTCAAACTCAGTAGGAGTGACAGACTCGAATCGGCATTAAAGTGCTCGCTTTCTCTAGGCCTAGCAGTGGTCTCCGGATTGATGCTAGAGAAAGAAAACGGGTGCTGGGCGAGCCTCACAGTAGCCACCGGCTTCTCCATAGGGAAGCAGCCCTTCTTCACGGCAGCAAACTCTAGAGCACAAGGGACAGCTGTCGGATCGGTGTACGGTGTAATATGCTGCTTTCTATTCCATTACTTAGAATTAAGGCTCTTATCCCTTCTCCCGTGGATAGTTTTCTCAATCTTTATAAGGCACAGCCGAATGTACGGTCAAACAGGCGGAATGTCAGCAGCTGCAGGTGCGTCACTAATACTCGGGAGAAAGAAATACGGGCCTCCGAGCGAATTTGCTATTGCCAGAATCACATCAGTTTTTGTCGGGATGTTTTGTTTTCTTCTTGTGGAGCTTCTTATTCAGCCAAACAGAGCAGCCACTCTAGCCAAGAGACAGTTGTATCTGACATTAGGAGCCCTCGAGAATTCCTTAAACGGAACGGGATTTCGTAGAGTGCCCAAATTCCTACAAGCAAGAGAAAAAAATCAAAGAAAATTTGAGACTCGTGTCCAAGAACTGAGTATATCAGTGGCGGATGCTGACTCGGAGCCCGATTTTTGGTGCTTGCCTTTTCAGACATCCTGCTACAAGAAAGTGGTGGCATCTTTGTCCTGTATAGTGAATATGGTGTACTTTCTCGAGTACAATTTAGAAACACTGTCGGAATATCACGAGCAGTTGGATAATGAATTGGAACTACTCAAAGAATCTATAAAGTCTCTGCTGAAATATTTGAAGGTGTCTTTGGTCAAAACACCACCAGTGGACATAGAAGAGAAATCGAGGGAAATTGAGGCGGGGAAGTTGCGAAACTCGGAGAAAGTAAATGAATTGGTCATAGAATATGAAGAGAAGGAAAACGAGAGACGACACGGAGAAACGGTGGTTCGGTGTATGGGTGCTATAGAGTTTTGCATCAGTTCTATGAGGAAAGAAATAGATAATGTAGAAATCTATGTAAAAGAAATAGTGCAATGGGAGAATTATTCGACCAAATAG >Migut.L01934 ATGGCGAGCAGCACGGTGGCGGAACGATCGCGCATCATGTGGTGCATGCGGCTGCAGTCGGCCTTACGAACCGCGATGGCGTGCACCATAATAGGGTGCGCCACCATCTACGGCCCGGAGTTCCTCGTCAGCGAGATAAGATTTGCGGCGTTTTCGTATCTGACGGCGGTGCTGATAGTATCCGACGCGTCGCTGGGCGACACGATGAGCGGGTGTTGGCATGCATTTTGTGCGACGGCGCAGGTGGTGCCGCTCGCCGTGCTGGGGAGGTGGCTGGTTGATCCGACAGAGGGGCTGCCGCTGGGTTATGCGGCGGTGGCTGTTGGGGTGGCGGCGTTTCTTGTGGCCATGCCGGAGTGCACGCATTTGACGGCGAAAAGGATTGCGTTTGGGCAGATTGTGTTGGTGTGCAGTGACGCCGTTATTGGTAGAGACGGAAAAAGTGACGCGGCGTTTATGAACCCAGTGTATGTTGCGGCTAGTACCGCCCTTGGTGCTTTGGCTTCTGTATTGGCGTTGCTGATACCGTACCCGAGTTTAGCCTGTCACAAGGTACAAAAATTGTGCAGAGTATACGGTGAAAACGCTTCACAGAGGATGAATATATACATGAGAGCATTTAGCGCGCGTGACAACCACACTAAAACAGAGCTTATATCTCAAACCAAGCCCTTGTCTGAAACAGGGGACAAGCTTTTGCAGACTATCATTATCTTACAGGAAGGAATGAAATGGGAAAGACCTTGGAGCCGATATCTGGAGCCAAATAAAGTCAGCCCCGGTGAAATATTGCAAAACGTTGAACTGCAAATGAGAGGAATAGAATATTCCCTGGTATCTTCTCCCGTGCAAACAATCGATCAAGAACATCTCTCCAACGTATTGCAGGGTTTATCTATTCAGCTCGAAAAGAGACTAGAGCAACTTACGTGTTCTTCTCCTTACAACTCGAGCAAAGAATCAGAAACGAGAGGAGAATTTACGGAACAGCCATCATTACCGATCGAGGCAATGTCCCCAATACTCGAGCACGGATGGGCATTTTTCTACTTCTCCTGCGTAGATATGTTGCTGAGCGATTCTTCCGCATCGCCAAAATATCTCCAAACTCAGCCTGCAAAAACAGAGGATTTCAGCATTTTAATAAAACTCAGGAATTGGATTTCGAAAATCATAAAAAACGGGAGGCTGGAATTTGCCCTCAAATGCTCACTCTCGTTGAGCCTAGCAGTGCTATTTGGATTGATATTCGACAAAGAAAACGGCTGCTGGGCAGGTCTCACGATTGCAATCAGCTTTGTCACAGGCAGACAAGCAATCTTTACAGTAGCAAACACGAGAGGACAAGGCACAGCCATTGGATCGGTGTACGGTGTAATATGCTGCTTCCTCTTTCACTCGGAAGAAATGAGGCTATTAGCCCTTCTTCCATGGATCGTTTTCACCTGCTTTTTGAGGTACAGCAAATTGTACGGCCAAACAGGGGGGGTGTCGGCAGCCATTGGAGCACTGTTGATAGTCGGCAGAAAGAATTACGGGGTTCCAAATGAATTCGCCATTGCCCGATTAACAGAGGTTTTTATCGGCCTTTCAGCTTTCATTCTCGTGGAGCTTTTCCTGCAGCCAATCAGAGCAGCCACATTAGCCAAGAATCATTTATCTCTAACGCTGAACTCACTCGAGGATTGCGTAAAGGAAATCGGATTTTTTCCAGTGCAGAAAAATCAATTTCTCGAACTGAGAGAGAAGCAAAGAAATCTCAGTTCCTTAGTCTGCGAGCTAAGGAAATTCGTAGCGGATGCTGAGCTCGAGCCCGATTTCTGGTATTTGCCTTTCCGTGGTTCTAGCTATCAGAAGTTGGTCGGTTCTTTGTCGAACATAGTGCACATGTTGTACTTCATTACGTACAACTTCGAAATACTTCTAGAACTATCCGAGAAAAGCAACGTGTGCAAGGAATTCCAGGAGCAGATAAGTAACGAACTGGAATTATTTCAAGAAACGCTAAGCTCGTTACAGGTATATCTGGAGAAGGCCCTTTCTACTGAATCTCAAGCCGACACTAACGGGAGCATCGATGAGAAGTTCAGAGACCTTGAAATGGGGAAGCCACAAAATCGAGAAAAACAAAGTGTTAGTATCATCGCAGAAAATAAAGAAACGGAGATGAGTAGTGATGAGGTGGAGAGTGAAGAATTAAGAGAGAGAATGATTCGATGTTTGGGTGCGACGGGGTTTTGCATCAGTTCGTTGATGAAAGAAATAGACGATACCGAGATGTGTATACGAGAGATAGACCAATGGGAGAGTTAG >AL3G20630 ATGCGCGACACAGCATGGCTCGAGCGACTTGGCCTGGCTCTGCGAACCGCCATGGCTTGTCTCATCGTGAGCTTAACCACTTTGTACGGTCCCAAACCACTAAGACACTTCACAACGTTTCCAGCCTTTTCTTACTTGACCACAATCCTGATCTGGCTCTCTGATGCTGAACCAACATACGGTGAAGTACTCAAGTGCTGTCTTGATGTCTCTTACGCCACTTTTCAGACAATAGCCATTGTGCTAGTGAGTGTCTTGGTGGTTGGACCAGCTTCACTAGGGAATGGCTTGGTGGCTCCAGTTGCTGTGGCTCTAGCTTCATTCTTAGTGGCTTTCCCCGTGTCCACAAGTCTGCTGACTAAACGGATTGCCTTTGGGCAGATCGTTGTTGTCTACGTGACTTTTGTGGTGTTCAATGGAGAGGTGGCTCATGTTTTCATGCTCCCGGTTCATGTGGCGGGTAGTACAGCACTTGGAGCCATTGCTTCTCTCATCGCAGTGCTTCTCCCGTTTCCAAGGCTGGCTCATAGTCAGATGAGTAAGGGTTGCAAATTATATGCTGAAAATGCTCTTGAGAGGGTGAATATGTTTGTCGAGATCATGATGGCTCGAGACAACACCACAGCTCAGGCTTTGCTCGCAAGGGCAGCTTCATTGTCTGTAGCAGCTAAAAACACACTCAAGAACATCAAAATCCACCATGAGCGTATGGCATGGGAGCGACCAGATACAAGATTCTTGAGAAGGAAGCAGAAGTTGGATCCTGGAGAGAAACTCCATGCAACAGAATTTCTGATGAGGGGACTGGAGCTGGCATTGGGTTCTTGCAGTTCCTTTCCTCAAAGCATGAGCCGCGACGAACTGACTTGTCTTTTAGAAGGTCCCAGAACACAGATTGCTTCCAATTCGGCATCTACTCTCAAGTCCCAAGATAGTCTAGGGTGGCATCTTGAGGCTGGGTCTCTGTCTACTGCAGCTTTACCCGTTTGCTTCTTCAGATATTGCGTAGAACTCTTCCGAGGTGATTTCTTATCTTTGAGACAAGACAGTAAATCCGTAAATATAAGTAACACAGAGGAAGAAATTCACCCAGAACACGAAGGATTGTCCATGGCCAGAAAGGTTTGGGACATTCTATGTGTCTGGATGGCCAGAGAAAGGTTTGTTTTTGCATTCAAGTGCTCAATTTCCCTAGGCCTCGCGGTGCTGTTTGGTATAATGTATAATAAAAAGAACGGGTATTGGTCGGGTCTAACTGTAGCCATTAGCCTTGTAAGCGGTAGGCAAGCAACATTAACAGTAGCAAATTCTCGTCTACAAGGGACAGCGATGGGATCAGTCTACGGTCTAATATGTTGTTCTGTTTTCCAAAGACTAGAAGAATTCAGGTTCTTACCTCTGCTCCCTTGGATAATCTTGGCCGTCTTCATGAGGCACAGTAAAGTCTATGGCCAACCTGGAGGAGTTACAGCTGCAATTGCTGCACTGTTGATACTTGGAAGGAGAAATTATGGAGCTCCAACCGAATTTGCAATCGCTCGCATTGTTGAAGCTTCAATCGGGTTGCTCTGTTTTGTCTTCGGGGAGATTCTTGTCACCCCTGCAAGAGCAGCAACTCTTGCAAAAACCGAACTTTCACACTGTCTCGATGCCCTCTTAGATTGCATCCAATCACTGGTTCTTTGTTCTGAGCAGAAGAACCAGAAAACGTCAGTGGTAACAGATTTGAGAAAAAGGCAGGCAAAACTCAAATTTCATGTTGAAGCATTAGAGAGGTTAACAGCAGAAGCCTTAACAGAGCCTAAGATTCCATTCCTCTGTCCACTCAACGCGGTCAGTTACAACAAGCTTTTGGGCTCTTTCTCGAAGATATCTGACCTTTGTCTGTATGTTTGTGATGGCCTCAAAAATCTATCTAGAGTTCAACCAACACTAGGATTTCCTTGGGACAACATCACTCATGAGCTAAGAGCCTTTCAAGAAAAGCTTCACCCATCGGTGAAATGCTCTTTAACCAAGTCTCAAGCAAGACTCCAAAAGGAGTTGCAGAAAAGAAAGATCTGCCATGATGTTGAAGCAGGAACAACATCCAACGAAAACTACTCAAACATGGAGTTGGGTCCAAGCCAGGATGATGCAGAGAGGTTTTCGGTTTCTTTCGTAATGCTACTGAAGGAAGCAACTGACAAGATAAGTGATAACACAGCTGAAGAGGTCCTCAAGAGTGAAACTGCTCTATGTTTGAGCAGTCTAGGGTTTTGCATAAGTAGATTGATGCAAGAAACAATATGTATTATGATAGAAATAACCCATACAACTTGA >AL4G23310 ATGCTAATGACGGAGAGAGGCCGAGCCATGTGGCGCACGTGCCTAGCCTCAGCGTTCCGAACAGCTCTAGCCTGCACAATCGTTGGCTCAGCTACACTTTACGGTCCCGAATGGATCAACCGCCACGTGGCATTCCCGGCCTTCTCTTACGTCACTGTTATCCTCATCATCACCGATGCTACACTCGGAGACACGCTACGTGGCTGCTGGTTAGCTCTTTACGCCACGTGTCAAAGCGTGGGACCTGCGATCATCACGTTAAAGCTTATTGGACCAGCTCGTCTCACGGCCGAAACTACGGCTCTCGCTGCGGCTCTAGCGGCGTTCGTGGTGGTGCTACCTAATAGTTCGACCCACTTGGTGGCTAAGAGAATCGCGTTAGGCCAGATCGTTCTCATTTATGTTATTGGTTATATAAAAGGAGCTGAGACTGATCCAGTTATGCACCCTCTTCAAGTCGCGGCTAGCACCGCGCTTGGTGTTGTAGCTTGCGTTCTTGCACTACTCGTCCCACTTCCTCGCTTGGCTACTTGTGAGGTGAAACAAAGCTGCAAAGAGCTTGGTCAAAATGTAACAACGAGAGTGAAGTTGTATATGAAGGCATTTTGCTCCGATGATGCCATGTCTGCAACGGCTTCAGTCTCACAGGCTCGAGTGTTGGCTCGTTCTTCCTCTAAGCTTTATCAAACACTCAAACGTTACCAACCAAGCATGACATGGGAGAGGCTTCCATTTAAGATATGGAGGTGGCAAAACGTGAATGATAACAAAGGAGAGAAACTACAAAGCATGGAAATTGCTCTTAGAGGAATGGAAATGGTAGTCGCAAGCAAATCTCCTATTCCTTCGAGCTTACTTGCGGGTGAAGTAAAAGAAGATCTCAAGAATATACAAGAACGTGTGATTCTCTCAATCAAACGAGTTAACAATAGTCGGCAACCGTCGGTAACACCAGAATCCGATCCGAAAAAACCTGATGAGTGCCTCCAAACACTTCAGGAAATCCCGGAAACGCCTCAAGATTTACCCTTTTACTTCTTCTTGTTCTGCATCAGGCTCCTTGAAATCATCACAATGGCTAAACCGGAGGAGAACAAGGTCAAGGTCTTAGAAAAATCCAAAACTAGATCTTGGATAAGTGATTGGGACAGCAAGAAGGTTATGCCCGCGTTGAAGCTATCGCTTTCATTAGGCTTAGCGATTATGCTAGGTTCAATGTTTAGTAAGCCAAACGGGTATTGGGCTGGTTTACCCGTAGCCATCAGCTTCGCAGCGGCGAGAGAGGCGACGTTTAAAGTGGCGAATGTGAAGGCACAAGGGACAGTGATAGGGACAGTGTATGGAGTGATGGGATGTTTTGTGTTTCAGAAGTTTTTGACGGTTAGGTTTCTTTCTTTGCTTCCATGGTTTCTCTTCTCTAGCTTCTTGAGCAAGAGCCGGATGTACGGACAGGCCGGAGGGATATCAGCGGCGATAGGAGCCGTTTTGATTCTTGGAAGAAAGAATATCGGGCCACCAAGCGAGTTCGCGATCGAGAGAATCATCGAGACTTTTATTGGGTTGTCTTGTTCGATCATGGTGGAGCTTGTCTTTCAGCCCACGAGAGCCGCTAACATAGCGAAACTTGAGCTCTCTAGAAGCTTCCACGCTTTGTACGAGTGTGCAAGCTTGTTTGGAGCTAAAGCTAGTAAAGCGGAGATAATGGAGAGTCAAAAGAAGTTGAGAAGTCATTTAAATGAGCTCAAGAAGTTCACAGCAGAAGCCCACGCAGAGCCAAGTTTCTGGTTTTCGCCTTTCAACTTTTCTTGCTACGAAAAGCTTTTCAAGTCATTGTCTAAAATGGCTGATCTATTGCAATTCAGTGGTTACGCGATAGGCTTTCTTGGAGAACAAGGAAAAACAAAATCACCACAGTGCAAAGAGATTCTAAGCAACGTAGACAAAGATCTGAAGAGTCTAACAGAAAGCATAGCTCTTTTAGCCAAATCATTCGAGGAAATCACTTTGCTCAAATCACTAGACGCCCTCGGAAAGGCGCTTGCAAAGAGCGACAACACCTCATGGGACATTGAGCTCGGAAAGACACCAAACCCTAGCTTCTCAACCGCGGTGAGCGAACCGGAGAAGATATTAGAAACGTATCTCCAGCATTGTAGAAGCGTTGCGGATGGAATATTCCGTGTGGAAGAAGGTGGAGAAGAAGAGGTTAAAGTGGACAAGAGTGAGGTTGTGTTGAGTTTGAGTGCATTAGGGTTTTGTGTGGAGAGAATTGGGAAAGAGACAAGAGAGATTGAGGAGATGGTTAAGGAGGTTCTGCAATCGGAGAACCCTTCAAGCCATGTTAACTTGCATGAGATCTCTTGCAAAATACGTTCTTTGTATAAATGA >GSVIVG01034199001 ATGCTGTCGCTCGCCGCTGTAGCAAGGGGCCCGACCCATGCGGTGTGGCTTTGCCGGCTAGGCTCTGCGCTACGGACAGTCCTCGCATGCTCCATAGTGGGCTGCACCACCCTCTTCGGCCCACCTCCACTCCAGCGCCTGTTAGCCTTCCCGGCATTCTCTTACGTGACGGCCGTGCTGATCGTGTCCGACGCGAGGCTCGGGGACACGTTAAGGGGATGCTGGCACGTGCTGTGCGCCACAGTGCAGGTGGTGGTTCCTGCCATGTTGAGCCTGTGGCTGATCGGAGCGGGGCAGTTGAGCACCGGATTGGCGGCGGCGGTGGTGGCGCTGAGCGTGTTTGTGGTAGGGTTGCCGGAGTGGACACATCTGATGGCGAAGAGGATTGCGTTTGGGCAGATTGTGATCGTGTACGTGGGTGCTTCTATCATTCACGAGGAGGGAGCAGGAGCCTTCATGCACCTCCTCCACGTGGCATCTAGTACGGCACTTGGAGCCTTGGCTTCTGTCCTCGCTCTCTTGTTGCCCTACCCTCGCCTAGCGTCCAGCGAGGTAAATGAAATATGGAAGTCCTACGCAGAAAATGCTTCAGAGAGGTTGAATCTGTTTTTGGAGGCATTCTCCGCCCCAGACAATTCCGCAGCATTAGACTCAATTTCTCAGGCCAAGTTCTTTTCTGAAAGGGGAGACAAGCTTCTTCAAACCATTAGACTCGTGGAGGATGGCATTCTGTGGGAGAGACCTTGGACAAGATTCTTCAAACCCCATTGCTTCGACCCAGGTGATAGATTGCAAGCCATCGAAATACCATTACGAGGGATGGAGATTGCTTTATCTTCTTTCACTTCCTTGCCCACTGCCATTGCTGATGACGAGCTCGGAGATGCTTTACAACGAGTGACTCTGAATACCAGCCTAAGACTTGAGCAAGCTAAATGCTCCCAACCTCTTGCTTCAACAACAACAGACAGTCCACATTTTGTTCTTCCAGCAATGAGAGAAAAGCAAAACAAGCTGAAAATGAATGTCAATGAATTGAACAAGTTCATTGGAGAGGCCAAGTTGGAGCCCAATTTCTGGTTCTTGCCTTTCCAAGGTGCTTGTTATTCGAAGCTTTGGGAATCTTTATCAAAGGTGGAGGATCTCTTGCTTTTTGTGGCCCACAATATTGATTTCCTCTTACAAGCATCACAGAAATTTGAAGTGTCTTGGAAAGAGATCCAAAAAAATATCCACAGTGATCTAGAACTTTTCAAGGAAACAGTGGCTTCTTCACTCAAATATCTTGTAAAGATCACTTCCATTGAGTCACTTACATTACTTGAGAAGGAACTGCAGAAGAAGATAATTGCCCATGACCTTGAACTGGGGAGACCACCAAATGCACACTGGGTTTGGAGTACAGATGATGAGGAGATAGAAAAAATTCTCGCTTCTTTTCTTCAGCATTCAGAGGAGATAATCAATGAAATCCACACTAACAAAGATAAGGAGGAGCTCAAGAGCCAGATGGTTCTTTCTTTGGGTGCCCTAGGGTTTTGCATGGGTAGTTTGATGAGGGAAACAAGAAAGATTGAGAAAGGGATACAAGAACTAGTTCAATGGGAGAATCCCTCAAGCTACATAGATTTTTCTGAAATTTCCTGTAAGATCAATGCCCTGTATGTATAG >GSVIVG01025002001 ATGTGGCTCTCTTGCTTAGCTTCCGCGTTTCGGACTGCATTAGCTTGCACAATAGTGGGCTGCGCCTCCCTCTACGGCCCCGCTTCACTCCGCCGCCAGATAGAGTTCCCTGCTTTTTCGTACGCCACTGTGATCATCATTATCAACGGTGCGACGCTGGGAGACACCGTGCGGGCCTGCTGGCAGGCGGCTTACGCAACGGTGCTGGGTGTTTGCCCGGCGATATTGAGCCTGTGGGTGATAGGACCGACGAGATTGTCGATCGGGAACATGGCGGCAGCGGTGGCGCTGAGTGCATTTGTGGTGGGGCTGCCGGAGTGGAGTGGGTTGGTGGTGGAGAGGATAGCGCTGGGTCAGATTGTGATAGTGTACCTTCTGGCGCTGCTGAAAGGCGGGGAAACTGATGCCGTCATGCATCCTGTACACGTGGCAGCCAGCACTGCCGTTGGGGTGCTGGCTTGTGTGCTTGCTCTCTTGTTTCCGTACCCACGGCTGGCTTCTTACGAGGTGAAACAGAAGTGCAAGCTATTTGCTGAAAACGCTTCAGAGAGGCTGAAGCTCTTTGTGAAGGCATTCTGTGCAGAAGACCACGCATCAGCACTTTCATCTATTGCTCAAGCTAAGCGCTTTGCTGTTGCAGGAGCCAAACTTCATCATAGTGTCAAACGCAGACAAGGAAGCATGCAGTGGGAGAGACTTCCTTTGAAAATGTTCAAACCATGTTACAAGAACCCAGGAGAGAGACTGCAATGTATACAGATGCCATTAAGAGGGATGGAAATTGCTTTAACCAGTTCTCCCTCATTTCCGGTGAGAATAATGGATGGAGAGTTGAAACAAGGTCTAGTTCAACTGGAGGAGCACCTGAGCCTCACCCTAAAACAACTGGAACTTAAGTGCTCTTCCCCCAGTGATTCATCAACTGTTCCAGAATCAACCGCAGAGAATGTGGTGAAGTCCCTCCAGAACTTTCAAACCATCCCACCAACCCACAAAGAGTTGCCCTATTTTTTCTTCTTATTTTGCATGAAACTCCTCCACAGTGAATCAATGGCCAAACCCTTTAATTCTTGTCTTCAACCCAACTCTGTTGGTAAAAATGAAGGGGTGGATGATTCAGTAGACCGCAGTAGGCTCATGCCAGCATTGAAATGCTCACTTTCCTTGGGGCTCGCTGTTCTATTCGGGATGATTTATAGCAAGGAAAACGGGTTTTGGGCGGGACTCCCAGTAGCCATCACCTTTTCATCTGCAAGAGAAGCAACGTTTAAAGTTGCTAATCTCAAAGTCCAAGGGACAGTGTTAGGAACCGTGTATGGAGTATTGGGTTGCTTCGTTTTCGAAAGGTTTGTGAAACTGTGGTTCATATCGCTTTTTCCTTGGTTCATTTTCACAAGTTTTTTACAGCGTAGCCAAATTTACGGCCAGGCCGGTGGGCTTTCCGCTGTCATTTCTGCAGTACTAATATTGGGAAGGAAAAATTTCGGTTCCCCAAGTGAATTTGCTATTGCAAGAATCGTTGAAACCTTCATTGGATTATCTTGTTCAGTCCTTGTAGATATCGCTTTGCAACCCACCAGAGCTTCCACTCTAGCAAAAGTTCAACTCTCTAAATGTCTAGAAGCCTTGCACGATTGTATTTGCTCAATATCTCTTTGTGCCAGCAAATCCAATTTAGAAGAGAATCACAAAGTGCTGAAATCCCATTTAAATGAGCTTGGGAAATTCATTGGAGAAGCTGAGGTGGAACCCAACTTCTTGTTTTTGCCTCTCCATAGTGCTGCCTATAGTAGACTCTTGGTGTCTTTGTCAAAGATGGCCGATCTTCTGGTTCACGTGGCACATGCACTGAGATTCCTGGAACAAGAAACCTCAAAACCTGAGGCTTCATGGAAGGATGCTGTAGATAAGGTTGATGGAGACCTTAAGCCTTTTAAGGAAATGCTTGCCTCCCTAATTAAATCGTTTGAGGAGGTCGCCAGCATCAAATCACTACCAGCACTAGAAAAGGAGCTTGAAGAGAAGAACATCAGCTATGATCTTGAGATGGGAAAATCACCAACTACAAATTTGTCTAGACTTGCTGGTTCAGGCAATCGTGAAGATGAAATGGAGAAGATGATAAGCTGTTATCTTCAAAATTCTAAGGAAATTGTGGAAGGTGTGGAAGGTGAGGAAGTGAGGAGCCTAATGGTATTGAGCTTAAGCGGCTTGGGGTTTTGCATGAGCGGCTTGATGAGAGAGACAAGAGAGATCGAACAGGGAATAAAGGATATTGTACAGTGGGAGAATCATTCAAGCCACGTAAATCTGTATGAAATCTCATGTAAGGCGCATGCTTTATACAATTGA >TPR.G35242 ATGTCACAAACATCAACAATTGCTAAAACAAGAACAGAGCTAAGTCGAACTCGTCTGGGCTCGGCTCTAAGGACATTCTTAGCATGCAGCATAGTTGGTTGCACTGCTCTATATAGCCCTCAACCTATAAGACATTACATTAAATTTCCATCTATTGCTTATGTGACAACAATTCTTATAGTGTCCGATGCAACACTTGGTGACACTATTAGAGGTTGTTGGCATGTTTTATTGGCAACCATTCAAGTTATGGTTTTTTCTCTACTTAGCTTACAAGTTATAAGACCGGGTGGTCACTTAGGCGATTATATGGCTGCGCTGGCTGTGGCTACCGGTGCGTTTTTTGTCGCGCTGCCGGGATCGACACACTTGTTAACTAAAAGGATTGCATATGGACAACTTGTGATTGTTTATGTAAGTACAGTTCTACATGGTGCTCAAGAAGGAGTGGCTAGACAATCAATTTATGTGGCTTGTTCCACTGCACTTGGAGCTATAGCTTCTGTTTTGGCCATGTTGCTACCTTATCCTCGATTTGCTTACAATGAGGCTAGGAAATTCTACCAATTATACTCTGAGAATACATCTGAGAGATTAAATTGCAATATAGAAGCCATCTCTGCCTCAGACAACTCAACTGCTGTTGGTTTTATAACTCAAGCCAAGTACCTCTCCACAACAGGAACCAATCTCCTCAACAATATCACAACTACACTGGATGGTATGCATTGGGAACGACCTCAAACAATAATTTCCAACTCCAGTTGCAATGACCCAGAAGAGAAACTGCAAGATTTGGATATACCAATTAGAGGGATGAACATCGCTCTGTCGAGTGGCATTTCTTTTCCTGTTGGTGTCATTGATGAAGAGCTCAAAGGTGTTCTGCATAATTGCAGAGGACAGATCAGTCAAAAATTAGATCAACAAGCTGAGTGCTTTGTTCCTTTTGATGCAACCACAACTCAAGAAATGAAACAAGATATTTTCGACAAATACCATTCCATAGCCTACAAACATCTCCCAACCTCGTTCTTTTTATATTGTGTGCAGCTTCTCCTAGATGACTTGTCTATTTCGAAGAAAACTGACCATGTGCAGAAGAAAGCTCAGAAAAGCGATGATTCCGAGTGGTGCTTCAACAGGATAAGACAGCTTTTGATGAACTTGATTCCGAGCAACCAAAGCTTGGTCTTTGCATTCAAGTCCTCTCTGTCATTAGGCTTTGCTGTGTTGTTTGGTCTGTTATATGACAGGGATAATGCATATTGGTCAGGACTCACAATTGCAATCAGTTTTGTGACTGGACGACAACCAACATTCGCAGTTGCAAATGCACGAGGACAAGGAACAGCTATAGGATCAATCTACGGGATCATTTGTAGCTTCATTTTCCAAAAAATTTCCCAAAAATATATGGATTTAAGGTTCTTAGCTCTTATACCATGGGTCATGTTCGCTTCTTTTCTCAGGCATAGTAAAATGTATGGTGAATCTGGAGCAATTTCGACAGTTATAGGGGCTTTGTTGATCCTTGGTAGGAAGAACTATAGTACCCCGACTCAGTTTGGAATTGCTAGAATGGCCGAAGCTACAATAGGACTCACTTGCTTCATCATTGTAGAGATTATATTAAGTCCCTCAAGAGCTGCAACTCTAGCAAAATCAAAACTTTCTCAAACCTTGAGCACGCTTCAAGATTGCATTAAGCAAATTGCCATGATTACCCCCAGCGAAAGCGAAAGAGATATGCCATCTTCAAGTTATCAAGCACTGAGAGAAGAACAGAAGAAGCTTAAATCTCTTGTGTGCCAGTTAAAAGAGTTTACAGCCGAAGCTGAGGTGGAGCCAAATTTCTGGTTCGTTCCATTTCATACTGCATGCTACAGCAATATGCTGGGATCTCTATCAAGGATGGTAGATCTCTTGCTTTTTGTGGCATACTCAATGGAGCATGTCACACAATTGGCACAGAAAGATGGAGTAAGTTGGATGGACATCCAAGGTCGAGGGAACGAGAATGTGAAGATTTTTAAGAACAAAGTTAACCCCATATTGAAAAGTCTGGAAGAGATAACAAGGATCAAGTCTATTAAGAAACTTGAAAATGAGTTGAAGAACCAAAATGTTCCTCAAGATCTCGAGTCACAAGAATATCCCAATGCAGACGCATTTAGCATCTTAAGCAGAGATGATGAGGTTGATAGCATTACAAACTCTTTCCTCCAACATCTAGAGGAAATTGCTAACAAGATTTATACTGACAAAGATGAGGAGATGCTTAAAGTTCAAATGCTTTTTCATTACAGCTGCCTGGGATTCTGCACCAGTAGCTTGATGAGAGAAACAATGAAGATTGGGGGTGAAATAAAAGAACTACTTATGTGGGAGAACCCCTCAAGTCAAACAAACTTCATCCAAAAAAGATCCCAGTAA >TPR.G34277 TTGGTTTATGTGGTGGCTTATGCTAATGGCGTTCATATTGATACTTTTATGCATCCTATTCAATTGGCTGCTAGTACTGCTTTAGGTGTATTTGCTTGTGTTGTTGCATTGCTTCTTCCTTACCCACGATTTGCTTGCTACCAGGTGAACAAAAACTACAAGCTATTAACGAATAATATCTTGAAGAGATTGAAGCTACTAATAAGTGTAATTAGTGAGGAGGAAAGTATTTCTGCACAAGGATTAATCTCTCGTGCTAAGTCTTTGGCAACCAAGCGAACCAAGATCTTTTCAACCATCATGCGCTACCTAGATGGCATGAAGTGGGAGAGGCTTCCCATTAAATTTTTCAAAGCACATTACAATAGCTTGGGGGAGAAACTTCAAGAGGTAGNNNGTGGTTCACTTACTGTTCCTGAATCCAATCCCAAAAACATAACACATTTTCTTCAATCCCTTCAAACCATTCCAACATTTCACCAAGAATTACCCATCTTTTTCTTCCTATTTTGTGCCAAACTCCTTCACGTGAAATCATCAACCGAAGACCCAACTAATGCTGAAGCCCAGCCCACTAAGAAAAAAGAAAATTCTCCCGAAGGCAAGGATAAATGGGCTAATTTGGCCACAAAATTAAAAAGCTCAAATCTTCTCCCGGCAGTTAAGTACTCTTTCGCTTTGGGTCTTTCGGTCTTCATGGGCTTATTATATAGCAAAGAAAGCGGGTTTTGGGCTGGGCTTCCGGTGGCCGTGAGCTACATTTCGGGTAGAGAACCTGCTTTTAGGGCCGCAAATGTTAAAGCCCAAGGGACGGTGATAGGAACTGTCTACGCAAGCAAACCCTCCTTCTTCAGCTCTTCAACCTCTCTCTCTCTTTCCATGGCAGCCTCTCAAGCAAGCCTTCTCCTTCAAAAACAGCTCAAAGATCTTTGTAAACATCCTGTTGATGGCTTTTCCGCTGGTTTGGTTGATGAAACCAATATTTTTGAATGGAGTGTAACCATAATTGGACCACCAGATACTCTTTACGAGGGAGGATTTTTCAATGCCATTATGAGCTTTCCGCCCAACTACCCAAACAGTCCACCATCAGTAAAATTCACCTCAGATATATGGCATCCCAATGGTTGGTTTTTCTCTCTGATGCACGGATACATGAAGTTGAATGATGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCTCCTGGGGATGACCCAAATGGTTACGAGCTTGCAAGTGAGCGCTGGACACCTGTTCATACATGTTGTGTATGGTGTCTTGCAGGTAGAGAGTATAGTGTTGAGTATCATTTCAATGCTTTCTGGGCCTAATGATGAATCTCCTGCAAATGTTGAAGCTGCAATAATTCCTTAA >TPR.G15254 GTTTTGCATTTTGGTGCATGTGCATTAAAAACACTTCAACAAGAGTTTCAAAGAAGTGACAATTTTGTGAATGAGGAAGTGAATATGCTACAAAGTGAACTTGCTAATGTTAGGGAAATTATTTGCTCTTCCATCAAAGGTCTTGAAGAAATTTCCAAGATGAAATCATTCAAGTTTGTTGAGAAAGAGACTGAAAAGAAGAAGAACATGTCTTGTGATTTTGAAATGGGAAAGTCGAGAGAGGACGGAACGTGGCTTTCGGGTTTAGGAGAAGATGGAATAAGAGAAATTATTGAAAATTTTCTTCATAGGTCAAGAGATGTTGTTGAGAAGTTGTATAGTGATGAAGGTGAAAAAGAACTTAAGAGTGAAGTTGTTTTGAGTTTGAGTGTTGTTGGGTTTTGCTTGAGTGTGTGTATGCATGGAACAATAGAGATTGAAGAGGCAATGAGGGAACTTGTTCAATGGGAGAATCCCTCTAGCAATGTTTAA >ATR0559G166 ATGATAAAGGCTACAGAACAAGCATTGAAGGGAATGGAAATCTCACTAAGCTCCCACCTTTCTCTCTCTACACCCTCTCTAACATCACATCCAATTCTCAAAGACTCATTGCACCAACTCACTGAGTGCACCACCCAAACCCTCCTCAACAAACCCTCTCCTTCCACACATCAAACTGCAAAACAAGCTCTCTACACCTTACACCATACCTTAGAACCCACCTCTCTCTCTCTACACAATCTCTCCTCTCTCTTTTTCATCTACTGCCTATGCCAATTGCACTCAGAAACCACCATCCCCTCTCAAAACCGCCAATCAAGTGGACCGAAGATCGCGCCCACCGTCGAAGAACCCGCAAACCCACAAAGTGAAAACCATAATTCATCCATTAAAACTGCTTACTGCAAGTCTCTCTCTTTCACAAACAAAGAATCAGCCATTTGGGCACTCAAGTGCTCTCTCTCTCTAGCCCTCTCTGTCCTCTTAGGCGTTTTGTACAGCAAAGACAATGGCTACTGGGCAGGCATTGGGGTAGCCATTAGCATGGGTGCAACAAGGGAGCCAACCTTCAAATTAGCAAATGTTAGGACACATGGCACAGTTGCTGGTTCAATCTACGGTGTTCTCGGCTGCTTTCTGGCTCAGAAGATCCCAGCCGTTCGTTACATCGCCTTAATTCCATGGGTGATCTTCACAAGCTTTCTAAGAGATAGCAAAATGTATGGCTATGCTGGTAGTTTATCAGCCCTAATTGGTGCAGTTATAATTCTCGGACGAAGAAACTTCGGTGCACCACCTGAATTCGCCATAGCTAGAATCACTGAGACCTTTATTGGGGTCGTCTGTTATATATTTGTCGAGCTCCTGATCGAGCCCACTCGAGCCACTAGGCTTGCTAGGCTCGAGTTGGATCGAGCCATGACTGAGCTCAGCGGCCTAATCCTGTCGGTCCTCTTCGAAAATCGAGAAAGCCATAAAGAAGATGAAAAGAGGCTTAGAAGCTGCATTTTTCGACTAAGGAAGTTTGTTGATGAAGCTAAAAATGAGCCGGATTTCTGGTTTTTCCCATTTCCAAGCGACATTTATACCAAAATTTTGGGGTCACTCTGCACCATGCTTGAGCTTTTAAGCTTTTGGGCTTCTGGGTTCGAGGAGTTGGCTCATGTGGCTCGAGCCCATGGGGCTCAAGTGGATTCGTTAATCGAACCGGTGGGCTCGGAGATCGAGTGGTTCAAGGGTTCGGCTGATTCGGTTTTGAGGTGCCTAGCTGGGGTTATGGGGGTTGGGTCCTTGAAAGAAATGAGCGATGAGTTTGGTAGGGTGGGCACGTGTGGGGATTTGGAAGCAGGAGGTGTCACACGTGTGACAATGGATGAGGAGGAAGTTGAAAAGATGACTAAGAGTTTTTTGGAGAATGGGCGTGAGGTGGGTGTTGGGTTCAGTGGGGAGGAGTTAAAGGGGCAGCTGGTTTTGTGCATGGGGTGCTTGGGGTTTTGCATGGAGGGTTTGATGAGAGAGATGAAAGAGTTAGAGAAAGGAGTGAGGGAGCTTCTAGAGAGAGAGGGGATTGATTATTCACATGAAACATGTTGTCGATAA >ATR0559G229 