Gene: AT5G10945 (Arabidopsis thaliana)

Overview top

Gene Identifier
Transcript Identifier
Gene Type
RNA gene
5 : 3456647-3456732 : negative


No gene family defined for this gene.

Loading...please wait


MIR156D; miRNA
Curated Summary
Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC


Identifier Name



  • ...the colinearity of this gene with other genomes.
  • ...the local gene organization for homologous genes.
  • ...the phylogenetic tree of the homologous gene family.
  • ...the orthologs using the Integrative Orthology Viewer.
  • ...the conserved binding sites (upstream/downstream,intron)



Biological Process

GO termEvidence(s)ProviderDescriptionSource
GO:0035195TASGene Ontologygene silencing by miRNA1
GO:0016036IEPGene Ontologycellular response to phosphate starvation1

Color Legend

Experimental Evidence
Electronic Evidence
Computational Reviewed Evidence
GO Sources:   Primary     Orthology     Homology  
Show redundant parents:  
No InterPro domains detected for this gene.
Mapman id Description
32micro RNA, natural antisense etc
No SignalP domains detected for this gene.