Gene Overview  


General information


Gene id
AT5G04275
Species
Arabidopsis thaliana
Transcript
AT5G04275.1
Coordinates
1188211 - 1188299
Strand
negative
Chromosome
5
Type
RNA gene
Sequence
Show sequence(s)
Description
Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAU;rna_type=mirna;MIR172/MIR172B; miRNA
Comment
transcript
eq
 
Gene structure

Loading...please wait

Toolbox


Explore

  • ...the colinearity of this gene with other genomes.
  • ...the local gene organization for homologous genes.
  • ...the phylogenetic tree of the homologous gene family.
  • ...the orthologous genes using the Integrative Orthology Viewer.

View

 
 

Functional annotation information


GO term(s)
Loading....please wait

Gene ids in other PLAZA versions


No linkout data found