ATGGCGACTACGCACGCTCGGGCACTCTGCAGATCGAGGGCGGCATCAGCCTTCAGGACGGGCTGGGCCTGCCTGATGGTCGGAACGATTATCCGATTCGCCGAGTGCCATCACAAGGATTTCTTGGCTTTCCCGGCGTTTGCCTACGTGACTGCGGTCATGGTCGCCGGCGAGGCTTCTTTAGGAGAAGCCCTACAGGGGGCTGCAGCCGCGGTCTGCGGGACCCTGCAGGGCGTCGGCCCGGCAATGGCATGCCTGTGGGCTGTCGGGCCGGGGAAATTGACAGTGTGGACATCGACACTGGCAGTGGCCCTCAGTGCCTTTGTTGTTGCGTTGCCTAACACCACACATATTATCGCTAAGAGAGTGGCCTTCGCACAGATGGTCATTGTCTATGTTGTGGCCTTGATACAGGGGGAGAGTATGGGGGCTATTAAGTACCCTTTGCACGTGGGGATCAGCACGTGTGTTGGGGCCGCGGCTTCTGTGCTTGCATTGCTGTTGCCCGTTCCCAAGTTGGCCTATGTTGAGGTAAAATAA >ATR0661G002 ATGTATGGCTATGCTGGTAGTTTATCAGCCCTTTTGGGTGCAGTTATAATTCTCAGACGAAGAAACCTCTGTGCATCCCCTGAATTCGCCATAGTTAGAATCACTGAGACCTTTATTAGGGTGTTTGTCGAACTCCTAATCGAGACCACTCGAGCCACCAGGTTGGCAATGGAGTTGGAGACCTATTTGGCAGATGGGCTTGGTAAAAGTAAGAGTTGGGCGGGTAGAGAGAGAAAGAGAGAGGATAGGTAG >Zm00001d044596 ATGACGATGAAGCAGCTAGTACAGTTAGTGGCCAAGCCGTTAACGCCGCCACCACCCTGCTGCAGCTCCTCGTCACAAGACGATGAAGACGACGATGTGGTGCGGCAACTGGTTATGGGCCGTTGGCGTTCGTCCCTATCGTCAGGCCTCCGTGCCGCCCTCGCCTGCACCATCGTGGGCCTCGTCTCCCTCTACGCACCGGACGCCCTCCGCAGACACATCACCTTCCCGGCCTTCTCCTACGTCGTCACGGTCATCCTCGTCACGGACGCCACACTCGGCACGGCCCTGCGCGGCGCGGTGAGCGCGCTCCACGGCACCCTCATGGGCGCCGCGCCGTCCGTGGTGGCGCTGTGGCTCGCGCACCGCACGGGCGCCGCGGAGTCGGCGGTGGCCACGTCGGCCGTGGTGGCGCTGACGGCGTTCGCGGTGGCGCTCCCGGAGTCGGTGGGCCCGGTGGCGAAGCGGATCGCGCTGGGGCAGGCCATCATAATCTACGTGGCCCGCAGGTTCCAGCCGGGGGAGCGCCCCAGCCGCGGCTGGGTGCTGCTGCACCCGGCCAACGTGGTGGCGTGCACGGCGCTCGGGGTGGCGGCGGCGCTGCTGGCCGTGCTGCTTCCCTGGCCGAGGCTGGCCACACGGGAGGCCAAAGACAAGAGCAGGACGTACAAGGTGGTTGCCTCAGAGAGGGTCAGGGTCCTGGCTGATGCCTTCGTCGTTGCCGCTGCTGTGGGTGTGGAGGAGGCCGATGAGGGGTGCAGCAGGCAGCGGCGATGGCAGATAGCGGCGTGCATGTCGGAGGCCAAGCGGCTGGCCTCCGCAAGTACAACACTCCTCAGCCGCATGAACGCCATCAAGGAGGATTTGCAGTGGGAGCAGAGAGCAGTGGCGGTGGCGGTGGAGGAGAAGGATAACAAGGGCAGCATCGAGATGCTCCTGGCAGGAATGCAGATCGCACTCGCGACCATGCAACAAGCCGACGGCGGCCATGGGAGGAATATAAACATGGTCGGCCTTGTCATGGCGATGAGGGACCAGATACGCCTCGCGCTTCTCACGCCCAACAACAAGCAGCAGAGCAGATCAACATGCACGCCCAGCTACCAGTTGCCAGCTACGAGCTTCGACTATCGCAACCACGAGCAGCATCAGCGGGCGTCTTTTTTGTTCATCTTCTCTCTCTACCAGCTCCATCATTGCTGCTGCGATGGTGGTCCCAAGACGCCTTCGACGGCAGCTACCATGCTGCCCAACGCCAAGCAGGTAGCGCCGGCGGCAACCACGACGACACGCCAAAAGCTACTACTACTGGAGCAACCAGCAGCCGACTTACTGCCGGACGACGAGCAAGAAGAAGAAGAAGAAGCAGGTCAGCATGTGGAGCAGGACGACGGACCATCTTCACAAGCTGGGGCAGCCACTGCAGGAGAGGAGAAGGCTACAGCGACGGCGGCAGCGGCGGCGACCAAGGACAAGCACAGCAGGCAGACACGCAGCTGTCGCCGGCTCGTGGCGGCGGCCAAGTGCGGCTTCTCCCTCGGCCTCGCCGTCCTGCTGGGCCTGCTCTTCAGCAACGACCACGGCTTCTGGTCGGGCCTCATCGTCGCCACAACCATGACGGCGGGGCGCGAATCCACCTGGGCCGTGGCCGTGGCGCGCGCCCACGGCACCGCCCTGGGCTCCATCTACGGCGTGCTGGGCTGCCTGCTCATGTCGCAGCAGCAGCTCGTGGCCATGGACCTGCGCTTCGTGGCCCTCCTCCCCTGGATGGTCCTCGCCACCTTCCTCAAACGCAGCCGCGCCTACGGCCCCGCCGGCGGCGTGGCGGCCGCGCTGTCGGTCGTCATCATCATGGGGCGCCGCTACGACGAGCCTCCCATGGCCTTCACCATCGCGCGCCTGGTGGAGACCTTCATAGGCATCTCCTGCGTCGTCCTGGCGGACCTTGTGTTCCAGCCCGGGGCGAGGCCGTCGGTGCAGGCCAGGGAGCAGCTCGCCCGCTGCATCGCCGCGCTGGCAGCCTGCAGCCGCCTTGTTGTTGCTGACCCTGCTGCTTCATCAGAATTATTGAAGAGGGTGCAGCAGGAGCTGGCCCTCTTGAGGAAGCACGCCGCGGAGGCCGGCAGCGAGCCCACCTACCTGTGGCTGCCGCCGTTCCCGGCGGCCTGCTACGAAACGATCCAGGGCAGCCTTGGCAGGATGGCACAGCTGCTGCAGCTCTACCATCAGGCACGCCGCTACATGAGTGTGTCTTTGTCCCAGCAGCAGGTGGACGTGGACGATGATATCAACACCATCCAACACCGGCGCTTCAGCAACCTCGCCTCCACCTCCCTCGGCCACTGCCTTCACATGCTGACAGCAGCAGAAGGCAAGGAGGCCAACAAAAAGCCCAAGGCCCAGGTCGTCGTTGACCTTGAGGCTGGGACTGCGGCTGCCTGTGGCTGCTGCTACAGGGATGACGAGGTGGTGGGCTCCTTCGTAGCGCAGGCAAGAGAGCTGCTGTTGAACGATGACGACGACGACGATAGCGTTGAGCAACAACAAGAGGAGGAGAGGTTTTTGGCAGTGTGCTGCCTGGGCTCCATTGTCCTGTGCATGGAAGAGATCCTCAAGGAGGCCCGGCGGCTGGAGGCGCACATCCTAGACCTCAACAACAACCTGCAACTCAAATCAGCACTCGCTGATATATTATAG >AH013646 ATGTCTATAAACGTGCAATCAGAAAGAACACGCAACTTTTGGAGATCAAGCCTAATCGCGGCCTCAAGAACCGCCTTAGCATGTATAATAGTAGGGTGCATAACCCTTTATGGCCCTGCCTCAATCAAGAAACAAGTTGCTTTTCCGGCATTTTCCTATGTCGCGATGATTCTTATCGTCACCAATGCCACCCTAGGAGACACGATTCGAGGTCTTTGGCTTTCGTTTTACGCTACCCTTCAAACGGTTTGCCCTGCTATCCTTTGTCTCTGGATCATGGGACCCACTAGGCTCACCACAGCCTCAACTTCCTTGGTGTTGGCTATAGCTTCTTTCTTTATTGCCTTGCCAAAATCAACCCATGTTGTGGCTAAAAGGATTGCTTTAGGCCAACTTGTTATAATATATGTTGTTGGTTACATTAATGCTGATCAAATACATCCTATCATGCATCCTGTCCATGTTGCTGCTAGCACTGCTGTGAAAACAAACAGCAAGTTATTCGCAGAGAACGCGACAGAGAGGCTCAAGCTATATGTGAAGGCCTTTTGTGCTGAAGACACTACATCTTCACAAGCATTGATCTCTCAAGCCAAGTGCTTGTCAGTTAAAGCCAAGAAGTTTATCCAATGCATCAAATCGAAACAAGAAAGCATGCAGTGGGAGAGGTTTTTGATCAAGTTTTTCAGGCCTTACTGTAAGAACCCAGGTGACCGATTTCAAGAAATCGAGACACCACTAAAAGGGATGGAAATCGCGCTAAGTAACTCGCAAGTTCCTGTTACGATATTTGGTGAAGAATTGAAAGATGGGATGGATAGAATAGAAGGAGAAATAAGCCAAAACTTAGAACAACTAAGAAAACATATGCCTTGTGAAACTTCAACTACTGTCCCTGAATCTACTAATGGACATGTTATGAACTTCCTTCAAAAACTCGAAATTCTCCCTTCGAATGATAAGGATTTACCCTCTTATTTTTTCTTCTTTTGTATGAAACTTCTACACTCTCAATCAAGGGCCATGACTATTCACCCGAACCCACAAAAAATCGACAAACAAACCCCACAAACACAAGCCCAACAACACCCATCAAATCATACCAAAAAACACCCAGATGGGCTTTCTTTGTCTTGGATTTTATCCAACTGGCCCACTTCACTGAACAAAGAAAGGCTACTAATTGCACTAAACTGCTCGCTCTCATTGGGCTTCGCAGTGTTAGTTGGGCTTTACTACAGTAAGCCCAATGGGTTCTGGTCTGGGCTCCCTGTAGCTGTGAGTTTTGCAGCAGCTAGGGAAGCAACTTTCAAAGTTACCAATGTTAAGTTCCAAGGGACAGTAATTGGGAATGTATATGGAGTTTTAGGCTGTTTTATTTTCGAACGATTTGTACAAATCCGGTTCATAGCACTTCTACCTTGGTTCATTTTCACAAGTTTTCTTCAACAAAGCAAAATGTATGGCCAAGCAGGAGCAGTCTCAGCAGTTATAGGAGCAATTCTGATATTGGGTAGAAGAAATTTCGGTCCCCCTAGCGACTTTGCCATAGCAAGAATCGTCGAAACTTTCATAGGCTTATTCTGCTCAATAATCATTGACATCTTATTACAACCTACTAGAGCTGCATCCTTAGCCAAAGTTCACCTAACCAAAACACTCGGTGCACTCCATACCGCCTTCTCCTCCATCGATCTCCTCACAATGTCTAAGGCTGAGTTACTTGAAAGCACGAAAAGCATCAAACTTCACCTCAATGAGCTAGGAAAATTCGTGGGTGAAGCCGAGGCAGAGCCCAATTTTTGGTTCTTACCTTTTCATACACAAGGGTATAACAAATTGATGGGCAATTTCACAAAAATGAGTGATCTTTTGGTGTTTGTAGCACATGCTAATGGAATCCTAGAAGAACAAATCAAAAGATTTGATATGATGGGATTTAAGGATGAATTGGATAGAATAAATGGTGATGTTAACCATGTAGGGAATGTGATAGCAAATAGTATGAAATCATTCCAAGAGATAGCTTGTATTAAGTCAATGTTAGTTCTTGAAAAGGACCTTACTAAAAGTGGAAAGACTTATGATATTGAATTGGGAAAATCAAGTAAGGATCCGAAGTTAGATGAGAAAGAAATCGCGAAGAATATAACCGTATTTCTTGATCATTTGAAGGAAATGTTTGAAAAGATTGAGGTACATGAAGAGGAGAAAGAGATAAAGAGTCAAATTGTGATGAGTTTTAGTGCAATTGGATTTTGTTTAAGCAGTTTGATGAAGGAAACTAAAGAGGTTGAGAAAGGAATTAAGGAACTTGTTCAATGGGAAAATCCTACTAGTAATGTAAATCTTCATGAGATTTCATGTAAAATTCATGCATTATATGATTGA >AH013647 ATGTATAAATGTAAGGGTGGCATAAACCTTTATGGCCCTGCCTCAATCAAGAAACAAGTTGCTTTTCCGGCATTTTCCTATGTCGCGATGATTCTTATCGTCACCAATGCCACCTCTAGAGAACGATTCGAGTCTTTATGGCTTTCGTTTTACGCTACTGATTCAACGGTGAAAACAAACAGCAAGTTTATTCGCCAGAGAACGCGACAGAGGAAGGCTCAAGCTATATGTGAAAGGCCTTTTGTGGCTGAAGACACTACATCTTCACAAGCATTGAATCTCTTCAAGCCAAAGTGCTGA >NNU_12297 ATGCTAACGCAGCCAGCAAGTGATAGAACACGAACCATATGGCGTTCGCGCCTTGGCTCGGCACTTCGGACGTCGCTCGCTTGCACCATAGTGGCCTGTGCCACCCTCTACGGTCCCGTCGCTCTCCAGCGCCAGATATCATTCCCGGCTCTCTGCTACGTTACCATCATCCTCATCGTCACCAATGCCACGCTAGGCGACACTTTGCGTGGCTGCTGCTACGCTCTGTATGCTACCATTCTCGGCGTCCTTCCCGCTATTCTGTGCTTGTGGGCTATCGGACCTGCCCGCCTCTCCGCCATCACCATGTCTCTCGCAGTGGCGCTCAGTGCGTTTGTCATTGTACTACCCGAATCGACTCATTTGATAACCAAGCGGATAGCACTCGCTCAGGTTGTTCTTGTGTACGTCGTGGCTTATATAAACGGCGTTCACACTGGTGCCATCACGCACCCTGTCCACGTCGCAGCAAGCACGGCCATTGGCGCCTTGGCTTCTGTCGTGGCCTTGCTGTTACCCTACCCTCGGCTGGCATGTCACGAGGTAAGAAAGAAGTGCAAACTATTTGCTGAGACGGCTTCAGAGAGGCTAAACCATTTAGTACATGCTTTCTGTGCGGATGAGAAAACATCTACACTTGCATCTCTCTCTCAAGCCAAATCCTTGTCCAAGACAGAAGCCAAACTTCTTCAGAGTATCAAACTCAAGCAAGAAAGTATGCAATGGGAGAGACCTCGAATCAGCTTCTTTCAACACCATTGTACGAGCCGAGGGGATAGATTACAGGGAATAGAGATATCCCTAAGAGGGATGGAAATTGCTCTAACTTCTTGCCCTTCATTTTCTGTTAAAGTACTGGCAGATGAGGAGCACAAAAGCTTCCTTCATGCACTACAAAAGCATGTGAGTCTGACGTTGAAGCGAGCCAATCTTTATCTACCTAGTTGTGATTCATCAACTACACCGGAGATAAAGGGATCAGAAGCTGTAGATGATAAATTTATGCAAATCCTTCAGGTCGTCTTCCCAACCTACAAGGATCTACCATCTCTTTTCTTCCTCTTTTGCTTGAAACTTCTTCACAATGAATTAACAGGGACCCCAACCCCATCAAACGGGATCTCTCTAGGAAACAGTTCTGCTCCCTGCACCCAATATGGGACGCGCTCAAGCAAACAGTCCTGGGGTGCCATTTTGAGCCATTGGCCTGTTAAAATAGGTAAGCGAAGGCTCATTTTGGCATTCAAGCGAGCACTTTCTTTGGGTCTTTCCGTTCTGTTTGGGACAATGTTTAGTAAGGAAGATGGGTATTGGTCGGGATTGACAGTCGCCGTCGGCATGGCTTGGGGGAGAGAAGCAACGTTTAAGGTTGCAAACGTTAAGGCACAAGGGACAGTTTTAGGGACCGTCTATGGAGTCTTGGGTTGCTTCATCTTCCAGAGATTCGAAGATATTAGGTTTCTCTCCTTTCTCCCATGGATCATCTTCACCAGTTTTTTGGGACGGAGTCGGATGTATGGCCAAGCCGGGGGCATTTCAGCTGTAATTGCTGCATTAATTATATTGGGCCGGAAGAATTACGGTCCTCCAAGTGCATTCGCCATTGTAAGAATCATGGAAACCTTTATCGGATTATCATGCTCAATCATGGTAGAGCTTCTCTTGCAGCCCACAAGAGCCGTTACCCTAGCTAAAGTTGAATTCTGTCGGAGTCTAGGGACACTTCACGACTGTATCCAATGCATAAGCTTTTCTTCCAGCCACACAAACGACGATTATCCTTGTTTACAGGAGTTGAATGAGAAGCAAAAGAAGTTGACTACCCATGTGACTGAACTAGCTAATTTCATCGCAGAGGCTGAGGTAGAACCGAATTTTTGGTTCTTGCCTTTTCACAGTATCTGCTATGGTAAGCTCTTGAAGTCACTGTCAAAGATGGTGGATTTCTTGCTTTTCGGGTCTCATGCAATGGGATTCATTGTACAAGCATCACAAAGATGTAGGGTTCCATGGAAAGAGATCCAGGAACACATTGACGAAGATCTACAACTTTTCAAGGACAAGATCGGGTGTGCCATCAAATGTTTCGAGCAGGCCACGTCTATCAAGTCACTCGCAGCACTAGAAAAGGAGCTATGGAAGAACATCCCTCGCGATCTTGAGTTTGGAAAATCGCCAAAACCAGATGGGTTTAGGGTTTTAGATGCAGATACAGATGAAGATGAAGATGAAGATAAGGTGGAGGAGATGCTTACTTCATTTCTTCAACATTCAAGAGAAATTATAGACAAATTTCATGCTGCTGAAGCTGAGGAGGGGCTCAAAAGCCAAATGATTCTCTGTCTCAGTGCCCTAGGGTTTTGCTTGGGTGGATTGATCAAAGAGACAAGAGAAATGGAGAACGGAATCAGAGAACTTAAACGCGTGGCATTAGAATTGCGATTTCAGATCTAG >Glyma.03G171200 