Gene Overview 
General information
- Gene id
- AT3G18827
- Species
- Arabidopsis thaliana
- Transcript
- AT3G18827.1
- Coordinates
- 6488234 - 6488426
- Strand
- positive
- Chromosome
- 3
- Type
- RNA gene
- Sequence
- Show sequence(s)
- Description
- Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CUUCUUAAGUGCUGAUAAUGC;rna_type=mirna;MIR868a; miRNA
- Comment
- transcripteq
- Gene structure
-
Loading...please wait
previous gene
Toolbox
Explore
- ...the colinearity of this gene with other genomes.
- ...the local gene organization for homologous genes.
- ...the phylogenetic tree of the homologous gene family.
- ...the orthologous genes using the Integrative Orthology Viewer.
View
- ....the multiple sequence alignment of the homologous gene family.
- ...BLAST hits against the PLAZA database.
- ...BLAST hits against NCBI's protein database.
- ...the gene in the 'Genomeview' or in the 'AnnoJ' genome browser.
- ...all anchorpoints.
Functional annotation information
No functional annotation available for this gene.