Index of genes with 1 constraints:

GO term parent-child relationships are used in this table.

Page 12 of 1134, showing 20 records out of 22678 total, starting on record 221, ending on 240

gene_id species description comment go evidence
AT2G39940 ath Encodes a protein containing Leu-rich repeats and a degenerate F-box motif. Associates with AtCUL1, AtRbx1, and the Skp1-like proteins ASK1 and ASK2 to assemble SCF COI1 ubiquitin-ligase complexes in planta. A single amino acid substitution in the F-box motif of COI1 abolishes the formation of the SCF(COI1) complexes and results in loss of the JA response. Required for wound- and jasmonates-induced transcriptional regulation.;RNI-like superfamily protein transcript=eq;prot=eq; GO:0009909 IMP
AT1G11870 ath Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.;Seryl-tRNA synthetase transcript=eq;prot=eq; GO:0048481 IMP
AT5G27720 ath embryo defective 1644 (emb1644); CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein (LSM) domain (InterPro:IPR001163), Like-Sm ribonucleoprotein (LSM)-related domain (InterPro:IPR010920), Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: snRNP core protein SMD3 (TAIR:AT1G76300.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;Small nuclear ribonucleoprotein family protein transcript=eq;prot=eq; GO:0009793 NAS
AT2G24430 ath NAC domain containing protein 38 (NAC038); FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, hypocotyl, root, leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 58 (TAIR:AT3G18400.1); Has 3031 Blast hits to 3023 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 6; Plants - 3020; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;NAC domain containing protein 38 transcript=eq;prot=eq; GO:0007275 ISS
AT1G47750 ath member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.;peroxin 11A transcript=eq;prot=eq; GO:0007569 IEP
AT4G24972 ath Encodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1.;tapetum determinant 1 transcript=eq;prot=eq; GO:0001709 IMP
AT4G24972 ath Encodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1.;tapetum determinant 1 transcript=eq;prot=eq; GO:0048653 IDA
AT1G25540 ath Encodes a nuclear protein that acts in a phyB pathway (but downstream of phyB) and induces flowering in response to suboptimal light conditions. Mutants are hypo-responsive to far-red and hyper-responsive to red light and flower late under long day conditions. Also shown to be a Mediator subunit regulating jasmonate-dependent defense.;phytochrome and flowering time regulatory protein (PFT1) transcript=eq;prot=eq; GO:0009909 IMP
AT2G02850 ath Encodes plantacyanin one of blue copper proteins. Involved in anther development and pollination. Expressed in the transmitting tract of the pistil.;plantacyanin transcript=eq;prot=eq; GO:0048653 IMP
AT1G16710 ath Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC12 acetylation of the H3 or H4 peptides, suggesting that HAC12 can acetylate any of several lysines present in the peptides.;histone acetyltransferase of the CBP family 12 transcript=eq;prot=eq; GO:0009908 IGI
AT1G25580 ath Encodes suppressor of gamma response 1 (SOG1), a putative transcription factor governing multiple responses to DNA damage.;NAC (No Apical Meristem) domain transcriptional regulator superfamily protein transcript=eq;prot=eq; GO:0007275 ISS
AT4G00120 ath INDEHISCENT (IND); FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: polar nucleus fusion, regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT5G09750.1); Has 2280 Blast hits to 2276 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2280; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;basic helix-loop-helix (bHLH) DNA-binding superfamily protein transcript=eq;prot=eq; GO:0010197 IMP
AT5G04275 ath Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAU;rna_type=mirna;MIR172/MIR172B; miRNA transcript=eq; GO:0010022 IMP
AT5G04275 ath Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAU;rna_type=mirna;MIR172/MIR172B; miRNA transcript=eq; GO:0009908 IMP
AT5G27740 ath A locus involved in embryogenesis. Mutations in this locus result in embryo lethality.;ATPase family associated with various cellular activities (AAA) transcript=eq;prot=eq; GO:0009793 IMP
AT1G25560 ath Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes.;AP2/B3 transcription factor family protein transcript=eq;prot=eq; GO:0048573 IMP
AT1G08465 ath Member of the YABBY family of Arabidopsis proteins involved in the abaxial cell fate specification in lateral organs;Plant-specific transcription factor YABBY family protein transcript=eq;prot=eq; GO:0010158 IDA
AT4G00100 ath Encodes a cytoplasmic ribosomal protein S13 homologue involved in early leaf development;ribosomal protein S13A transcript=eq;prot=eq; GO:0010090 IMP
AT4G00100 ath Encodes a cytoplasmic ribosomal protein S13 homologue involved in early leaf development;ribosomal protein S13A transcript=eq;prot=eq; GO:0009965 IMP
AT2G02820 ath Encodes a putative transcription factor (MYB88), involved in stomata development, double loss of MYB88 and FLP (MYB124) activity results in a failure of guard mother cells (GMCs) to adopt the guard cell fate, thus they continue to divide resulting in abnormal stomata consisting of clusters of numerous guard cell-like cells. This phenotype is enhanced in double mutants over the single mutant flp phenotype.;myb domain protein 88 transcript=eq;prot=eq; GO:0010052 IGI
<< previous 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 next >>

Download genes

Include following columns
gene_id
species
description
comment
go
evidence