ATGTCAAAAACATCCTCAATTACAACCGCACGATCAGAGATGTGGCGTGGTCGTTTAGGCTCTGCCCTACGAACCACCTTAGCATGCACCGTCGCAGGTTGCACCTCCCTTTACGGCCCCGCCCCTCTCCGCCGCTACCTCGAGTTCCCCTCCTTCATGTACGTCACAACCGTCCTCGTAGTGTCGGACGCGACACTCGGGGACACTGTACGAGGTTTCTGGCACGTCGTTTGTTCGAATATTCAGGTCATGATGCTTTCTTTGCTTAGTTTGCAGCTCATAGGGCCTCACAGGTTTAACAGCTGCGTTGCTGCGCTGGCCATGGCGGCTTCGGCGTTCGTCGTTGGGTTGCCGGAGTCGACGCACTTGGTCACTAAGCAACTTGCATTTGGACAGCTTGTGAATGTTTTTGTTAGCACGGTGGTGGATGGTGGACGGACCGGGGTGGCCGTTCACCCAGTTCATGTGGTGTGCTCTACAGCCTTTGGAGGTGTCGCTGCTGTCCTCGCCATGTTGCTTCCATTTCCTCGCCTAGCCCACTATGAGACAAGGAAGTTCTATCGACTATACGCTAAGAATACTTGTGAGAGGTTCGATTGCAACATAGAGGCCATCTCTGCCTCGGACAACTCAACTGCAGTTGGTTTCATCGCTCAAGCCAAGTCCCTCTCCACAACAGGAGCCAAGCTTCTCCAGATTATTAGAAGTAAACAGGATGGCATGCATTGGGAATGGCCACAAACAAGAATTTTCAACTCCCATTGGATTGACCCAGAAGATGAACTGCAACACTTGGAGTTAACAATAAGAGCTACGGATATTGCCCTATCAACTTGTACCTCTTTTCCTGTTGGGGTCATTGATGAGGAGCTCAGAGGTGTCTTGCTCAATTGCAGAGGACACTTCAGCAAAGTCTTAGGTCAGCAAGCCAAGTGCTTTGATTCTTTTGATGCAACCATAACTTCAGATATGAAAAAAGAAATTTTGACCAAAAACCTCTCTATAGCCTATAAAGATCTCCCAACCTCGTTTTTTTTATACTGTGTGCATCTTCTCCTATATGACTCACCCATTGCAAAGAAAACTGACCACGTGCTGGGAAAAACTCAGAAAAGAGGTGATTTCAAATGGAGCGCCAGAAAGACCAGAGAGGTTGTCATGAACTTGATTCCCAACAACCACAACTTGGCTTTTGCATTCAAGTCCTCACTTTCATTAGGCCTCGCTGTGTTTTTAGGTTTAACATATAACAAGGAAAATGGATACTGGGCGGGACTCTTAATTGCCTTGTGTTTCGTGCCTGGACGGCATCCAACATTTTCTCTTGCAAATGCACGAGGACAAGGAACAGCAATGGGATCAATCTATGGGATCCTATGCTGCTTCGTTTTCAAAAAAATTGTGGATTTCAGTTTCTTACCTCTTTTACCATGGATCTTTTTCTCTTCTTTTCTTAAGTATAGTAGAATGTATGGGCAAGCTGGTGGGATTGCAGCAGTTACAGGGGCCTTGTTAGTAGTTGGTATGAAGCACAATGATCCTCCTAGTCAATTTGCACTTGCTAGAATGGTCGAGGCCACAATAGGCCTCCTTTGCTTTGTTATTGTAGAGATTATTTTTAATCCCTGCAGAGCTGCAACTCTAGCAAAATCTGAACTTTCTCAATGCTTGAGATCACTTCATGATTGCATTGGCCAGATTGCCATCATTACTCCTACCAAAAGAGAGATGCCATTTTCAAGCTGTCAAGAATTGAGAGAAGGACAGAAAAAGCTGAAATCTCTAGTGTGCCAATTAGAAGAGTTCACAGCAGAGGCTGAATTGGAGCCAAATTTCTGGTTCATTCCATTTCATAATGCCTGCTACAGAAAGATGCTGGAATCACTATCAAAGATGGCAGATCTCTTACTTTTTGTGGCATACTCAATGGAAAATATCATGCTATTGTCACAGAAAAACGGAGCATTTGGGGTGGATCTCCATGATGGAGTAAACAAGAATGTGAGGATTTTTAAAAACAAAGTTAGCCCCACATTGGAACACCTTGAAGAGATAACAAGGAAAAAGATTCCCGGGAAACTTGCAAATGAGTTGAATAGGAATATTCCTTGTGATATCGAGGCACAAGAACATCCCAATGCAGAAGCACTTAGGGTCTGGAGTGGAGATGAAGTTGTTGATAGCATTACAGGCTCTTTTCTCAAACATCTAGAGGAGATGGCTAACAAAACTCATACCAATATAGATGAGGAGATGCTTAAAAGTCAAATGCTTTTCCATTACAGCTGCTTGGGATTCTGTACTAATAACTTGATGAGAGAAACAATGAAGATTCAGAGTGAAGTAAAAGAACTACTTATGTGGGAGAATCCCTCAAGTCAAACAAATCACAAGTAA >Glyma.13G334600 ATGCCACCATTGTGGCGAGAGTGCCTCTCATCTGCGTTCCGAACCGCCCTAGCGTGCACCATAGTGGGTTGTGTGACCCTCTATGGTCCTTCTTCCATTTGCACCCTCGTAGCATTCCCTGCATTCTCATACGTCACAGCCATTCTCATCATCATAAACGACGCCGCTTTGGGAGACGCCTTGCGTGGATGTTGGCTCGCACTCTATGCCACCTTTCAGAGCATGGGCCCCGCCATGTTGAGCTTGTGGGCTGTCGGACCAGGACGGTTCTCTAAAGCCACCAGCGCTGCGGCGGTGGCGCTGGCCGCATTTGTGGTGGTTCTTCCCTGGCCTCAGAGCACGCATTTGATAGCTAAACGTGTATCGTTGGGTCAGATAGTGCTGGTGTACGTGGTGGCTTATGCAAATGGTGTTCACACTGATCCTATCATGCACCCTATAAGCTTGGCTGCTAGCACTGCCTTAGGTGTTCTTGCTTGCGTTGTGGCATTGCTGCTTCCTTATCCGCGTCTTGCTTCCTCCCAGATGAATCAAAGCTACAAGCGATTAACCAAAAATATCTTGAAGAGATTGAAGCTTCTTGTAAAAGTGATATGCGAGGAGGACAAGATTACTGCGGTCGGATTAATGTCTCATGCCAAGTCTTTAGTAACTAAGCGAACCAAGCTCCTTTCTATCATCATTCGCTACAATGAGGGCATGCAATGGGAGAGACTTCCAATTAAAATTTTCAGATCACATTGCTTGAGCCTAATAGAGAGACTTCAAGAGGTAGATACCAATCTAAGAGGGATGGAGTTGGCTTTAGCTTGCACCAATTCATTCCCAATCAACATTCTCGACCAAGACTTTAAACATGGTCTTAATAGCCTTGAGGAGCATGTTACCCTGACCATAAAACAAGCTAAACAAAGCTTACGTGACGGTTCACTAACTGTCCCCGAATCTAATGCAAAAACCACAACCCATTTTCTCCAATCCCTTCACACCATTCCAACAACTTACCAAGAATTATCCATTTGCTTCTTCTTATTTTGCGCCAAACTCCTCCACAAGAAATCATTGACCGAACCTCCAACTTGTACTCAAGACCTACTCGTTAAGAAAAATGGAAATTCTCCGAAAGAAAAGTTGGCTAATTTGATAGCAACGTTAAGAAATACAAATCTTATGCCAGCAATTAAATTCTCTCTCTCTTTGGGCCTCTCAGTGTTCATGGGCTTAATATACAGCAAAGAAAATGGGTTCTGGGCTGGGCTTCCAGTGGCCGTGAGCTATGTTTCGGGGAGAGAAGCCACATTTAGAGCTGCAAATGTTAAGGCTCAAGGAACCGTGTTAGGAACTGTGTATGGCGTTTTGGGTTGCTTCGTATTTGAGAGATTCTTGCCCATTAGATTCTTGTCTCTACTTCCTTGGTTCATCTTCACGAGCTTCCTTCAGCGAAGTAAAATGTATGGGCCTGCTGGTGGCATTTCCGCAGTTATTGGGGCCATTCTAATTCTTGGTAGGAAAAATTTTGGGCCACCAAGTGAGTTTGCTTTAGCCAGAATAATTGAAACTTTTATTGGGCTCTCATGTTCTATTTTCGTGGATCTTATTTTCTGGCCCAAAAGAGCCTCCACCTGCTCCAAAACGGAACTCTCTCAATGCCTGGCCACACTTGGTGAGTCCATTGGGTCGTTGAGTCTCCTTGTTGCTGGCAAAACCAATTTGGAAGATAACCAAAGGAAGTTGAAAATGCAAGTTAACGAGCTTAGGAAATTTGTTGTGGAAGCAGAAATGGAACCTAACTTATGGTTTCTACCATTTAATAGTGTTTGTTATAATAAGCTTTTGGGGTCATTGTCAAGAGTGGTGGATCTCATGAGGTTTGGAGAACATGCTTTGAAGTTCCTCCAACAAGAATTCCAACGATGTGGGGCTTGTGAGAAAGAGGATGTGAACATGCTAGAGGGTGAACTTGGACACGTTAAGGACTTGATTTGCTCTTCAATAAAAAATATTGAAGAGATTTCTAGTACGAAATTTGTTGCGAAAGAGGTTGAGAAGAATAACAATTCGTGTGATCTCGAAGCAGGAAAGTCAAATTGGGGTAATAATACGTGCATGATTTCTCGTTTAGGTGAAGATGGAATTGAACAAACAATTGGCTCTTTTCTCCAACGGTCTAGAATTGTTGTTGATAACTTATATGGTGATGAAGGTGAGAACGAAATGAAGAGCCACGTTGTTCTTAGTTTGAGTGCCGTGGGATTCTGCTTGTCTGCATGTATACAGGGGACGATGGAAATTGAAGAAGCAATCAAGGAACTTGTTCAATGGGAGAATCCCTCTAGCGAGATTGATTAA >Glyma.15G039900 ATGAATATGCCTCCATTTGTGGCGAGAGTGCCTCTCATCTGCGTTCCGAACAGCCCTAGCGTTACCATAGTGGGAGACGCCTTCCGTGTCTATGCCACCCTTCAGATCATAGGCCCCGCCATCTTGAGCTTGTGGGCTGTCGGACCAGGGCGGCTCTCTAAAGCCACCACCGCTGCGGCGGTGGCGCTCGCCGCGTTTGTGGTGGTTCTTCCCTGGCCTCAGAGCACGAATTTGATAGCTAAACGCATATCATTGGGTCAGATATGCTCCTTGGCTGCTAGCACCGCCTTAGGTGTTTTCGCTTGCGTTTTTGCGCTGTTGCTTCCATATCCGCGTCTTGCTTCCTCCCAGATGAATCAAAGCTACAAGCAATTAACAAAAAATATCTTGAAGAGATTGAAGCTTCTTGTAAAAGTGATATGCGGGGAGGACAAGACAACCGCGGTCGGATTAATGTCTCATGCCAAGTCTTTAGTAACTAAGCGAACCATGCTCCTTTCTATCATCATGCGCTACAAAAGACTTCCAATTAAAACTTTCAGACCAAATTGCTTAAGCCTAATAGAAAGACTTCAAGAGGTAGATACCAATCTGAGAGGCATGGAGTTGGCTTTAAGTTGCACCAATTCATTCCCAATGAGCAATATTCTCGACCAAGACCTTAAACATGTTCTTAACAGCCTCGAGGAGCATGTTACCTTAACCATAAAACAAGCTAAACAAAGCTTACGTGGCGACCTACCCGTTAGGAAAAATGGAAATTCTCCCAAAGAAAAGTGGGCTAATTTGATAGCAACGTTAAGAAATACAAATCTTATGCCAGCAATTAAATTCTCTCTCTCTTTGGGCCTTTCAGCGTTCATGGGCTTAGTGTACAGCAAAGAAAATGGGTTCTGGGCTGGGGTTCCAGTGGCCGTGAGCTATGTTTCGGGAAGGGAAGCCAAATGGGCATTGCTATCCACATTTAGAGCAGCAAATGTTAAGGCCCAAGGAACCGTGTTTGGATCTGTGTATGGCGTTTTGGGTTGCTTCGTATTTGAGAGATTCTTGCCCATTAGATTCTTGTCTCTACTTCCTTGGTTCATCTTCGCGAGCTTCCTTCAGCGAACCGAAATGGAACTCTCGCAATGCTTGGCCACACTTGGTGAGTCCATTGGGTCGTTGAGTCTACTTGTTGCTGGCAAAACCGATTTGGAAGACAACCAAAGGAAGTTGAAAATGCAAGTTAAGGAGCTTAGGAAATTTGTTGTGGAAGCAGAAGTGGAACCTAACTTTTGGTTTCTACCATTTGATAGTGTTTGTTATAATAAGTTTTGGGAACTAGCGTTGAAGTTCCTCCAACAAGAATTCCAACGATGTGGAGCTTGTGAGAAAGAGGATATGAAGATGCTAGAGGGTGAAGTTGGACGCTTTAAGGAGTTGATTTGCTCTTCAATCAAAAGTCTTGCGGAGATTTCTAGTACGAACTTTGTTGCTAAAGAGGTTGAGAAGAATAACAACTCTTGTGATCTCGAAGCAGGAAAGTCAAATGGGGGTAATAATACTTGCATGGTTTCGGGTTTAGGTGAAGATGGAATTGAACAAACAATTGGCTCTTTTCTCCAACTGTCGAGAATTGTTGTTGATAACTTATATGGTGATGAAGGTGAGAAGGAAATGAAGAGCCAAGTTGTTCTTAGTTTGAGTGCGGTGGGATTCTCCTTGTGTGCATGTATACGGGGGACGATGGAAATTGAAGAAGCAATCAAGGAACTTGTTCAATGGGAGAATCCCTCTAGTGAGATTAATTAA >Glyma.19G172300 ATGGCCGCTTCGGCGTTGGTCGTTGGGTTGCCGGAATCGACGCACTTGGTCACTAAGCAACTTTCAGTTGGACAGCTTGTGAAAGTTTTTGTTAGCACGGTGGTGGATAGTGGACGGACAGGGGTGGCCGTTCACCCAGTTCACGTTATATATATTCGATTATACGCTAAGAATACTTGTGAGAGGTTCGATTGCAACATTGAGACCATTTCTGCCTCAGACAACTCAACTGCTGCTGGTTTTATCGCTCAAGTCAAGTCCCTCTCCACAACAGGAGCCAAGCTTCTACAGAGTATTAGAAGTAAACAGGATGGCATGCATTGGGAATGGCCACAAACAAGAATTTTCCACTCCCATTGGATTGACCCAGAAGATAAACTGCAAGACTTGGAGTTAACAATAAGAGAGCTCAGAGGTGTCTTACTCAATTTCAGGGGACAATTCAGCAAAATATTGGGTCAGAAACCTCGTTCAGAGATGAACAAAGAATTTTTTACCAAAAACCTCTCTATAGCCTATAAAGATCTCCCAGCCTCATTCTTATTATACTGTGTGCATCTTCTCCTAGATGATTCACCCATTGCAAAGAAAACTGACCACGTGTTAACATATAATAAGGTAAATGGATATTGGGCAGGACTCTTAATCGCCCTGTGTTTCGTGACTGGACGCCATCCAACATTCTCACTAGCAAATGCACGAGGACAAGGAGCAGCAATGGGATCAATCTATGGAATCCTTTGCTGCTTCATTTTCAAAAAAATTGTGGATTTCAGCTTCTTGCCTCTTTTACCATGGATCTTTTTCTCTTCTTTTCTTAAGTATAGTAGAATTTATGGTCAAGCTGGTGGGATTGCAGCAGTTACAGGGGCCTTGTTAGTCGTTGGTAAGAAGCAAAATGACCATCCAAGTCAATTTGCACTTGCTAGAATGGTCGAGGCCACAATAGGCCTCCCTTGCTTTGTTATTGTAGAGATTATTTTTAATCCCTGCAGAGATGCAACTCTAGCAAAATCTGAACTTTCTCAATGCTTGAGATCACTTCAAGATTGCATTGACCAGATTGCCATCATTACTCCTACAAAAAGAAAGATGCCAGTTTCAAGCTCTCAAGCATTGAGAGAAGGACAGAAAAGGCTGAAATCTCTAGTGGGCCAATTAGAAGAGTTCACAGCAGAGGCTGAATTGGAGCCAAATTTCTGGTTCATTCCATTTCATAATGCCTGCTACAGAAAGATGCTGGAATCACTATCAAAGATGGCAGATCTCTTACTTTTTGTGGCATACTCAATGGAAAATATGATGCTATTGTCACAGAAAAATGAAGCATTTTGGGTGGATCTCCATGATAGAATAAATGAGAATGTGAGGATTTTTAAGAAAAAAGTTAGCCCCACATTGAAACGCCTTGAAGAGATAACAAGGAAAAAGACTCCTAGGAAACTTGAAAACGAGTTGAATAGGAATCTTCCATGTGATATCGAGGCACCAGAACATCCCAATGCAGAAGAATTTAGGGTCTGGAGTGGAGATGAAGTGGTTGATAGCATTACAGACTCTTTTCTCTAA >MELO3C003118 ATGGCGGTCACGGCGGCGACCATGATTGTGTGGCGAATGCGCCTAGGCTTAGCTCTACGAGCGGCTTTGGCATGTGGCATAGTCGGCGCCGTCACGGTTTTCGGCCCAGCACCTGTTAGACGGTTACTGGCCTTCTCAGCTTTCTCCTACTTCACCACCATTTCTATAGTACTTTCCGACGCTGTTTCCCTCGGTGACGCTGTGAGGGGTGTGTGGCACGTGATGTGGGCAGTGGTGTTTGTGGTCGTCTCGTCTCTGCCGTGCTTGTGGCTGATCGGACCGGGACGGTTCACCAGTGCGGCATCGGCGGCGGTTGCAGTGGCTGTCAGTGCGTTTGTGGTGGCCCTGCCGGAGCGGACACACTTGCTGACGAAGCGAATCGCGTTTGGACAGCTGGTGATTGTGTACGTTGGGACAGTGATTCACGGCGGTCAGATCAGTTTTGTTAAGCACCCAATACGTGTTGCGTCTAGTACGGCTGCCGGAGCTCTGGCCGCCGTCGCCGCCATGATGATTCCCTTTCCACGCCTCGCTTTCTTCCAGATAAGGAAACTTAGTAAGGGTTACTGTGAGAATGGTTGGAAGAGAGTAGAGGCAATGGTGGAAGGAGTGGGTGCAAAGACCAAAGGAGAGGCAGTTGCATTTATGGTTGAAGCCAAGTCTCTATCAACCAACGCAACTAAGCTTCTTCAAACTATCAAATCCAATATGAGAGGGGTGATTTGGGAGAGACGACAAATGGGCTTCGACGTTGAAGAAAAATTGGAAGAAATGGAAGTTGCAATGAAAGGAATGGAAGCCGCTTTAACTTCCCCTTCCATGGTCTTCGGATCAATGGACGAACAGCTCTCCAATTTCCTCAACAATCTCAAACCCAAAGCCATCTCAAAGCTACAACAATTCAAGATCACCGTTCCTCCTACTTCCACCACCGCGCCGGAGACAAAACCCACCTTCTCAACCCCTTTACCTCTCAATATTTCTCCCATCACCCCTCAGATTCTTCCCACTTCCTTCTTCTTGCGCTGTATGGAAATCCTCCTATACGACTCAACCGCCGGCCGGAATCTCGTTTCCGACGTGGAAATTGGTCGGAGAGTCAACGGAGAAAAAGCAACTCAGTTGGGAGATCATTGTACCAAAAAAACTTGTTGGGGCACTTTGTCGAACATGTTGCCTACAAACCAGAGTTTGTGTTTTGCGCTGAAATGCTCGATTACATTGGGGCTTGCTGTGTTTCTGGGCTTGACTTATACAAAACCAAATGGGTATTGGTCAGGATTGACGGTTGCTATCAGTTTTGCAACGGAGAGACAAGCTGTTTTTACTGTTGCAAATGCTCGAGCTCAAGGGACGGCCATTGGGTCAATCTATGGAGTTTTATGCTGTTTTATTTTAAAGAAATATGAGTATTTATGGCTCTTACCTCTTCTTCCTTGGGTTGTTTTTACTAGCTTTCTTGTTCATAGTAGAATGTATGGTCAATCTGGTGGGATAGCATCAGCATTAGGCGCATTGTTAGTTCTTGGGAGGAAGGATTATGGCGTTCCATCTGAGTTTGCAAATGCTAGACTCACTGAAGCTTGCATTGGATTACTCTGTTTTCTTACAGTGGAGATTATATTCAACCCAACAAGAACAGCTACTTTAGCAAAAACAGAATTCTCAACAACTTTGGTGGCACTTGAAGATTTCATCAAAAGGGTAATCCTTGTTCCTCAAAAGAACTTGAATCATGAAACTTCTAATTTCGTTTCATTGATACAACACCACAAAATCCTGAAATCCCATGTTAGTCAATTAGGAAAATTCATTGTTGAAGCTGGGTTTGAGCCTAATTTCTGGTTCACACCTTTCCAAGGTGGTTGCTATGAGAAAATTTTGAAATCCCTTCAGAAAACATTGGATATCTTACAAATTATGCTGCATGAAATAAAGTTTCTGTCTCTAGAGCTCAATAGTTCTGGTCTTATTGTGAAGGAACTTCATGATAGTTTAACTGAAGACATGGAAATTTTCAGCAAAAAACTTGGATGTTCTTTGAAGTTCATGGAGAAGTTGAGCTCAATAAAGTCCTTAAAAGAATTGCAGAACAAAAACCAAAACCAATGTCTAGAAATGGAAATGGGGAAGAAGGGTTCAAATGATGGATGCAAAGCTTTTGCTCTTATTGAAGAAGATGTTGAGAAAATTGTGGGTTCTTTCTGCCAACATGCTAATGAAATATTGAGCAAAGCTTACACAAACGACGAAGTGGAGGGAAATTTGAAAGGCCAAATGACACTATGTTTGAGTTCAATTGGGTTTTGTATGGAATGTTTGATGAGAGAAACAATGGTGATGGAGAAAGAAGTGCTTCAAGTGCTGAAACTGGAGAATCCATCTATTCATATTAATTTGCAAGAACTTTCAACAAGACTAAACGCTTACTGTACAAAGTAA >MELO3C020655 ATGCCGTCCTTGTGGTTCACGTGCTTCGCCGCCGGTTGCCGCACCGCAGTCGCATGCTCTATTATTGCTGCAGCCACCGTGTACGGCCCCCTTTTTCTACGAAGTCAAGTGACGTTCCCGGCATTTTCTTACGTCACCGCCATCTTGATCGTGACAAATGCAACTCTCGGGGACACCGTCCGTGGCTGTTGGCTGGCACTCTATGCCACCCTGCAGACTGTCTGTCCGGCCATGGCAGTGTTTTGGTTTATTGGACCGACGAAGTTCTCGTATGAGACCATCGCTTTGACAGTGGCACTGGCATCGGTTGTGGTGGTGCTGCCGAGTTCTAGCCATGTTTTGGCTAAACGGATTGCTTTGGGTCAGATTGTGATTATTTATGTGGTCGGTTTCATCGGCGGCGTTCAAACTAACCCTCTCATGCACCCTGTTCATGTCGCTTCTACAACCGCGATGGGTGTCGCCGCCAGCTTCCTCGCCACCCTACTTCCCTTTCCACGTCTCGCTTCTCTTGAGGTGAAAGAGAAGAGCAAAGCAATGGTGGAGATGGTGGGAGAGCGGTTAAGAGTGTTGGTGAAAGCATTTCTTGCTGACAATGACACAGTGGCTGTTGGGTCCCTTTCTAAAGCTTCACTATTGTCCACCTCAGCAACCAAACTCCTCCAACCCATCAAACAATACCAAGAAAGCATGAAATGGGAGTGGATTCCATTAAAAGTTTGCAAATTGGGATGGTTGTGCAATAGCCAAAAATTGCAAGATTTGGAAAGACCAATAAGAGGAATGGAATTAGCTTTATCAAACATTGCTTCATATCCAATATTGCAACCACTTCAAAATGGTATAAATTCTTTAGAGAATCAAATCATCCAATCTTTAAACCAAGGCATTGCTTATCCACCCTCCGATTCACATACTTTCCCTGAGTCAAACCCTTTTGATGAAGCTCAAGATCAAGATCCAATGATCAACACCATCCAATTATTCAACCCAACAAATCACAAAAATCTCCCTTCCTTTTTCTTCATATTTTGCTTGAAACTCCTTCAAGAAAAATCCCAAAACAACAAATTACCAAACCCCAAGAAGAAATCAGAAGAACGAAAACAAACACCAAATACAACAAAATGGGCAATTCCAAGTGGGATTTTGAGCAGCAAACAGGTAATGGGAGCTTTAAAATCAGCAATTTCTTTAGGAATTGCTGTTTATTTGGGATTGATTTATAGCAAAGAGAATGGATTTTGGGCAAGTTTAGGAGTGGCTGTTAGTATTGCTTGCACAAGAGAAGCAACTTTCAAAATAGCAAATGTTAAGCTTCAAGGAACAGTTATTGGATCAGTTTATGGAGTTTTGTGTTTTGTTATATTTGAAAAGTTTTTAATCGGAAGACTTCTTTGTCTTCTCCCATGTTTTGTCTTCACAAGTTTTCTTCAAAGAAGCAAAATGTATGGAGCAGCTGGTGGAGTTTCAGCCATTATTGGAGCTGTCATCATTTTAGGAAGAACAAATTATGGTTCACCAAAAGAACTTGCTTTTGCCAGAATTGTTGAGACTATTATTGGAGTTTCATCTTCAATTATGGTTGATATCATTTTACATCCAACTAGAGCTTCTAAACTAGCCAAATTTCAACTCACTTCCACTTTACGAGTGCTTCTAAAATGCATCAATTCAACGAGTTTTCAACCCGAAGATCTCAAGGGAAGTTTAAAAGAATTGGGAGGCCATGTTGTTGAGTTGAAGAAGTTGATTGATGAGGCTAACGTAGAACCCAACTTTTGGTTTTTGCCATTTCAAAGTGGTTGTTATGGGAAGTTGTTGAAGTCGTTGTCGAAAACGGTTGATTTGTTTGCTTTCGTCAGTCATTCGGTTGAAGGGATAGGACAGAATCTTCTGGTATTGGAAGATTCGTCGTCGTGGGCGAAAATAGGTGAAAATTTAGAGGAGGATGTCGAGGATTTTAAGGAAATGATGAGTGGTTTGGTGAAGTGTTGTGCGGATGTGAGTTCTTTGAAATCATTGAAGGTGCTTGAGAAGGAAGTAGAGAAAAAGAATAAGGGAGAGAGTGATGTTGGGGATGTTGAAATGGGTGAGAGTAAAATGGTCATTGAAATGGAGGAAATGGAGAGAGAGAAATTGCTTTGTTCATTTATGAAGCATTATGTGGAAATCGTTGAGCAAAGTAGTGAAAGTGAAGAAGGTAAAAGAGAAGCACTTTTGAGTTTTAGTGCTTTGGCTTTTTGTCTAAGTAGTTTGATGAAAGAGATTGAAGAAATTGGGAAAGCAACAAGAGAATTGATTCAATGGGAGAATCCTTCAAGTCATGTTGATTTTAATGAAATCTCATCTAAGATTCATGTTGTACAAAAAGGTGTGAACTAA >MELO3C020659 ATGTATGGTTCGGCTGGTGGAATTTCGGCCATTGTTGGAGCTTTAGTAGTTTTAGGAAGAACAAATTATGGTTCACCAAAAGAATTCGCTTTTGAAAGAATGATTGAAACTTTTATTGGGATTTTTATATCAATTCTAGTTGACATCATCTTTCAACCAAAAAGAGCTTCTAAATTGGTAAAAATTCAATTCATTTTGAGTTTACAATTGCTACAAAAATGTATCAATGATTCATTTAGTTATGAATCAAGCACAATAATGGAGAAGGACTTGCAAGGCTTAAGAACTCAAGTTATTGAGGTGAAGCAATTGATTGATGAGGCTGAGGTTGAACCAAATTTCTTGTTTCTGCATCCATTTCATGGGGATAGCCACTTGAAGATGTTTAATTCCTTGTCAAAAATGGTTGGTTTATTAGCTTTGAATGGTGAAGCAATGAATAACCTTAAAGAGAGCTTGAGAGAGGATTTGTGGAGAAAGGTTGGGGAGAAATTAGAGGGGGATTTTGAGAAGTATAAGGAAATTATGACCAGTGGTTTTGTGACATTTTATGAGGATTTTAGATCTTCTTCATTGAAGTTTTTGAAAGGGAATGAAAATAAGGAAGATAATTGTGGTGATATTGAGATGGGAGAGGCACAAAGGATTGAAGTAATGGATGAAATTGAGAAGGAAAAGTTGATTAATTCATTTTTGCAGCACTTGAGAGAGATTGTTGAAAGTAAAGATGGTACAAGTGAAGAAATAATTTTGAGTTTGAGTGCTATGGCTTTTTGCTTTAATAGTTTGATAAAAGAGATGGAAGAGGTTGGAGAGGCAATTAGAGAACTCATTGAATGGGAGAAATCCTTTTTCTAA >MELO3C020660 ATGGCTGCCACCACCACCACCAACACCTACCAAGATGGCCGAGCCGTGTGGTTCACACGACTCGCCTCTGCCTCCCGAGCAGCTCTTGCTTGCTCCATAGTGGCCTACACCACCTTGTACGGTCCGGCTACTCTTCGTCGCCTTGTGGCCTTTCCCGCTTTCTCCTATCTCACCGCTACTCTCATAGTCACTAACGCCGCTCTTGGTGATGCCGTGCGTGGTTGTTGCCTAGTCGTCTTCGCTACCATTCAAACCGTTTGCCCCGCCATGTTCCTATTTTGGTTCATTGGTCCGGCCAAATTCTCCCTCATCACGACCGCCGTGACGGTGGCGTTGGCTTCTGTGGTGGTGGTGCTTCCGAGCTCAACCCATTTGCTGGCTAAGAAGATCGCTTTGGGTCAGATTGTGATCATTTACGTTGTGGGTTTCATCGGCGGCGCCCAAACTGACCCTCTCATGCACCCACTCCACGTCGCCGCCACCACCGCCTTGGGCGCGGCCGCCAGTCTCATTGCTACACTCCTCCCTTTCCCACGCCTTGCTTCTCTTCAGGTGAAAACGAAGAGCAAAAGTGTGGTGGAGAACATGACAGAAAGGTTAAGTTTAATGGTGAAGGCAATCCTTGCAGAAGATAGAACAATGGCGGCTGCTTCCATATCAAGAGCTCACTTCTTGTCTTCTTCAGCTACTAAACTTCTCCACTCCATTAAACTTTACCAAGTAAATATTTTACCTTCTTAA >Eucgr.B02385 ATGACGCGGGGGATCTCGGGTCGGCCGGAGCGAGCGGGAGCCCTGTGGCGCGCGTGCCTCTCGTCCGCCCTCCGGACCGCGCTCGCCTGCGCCGTCGTGGCGTGCGCCACCCTGTACGGGCCGGCCCCGCTGCGGCGCGCCGTGTCGCTCCCGGCCTTCTCCTACGTGACGGTCATCCTGGTCGTCACCGACGCCTCCCTGGGCGACACGCTGCGCGGGTGCTGGCTGGCGCTGTACGCCACCGCCCAGAGCATCGGGCCCGCGATACTGAGCCTCTGGCTGATCGGCCCCGCGAGGCTGTCGACCGGGACGACGGCGCTCGCGGTGGCGCTGGCGTCGTTCGTGGTGGCGCTGCCGGGGGCCACGCACGGGACGGCGAGGCGGATAGCGCTGGGGCAGGTGGTGCTGGTGTACGTGATCGGTTACATCGAGAAGGAGCGGATCGAGGCGGTCATGCACCCGCTCCACGTGGCTGCCAGCACGGCCGTCGGGGCCCTCGCTGGCCCGCTGGCCCTGTCGCTCCCCTTCCCGAGGACGGCCTGTCATGAGATAAAAGAGAACTGCAAGGCCTACGCCGAGAATGCCTCGAACAGGTTGAAGCTCTTTGCCGAGGCGTTCCTCGCCGAGGACGAAGAATCCGCCCTCGCCCTTATCTCTCGAGCCAAATGCTTGTCCCGTGCTGGGAACATACTTCTTCGGAATATCAAATGCCATCAGGAAAGTGCGCTTTGGGAGAGAGTTCCGTTCACGTCCTCGAGACCATACCACATGAGCCCAAGAGACAGATTGCAGGAAAGTTTAGAAACACAATTGCGTGGGATGGAGACGGCATTAACGAGCATCACTTCGTTCCCAGTCACATTGTCCGGTGATGATGGACCGCTCAAAAATTGTAAACTCGCTTTAGACGAACACATTGCTCTGATCATGAGGCAATCTAAGAGCTGGCTTTCCCCGGGTGATTCTACTTCAACCGTCCCTGAATCAGTTTCCAAAAACATAATTGGCTTCTTCGACTCTATTCGCAAAGTACCGGCCTCGCCCGAGCACTTGCCCTCCATCTTCTTCCTCTTCTGCATGAAACTCCTCCACGGCAAGACCACACCATTGACATCACCCCAAGATGATCCTCTTAGAAAAGACGAACAGTCAACAGGTAAAGAAAGCGGGCTTTCTCACTGTTTCGGAAGAGTCTGGAACGAGTGGGGCTTCAAAATGAGCCCCAAAAGGCTCGTCCCCGCGCTCAGGTGCTCGCTCTCGCTGGGCCTAGCGGTGCTGTTTGGGCTTATGTACAGCAAGGAGGACGGTTATTGGGCCGGGCTTCCGTTAGCCGTCAGCTATTCCTCAGCCAGAGAGGCTACTTTCAAGGTGGCCAACGTCAAGGCGCAGGGCACGGTTCTGGGATCCGTTTATGGAGTCATAGGTTGCTTTCTTTTTCAGAGGTTCTTGCCCGTGAGAGTCCTTTCTCTCGTCCCTTGGTTCGTCTTCTGTAGCTTTCTTAGGAAGAGCAAGATGTACGGCCAAGCAGGCGGCATCTCGGCTGTGATCGGAGCCCTGTTGATACTGGGTAGGAAGAACTTCGGCCCGCCGAGCGAATTCGCCATCGCAAGAATAGTCGAGACCTTCATTGGGTTTTCTTGTTTGGTAGCGGTGGAACTTCTGATGCAGCCCACGAGAGCTTCTTCTCTGGCTAAGCGTCAGCTCACCGATTGTTTCATGGCATTACGTGAGTGCATTGCCACGGTCACGACACTGGGTGGACTCGACAACACCAAGATGTCTAATCTTGAAGAGAAACAAAAGAGGGTCAAGATGAGTGTGCTTGAGCTCGGTAAGTTCATCGAGGAAGCCAATGTAGAGCCGAATTTCTGGTTCGTGCCCTTTCACAGTGCTTGCTACAGTAGGCTCTTGGGGTCTTTGTCAAAGATGGCGGACCTCTTGTATTTCTGTGGCCTTGCGCGGAAGTTCCTCGAACAAGAATTGTCAGCACTCGAGGCCGCGGCTGCTTCTTCAGAAGAGGCCCTGGATAAGCTTCACAGCGACCTTGAACTTTACAGGGATCTCGCGAGCTCTTCGCTGAAATGCTTCGAGGAGATCAACTCAATCAAATCAGTCTCGCTTCTCGAGAAGCAGCTTCAAGAGACCAGCGTTTCTTGTGATCTCGAGTTGGGGAAAGCAACAAAATCCAACCTGCTAAGGCCTCGTTTTGATGAAGGTGACGTCGAGAAGATGGTGGGCTCTTATCTTCAGCATTCTCGAGAGGTGCTCCATAAAATCAGCAGTGGCGGTGATGGCGTCGAAGCCGAGAACGCGATCAAAAGCGAAATGGTCCTCAGTTTGGGTGCTTTAGGATTCTGCATGAGTAGCTTGCTAAGGGAAGTGAGAGAGATCGAGAAGGCCATGAAAGAACTCGTGCAGTGGCATAATCCGACAAGCCAGATAGCGAACTTGCACGACTTTTCTCGCAAGATTCACGCCTTGCGCGGCTGA >Eucgr.K03147 ATGGCCACCACCTCAACAATAGCTGAGCAAGCCGACGCGCTGCGGCATGCACACTTGAAGTCGGCGCTGCGCACAGCCCTGGCTTGCTCCATTGTCGGGTTCACCACCCTCTATGCCCCAACCAGTGTTCGGAAGTTCTTAGCATACCCGGCTTTCTCGTACGTGACGACCATTTTGATCGTGTCGGAAGCGACGGTCGGCGACGCTCTGAGAGGAGTATGGAACGCATTCTACGCAACTACTCAGGTCATGCTTTTCTCCGTGTTGAGCTTGTGGCTGGCCGGACCTGCCCGGTTCGCTACTCATGGCCTGGCTGCTGCGGTTGTGTCTCTAGGTACTTTTCTGGTCGCGCTGCCCGAGTCGACTGATTTGATGGCCAAAAGGATCGCTTTTGGGCAGCTGGTGATCATCTTCGTGGGAGCCGCTATAGGGGGAGCAAGCACGGGAGTTGTGATGCACCCAGTTCACGTGGCGTCGAGCACCGCACTTGGCGCCCTGGCTTCGGTCCTGGCTCTGTTGTTCCCATACCCTTGGCTTGCGTGCAGTGAGATCAGGAAAACGTGCCGATTGTATGTCGAGAATGCATCGGAGAGGCTGAATCTCTATTTAGATGGTTTCTTTGCCAAGGGACGCCCGGCTGCAGTAGACTTGATTTCCCGAGCGTCATGCTTTGCCAGAGTAGCAAAGAAGCTCCTTCAAAGTATTAAAGAACACGAGAGAGGTGTGTCATGGGAGAGACCGGGAATACGATTCCTGAAACCTAACTACGTCAACTTAGGAAAAAGATTGCAAGAAATAGAGCTGCCGTTGAGAGGAATGGAAATGGCCCTCAATTCTTGCTCCTCTTTTCCTATCAGCATGGCAGACCAAGAACTTCAAAAGGCTTCGCCCAAAATTAAACTGCACTTGCGGCAAAAACTTGAGCAAGCAAAATGTTTCACGCCTTGTGATGCCACAACAGCTCCTGAGACCAAGGGAGACGACATAGAAAATGCCCTCCGGCCATTCACCACTATGCCCGCATCCCAGGAAGGCCTACCAGCACTTTTCTTCCTTCACTGTGTCGAAATCCTCCAACATGACCTGATTTTTGGACAGCCCGTAAAACCTGTTGATTTCAAGAGCCAGGATTCTGTTACTCAACAGTCTGGAGAAAAAGATCAAGCTAAGTACTGCTTCGGAGGGAGGAGGACAAGGCTAAACTTGAAACCGAGCTGCCAAAGTTTGATTTTTGCATTGAAGTGCTCAGTTTCTCTGGGTCTTGCGGTGCTATTCGGTTTGTTATATAACAAGGAAAATGGGTACTGGTCAGGACTCACCATTGCAATCAGTTTTGTGACAGGAAGGCAACCAACCTTCACCGTCGCAAATGCGCGAGCGCAAGGCACAGCCATGGGATCAGTGTATGGATTACTGGGCTACTTCATTTGCGGAAAATTCGTACACCTGAGATTCTTACCTCTTCTTCCATGGATCATTTTCGCTAGCTTCCTCAGACACAGCAGAATGTATGGGCAAGCAGGTGGCATTTCAGCAGTCATAGGAGCATTGCTCATCTTGGGTCGGAGAGATTATGGACCCCCAGCGCAGTTCGCAATCGCCAGAATCGCAGAGGCATCCATTGGACTGATCTGCTTCATCACTGTAGAACTACTTTGGGAACCTGCAAGAGCGTCAACCCTTGCTAAGGTTGAACTCTCGACGAGCTTGAGAAAACTTGGCGAAAGCATTGAGGGTATAGTTCTTTGCTTGGAAGAGAAACAATGGCCAGACTCGAAATTCCATACCTTGCAGGAAAAGCTAGAGGATCTAAGAAGCCGCACCTCCAAATATGGAGTTCTGACAGAAGAGGCCGTGTCAGAGCCTAACTTCTGGTTCCTCCCCTTTCCAGGGGATTGCCATCTCAAGATTCTGGAATGCTTGTCGAAAATGGTGGACCTCATACAATTTACCAGCTTCCAACTGGAGTCTCTCCAACGATTATCTGTGAGCATCGGTGTCGCTTGGAAAGAGATTCAAAAGCCACTGGAACAGGATCTGGAGCTTTTCAAGGAAATGATAGGCACTTCAATCCAATTCCTTGGAGCAGTCACTTCACTCAAGTCCCTTTCTGCAATTGACACAGAATTGCAGAAGACAAAAGTGGCTTGTGACATGGAATTGGGGAAGTCGCAAAGTGGAAACCTGACTACATTTTCGGGTACAAATGACGAAGATGTTGCGAAGGTTACGAGTTCATTTCTTTGCCGATCGAATGAAGTGGCAACAAGAATTCACGCTCAGGAAGGTTTGGAGGAGCTCAAGAGCCAAATGGTTCTATGCATTGGTGGCCTAGGCTTTTGCCTTAGTAGGTTGATGAGAGAAACAATGATCATGGAGGAAATCCTAAGAGAGCTTCTTCAGAGGGAGAATCCTACATGTCTCGTAAACATCTCCGAAATTTCTTCCAAGCTAAAAGCTTTGGACATGTAG >DCAR_005311 ATGCAAATCCTAAGCTTCAAATCCGAAAGAAGCAGAGCTTTCTGGACTACATGTCTAGCCTCAGCTTTCCGAACAGCCTTAGCTTGTGCCATAGTAGGCGGCATCACTCTTTTCGGCCCCATGTCAATCCGAAGCCAGATAACACTCCCTGCATTTTCATACGTCACGGTTATCATCATCATCGTTGATGCCACCTTAGGCGACACTTTCAGAGGTTGCTGGTACGCTCTTTACGCGACAGTCCAAGGAGTCTGTCCAGCTATTTTCTGCTTGTGGCTGCTCGGTCCAGCTCGTCTCACGACGCTGGTCACGTCTGTGTTGGTGGGGGGGAGTGCATTCGTGGTGGTCTTGCCACAAAACACACATGTGATAGCCAAGAGAATAGCTCTGGGACAGATTGTGTTGGTGTATGTTATAGGCTATATTAATGGTGTCAATACTGAGCCTATTATGCATCCTATTCACGTCGCGACTAGTACAGCGATTGGAGTCTTTGCTTGTGTCTTGGCCCTCTTGTTTCCTGTCCCAAATTTGGCTTGCGTCGAGGTAAAGCGGAGTTGCAGACTAATTGCAGAGAATTATTCAGAGAGGCTAAATCTAATGATGAAGGCATTCTTGGAAGAAGATAAGAAATCCGCTTTAGCATTCATGTCTCAAGCCAAGTCTAAGGCTACTAAAGGAACCAAACTTCTCCATAGTATCATATCCAAGCAAGAAAGCATGCAGTGGGAGAGATTCGGAATCAAATGCTTGGGACCTTATTGTGCAACTCCAGGACAGAGACTTCAAGAGTTAGAAACACCATTGATGGGAATGTCGATTGCTTTATCGAGCTGTCAGAAATTTCCAATGAAATTGCTAAATTTAGAGCTCAAAGATGGTCTGCATAAGCTAGAGGAGCACATTGATATGAGCTTTACCCGGATCAAGAACCGCCTTCCATTTGATTTAGCCACTGTTTCTGAATCAAACACGGATGATGAAGTGGACGCCCTTCAAGCTTTACAATCTGTACCAACAGAACAGAAAGATTTGCCATCTTTTTTCTTCTTATTTTGTCTGAAACTCCTTCAAAATAAAGTACTTGGTACCAAAAGAGATGATCCTCCCAACAAGTCAGCAAAAGTAGATGATTCACAAAACAAACAAATTCATCAAGGGAGCATTTGTACCGGTGCTAAGAGATTAATGCCAGCCTTTAAGTGTGCACTTTCTCTATTTCTTGCGGTGCTCTTTGGTTTAATGTATAGTAAAAAAGATGGATACTGGTCAGGTCTTCCTGTAGCTATTACTTTCGCAGCATCAAGAGAAGCAACGTTTAAGGTTGCTAATCTCAAAGCTCAAGGGACTGTTCTTGGAACCGTGTATGGTGTCCTGGGGTGCTTTCTTTTTGAAAGATACGTAAAATTAAGGTTCATTTCTCTCTTTCCTTGGTTCGTTATTACTGAACTTTTGAGGCGTAGTAAAATGTATGCCCAGGCCGGAGGAGTTTCAGCTGTCATTGGAGCAGTACTTATATTGGGAAGAACAGGTTTTAGATCTCCAAGTGAATTTGCCATAGCTAGAATTGTTGAAACTTTTATTGGATTATCCTGTTCTATATTGGTAAATATCAGTTTCCAACCTACAAGAGCTTCGACACTAGCTAAAACTCAACTCTCTGCAAGCCTCAAGTCCTTGCATGAATGTGTTGAGGGTATCAATCTATCTTTTTCAAGCATAACCAAGTTCCGAGAAAGCCAGAAGGGGCTTAAGTCTAGTGTAACAGAGCTAAGAAAACTCATTGCAGAGGCTGAAGTGGAGCCAAACTTCTGGTTTCTGCCTTTTCATGGTGCAGCCTACAACAAGGTCTTAAAATCCCTATCAAAGATGGTGGATGTATTGCATTTTGGAGCTGAATCAATCGAATTCATAGAGAAAGAACTGCATGGACCACATCATGACCGCCACGTAGAGATTATGACAGAACTGGACAGTGATATTCAGGTCTTAAAGGAAAAGGTTGGAAATTCAGTAAAATGTTGTGAGGGAATCACAAAGATAAAATCAGTGGCGGTTCTCGAAACGGAGATTGAAAAGAATGGCATTGCCTGTGATGTGGAGGCTGGAAAAGCATCTATTCCAAGTATGTTCATGTCTTCTGACTATGATTTGGATAATAAGATTGAGAAGATCTTAAGTTGTTACCTTGGAAATGTTAAGAAGATGATTGACAGAGATGAAAGGCAGGAGAAGAAGCAGATGGTTCTGGGACTGAGTGGTCTGGCCTTTTGTATGGGAATTTTAGTTGCAGAAACAACAGAGGTTGAGAAGACAATTGAAGAACTTGTGCAGTGGGAGAATCCTTCTAGCCATGTTAACTTGCATGATATTTCTTTTAAAATACATGCTCTACAAAATCTCTGA >DCAR_014842 ATGGGTTCAGCCTCTCAAGCAAATCTTCTCCTCCAAAAACAGCTCAAAGATCTATGTAAAAGACCACTGGATGGCTTTTCTGCTGGTTTGGTTGATGACAGCAATATCTATGAATGGAGTGTAACTATTATTGGACCTCCCGATACTCTTTATGACGGGGGCTATTTTAATGCAATTATGAGCTTTCCGCCGAACTACCCAAATAGTCCTCCATCAGTGAGGTTTACGTCTGAGATGTGGCATCCCAACGTATATTCTAATGGGAAGGTTTGTATATCAATTTTACATCCTCCTGGCGAGGATCCAAATGGTTACGAGCTTGCAAGTGAGCGCTGGACACCCGTCCATACTGTCGAGAGTATACTATTAAGTATCATTTCAATGCTTTCTAGTCCGAATGATGAGTCTCCTGCCAATATTGATGCTGCAAAACAGTGGAGAGATAAGAAAGATGAATTCAAAAAAAAAGTCAGTAGGCTAGAAATGGACAGGAAGCAAATGATGCTGCGAATGCGGCTGGAGTCTGCCATCCGGACAGCAGTGGCATGCATCATAGTTGGCTGCACCACCCTCTATGGTCCATCCCACTTCCAGAACCATGTACCCTTTCCTTCGTTTTCCTACGTGACCGCTATACTTATTGTGTCAGATTCGACTCTAGGGGACACGTTGAGAGGATCGTGGTCTGCATTCTGTGCCACGGTTCAAGTGGTGCCAGTTTCCATTTTGAGCCTGTGGATTTTTAAACCTGCTAATTTCTCTCCAGCCACCGCTGCTGTGGCAGTGGTCTTGATGTCGTTTCTGGTGGGGGTGCCGAGAAGTACAGACTTGTTGTGTAAGAGAATTGCGTTTGGTCAAGTTGTGATTGTGTATGTTGGTGCTGTGGCCTATGGGGATGCACCTGGAGCTGTGCTTCGGCCTCTCCATTTGGCTTCAAGTACTGGACTTGGTGCTTTGGCTTCTGTCATCGCAACTTTTTTACCATTTCCCCGGTTAGCCATCATCGAGGTTAGGAAGCTGTTTCACTTGTATACTCAAAATGCTTCAGCAAGGACAAGTCTCTTTATCAAGGCCTTTTTGAGCCAAGACAGCGAATCAGTAACTGAAGCTGTAATTGAATCTAAGCCCTATAGTGAAACTGGGGATATGCTTCTTCAGAATATCAAACTCATACAGGAGGGTTTGCCATGGGAGAGACGCGTCATGGACTTGAGATGCCACCTCAGTAATCCCGGATATCAGCTGCAGGGCATAGAGACGGCAATTAGAGGGATGGAGATGGCCTTAGCTTCCTGCCCTTTACTTCCGGTGAGCATCATTGATCAAGAGCTCAACACAAGCTTGCAAGGAATGGATATAGAACTTGGACTAAAGCTCCTGGAAGCACCGAGCCTTTTGCCTAAAGAAGCCATCACCGTTAGAGATACAAAGAGTGTATATTTCGACAAAGTTGTCCAGTCCCTGGCAAAAGTCTCTCCTACAGAAGAACAGCTTCCTATTATATTCCTTCTATTTTGCATGGGAATTTTGTTCGATTCCACTTCAGGAAATATTCAGATACCTAAAACAAAAAACGTTCAGATAAATAGTAATATAGAAGTTAAAGCTTCACAAGGACAGTCCAATGATTATCGTCAGAGAATTCTGGGTATTTTAAACTGGCTCCCAGGTATTGAAGAACTGTTATTTGCCTTCAAGTGCTCAATTTCTTTGGGCCTGGCTGTGCTTTTCGGTATGGTTTTCAACGAGAAAAATGCTTACTGGTCTGGACTCACAATTGCCATCAGTTTTGCAACAGGAGTGCAGCCAACATTTACAGTAGCCAATGCTCGGGCACAGGGCACAGCACTGGGGACTGCCTACGGTGTTGTGGGCTGCTTTCTCTTCCCCAAGTCAAGAGAACTAAAATTCCTGACGCTTCTCCCTTGGATAATATTTGTCGGCTTTCTTAGACACAGTCGAATGTATGGCCAAGCTGGCGGAATTTCTGCTGTTATAGGAGCCCTGCTGATTCTAGGCAGACAGCGCTATGGGCCTCCACATGAATTTGCCATAACAAGACTCACAGAGGCTTTTGTTGGATTATCATGCTTGATCTTAGTTGAACTTGTTTTACAACGACAAAGACCAGCAACCCTTGCAAAGTTTCAACTCTCCAGGAGCTTAAGAATTCTTGAAGAGTGCATCCAGCACATTACTTTTCCTCCTCTGGAACTGAAAGAAAAGCAAAGAACTCTGAAATTACACGTCGATGAGCTTAAGCAACTCAGAAAATATGCTGAAACGGAGCCTAATTTCTATTATATGCCTTTCCGTGCTGCATGTTATGACAAGCTGCTGGGGTCGTTATCAAAAATGATCATTCTACTGCAATTGGTCACCAATATATTCGAGACCCTTCCAGATGTGTTAAATAGACTTGTCGATGAACGGGAGGAGATTGAAGAGCTCATAAACATCGATCTTCAACATTTTAAGGAAAATGTGAGCACTTCCTTGAGATATTATGAGAATATCACGACAATCAAGTCACTTGCATTTGGTGAGAAAGGACGGCAAGAAAATAAGATATTTCATGACCTTGAGGCAGGGGATTCGACGAATAGAAGTGAGCTTAATTCAGCTAAACGTGGCGATTTAGCTGAGAATATATTGAGTTCTTATACTCGGCACTCGGTGCAGTTGGTGGAGAGAGTTTGCATTAGTGAATGCGAGGAGGATTTGAACGGGAAGATAGTTCTGTACTTGGGCTCCTTGGGGTTCTGCATGAAGAGCCTTGTGAGCGAAATAACAGCCACTGAGAATGGAATAAAGGAATTGCTTAGATGGGAAAATCCTCTGAGGCGCAAACTGCTTTAG >DCAR_017876 ATGGACAGAGAACAGATGATGTGGCGAATGCGGCTCGAGTCCGCGGTCCGGACCGCCGTGGCGTGCACCATAGTAGGCTGCAGCACCCTCTATGGTCCCTCACATCTCCGGAGCCACGTCACATTTCCCGCGTTTTCTTATGTCACCGCGATACTTATTTTGTCTGATGCCACGTTAGGGGACTCTTTGAGGGGGTCATGGCATGCCTTGTGTGCCACGGTTCAGGTGGTCCCGGTTTCCATTTTGAGTCTGTGGATTATTGGACCGGCTAGTGCTGCTCTGGCAGTCGCGGTGATGGCCTTTCTCATCGCGGTGCCAGAGAGGACTAACATTTTGTCTAAGAGGATCGCGTTTGGCCAGGTTGTGATTGTTTATGTTGGCGCTGTGGTTTATGGTAGCGCGGCTGGAGCTGTGATCCACCCTTTGCATGTGGCCTCAAGTACTGCACTTGGTGCTCTGGCTTCTGTCGTTGCCGCGCTCCTGCCATTCCCCCGCCTAGCCAGCAATGAGGTAAAGAAGCTACTTCAGCTGTATACTCAAAATGCTTCTGCAAGGACAAGCCTTTTTATCAAAGCATTCTTAAGCCAGGACAAGCAGTCAGCAACCGAAGCTATATCCCAATCTAAGCCCTTTAATGAAACTGGTGACAAGCTTCTTCAGAGCATAAAACTCATTCAGGAGGGTTTGTCATGGGAGAGTCCGCTTAGAAACTTGAGACACCAGCTCATGGATCCTAGAGATCAGATGCAGGACATAGAGACGGCGATAAGTGGGATGGAGATGGCTTTAGTTTCTTGCCCCTCGTTCCCGGTGAGCTTCATAGATCAAGAGCTTAACGCAAGCTTACGAGGGATGGATATACAACTTGGACTAAAGCTCGGGGAAGCTCAGCCTGCACAGGGCCTTTTTCCTTCAGAAACTATCACCACTCCACATACAAAGAATGAATATTTTGACAAAGCCATCCAGTCCCTTGCCAAATTCTATCCTACACAAAAAGATCTACCTACTATATTCCAATTATTTTGCATAGGATTCTTATCTGATTCGATGAGATCCAAATCTTCAGAATCTGCTTCAGACGATAATCAGAAACTTCACGAAGAAGAATTGACAACTTCCCCTGAACAACCTAAAAGTTCTGGCATTTCAAAAATGCTCCCCAGTACCAAAGGACTGTTATTTGCATTCAAGTGTTCCCTTTCTTTAGGTCTGGCTGTGTTTTTTGGTACAATTTTCAGCAAGGAAAATGGTTACTGGTCTGGACTCACAATTGCCATCAGTTTTGCCACTGGAAGGCAGCCAATATTCACAGTAGCCAATGCTCGGGCACAGGGGACAGCAATGGGCTCAGCTTATGGTGTTGTGGGTTGTTTTCTTTTCCACAAGTTAATGGAGTTGCGATTCCTGACGCTTCTACCTTGGATCATATTTGCCAGTTTTCTTAAAAACAGCCGAATGTATGGCCAAGCTGGTGGTATTTCTGCTGTTATAGGAGCCCTACTAATCCTAGGCAGAAAGAACTACGGACGTCCAGATGAATTTGCCATAACTAGACTCACAGAGGCATTTATTGGACTATCATGTTTAATCATGGTAGAGTTCGTCCTTCAACGAGCAAGAGCAGCAACTCTTGCAAGAAACCAACTCTCCGCGAGCTTGAAGGCACTTGAAGAGTGCATACAGCATATTGTTTTTCCTTCCCACCAGAAAGACAAGCCTGATTCAATGCCACTTCAGGAGCTGAAGGCAAAGCAAAGAATGCTAAAATCACATGTCAGTGACCTTGAAGAACTGAAAAAAGATGCTGAGATGGAGCCCAATTTCTTTTATTTGCCTTTCCGTGTTGCATGCTATGACAGGCTCCAAGGGTCATTATCAAAGATGGTCATTCTATTGCAGATAGTAGCCAGCGTATTAGAAAACCTTCAACTCGTATCAGAAAAAGCTGGTGATGGATGCAAGGAGATTCAAGAGCTCATGATCAGTGATCTACAACTTTTTAAGGCAGACATAAGCACTTCCTTAAAATGTTATGAAAAAATCACCAAGATCAAGTCACTTGCATGTTTTGAGAAAGGTCGACAAGAGGGTAAAATATTTCATGACCTCGAGGCAGGGGAAGTGTCAAGTGTGCATAGTTCAACAAAATGTGGTGACGTGGCTGAAAATATATTGAACTCTTATGTTGAACACTCAATGCAGCTGGCTGAGAAAGTCTGCAACAGTGAATGCGAGGACTTTGTCAAGGGAAAAATTGTTCTGTTTTTGGGTTCTTTAGGTTTCTGCTTGAAGAGTGTGATGAAGGAAACAACAGAGATTGAGAACGGAATAAAGGAACTGATTAGGTGGGAAAATCCTTCAAGACACATAAACTTCTATGAAATTTTCAGTAAAATAGACGCGGCATGTCCATAA >THA.LOC104806054 ATGAAAATGGCCATGACGGAACGAGCCCAAGCAATGTGGCGCACGTGCCTGGCCTCGGCCTTCAGGACGGCCCTTGCCTGCACCATCGTCGGAGCCGTGACACTCTACGGCCCCACGTCGCTCCTCCGTTACGTAGCATTCCCGGCCTTCTCTTATGTCACCGTTATACTCATCATCACCGACGCCACGCTCGGCGACACCCTCCGAGGTTGCTGGCTCGCCGTCTACGCCACGTGTCAGAGCGTGGGTCCTGCTCTCATCAGCCTCCACCTCATCGGGCCCGCGCATCTCTCCGCCGGTACTTGCGCCGTAGCCGTGGCAATCGCCGGGCTCGTGGTGGTGCTGCCGAGCGAGTCGACTCACCTGGTGGCGAAGCGCATCGCTCTCGGGCAGATCGTCATCATTTACGTCATCGCTTACATCAAAGGAGCCGACACGGAGCCCCTCATGCACCCTCTACGCGTCGCCGCAAGCACCGCCGTCGGCGTTGTAGCTTGTGTTTTCGCTCTTCTCCTCCCGTATCCTCGTCTGGCTTCTCGAGAGGTGAAACAAAGCTGCAAGGAGATTGGCCAAAATATATCGGAGAGACTGAAGCTGTATATCAAGGCCTTTAGTGCTGATGATGCCACGTCAGCAACCACGTCGATTTCTCAGGCCAGATTATTG >THA.LOC104816079 