Gene Overview  

General information

Gene id
Arabidopsis thaliana
13866205 - 13866467
RNA gene
Show sequence(s)
Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TTTAAATCATATACTTTTGGT;rna_type=mirna;MIR407; miRNA
Gene structure

Loading...please wait



  • ...the colinearity of this gene with other genomes.
  • ...the local gene organization for homologous genes.
  • ...the phylogenetic tree of the homologous gene family.
  • ...the orthologous genes using the Integrative Orthology Viewer.



Functional annotation information

No functional annotation available for this gene.

Gene ids in other PLAZA versions

No linkout data found