Index of genes with 1 constraints:
GO term parent-child relationships are used in this table.
- GO term : GO:0009718
GO term parent-child relationships are used in this table.
Page 8 of 10, showing 20 records out of 188 total, starting on record 141, ending on 160
| gene_id | species | description | comment | go | evidence |
|---|---|---|---|---|---|
| AT5G46845 | ath | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA;rna_type=mirna;MIR160/MIR160C (MICRORNA160); miRNA | transcript=eq; | GO:0031540 | IMP |
| AT1G64520 | ath | regulatory particle non-ATPase 12A (RPN12a); FUNCTIONS IN: peptidase activity; INVOLVED IN: in 14 processes; LOCATED IN: proteasome complex, nucleus, proteasome regulatory particle, lid subcomplex, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 26S proteasome non-ATPase regulatory subunit Rpn12 (InterPro:IPR006746), SAC3/GANP/Nin1/mts3/eIF-3 p25 (InterPro:IPR005062); BEST Arabidopsis thaliana protein match is: regulatory particle non-ATPase 12B (TAIR:AT5G42040.1); Has 474 Blast hits to 474 proteins in 207 species: Archae - 0; Bacteria - 0; Metazoa - 195; Fungi - 129; Plants - 70; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).;regulatory particle non-ATPase 12A | transcript=eq;prot=eq; | GO:0031540 | IMP |
| AT2G28350 | ath | Involved in root cap cell differentiation.;auxin response factor 10 | transcript=eq;prot=eq; | GO:0031540 | IMP |
| AT2G39175 | ath | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). Hypomorphic mutants exhibit defects in embryo, vegetative and floral development.MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA;rna_type=mirna;MIR160/MIR160A; miRNA | transcript=eq; | GO:0031540 | IMP |
| AT4G17788 | ath | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA;rna_type=mirna;MIR160/MIR160B; miRNA | transcript=eq; | GO:0031540 | IMP |
| AT1G56650 | ath | Encodes a putative MYB domain containing transcription factor involved in anthocyanin metabolism and radical scavenging. Essential for the sucrose-mediated expression of the dihydroflavonol reductase gene.;production of anthocyanin pigment 1 | transcript=eq;prot=eq; | GO:0031540 | IMP |
| AT1G75040 | ath | Thaumatin-like protein involved in response to pathogens. mRNA level of the PR-5 gene (At1g75040)is significantly changed after cutting the inflorescence stem indicating the existence of a network of signal transducing pathways as other stress-regulated genes (At5g01410, At3g17800, At1g29930)do not response to the treatment.;pathogenesis-related gene 5 | transcript=eq;prot=eq; | GO:0031540 | IEP |
| AL6G13650 | aly | name=fgenesh2_kg.6__1353__AT5G13930.1;pid=488219;prot=eq;tid=488219 | GO:0031540 | ISO | |
| AL4G11660 | aly | name=fgenesh2_kg.4__731__AT2G28350.1;pid=481671;prot=eq;tid=481671 | GO:0031540 | ISO | |
| AT5G42040 | ath | regulatory particle non-ATPase 12B (RPN12b); FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: proteasome regulatory particle; CONTAINS InterPro DOMAIN/s: COP9 signalosome, subunit CSN8 (InterPro:IPR019280), 26S proteasome non-ATPase regulatory subunit Rpn12 (InterPro:IPR006746); BEST Arabidopsis thaliana protein match is: regulatory particle non-ATPase 12A (TAIR:AT1G64520.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;regulatory particle non-ATPase 12B | transcript=eq;prot=eq; | GO:0031540 | ISO |
| AL7G35500 | aly | name=fgenesh1_pm.C_scaffold_7002559;pid=330332;prot=eq;tid=330332 | GO:0031540 | ISO | |
| AL2G00280 | aly | name=fgenesh2_kg.2__25__AT1G64520.1;pid=474895;prot=eq;tid=474895 | GO:0031540 | ISO | |
| AL2G13400 | aly | name=fgenesh2_kg.2__869__AT1G66370.1;pid=475739;prot=eq;tid=475739 | GO:0031540 | ISO | |
| AL2G13450 | aly | name=scaffold_201358.1;pid=894284;prot=eq;tid=925797 | GO:0031540 | ISO | |
| AT1G66390 | ath | production of anthocyanin pigment 2 protein (PAP2);myb domain protein 90 | transcript=eq;prot=eq; | GO:0031540 | ISO |
| AL2G13440 | aly | name=scaffold_201357.1;pid=894283;prot=eq;tid=925796 | GO:0031540 | ISO | |
| GM18G49670 | gma | 18 | pid=16310957;transcript=eq;prot=eq;name=Glyma18g49670.1 | GO:0031540 | ISO |
| GM09G37010 | gma | 09 | pid=16277472;transcript=eq;prot=eq;name=Glyma09g37010.1 | GO:0031540 | ISO |
| GM18G49690 | gma | 18 | pid=16310959;transcript=eq;prot=eq;name=Glyma18g49690.1 | GO:0031540 | ISO |
| GM09G36990 | gma | 09 | pid=16277470;transcript=eq;prot=eq;name=Glyma09g36990.1 | GO:0031540 | ISO |