ATGTGTCGACAGGTGAAACAAAGCTGCAAGGAGATTGGCCAAAATATATCGGAGAGACTGAAGCTGTATATCAAGGCCTTTAGTGCTGATGATGCCACGTCAGCAACCACGTCGATTTCTCAGGCCAGATTATTGGCTCCCCCTTCCTCCAAGCTTTACCAAACCATTAAACGCTACCAACCAAGCATGAAATGGGAGAGGCTTCCGTTCAAGCTGTGCAGATCGCAACACTTCAACGAGAACACAGGAGATAAACTACAAAACATGGAAATCGCTCTAAGAGGAATGGAAATGGCTTTAACCAACACGTCTTCTTTTCCGGCGACATTACTTGCCGGAGAAGTAAAAGACGGCTTGATAAAGATACAAGAAGGCGTCACTCTCACCATCAAACGGATAAATAACTGTCTGCAGCCGTCCGTAAACCCAGAATCTGATCCCGACAACGCCTCCGGGTGCCTCCAAACACTTCAAGAATTCCCGGGCAAGCATCAAGATTTGCCTTTTTACTTCTTCTTGTTCTGTCTGAAGCTCCTCGAGAATATATCAATGGCTGAACCGGAGAACGACGAGGACAAGAAACCAGAATCTTCTTTGGAAGAGGACAAAAGTTGGTTCAGCATAAACTGGAGAAGCGCTTTGGGCAGCAAGAGGATGATGCCGGCGATTAAGCTGTCGCTTTCTTTAGGATTGGCTGTTTTGTTCGGTTCGATGTACAGTAAACCAAACGGTTACTGGTCCGGTTTACCTGTTGCCATCAGCTTTGCTGCTGCGAGAGAGGCGACTTTCAAGGTGGCAAACGTTAAGGCTCAAGGTACAGTGATAGGGACAGTGTATGGAGTCATGGGATGTTTTGTCTTTGAGAGGTTTTTGCCAATAAGGTTCCTGTCTTTGCTACCTTGGTTCGTCTTCTCGAGCTTCTTGGGTAAGAGCCGAATGTATGGACAAGCCGGGGCAATCTCGGCTGCGATTGGAGCTGTTCTTATCCTCGGGAGAAAGAATTTTGGACCACCGAGCGAGTTTGCCATCGCGAGAATTGTCGAGACTTTTATCGGCTTGTCATGTTCGATCATGATTGAGCTCATCTTGCAGCCCACAAGGGGTTCAACTCTCGCAAAACTCACGCTTTCTAGAAGCTTCCATGCATTACACGAGTGTGCAAGCCTGTTCGGGGAGAAAGGGGGTAAGGCAGAGATAATCCGGAGCCAGAAAAAGGTGAAAACCCATTTGATTGAGCTCAAGAAATTCACTGAAGAAGCCCAAGCCGAGCCGAGTTTCTGGTTCTTGCCCTTCAACTGTTCTTGCTATGACAAGTTATTCCGTTCGCTTTCCGAAATGGCTGATCTGTTGCAATTCAGCGCTCACGCAATAGGGTTTCTTGGAGCACAAGAAACGGACAGGCTTCAGAGTAAAAAGGTTTTGATTGAAGCGGAAGAAGACCTGAAGAATCTGACAGAGTCCATAGCTTCTGTCGCTAAATCTTTCGAGGAGATTATTCTTCTGAAGTCGATAAACGCACTGGAAAACGCGCTGGTCGAGAACAATGTCTCTTGGGACATCGAGGTGGGGAAGACCAAGAACCCTAGTTTTTCAAGAGCCGAGAATGATACGGATAAGGTCTTGGGGTCGTATCTCCGGCGTGAAGGAGAAGTGGAAGAGGTTGACAAGAGTGACGCGGTGCTGGGTTTGGGTGCGTTGGGGTTTTGCATGGAGAGAATGGTGAAGGAGATGAGAGAGATCGAAGAGAGGATCAAAGAGCTCGTGCAATGGGAGAACCCTTCGAGCCACGTTGATTTGCATGAAATCTCATGCAAAATACGTTCTTTGTACAAATGA >THA.LOC104816285 ATGCAGAGCCGACGAGCCGTATGGCTCAAGCGTCTCGAACTGGCCCTTAGAACCGCCTTGTCTTGTCTTCTCGTGAGCTTGACCACCTTGTACGGTCCTGAACCACTCAAACACTTCACAAAGTTCCCAGCTTTTTCTTACCTGACCACAATCATAATCTTGTCATCTAACCACGACTCTTCACTCGGTGATGTGTTGAGGGGCTGTGTTCACGCCTCATACGCCACTTTCCAGATGATGGGTCTCGCCCTGGTGAGTCTCAGGATGGTTCCACCAGCTTGGCTTAGCAGTAGCCCAGTGGCTGCAGCCGCTGTTGCTCTGGCTGTGTTCATTGTGGCTTTGCCTGAGTCCACGAGTCTACTTGCGAAAAGGGTAGCTTTCGGGCAGATTGTGATTCTCTATGTGTCACTTGTGATATTTGAAGGAGAGCCGGTTCATCCGGTCATGCACCCGGTTCAAGTGGCGGCTAGTACAGCCCTTGGAGCCATTGCCTCTCTTCTGGCCATGCTGGTCCCTTTTCCACGTTTGGCTCATAGTCAGATGAAAAGTGCTTGCAGATCATATGGTGAGAATGCTTCAGAGAGGATGAACTTGTTTGTGAAAGCCGTGATAGCCCGAGACAACACGGAAGCTCAACCATTGATTGCACAAGCCGGGTCGTTTTCTGCAACAGCAAGATCTATCCTTCAGACAATCAAACTGCATAATGAAGGTATGACATGGGAGCGACCAGAAACTAGATTCTTCGGGCAGAAACAGAAGCAGACAGATCTCGGACAGAAACTACAAGGAATGGAAATTCCATTGAGGGGAATGGAACTGGCCTTGGGATCGTGCAGATCCTTTCCTATATATCTGAGACACGAGGAACTGAGACATTCTCTGGAAAGTTCCAGAGAACAGATTGCTCTCGGGAGTTCCATTCTTCCAGGATCAGTCTCAGCTCTCAAAACCAAGGATGAAAGCAAGCCGCGGTGGCATCTCGAGGTTGGTTCTCTGTCTCCTCCGGATTTACCGGTTTGCTTCTTCTGGTGCTGCGTGGAACTCTTAAGAGGTGATCTCTTACCTTGCACTCAAAATAATCAATGCATAAATAAGGCTAATACCAAGGAAGTAACTGGCTCTGAAAATGAAGGATCATTCAAGGCCAAAAGGATTTGGGATAATCTTTTTGCCTGGATGGTCAGAGAGAGGCTGGTTTTTGCACTCAAGTGCTCGGTTTCCCTAGGCCTTGCTGTATTGTTTGGTCTAATGTATAATAGAGAACATGCGTATTGGTCGGGTCTGACCATAGCCATCAGCCTTGTGACCGGAAGACAGGCAACTTTTGCATTAGCGAATGCTCGGTTACAAGGGACAGCAATGGGATCGGTCTACAGTCTCTTATGTTGTTCTGTTTTCCACAGACTAGAAGAGTTCAGGTTCTTACCTCTGCTACCTTGGATAGTCTTCACCGGCTTCCTAAGGCACAGTAGAATGTATGGCCAAGCTGGAGGGATTTCCGCCGCCATTGGAGCGGTTCTGATACTGGGAAGGAGAAACTACAGATCTCCAACCGAGTTTGCAATTGCTCGCATCGTTGAAGTTTCCATTGGGTTACTCTGTTTTATCTTCACAGAGCTTCTCTTTAATCCTGCAAGAGCAGCAACACTAGCAAAAACCGAGCTTTCACATTGTCTAGAAGCACTCCAAGATTGCATCCAGTGCCTGATTCTTTGCTCTGAGCAAGAGAACGGGCCAGTGTCAGTCCTGAAAGATTTAAGAAAAAAGCAGGCAAAACTCAAGAATCATGTAGATGCACTAGAAAATTTCATAGCAGAAGCCATGTTAGAGCCTAACTTCTGGTTCCACCCCTTCAACGCCACCTGCTACAAAGAGCTTTTGGGTTCATTCTCAAACATAGCGGACCTTTGTCTCTATATCAGCGATGGGCTCACAAACCTGTCCCGGGTTCAACCGATATGTGGGTTTGCTTGGGAAGAACTGCAAGACCACATCACTCATGATCTAAAATCCTTCAAGGAAAAACTCGACTCTTCAGCAAAATGCTTCGAAGAGATTATATCAGTCAACTCTCTAGCAAGATTCCAAAAAGAGTTGCAGAAGAGGAAGATATGCCATGACATTGAAGCAGGAAAACAACACAACAGCCACTCAAGGATGGGAAGAATGGGGCCAGACCAAGAGGACGTAGAGAGGTTTTCGGCTTCATTTTTGCTGTTGCTGAAGGAAGCGGCTGACAAGATTAGCAGCTGCAAAGCCGAAGAGGTGCTCAAGAGCAGAACAGTTCTCTGTTTGAGCAGTCTCGGCTTCTGCACCAGCAAATTGATGCAAGAAACAATAGCCATTAAGACAGGAGTATTCCAAATTACTTAA >THA.LOC104826334 ATGCGGACGAAAATGCACATGACGGAGCGAGCCAGAGCAATGTGGCGCACGTGTCTGGCCTCGGCCTTCAGGACGGCCTTAGCTTGCACCATCGTCGGGGCCGCGACCCTCTACGGCCCGGACTGGCTCCTCCGCCACGTGGCATTCCCTGCTTTCTCATACGTCACCGTCATACTCATCATCACCGACGCCACGCTCGGTGACACCCTCCGCGGCTGCTGGCTCGCCCTCTACGCCACGTGCCAGAGCGTGGGCCCCGCACTCATCAGCCTCAGGCTCATCGGTCCCGCCCATCTCTCGGCTGGGACCACCGCCGTGGCCGTGGCGCTCGCCGGGCTGGTGGTGGTTCTGCCGAGCGACTCAACTCACTTGGTCGCGAAGCGGATCGCGCTCGGACAGATCGTCATCACTTACGTCATTGGTTACATCAAAGGAGCTGAGACGGATCCCTTCATGCACCCTGTTCGAGTCGCTGCGAGCACTGCCGTCGGGGTCGCCGCCTGCGTCCTCGCTCTTCTCCTCCCGTATCCTCGCTTGGCTTCTCGCGAGGTGAAGCAAAGCTGCAAAGGGATTGCCCAAAACATATCGGACAGGCTAAAGCTATATACAAACGCCTTTTGTGCTGAGGATGCCACGTCAGCAACCGCGTCCGTCTCACAGGCGAGATTATTGGCTCGCTCTTCCTCCAGGCTTTATCAAGCCATCAAACGCTACCAACCAAGCATGAAATGGGAGAGGCTTCCATTCAAACTGTGGAGATCACAACACTTGGAAGAGAACACGGGAGACAAACTACGAAGCATGGAAATTGCGCTGAGAGGAATGGAAATGGCTTTAACCAACACATATTCTTTTCCGGCGACATTACTCTCCGGAGAAGTAAAAGATGGCTTGACAAAGATACAAGAAGGCGTCACTCTCGCCATCAAACGAGCCAATAACTCTCTGCAGCCGTCAGTAAATCCGGAATCCGATCCAGACAGCGCCGCCGGGTGCTTCCAAACACTTCAAGAATTCCCGGGCATGCATCAAGATTTGCCCTTTTACTTCTTCTTGTTCTGTATGAAGCTTCTCGAGAACATATCAATGGCGAATCCAGATAACAGTAAGGATAAGAAACCTGAAGTTTCTTCGAAAGAGGAGAAAAGTCGGTTCAGTATACACTGGAGAAGCGCTTTGAACAGCAAGAGGATAATGCCGGCGATTAAACTATCGCTATCTTTAGGATTGGCGGTTCTGTTCGGTTCCATGTACAGTAAACCAAACGGTTACTGGGCTGGTTTGCCTGTTGCGATTAGCTTTGCTGCTGCGAGAGAAGCAACGTTCAAGGTGGCGAACGTTAAAGCACAAGGGACAGTGATAGGGACAGTATACGGGGTCATGGGATGTTTTGTCTTCGAGAGGTTTTTGCCCATAAGGTTCTTGTCGTTGCTTCCCTGGTTCGTCTTCTCGAGCTTCTTGGGCAAGAGCAGGATGTACGGGCAAGCCGGGGCGATCTCGGCAGCAATCGGAGCCGTCCTGATTCTCGGAAGAAGGAACTTCGGTGCACCCAGCGAGTTCGCCATCGCGAGAATCGTCGAGACTTTTATCGGGTTGTCGTGTTCACTCATGGTTGAGCTCGTCTTGCAGCCAACAAGAGGTTCAACTCTCGCGAAACTCACGCTTTCTAGAAGCTTCCACTCGTTACACGAGTGTGCAAGGTTGTCCGGGGCAAAAGCTAGCAGCTCTGACATAATCGAGAGCCAGAAGAAGCTGAAAACACATCTGATTGATCTCAACAAGTTCGTTCAAGAAGCCCAAGCCGAGCCGAGTTTCTGGTTCTTACCTTTCAACGGTTCTTGCTACGACAAGTTACACGGCTCGCTCTCTAAAATGGCTGACCTGCTGCAATTCAGCGCCCACGCAATAGGGTTTCTCGGAGACGAAGAAACGAACAAGGCTCTGTGCAAAGAGGTTCTGAACAAAGTGGATGAAGACCTCGAGAATCTGACAGAATCCATTGGTGCTGTCGCCAAATCTTTCGAGGAGATCACGCTCCTGAAGTCGTTGAAGGCACTGGAGAAGGCGCTCGTAAAGAACGATGTCTCTTGGGACATAGAGATGGGGAAGAGCAAAAGCCCTAGTTTTTCAAGGGTTGAAGGCTCCAAGAGCGAGCAGGAGAAGGTGGTAGAATCGTATCTCCAGCATTCCGCCGATGTAATAACATTGCATGATAGTGAGGAAGATGAGGTGGAGGTCGTTGACAAGAGCGAGGTGGTGCTGAGTTTGGGTGCGTTAGGGTTTTGCATGGAGAATATGACGAAGGAGATGAGAGAGATCGAAGAGAGGGTTAAAGAGCTCGTGCAATGGGAGAACCCTTCGAGTCACGTTGATTTGCATGAAATCTCATGCAAAATACGTTCTTTGTACAAATGA >Brara.D01723 ATGCAAATGACTGAGAGAGGCCGAGCCATGTGGCGCACGTGTCTAGCCTCAGCGTTCCGTACAGCTCTAGCTTGCACAATTGTTGGAGCGGCTACACTCTACGGACCTGAATGGATCCTCCAATACGTGGCATTCCCGGCGTTTTCTTACGTCACGATCATACTCATCATCACCGATGCTACGCTCGGCGACACGCTACGTGGCTGCTGGCTAGCTCTTTACGCCACATGTCAGAGCGTTGCCCCCGCTATCATTACACTGAAGCTTATTGGACCAGCTCGGCTCACGGCTGGAACTACTGCTCTAGCCGCCGCTCTAGCAGCGTTTGTTGTGGTGCTACCAAATGGTTCGACCCATTTGGTGGCTAAGCGGATCGCACTTGGCCAGATTGTTCTTATTTATGTTATTGGTTATATAAATGGAGCTGAGACTGATCCAGTCATGCACCCTCTTCGAGTTGCAGCTAGCACCGCGCTTGGTGTTATCGCTTGCGTTCTTGCGCTTCTCGTTCCACTTCCTCGTTTAGCTACTAGCGAGGTGAAACAAAGCTGCAAAGAGATCGGTCAAAATGTAACAACGCGAGTAAAGTTGTACATGAAAGCTTTTTGTGCCGAGGATGCCATGACAGCAATGGCTTCTGTCTCAGAGGCTCGAGAGCTGTCTCGTATTTCCTCCAAGCTTTATCAAACCATCAAACGCTACCAACCAAGCATGAAATGGGAGAGGCTTCCATTTAAGATATGGAGATGGCAAAACGTGAACGATAACAAAGGAGAGAAACTACAAAGCATGGAGATTGCTCTTAGAGGAATGGACATGGTACTAGCAAGCAAGTCTCCTATTCCTGCGAGCTTGCTTGCGGGAGAAGTAAAAGACGATCTCAAGAACGTACAAGAACGTGTGATCCTCTCAATCAAACGAGTAAACAACGTCCCCCAACCGTCAGTAACTCCAGAAACCGATCTACAAAAGCCCGATGAGTGCCTCCAAACACTTCAGCAAGTCCCGGAAACACCTCAAGATTTGCCCTTCTACTTCTTCTTGTTCTGCCTCAGGCTCCTCGAAACCATCTCAACGGCTAAACCGGAGGAGACCAAAGTAAAACCGGAGGAGAACAAAGGCTCAGTCAAAACCAAGAGTAGGTCTTGGTCTTGGTTTAGTGATTGGGACAGCAAGAAGGTTATGCCGGCTACGAAGCTATCGCTTTCGCTAGGTTTAGCGATTTTTCTAGGGTCATTGTATAGTAAACCAAACGGTTATTGGGCTGGTCTACCAGTAGCGATCAGCTTCGCGGCAGCAAGAGAGGCGACCTTTAAAGTGGCGAATGTGAAGGCACAAGGGACAGTGATAGGGACAGTGTACGGAGTGATGGGCTGTTTTGTGTTCCAGAGGTTCTTGACGGTTAGGTTCCTTTCTTTACTTCCATGGTTTATCTTCTCTAGCTTCTTGAGCAAGAGCCGGATGTACGGACAGGCCGGAGGGATCTCGGCGGCGATCGGAGCCGTTCTGATTCTAGGAAGGAAGAATTTCGGACAGCCAAGGGACTTTGCTATCGACAGAATCATCGAGACTTTTATAGGGTTGGCTTGTTCCATCATGGTGGAGCTTATCTTGCAGCCCACGCGAGCCGCTAACGTCGCGAAACTCGAGCTCTCTCGAAGCTTCCACGCTTTGTACGGATGTGCAAGCTTGTTTGGAGCTAAAGCAAGCAAAGGGGAGATAATGGAGAGCCAAAAGAAGCTGAGAAGCCATCTAAACTTGCTCAAGAAGTTTACGGAAGAAGCACAAGCAGAGCCGAGCTTCTGGTTTACGCCTTTTAACGCTTCTTGCTACGAGAAGCTGTTCAAATCGTTGTCTAAATTGGCTGATCTGTTGCAATTCAGCGGTTACGCGATAGGGTTTCTTGACGAGCAAGGAAGATGGAAATCACCTCAGTGCAAGGAGATTCTTAGCGACATTGACAGTGATCTCAAGAGTCTAACGCAAAGTATAAGTCTTCTAGCAAAATCTTTCGAGGAAATCACTCTTCTCAAATCACTAGACGCACTCGAAAAGGCGCTCACCAAGAACGGCAACACTTCGTGGGACATTGAGTTGGGGAAGACACCAAACCCTAGTTTCTCAAGCCCCGAGAGCGAGCCAGGGAAGATTCTAAATACGTATCTCCAGCATTGCAGAGGAGTCTCGGATGGTATATTCCGTGCTGATGATGAAGAAGGGGAAGAGGTTAAAGTGGACAAAAGTGAGGTGGTGTTGAGTTTGAGTGCATTAGGGTTTTGTGTGGAGAAAATGGGGAAAGAGACAAGAGAGATTGAGGAGATGGTGAAAGAAGTTGTACAATCAGAGAATCCTTCAAGCCACGTAAACTTGCATGAGATCTCTTGCAAAATACGTTCTTTATACAAATAA >Brara.E03087 