GO page  


GO term
GO:0010150
Description
leaf senescence
Type
BP
GO depth
5
Number of genes
597
 

GO distribution

Genes by species
Genes by evidence tag
 
 
Tandem/block/both gene duplicate percentage within this GO term :
This page uses the Flash plugin.

Toolbox


Index of genes with 1 constraints:

GO term parent-child relationships are used in this table.

Page 1 of 30, showing 20 records out of 597 total, starting on record 1, ending on 20

gene_id species description comment go evidence
AT5G11520 ath Encodes the chloroplastic isozyme of aspartate aminotransferase. Involved in aspartate biosynthesis and nitrogen metabolism. mRNA is expressed in senescing leaves.;aspartate aminotransferase 3 transcript=eq;prot=eq; GO:0010150 IEP
AT5G64930 ath Regulator of expression of pathogenesis-related (PR) genes. Participates in signal transduction pathways involved in plant defense (systemic acquired resistance -SAR).;CPR5 protein, putative transcript=eq;prot=eq; GO:0010150 IMP
AT2G31690 ath encodes a triacylglycerol lipase located in plastoglobuli and involved in the degradation of triacylglycerol. It also has impact on leaf senescence and maintaining the structural integrity of thylakoids.;alpha/beta-Hydrolases superfamily protein transcript=eq;prot=eq; GO:0010150 IMP
AT5G27807 ath Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCG. Early extra petal mutant (eep1);rna_type=mirna;MIR164/MIR164C; miRNA transcript=eq; GO:0010150 IMP
AT1G20780 ath Encodes a protein containing a U-box and an ARM domain.;senescence-associated E3 ubiquitin ligase 1 transcript=eq;prot=eq; GO:0010150 IMP
AT5G62000 ath Encodes an auxin response factor. Mutants have many defects including enlarged rosette leaves, reduced fertility, later senescence, hypocotyl elongation defects, enlarged seeds and enlarged cotyledons. May not mediate auxin effects. Increase in seed size due to increased cell proliferation.;auxin response factor 2 transcript=eq;prot=eq; GO:0010150 IMP
AT4G18980 ath Encodes a nuclear-targeted protein AtS40-3 that modulates senescence associated gene expression.;AtS40-3 transcript=eq;prot=eq; GO:0010150 IMP
AT1G20900 ath Encodes an AT hook domain containing protein that acts redundantly with SOB3 to modulate hypocotyl growth inhibition in response to light.;Predicted AT-hook DNA-binding family protein transcript=eq;prot=eq; GO:0010150 IMP
AT4G38630 ath Regulatory particle non-ATPase subunit of the 26S proteasome with multiubiquitin-chain-binding capabilities;regulatory particle non-ATPase 10 transcript=eq;prot=eq; GO:0010150 IMP
AT4G16110 ath Encodes a pollen-specific transcription factor involved in the expression of nuclear genes for components of mitochondrial complex I in Arabidopsis. Acts in concert with other type-B ARRs in the cytokinin signaling pathway. AHK3 mediates cytokinin-induced phosphorylation of ARR2 on the Asp-80 residue. This phosphorylation plays a positive role of ARR2 in cytokinin-mediated control of leaf longevity.;response regulator 2 transcript=ne;prot=eq; GO:0010150 IMP
AT1G69490 ath Encodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence.;NAC-like, activated by AP3/PI transcript=eq;prot=eq; GO:0010150 IMP
AT5G39610 ath Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510.;NAC domain containing protein 6 transcript=eq;prot=eq; GO:0010150 IEP
AT3G19190 ath Encodes autophagy-related 2 (ATG2).;autophagy 2 transcript=eq;prot=eq; GO:0010150 IMP
AT3G51430 ath Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity.;Calcium-dependent phosphotriesterase superfamily protein transcript=eq;prot=eq; GO:0010150 IEP
AT2G47585 ath Encodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA;rna_type=mirna;MIR164/MIR164A; miRNA transcript=eq; GO:0010150 IMP
AT5G44610 ath Encodes a protein with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. Associates to the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates, indicating an involvement in cellular signal transduction. Expression is enhanced by abiotic and hormonal factors. Induced during senescence.;microtubule-associated protein 18 transcript=eq;prot=eq; GO:0010150 IEP
AT2G35980 ath Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and during senescence. The gene product is localized to the chloroplast.;Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family transcript=eq;prot=eq; GO:0010150 IMP
AT4G23810 ath member of WRKY Transcription Factor; Group III;WRKY family transcription factor transcript=eq;prot=eq; GO:0010150 IMP
AT1G27320 ath Encodes a histidine kinases, a cytokinin receptor that controls cytokinin-mediated leaf longevity through a specific phosphorylation of the response regulator, ARR2.;histidine kinase 3 transcript=eq;prot=eq; GO:0010150 IMP
AT5G50210 ath Encodes an Fe-S binding protein with quinolinate synthase (QS) activity and cysteine desulfurase activator activity. The QS activity was demonstrated by functional complementation of corresponding E. coli mutants and complementation of embryo-lethal phenotypes of the QS homozygous null allele in Arabidopsis. The SufE domain of the protein also stimulates the cysteine desulfurase activity of CpNifS (AT1G08490) in vitro. This protein binds a (4Fe-Su)2+ cluster in its NadA domain and is localized in the chloroplast.;quinolinate synthase transcript=eq;prot=eq; GO:0010150 IMP
<< previous
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 next >>

Download genes

Include following columns
gene_id
species
description
comment
go
evidence