Index of genes with 1 constraints:

GO term parent-child relationships are used in this table.

Page 8 of 10, showing 20 records out of 188 total, starting on record 141, ending on 160

gene_id species description comment go evidence
AT5G46845 ath Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA;rna_type=mirna;MIR160/MIR160C (MICRORNA160); miRNA transcript=eq; GO:0031540 IMP
AT1G64520 ath regulatory particle non-ATPase 12A (RPN12a); FUNCTIONS IN: peptidase activity; INVOLVED IN: in 14 processes; LOCATED IN: proteasome complex, nucleus, proteasome regulatory particle, lid subcomplex, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 26S proteasome non-ATPase regulatory subunit Rpn12 (InterPro:IPR006746), SAC3/GANP/Nin1/mts3/eIF-3 p25 (InterPro:IPR005062); BEST Arabidopsis thaliana protein match is: regulatory particle non-ATPase 12B (TAIR:AT5G42040.1); Has 474 Blast hits to 474 proteins in 207 species: Archae - 0; Bacteria - 0; Metazoa - 195; Fungi - 129; Plants - 70; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).;regulatory particle non-ATPase 12A transcript=eq;prot=eq; GO:0031540 IMP
AT2G28350 ath Involved in root cap cell differentiation.;auxin response factor 10 transcript=eq;prot=eq; GO:0031540 IMP
AT2G39175 ath Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). Hypomorphic mutants exhibit defects in embryo, vegetative and floral development.MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA;rna_type=mirna;MIR160/MIR160A; miRNA transcript=eq; GO:0031540 IMP
AT4G17788 ath Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA;rna_type=mirna;MIR160/MIR160B; miRNA transcript=eq; GO:0031540 IMP
AT1G56650 ath Encodes a putative MYB domain containing transcription factor involved in anthocyanin metabolism and radical scavenging. Essential for the sucrose-mediated expression of the dihydroflavonol reductase gene.;production of anthocyanin pigment 1 transcript=eq;prot=eq; GO:0031540 IMP
AT1G75040 ath Thaumatin-like protein involved in response to pathogens. mRNA level of the PR-5 gene (At1g75040)is significantly changed after cutting the inflorescence stem indicating the existence of a network of signal transducing pathways as other stress-regulated genes (At5g01410, At3g17800, At1g29930)do not response to the treatment.;pathogenesis-related gene 5 transcript=eq;prot=eq; GO:0031540 IEP
AL6G13650 aly name=fgenesh2_kg.6__1353__AT5G13930.1;pid=488219;prot=eq;tid=488219 GO:0031540 ISO
AL4G11660 aly name=fgenesh2_kg.4__731__AT2G28350.1;pid=481671;prot=eq;tid=481671 GO:0031540 ISO
AT5G42040 ath regulatory particle non-ATPase 12B (RPN12b); FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: proteasome regulatory particle; CONTAINS InterPro DOMAIN/s: COP9 signalosome, subunit CSN8 (InterPro:IPR019280), 26S proteasome non-ATPase regulatory subunit Rpn12 (InterPro:IPR006746); BEST Arabidopsis thaliana protein match is: regulatory particle non-ATPase 12A (TAIR:AT1G64520.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;regulatory particle non-ATPase 12B transcript=eq;prot=eq; GO:0031540 ISO
AL7G35500 aly name=fgenesh1_pm.C_scaffold_7002559;pid=330332;prot=eq;tid=330332 GO:0031540 ISO
AL2G00280 aly name=fgenesh2_kg.2__25__AT1G64520.1;pid=474895;prot=eq;tid=474895 GO:0031540 ISO
AL2G13400 aly name=fgenesh2_kg.2__869__AT1G66370.1;pid=475739;prot=eq;tid=475739 GO:0031540 ISO
AL2G13450 aly name=scaffold_201358.1;pid=894284;prot=eq;tid=925797 GO:0031540 ISO
AT1G66390 ath production of anthocyanin pigment 2 protein (PAP2);myb domain protein 90 transcript=eq;prot=eq; GO:0031540 ISO
AL2G13440 aly name=scaffold_201357.1;pid=894283;prot=eq;tid=925796 GO:0031540 ISO
GM18G49670 gma 18 pid=16310957;transcript=eq;prot=eq;name=Glyma18g49670.1 GO:0031540 ISO
GM09G37010 gma 09 pid=16277472;transcript=eq;prot=eq;name=Glyma09g37010.1 GO:0031540 ISO
GM18G49690 gma 18 pid=16310959;transcript=eq;prot=eq;name=Glyma18g49690.1 GO:0031540 ISO
GM09G36990 gma 09 pid=16277470;transcript=eq;prot=eq;name=Glyma09g36990.1 GO:0031540 ISO
<< previous 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 next >>

Download genes

Include following columns
gene_id
species
description
comment
go
evidence