ATGCGTGATACAACATGTCTCGAGCGACTCAGCCTGGCTTTGAGAACCGCTTTGGCTTGTCTCATCGTCAGCTTGACCACTTTGTACGGTCCCAAACCACTAAAAAACTTGGCAACGTTTCCAGCCTTTTCTTACCTGACCACAATCTTAATCTGGCTATCCGACGCCGAACCAACATACGGTGAAGTTCTCAAATGCTGTGTTGACGTATCTTACGCCACTTTTCAGACAGCAGCCATTGTGCTTGTGAGTGTCTTGGTGGTTGGACCAGCCTCCCTAGGGATTAGCATGGTGGCTCCAGTTGCTGTGGCTGTAGCTTCATTCATCGTGGCTTTCCCAGCGTCCACGAGTCTTTTAACCAAACGAATTGCCTTTGGGCAGATCGTTCTTGTCTATGTAACCTTTGCTGTGTTCAATGGAGAGGTTGCTCATGTTTTCATGCTCCCCGTTCATGTGGCGGCTAGTACAGCACTTGGAGCCTTTGCTTCTCTACTCGCCGTGCTTCTCCCGTTTCCAAGACTGGCTCATAGTCAGATGTCTAAAGGTTGCAAATTATACGCTGAAAATGCTCTTGAGAGGTTGAATTTGTTCGTCGAGGTCATTATGGCTCGAGACAACACCACAGCTCAGGTGTTGATCACAAAGGCCGCTTCATTGTCTTCAGCAGCTAGACACACACTCAAGAGCATCAAAATCCACCATGAGCGTCTTGCATGGGAGAGACCAGATACAAGATTCTTGAAAAAGAAGCAAAATCATCAAGGGGAGAAACTACAAGCCACGGAGTTTCTGATGAGAGGGATGGAGATAGCGCTGGGATCTTGCAGTTCTTTTCCTCTAGGCATGAGCCGCGACGAACTGACAAATCTTCTAGAGGCTCCTAGAGCACATATCGCTCATGAGTCAGCACCAACTCTCAAGCCAGAGGACAAGCTAACATGGCTTCCTGAAGCTGGTTCTCTTTCTACAACATCTTTACCAGTTTACTTCTTCAGATACTGCGTGGAGCTCTTCAGAGGCGACGTCTCATCTGTGAGACAAGACAGTAAACGTGTAGATGAGCTGTCCACGTCCAAAACGGTTTTGGATGTTCTCAGTGTCTGGATGGCTAGAGAGAGGTTTGTTTTTGCGTTCAAATGCTCAATCTCTCTAGGCCTTGCGGTGCTGTTTGGTATACTCTACAACAAAAAAAACGGGTACTGGTCCGGTCTAACCGTAGCCATCAGTCTTGTATCCGGCAGGCAAGCGACGTTAACAGTAGCGAACTCTCGCTTACAAGGAACAGCGATGGGATCAGTCTACGGTCTGTTATGCTGCGCTGTTTTCCAAAGACTAGAAGAGTTCAGGTTCTTGCCTCTCCTCCCTTGGATAGCCATCACCGTCTTCATGAGGCACAGCAAAGTCTATGGCCAGCCTGGAGGAGTTACATCCGCCATTGCAGCGTTGCTGATACTTGGAAGGAGAAACTATGGAGCTCCTACTGATTTTGCTATTACTAGAATCGTTGAAGCTTCGATAGGGCTGCTTTGTTTCGTCCTTGGGGAGGTTCTTGTCACTCCTGCGAGAGCGTCAACTCTCGCAAGAGCTGAACTTAAACACTGCCTCGACGCGGTCTTAGACTGTATTGGATCATTGGTTCTTTGCTCTGAGCAAAAGAACATGCCGTTGTCGGATTTGAGAAGCAAGCAGGAGAAACTCAACTCTCACGTTGAAGCATTGGAGAGGCTTACATCAGAAGCATTGAGAGAGCCTAATGTTCCATTCCTCAAACCTCTCAAGGCGGTTAGTTACAAGAAGGTTTTGGTTTCTCTCTCGAAGGTTTCTGATCTCTGTCTCTATGTTTGTGATGGTCTCACAAACCTATCTGGAGCTCATCCTTGGGACCAAGCCATCACTCATGATCTTAAAGCCTTCCAAGAAAAGCTTCACTCTTCGGTGAAATGCTTAGAAGAGATGGCATGTACCAAGACTCAAGCAAGACTACAAAAAGAGTTACAGAAGAGAAAGATATGCCATGATGTTGAAGCAGGAACAGCATCGAACGACAACTATTCAAACATGGAGATGGGTCCAAGCCAAGATGATGCAGAGAGGTTTTCGGTTTCTTTTGTAAAGCTACTGAAGGAAGTAACAGAGAAGACAAGTGGTAGCACAGCTGAAGAGGTGGTGAAGAGTGAAACTACTCTGTGTCTGAGCAGTCTAGGTTTTTGCATCAGCAGATTGATGCAAGAAACAGTATGTATTATGACAGAAATAACTCATACAACTTGA >Cucsa.066060 ATGATTGTATGGCGAATGCGCCTAGGCTTAGCTCTACGAGCGGCTTTGGCATGTGGCATAGTTGGAGCCGTCACGATTTTCGGCCCAGCACCTCTTAGACGGTTACTGGCGTTCTCAGCTTTCTCCTACTTCACCACCATTTCTATGATACTTTCCGACACTGTTTCCGTCGGTGACGCTGTGAGGGGTGTGTGGCACGTGATGTGGGCAGTGGTGTTCGTGCTCGTCTCATCTGTGCCGTGCTTGTGGCTGATCGGACCGGGACGGTTCACTAGTGCGGCATCCGCGGCGATCGCAGTGGCTGTCAGCGGGTTTGTGGTGGCGCTGCCGGAGCGGACACACTTGCTGACAAAGCGAATCGCGTTTGGACAGCTGGTGATTGTGTACGTGGGGACAGTGATTCACGGCGGTCAGATCAGTTTTGTTAAGCACCCAATACGTGTTGCGTCTAGTACGGCTGCCGGAGCTCTCGCCGCCGTCGCTGCCATGATGATTCCCTTTCCCCGCCTCGCTTTCTTCCAGATAAGGAAGCTTAGCAAGGGTTATTGTGAGAATGGTTGGAAGAGAATAGAGGCAATGGTGGAAGGAGTGGGTGCAAAGACCAAGGGAGAGGCTGTTGCATTAATGGTTGAAGCCAAGTCTCTTTCAACAAATGCAACGAAGCTTCTCCAAACTATCAAATCCAATATGAGAGGGGTGATTTGGGAGAGACGACAAACATGCTTCGACGTTGAAGAAAAATTGGAAGAAATGGAAGTTGCAATGAAAGGAATGGAAGCCGCTTTAACTTCCCCTTCCATGGTCTTCGGATCAGTGGACGAACAGCTCTCCAATTTCCTCAACAATCTCAAACCCAAAGCCATCTTAAAGCTACAACAATTCAAGATCACTGTTCCTCCTACTTCCACCACCGCGCCGGAGACAAAACCCAGCTTCTCAACCCCCTTACCTCTCAACATTTCTCCCATCACCCCTCAGATTCTTCCCACTTCCTTCTTCTTGCGCTGTATGGAAATCCTCCTATACGACTCAACCGCCGGCCGGAATCTCGTTTCCGACGTGGAAATTGGTCAGAGAGTCAACGGAGAAAAAGCAACTCAGTTGGGAGACCATGGTACCAAAAAAACTAGTTGGGGCATTTTGTCGAATATGTTGCCTACAAACCAGAGTTTGTGTTTTGCGCTGAAATGCTCGATTACATTGGGGCTTGCTGTGTTTCTGGGCTTGACTTATACAAAACCAAATGGTTATTGGTCAGGATTGACGGTTGCTATCAGTTTTGCAACGGAGAAACAAGCCGTTTTTACTGTTGCAAATGCTCGAGCTCAAGGGACGGCCATTGGGTCAATCTATGGAGTTTTATGCTGTTTTATTTTAAAGAAATATGAGTATTTATGGCTCTTACCTCTTCTTCCTTGGGTTGTTTTTACTAGCTTTCTTGTTCATAGTAGAATGTATGGTCAATCTGGTGGGATAGCATCAGCATTAGGCGCATTGTTAGTTCTTGGGAGGAAGGATTATGGAGTTCCATCTGAGTTTGCAAATGCTAGAATCACAGAAGCTTGCATTGGATTACTCTGTTTTCTAACAGTGGAGATTATATTCAACCCAACAAGAACAGCAACTTTAGCGAAAACAGAATTCTCAACAACTTTGGTGGCACTTGAAGATTTCATCAAAAGGGTAATCCTCATTCCTCAAAAGAACTTGAATCATGAAACTTCTAATTTCGTTTCATTGATACAACACCACAAAATCCTGAGATCCCATGTTAGTCAATTAGAAAAATTCATTGTTGAAGCTGGGTTTGAGCCTAATTTCTGGTTCACACCTTTCCAAGGTAGTTGCTATGAGAAACTTTTGAAATCCCTTCAGAAAACATTGGATATCTTACAAATTATGCTGCATGAAATAAAGTTTCTGTCTCTAGAACTGAATAGGTCTGGTCTTATTGTGAAAGAACTTCATGATAGTTTAACTGAAGACATGGGAATTTTCAGCAAAAAACTTGGATGTTCTTTGAAGTTCATGGAGAAGTTGAGCTTAATAAAGTCCTTAAAAGAATTGCAGAACAAAAACCAAAACCAATGTTTAGACATGGAGATGGGGAAGAAGGGTTCAAACGATGGATGCAAAGCTTTTGCTCTTCTTGAAGAAGATGTGGAGAAAATTGTGGGTTCTTTCTGCCAACACGCTAATGAAATATTGAGCAAAGCTTACTCAAACGATGAAGTTGAGGGAAATTTGAAAGGCCAAATGACATTATGTTTGAGTTCAATTGGGTTTTGTATGGAATGTTTGATGAGAGAAACAATGGTGATGGAAAAAGAAGTGCTTCAAGTGCTGAAACTAGAGAATCCATCTATTCATATTAATTTGCAAGAACTTTCAACAAGAGTAGACGCTTACTGTACAAAGTAA >Cucsa.213740 ATGTGGTTCACACGGCTTGCCTCTGCCTCCCGAGCAGCTCTTGCTTGCTCCATAGTGGCCTACACCACCTTGTACGGCCCGGCTACTCTCCGTCGCCTTGTGGCCTTTCCCGCCTTCTCCTATCTCACAGCTACTCTCATAGTCACTAACGCCGCTCTTGGTGATGCCGTCCGTGGTTGTTGCCTAGTCGTCTTCGCCACTATCCAAACCGTTTGCCCCGCCATGTTCTTATTTTGGTTCATTGGTCCGGCCAAATTCTCCCACATCACGACCGCCGTGACGGTGGCGTTGGCTTCTGTGGTGGTGGTGCTTCCGAGCTCAACCCATTTGCTGGCTAAAAAGATCGCTTTGGGTCAGATTGTGATCATTTACGTTGTTGGTTTCATCGGCGGCGCCCATACTGACCCTCTCATGCACCCACTCCACGTCGCCGCCACCACCGCCTTAGGCGCCGCCGCCAGTCTCATTGCTACACTCCTCCCTTTCCCACGCCTTGCTTCTCTTCAGGTGAAAAGGAAGAGCAAAAGTGTGGTGGAGAACATGACAGAAAGGTTAAGTTTAATGGTGAAGGCAATCCTTGCAGAAGATAGAACAATGGCTGCTGCTTCCATATCAAGAGCTCAGTTTTTGTCTTCTTCAGCAACTAAACTTCTCCACTCCATTAAACTTTACCAAGAGAGCAAGCAATGGGAAAAGTTTCCACTCGAAATATGCAAAATGGGATGGTTGAGCAATAGTGAGAAATTAGAGGATTTAGAAATGGCCTTAAATGGAATGGAATTAGCTTTGTCCAAAATCCCTTCATATCCAATTCAAAATAATCCTCAAAATTACCAAACCCTAAAACATGATCTAAATACTTTAGAGAACCAAATTACACTTTCTTTAAAACAAGCCAATACTTATTTTCCACCGTCCGATTCGGTGACTTTTCCAGAAATCAACGTAGATGGTAATACAGCAACAGTAATCAACACCCTCAAATCCATTCAAATTACTCCCACAAGCCACCAAGATTTACCTAATTTTTTCTTCATATTTTGCATGAAACTCCTCTACAAGAAAACTCAAGTCAAAACTCCAATAAAGTTTAAAGAGGAATCAAAGGAAAAAGAAATTAAAAATTCCACCAACAAAGAAAAAAACAGATCAACATGGGTTTCCTCCATGAACAACCAAAGGGTAATTACAGCTTTGAAATGTGCAATTTCATTGGGAATTTCAGTGATTTTGGGATTGATTTACAATAAAGAAAATGGATTTTGGGGGAGTTTAGCAGTGGCCGTAAGTATTGCTTCAAATAGAGAACCAACATTTAAAGTTGCAAACATTAAGGTTCATGGAACAATGTTGGGATCTATTTTTGGAATTTTGAGTTTTGTTCTTTTCAAAAAGTTTTTAATTGGAAGGCTTCTTTGTCTTCTTCCTTGGTTTGTTTTCACAAGCTTTTTACAACATAGTACAATGTATGGTTCAGCTGGTGGAATTTCAGCCATTGTTGGAGCTTTAGTAGTTTTAGGAAGAACAAATTATGGTTCACCAAAAGAATTTGCTTTTGAAAGAATGATTGAAACTTTCATTGGGATTTCTATATCAGTTGTAGTTGACATCATTTTTCAACCAAAAAGAGCTTCTAAATTGGTGAAAATTCAACTCATTTTGAGTTTACAATTGCTACAAAAATGTATCAATGATTCATTTTGTTATGAATCAAGCACAATAATGGAGAAGGATTTGCAAGGCTTAAGAACTCAAGTTATTGAGGTAAAGAAATTGATTGATGAGGCTGAGGTTGAACCAAATTTCTTGTTTTTGCATCCCTTTCATGGGGATAGCCATTTGAAGATGTTTAATTCCTTGTCAAAAATGGTTGGTTTATTAGCTTTGAATGGTGAAGCAATGAACAACCTTAAAGAGGGGGATGAAAGTAAGGAAGATAATTGTGCTGATATTGAGATGGGAGAGGCACAAAGGATTGAAGTAATGGATGAAATTGAGAAGGAAAAATTGATCAATTCATTTTTGCAGCACTTGGGAGAAATTGTTGAAAGCAAAGATGGTAAAAGTGAAGAAATAATTTTGAGTTTGAGTGCTATGGCTTTTTGCTTGAATAGTTTGATGAAAGAGATGGAAGAGGTTGGAGAGGCAATTAGAGAACTCGTTGAATGGGAGAAATCTTCTTTTTAG >Cucsa.213750 ATGACGTCCTTGTGGTTCACGTGCTTCGCCGCCGGTTGCCGCACGGCAGTGGCATGCTCTATTATTGCTGCAGCCACCGTGTACGGCCCCCTTTTTTTACGACGTCAAGTGACGTTCCCGGCATTTTCTTACGTCACTGCCATCTTGATCGTGACAAATGCAACTCTTGGGGACACCGTCCGTGGCTGCTGGCTGGCACTCTATGCCACCTTGCAGACTGTCTGTCCGGCCATGGCGGTGTTTTGGTTTATTGGACCGACGAAGTTCTCGTACGAGACGATCGCTTTGACAGTGGCGCTGGCATCGATTGTGGTGGTGCTGCCGAGTTCTAGCCATGTTTTGGCTAAACGGATTGCTTTGGGTCAGATTGTGATTATTTATGTGGTCGGTTTCATCGGCGGTGTTCAAACTCACCCTCTCATGCACCCTGTTCATGTCGCTTCCACGACCGCTATGGGTGTCGCCGCCAGCTTCCTCGCCACCCTTCTTCCCTTTCCACGTCTCGCTTCTCTCGAGGTGAAAGAGAAGAGCAAAGCAATGGTGGAGAACGTGGCAGAGAGGTTAAGGGTATTGGTGAAAGCATTTCTTGCTGACAATGACACAGTGGCTGTTGGGTCCCTTTCTAAAGCTGCACTGTTGTCCACCTCAGCAACCAAACTCCTCCAACCCATCATACAATACCAAGAAAGCATGAAATGGGAGTGGATTCCATTAAAAGTTTGCAAATTGGGATGGTTGGGCAATAGTCAAAAATTGCAAGATTTGGAAAGACCCATAAGAGGAATGGAATTGGCTTTATCAAACATTCCTTCATACCCAATATTGCAACCACTTCAAATTGAATCACTTCAAAATGGTATAAATTCTTTAGAGAATCAAATCGTCCAATCTTTGAACCAAGGCATTGCTTATTCACCGTCCGATTCACATACTTTTCCTGAATCAAACCCTTATGATGAAGATCAAGATCAAGATCCAGTGATGAACACCATCCAATTAATCAACCCAACAAATCACAAGAACCTCCCTTCCTTTTTCTTTATATTTTGCTTGAAACTCCTTCAAGAAAAATCCCAAAACAACAAGTTACCCAACCCCCAGAAATCAGAAGAACAAAAACAAACACCAAATACAACAAAATGGGCAATTCCAAGTGGCATTTTGAGCAGCAAAAAGGTAATGGGAGCTTTAAAATCGGCAATTTCATTAGGAATTTCTGTTTATTTGGGGTTGATTTATAGCAAAGAGAATGGATTTTGGGCAAGTTTAGGAGTGGCTGTTAGTATTGCTTGCACAAGAGAAGCAACTTTCAAAATATCAAATGTCAAGCTTCAAGGAACAGTCATTGGATCAGTTTATGGAGTGTTGTGTTTTGTTATCTTTGAAAAGTTTTTAATTGGAAGACTTCTCTGTCTTCTCCCATGTTTTGTGTTCACAAGTTTTCTTCAACGAAGCAAAATGTATGGAGCAGCTGGTGGAGTTTCAGCCATTATTGGAGCTGTCATCATTTTAGGAAGAACAAATTACGGTTCACCAAAAGAACTTGCTTTTGCAAGAATTGTTGAGACTATCATTGGAGTTTCATCTTCAATTATGGTTGATATCATTTTACATCCAACTAGAGCTTCTAAACTAGCCAAATTTCAACTCACTTCCACTTTAAGAGTGCTTCTAAAATGCATCGATTCAATGAGTTTTCAACCCCCAGATCTTAAAGGGAGCTTAAAAGAATTGGGAAGCCACGTTGTTGAGTTGAAGAAGTTGATTGATGAGGCTAACGTAGAACCCAACTTTTGGTTTTTGCCATTTCAAAGTGGTTGTTATGGGAAGTTATTGAAGTCACTGTTGAAAACAGTTGATTTGTTTGCTTTCGTTAATCGTTCAGTTGAAGGGATAGGACAGAATCTTCTGGTATTGGAAGATCCGTTGTCGTGGGCGAAAATAGGTGAAAATTTAGAAGAGGATGTTGAGGATTTTAAGGAAATGGCGAGTGGTTTGGTGAGATGCTGTGTGGATGTGAGTTCTTTGAAGTCATTGAAGGTGCTTGAGAAGGAAGTAGAGAAAAAGAACAAGGGAGAGGGTGATTTTGAGGATGTTGAAATGGGTGAGAGTAAAATGGTCATTGAAATGGAGGAAATGGAGAAAGAAAAACTGCTTTGTTCATTTATGAAGCATTATGTGGAAGTTATTGAGCAAAGTGGTGAAAGTGAAGATGGTAAAAGAGAAGCACTTTTGAGTTTTAGTGCTTTGGCTTTTTGTTTAAGTAGTTTGATGAAAGAGATTGAAGAAATTGGGAAAGCAACAAGAGAATTGATTCAACGAGAGAATCCTTCAAGTCATGTTGATTTTAATGAAATCTCATCTAAGATTCATGTTGTACAAAAGGGTGTGAAGTAA