Gene: AT4G00885 (Arabidopsis thaliana)

Overview top

Gene Identifier
AT4G00885
Transcript Identifier
AT4G00885.1
Gene Type
RNA gene
Location
4 : 369856-369991 : negative

Family

No gene family defined for this gene.

Loading...please wait

Descriptions

Description
MIR165/MIR165B; miRNA
Curated Summary
Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC

Identifiers

Identifier Name
aliasMIR165
aliasMIR165B
aliasmicroRNA165B
aliasMICRORNA 165

Toolbox

Explore

  • ...the colinearity of this gene with other genomes.
  • ...the local gene organization for homologous genes.
  • ...the phylogenetic tree of the homologous gene family.
  • ...the orthologs using the Integrative Orthology Viewer.
  • ...the conserved binding sites (upstream/downstream,intron)

View

 

Biological Process

GO termEvidence(s)ProviderDescriptionSource
GO:0035195TASGene Ontologygene silencing by miRNA1

Color Legend

Experimental Evidence
Electronic Evidence
Computational Reviewed Evidence
GO Sources:   Primary     Orthology     Homology  
Show redundant parents:  
 
No InterPro domains detected for this gene.
Mapman id Description
32micro RNA, natural antisense etc
No SignalP domains detected for this gene.