GO page  


GO term
GO:0048573
Description
photoperiodism, flowering
Type
BP
GO depth
4
Number of genes
497
 

GO distribution

Genes by species
Genes by evidence tag
 
 
Tandem/block/both gene duplicate percentage within this GO term :
This page uses the Flash plugin.

Toolbox


Index of genes with 1 constraints:

GO term parent-child relationships are used in this table.

Page 1 of 25, showing 20 records out of 497 total, starting on record 1, ending on 20

gene_id species description comment go evidence
AT5G48300 ath Encodes the small subunit of ADP-glucose pyrophosphorylase. The small subunit is the catalytic isoform responsible for ADP-glucose pyrophosphorylase activity. The presence of the small subunit is required for large subunit stability. Two isoforms of the small subunit (ApS1 and ApS2) have been described. ApS1 is the major small subunit isoform present in all plant tissues tested.;ADP glucose pyrophosphorylase 1 transcript=eq;prot=eq; GO:0048573 IMP
AT1G25560 ath Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes.;AP2/B3 transcription factor family protein transcript=eq;prot=eq; GO:0048573 IMP
AT5G64930 ath Regulator of expression of pathogenesis-related (PR) genes. Participates in signal transduction pathways involved in plant defense (systemic acquired resistance -SAR).;CPR5 protein, putative transcript=eq;prot=eq; GO:0048573 IMP
AT3G26640 ath LIGHT-REGULATED WD 2 (LWD2); CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat, conserved site (InterPro:IPR019775), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD40 repeat, subgroup (InterPro:IPR019781); BEST Arabidopsis thaliana protein match is: Transducin/WD40 repeat-like superfamily protein (TAIR:AT1G12910.1); Has 5639 Blast hits to 5196 proteins in 384 species: Archae - 6; Bacteria - 320; Metazoa - 2319; Fungi - 1389; Plants - 885; Viruses - 0; Other Eukaryotes - 720 (source: NCBI BLink).;Transducin/WD40 repeat-like superfamily protein transcript=eq;prot=eq; GO:0048573 IMP
AT4G02440 ath EID1 is an F-box protein that functions as a negative regulator in phytochrome A (phyA)-specific light signalling. Expressed at all stages of plant development independently of light conditions, localizes to the nucleus, and forms nuclear speckles under continuous far-red light. Forms stable dimeric and trimeric complexes with several ASK proteins and Cullin1 in yeast and in planta.;F-box family protein transcript=eq;prot=eq; GO:0048573 IMP
AT5G41990 ath Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Interacts specifically with and phosphorylates AtVHA-C, subunit C of the vacuolar H+-ATPase.;with no lysine (K) kinase 8 transcript=eq;prot=eq; GO:0048573 IMP
AT3G51630 ath Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases.;with no lysine (K) kinase 5 transcript=eq;prot=eq; GO:0048573 IMP
AT2G35510 ath Encodes a WWE domain-containing protein with 76% similarity to RCD1. The protein also contains a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation.;similar to RCD one 1 transcript=eq;prot=eq; GO:0048573 IMP
AT2G40080 ath Encodes a novel nuclear 111 amino-acid phytochrome-regulated component of a negative feedback loop involving the circadian clock central oscillator components CCA1 and LHY. ELF4 is necessary for light-induced expression of both CCA1 and LHY, and conversely, CCA1 and LHY act negatively on light-induced ELF4 expression. ELF4 promotes clock accuracy and is required for sustained rhythms in the absence of daily light/dark cycles. It is involved in the phyB-mediated constant red light induced seedling de-etiolation process and may function to coregulate the expression of a subset of phyB-regulated genes.;Protein of unknown function (DUF1313) transcript=eq;prot=eq; GO:0048573 IMP
AT5G62640 ath nuclear targeted protein involved in flowering time regulation that affects flowering time independent of FLC;proline-rich family protein transcript=eq;prot=eq; GO:0048573 IMP
AT2G44680 ath Encodes casein kinase II beta chain, a CK2 regulatory subunit. Nuclear-localized CKB4 protein exists in vivo as different isoforms, resulting from phosphorylation on serine residues. The phosphorylated isoforms are the preferred substrate for ubiquitination and degradation by the proteasome pathway. Involved in regulation of circadian clock.;casein kinase II beta subunit 4 transcript=eq;prot=eq; GO:0048573 IMP
AT1G27650 ath U2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions.;U2 snRNP auxiliary factor small subunit, putative transcript=eq;prot=eq; GO:0048573 IMP
AT3G09190 ath Regulates flowering time in Ws ecotype.;Concanavalin A-like lectin family protein transcript=eq;prot=eq; GO:0048573 IMP
AT3G22420 ath Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.;with no lysine (K) kinase 2 transcript=eq;prot=eq; GO:0048573 IMP
AT5G42820 ath U2 auxiliary factor small subunit. The atU2AF35b protein and its homolog, atU2AF35a, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions.;Zinc finger C-x8-C-x5-C-x3-H type family protein transcript=eq;prot=eq; GO:0048573 IMP
AT3G25050 ath encodes a xyloglucan endotransglucosylase/hydrolase. Higher expression in flowers and in response to IAA treatment.;xyloglucan endotransglucosylase/hydrolase 3 transcript=eq;prot=eq; GO:0048573 IMP
AT2G32950 ath Represses photomorphogenesis and induces skotomorphogenesis in the dark. Contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. The C-terminus has homology to TAFII80, a subunit of the TFIID component of the RNA polymerase II of Drosophila. Nuclear localization in the dark and cytoplasmic in the light.;Transducin/WD40 repeat-like superfamily protein transcript=eq;prot=eq; GO:0048573 IMP
AT2G21070 ath FIONA1 (FIO1); FUNCTIONS IN: methyltransferase activity; INVOLVED IN: photoperiodism, flowering, circadian rhythm, photoperiodism; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S-adenosyl-L-methionine dependent methyltransferase, Mett10D, predicted (InterPro:IPR017182), S-adenosyl-L-methionine dependent methyltransferase, predicted (InterPro:IPR010286).;methyltransferases transcript=eq;prot=eq; GO:0048573 IMP
AT1G12910 ath Encodes a protein with similarity to the petunia WD repeat protein an11.;Transducin/WD40 repeat-like superfamily protein transcript=eq;prot=eq; GO:0048573 IMP
AT2G28056 ath Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAU;rna_type=mirna;MIR172/MIR172A; miRNA transcript=eq; GO:0048573 IEP
<< previous
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 next >>

Download genes

Include following columns
gene_id
species
description
comment
go
evidence