Gene: AT3G63375 (Arabidopsis thaliana)

Overview top

Gene Identifier
AT3G63375
Transcript Identifier
AT3G63375.1
Gene Type
RNA gene
Location
3 : 23406177-23406267 : positive

Family

No gene family defined for this gene.

Loading...please wait

Descriptions

Description
MIR167B; miRNA
Curated Summary
Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAAGCUGCCAGCAUGAUCUA

Identifiers

Identifier Name
aliasmicroRNA167B
aliasMIR167B

Toolbox

Explore

  • ...the colinearity of this gene with other genomes.
  • ...the local gene organization for homologous genes.
  • ...the phylogenetic tree of the homologous gene family.
  • ...the orthologs using the Integrative Orthology Viewer.
  • ...the conserved binding sites (upstream/downstream,intron)

View

 

Biological Process

GO termEvidence(s)ProviderDescriptionSource
GO:0035195TASGene Ontologygene silencing by miRNA1
GO:0043562IEPGene Ontologycellular response to nitrogen levels1

Color Legend

Experimental Evidence
Electronic Evidence
Computational Reviewed Evidence
GO Sources:   Primary     Orthology     Homology  
Show redundant parents:  
 
No InterPro domains detected for this gene.
Mapman id Description
32micro RNA, natural antisense etc
No SignalP domains detected for this gene.