Gene Overview 
- Description
- Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAU;rna_type=mirna;MIR172/MIR172A; miRNA
- Comment
transcript
eq
- Gene structure
-

Loading...please wait
Toolbox
Explore
-
...the colinearity of this gene with other genomes.
-
...the local gene organization for homologous genes.
-
...the phylogenetic tree of the homologous gene family.
-
...the orthologous genes using the Integrative Orthology Viewer.
View
Functional annotation information
- GO term(s)
-
Loading....please wait
Gene ids in other PLAZA versions
No linkout data found