Index of genes with 2 constraints:

GO term parent-child relationships are used in this table.
View genome wide organization

Page 1 of 229, showing 20 records out of 4569 total, starting on record 1, ending on 20

gene_id species description comment go evidence
AT1G01010 ath NAC domain containing protein 1 (NAC001); FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 69 (TAIR:AT4G01550.1); Has 2503 Blast hits to 2496 proteins in 69 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2502; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).;NAC domain containing protein 1 transcript=eq;prot=eq; GO:0045449 IEA
AT1G01030 ath NGATHA3 (NGA3); CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: AP2/B3-like transcriptional factor family protein (TAIR:AT4G01500.1); Has 1380 Blast hits to 1379 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1380; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;AP2/B3-like transcriptional factor family protein transcript=eq;prot=eq; GO:0006355 IEA
AT1G01030 ath NGATHA3 (NGA3); CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: AP2/B3-like transcriptional factor family protein (TAIR:AT4G01500.1); Has 1380 Blast hits to 1379 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1380; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;AP2/B3-like transcriptional factor family protein transcript=eq;prot=eq; GO:0045449 TAS
AT1G01040 ath Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.;dicer-like 1 transcript=eq;prot=eq; GO:0030422 IMP
AT1G01040 ath Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.;dicer-like 1 transcript=eq;prot=eq; GO:0035279 IMP
AT1G01040 ath Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.;dicer-like 1 transcript=eq;prot=eq; GO:0010267 IMP
AT1G01040 ath Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.;dicer-like 1 transcript=eq;prot=eq; GO:0009616 IMP
AT1G01040 ath Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.;dicer-like 1 transcript=eq;prot=eq; GO:0010599 IMP
AT1G01040 ath Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.;dicer-like 1 transcript=eq;prot=eq; GO:0035196 IGI
AT1G01040 ath Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.;dicer-like 1 transcript=eq;prot=eq; GO:0031053 TAS
AT1G01060 ath LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1;Homeodomain-like superfamily protein transcript=eq;prot=eq; GO:0042752 IMP
AT1G01060 ath LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1;Homeodomain-like superfamily protein transcript=eq;prot=eq; GO:0045449 TAS
AT1G01060 ath LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1;Homeodomain-like superfamily protein transcript=eq;prot=eq; GO:0043496 ISO
AT1G01140 ath Encodes a CBL-interacting protein kinase with similarity to SOS2;CBL-interacting protein kinase 9 transcript=eq;prot=eq; GO:0007165 IEA
AT1G01140 ath Encodes a CBL-interacting protein kinase with similarity to SOS2;CBL-interacting protein kinase 9 transcript=eq;prot=eq; GO:0043266 IMP
AT1G01150 ath Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Homeodomain-related (InterPro:IPR012287), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: TRF-like 10 (TAIR:AT5G03780.1); Has 94 Blast hits to 77 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).;Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain transcript=eq;prot=eq; GO:0045449 IEA
AT1G01183 ath Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC;rna_type=mirna;MIR165/MIR165A; miRNA transcript=eq; GO:0035195 TAS
AT1G01200 ath RAB GTPase homolog A3 (RABA3); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: endosome, nucleus, cell plate; EXPRESSED IN: lateral root cap, hypocotyl, root, flower, epidermis; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Small GTPase (InterPro:IPR020851), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: RAB GTPase homolog A4C (TAIR:AT5G47960.1); Has 27164 Blast hits to 27137 proteins in 734 species: Archae - 19; Bacteria - 134; Metazoa - 14292; Fungi - 3779; Plants - 3194; Viruses - 20; Other Eukaryotes - 5726 (source: NCBI BLink).;RAB GTPase homolog A3 transcript=eq;prot=eq; GO:0007264 IEA
AT1G01210 ath DNA-directed RNA polymerase, subunit M, archaeal; FUNCTIONS IN: in 6 functions; INVOLVED IN: RNA elongation, regulation of transcription, DNA-dependent, transcription, regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Zinc finger, TFIIS-type (InterPro:IPR001222), DNA-directed RNA polymerase, M/15kDa subunit (InterPro:IPR001529), DNA-directed RNA polymerase, subunit M, archaeal (InterPro:IPR006288), DNA-directed RNA polymerase M, 15kDa subunit, conserved site (InterPro:IPR019761); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase, subunit M, archaeal (TAIR:AT4G07950.1); Has 1129 Blast hits to 1129 proteins in 326 species: Archae - 242; Bacteria - 0; Metazoa - 276; Fungi - 294; Plants - 112; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink).;DNA-directed RNA polymerase, subunit M, archaeal transcript=eq;prot=eq; GO:0006355 ISS
AT1G01210 ath DNA-directed RNA polymerase, subunit M, archaeal; FUNCTIONS IN: in 6 functions; INVOLVED IN: RNA elongation, regulation of transcription, DNA-dependent, transcription, regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Zinc finger, TFIIS-type (InterPro:IPR001222), DNA-directed RNA polymerase, M/15kDa subunit (InterPro:IPR001529), DNA-directed RNA polymerase, subunit M, archaeal (InterPro:IPR006288), DNA-directed RNA polymerase M, 15kDa subunit, conserved site (InterPro:IPR019761); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase, subunit M, archaeal (TAIR:AT4G07950.1); Has 1129 Blast hits to 1129 proteins in 326 species: Archae - 242; Bacteria - 0; Metazoa - 276; Fungi - 294; Plants - 112; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink).;DNA-directed RNA polymerase, subunit M, archaeal transcript=eq;prot=eq; GO:0045449 IEA
<< previous
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 next >>

Download genes

Include following columns
gene_id
species
description
comment
go
evidence