GO page  


GO term
GO:0010022
Description
meristem determinacy
Type
BP
GO depth
2
Number of genes
190
 

GO distribution

Genes by species
Genes by evidence tag
 
 
Tandem/block/both gene duplicate percentage within this GO term :
This page uses the Flash plugin.

Toolbox


Index of genes with 1 constraints:

GO term parent-child relationships are used in this table.

Page 1 of 10, showing 20 records out of 190 total, starting on record 1, ending on 20

gene_id species description comment go evidence
AT5G11530 ath Involved in regulating reproductive development;embryonic flower 1 (EMF1) transcript=eq;prot=eq; GO:0010022 IMP
AT5G04275 ath Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAU;rna_type=mirna;MIR172/MIR172B; miRNA transcript=eq; GO:0010022 IMP
AT4G28190 ath Encodes a novel Cys-rich protein with a B-box like domain that acts as a negative regulator of meristem cell accumulation in inflorescence and floral meristems as loss-of-function ult1 mutations cause inflorescence meristem enlargement, the production of extra flowers and floral organs, and a decrease in floral meristem determinacy. Acts opposite to CLF which represses AG, but preventing deposition of CLF repressive methylation marks.;Developmental regulator, ULTRAPETALA transcript=eq;prot=eq; GO:0010022 IMP
AT3G57130 ath Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1.;Ankyrin repeat family protein / BTB/POZ domain-containing protein transcript=eq;prot=eq; GO:0010022 IMP
OS07G13170 osa AP2 domain containing protein, expressed transcript=eq;prot=eq; GO:0010022 IC
SB02G007000 sbi 2 prot=eq;pid=5032885;tid=5032885 GO:0010022 ISO
ZM07G05170 zma sister of indeterminate spikelet 1 name=GRMZM2G176175;tid=GRMZM2G176175_T01;pid=GRMZM2G176175_P01;transcript=eq;prot=eq; GO:0010022 ISO
OSINDICA_07G11520 osaindica source=BGI China;type=FgeneSH; transcript=eq;prot=eq;name=OsIFCC023040; GO:0010022 ISO
BD1G53650 bdi Apetala2 domain pid=Bradi1g53650.4;tid=Bradi1g53650.4;GeneName=Bradi1g53650;Name=BdAp2-like2;transcript=eq;prot=eq GO:0010022 ISO
MD00G157240 mdo transcript=eq;prot=eq;pid=MDP0000123044;tid=MDP0000123044;contig=MDC006753.468 GO:0010022 ISO
MD15G004000 mdo transcript=eq;prot=eq;pid=MDP0000729522;tid=MDP0000729522;contig=MDC011753.233 GO:0010022 ISO
MD08G012400 mdo transcript=eq;prot=eq;pid=MDP0000489029;tid=MDP0000489029;contig=MDC011407.158 GO:0010022 ISO
FV2G35530 fve Cylicin-1 (probable) transcript=eq;prot=eq;pid=gene08809 GO:0010022 ISO
GM06G08790 gma 06 pid=16262228;transcript=eq;prot=eq;name=Glyma06g08790.1 GO:0010022 ISO
GM04G08680 gma 04 pid=16255332;transcript=eq;prot=eq;name=Glyma04g08680.1 GO:0010022 ISO
MT0G11210 mtr EMBYO FLOWERING 1-like protein (Fragment) (AHRD V1 *-*- Q52ZP2_PEA) transcript=eq;prot=eq;pid=AC225517_23.1; GO:0010022 ISO
MT0G10560 mtr EMBYO FLOWERING 1-like protein (Fragment) (AHRD V1 *-*- Q52ZP2_PEA) transcript=eq;prot=eq;pid=AC225507_26.1; GO:0010022 ISO
LJ1G022650 lja prot=eq;transcript=eq;scaffold=LjT04O06;name=chr1.LjT04O06.10.nc GO:0010022 ISO
TC09G003780 tca RNAname=Tc09_t003780;GeneName=Tc09_g003780;transcript=eq;prot=eq GO:0010022 ISO
CP00007G02480 cpa name=evm.TU.supercontig_7.248;pid=evm.TU.supercontig_7.248;prot=eq;transcript=eq GO:0010022 ISO
<< previous
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 next >>

Download genes

Include following columns
gene_id
species
description
comment
go
evidence