GO page  


GO term
GO:0009743
Description
response to carbohydrate stimulus
Type
BP
GO depth
4
Number of genes
2715
 

GO distribution

Genes by species
Genes by evidence tag
 
 
Tandem/block/both gene duplicate percentage within this GO term :
This page uses the Flash plugin.

Toolbox


Index of genes with 1 constraints:

GO term parent-child relationships are used in this table.

Page 1 of 136, showing 20 records out of 2715 total, starting on record 1, ending on 20

gene_id species description comment go evidence
AT5G46845 ath Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA;rna_type=mirna;MIR160/MIR160C (MICRORNA160); miRNA transcript=eq; GO:0009743 IMP
AT1G05630 ath Encodes an inositol polyphosphate 5-phosphatase with phosphatase activity toward only Ins(1,4,5)P3. Induced in response to ABA and wounding treatments. Expressed in young seedlings and flowers, while no transcripts were detectable in maturated roots, stems, and rosette leaves Modulates the development of cotyledon veins through its regulation of auxin homeostasis. Involved in blue light light–stimulated increase in cytosolic calcium ion.;Endonuclease/exonuclease/phosphatase family protein transcript=eq;prot=eq; GO:0009743 IMP
AT3G48360 ath encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. BT2 also mediates multiple responses to nutrients, stresses, and hormones.;BTB and TAZ domain protein 2 transcript=eq;prot=eq; GO:0009743 IEP
AT2G28350 ath Involved in root cap cell differentiation.;auxin response factor 10 transcript=eq;prot=eq; GO:0009743 IMP
AT2G39175 ath Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). Hypomorphic mutants exhibit defects in embryo, vegetative and floral development.MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA;rna_type=mirna;MIR160/MIR160A; miRNA transcript=eq; GO:0009743 IMP
AT4G17788 ath Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA;rna_type=mirna;MIR160/MIR160B; miRNA transcript=eq; GO:0009743 IMP
AL8G29760 aly name=scaffold_803004.1;pid=919604;prot=eq;tid=951117 GO:0009743 ISO
AT5G63160 ath BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development.;BTB and TAZ domain protein 1 transcript=eq;prot=eq; GO:0009743 ISO
AL5G17230 aly name=fgenesh1_pm.C_scaffold_5000980;pid=323436;prot=eq;tid=323436 GO:0009743 ISO
AL4G11660 aly name=fgenesh2_kg.4__731__AT2G28350.1;pid=481671;prot=eq;tid=481671 GO:0009743 ISO
AT5G41670 ath 6-phosphogluconate dehydrogenase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to fructose stimulus, response to cadmium ion, response to sucrose stimulus, response to glucose stimulus; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), 6-phosphogluconate dehydrogenase, decarboxylating (InterPro:IPR006113), 6-phosphogluconate dehydrogenase, C-terminal (InterPro:IPR006114), 6-phosphogluconate dehydrogenase (InterPro:IPR006183), NAD(P)-binding domain (InterPro:IPR016040), Fibritin/6-phosphogluconate dehydrogenase, C-terminal extension (InterPro:IPR012284); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase family protein (TAIR:AT1G64190.1); Has 12747 Blast hits to 12577 proteins in 2621 species: Archae - 86; Bacteria - 8556; Metazoa - 692; Fungi - 242; Plants - 329; Viruses - 4; Other Eukaryotes - 2838 (source: NCBI BLink).;6-phosphogluconate dehydrogenase family protein transcript=eq;prot=eq; GO:0009744 IEP
AT3G04120 ath encodes cytosolic GADPH (C subunit) involved in the glycolytic pathway but also interacts with H2O2 potentially placing it in a signalling cascade induced by ROS.;glyceraldehyde-3-phosphate dehydrogenase C subunit 1 transcript=eq;prot=eq; GO:0009744 IEP
AT1G69780 ath Encodes a homeodomain leucine zipper class I (HD-Zip I) protein.;Homeobox-leucine zipper protein family transcript=eq;prot=eq; GO:0009744 IMP
AT5G13930 ath Encodes chalcone synthase (CHS), a key enzyme involved in the biosynthesis of flavonoids. Required for the accumulation of purple anthocyanins in leaves and stems. Also involved in the regulation of auxin transport and the modulation of root gravitropism.;Chalcone and stilbene synthase family protein transcript=eq;prot=eq; GO:0009744 IEP
AT5G09650 ath Encodes a protein with inorganic pyrophosphatase activity.;pyrophosphorylase 6 transcript=eq;prot=eq; GO:0009744 IEP
AT3G49620 ath encodes a protein similar to 2-oxoacid-dependent dioxygenase. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell.;2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein transcript=eq;prot=eq; GO:0009744 IEP
AT2G24150 ath heptahelical transmembrane protein HHP3;heptahelical protein 3 transcript=eq;prot=eq; GO:0009744 IEP
AT3G26650 ath Encodes one of the two subunits forming the photosynthetic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and as such a constituent of the supramolecular complex with phosphoribulokinase (PRK) thought to be linked by a small peptide encoded by CP12-2. GapA-1 is coordinately expressed by light with PRK and CP12-2. The enzyme activity, tested in leaf protein extracts dropped significantly after external sucrose treatment for the photosynthetic GAPDH (NADPH-dependent) but not for the cytosolic GAPDH (NADH-dependent).;glyceraldehyde 3-phosphate dehydrogenase A subunit transcript=eq;prot=eq; GO:0009744 IEP
AT3G47340 ath encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell.;glutamine-dependent asparagine synthase 1 transcript=eq;prot=eq; GO:0009744 IEP
AT2G22490 ath encodes a D-type cyclin whose transcription level is regulated by sucrose but not phytohormones or nitrate. Protein physically interacts with CDC2A. CycD2 kinase activity is regulated by sequestration of CycD2 protein in a form inaccessible to immunoprecipitation and probably not complexed to CDC2A.;Cyclin D2;1 transcript=eq;prot=eq; GO:0009744 IEP
<< previous
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 next >>

Download genes

Include following columns
gene_id
species
description
comment
go
evidence