Gene: AT1G52185 (Arabidopsis thaliana)

Overview top

Gene Identifier
AT1G52185
Transcript Identifier
AT1G52185.1
Gene Type
RNA gene
Location
1 : 19430078-19430277 : negative

Family

No gene family defined for this gene.

Loading...please wait

Descriptions

Description
MIR406; miRNA
Curated Summary
Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAGAATGCTATTGTAATCCAG

Identifiers

Identifier Name
aliasmicroRNA406
aliasMIR406

Toolbox

Explore

  • ...the colinearity of this gene with other genomes.
  • ...the local gene organization for homologous genes.
  • ...the phylogenetic tree of the homologous gene family.
  • ...the orthologs using the Integrative Orthology Viewer.
  • ...the conserved binding sites (upstream/downstream,intron)

View

 

Color Legend

Experimental Evidence
Electronic Evidence
Computational Reviewed Evidence
GO Sources:   Primary     Orthology     Homology  
Show redundant parents:  
 
No InterPro domains detected for this gene.
Mapman id Description
32micro RNA, natural antisense etc
No SignalP domains detected for this gene.