Functional Clustering  


Cluster information

Cluster overview

Cluster id
CH_ath_13
Cluster type
GO
Species
Arabidopsis thaliana
Chromosome
5
E-value
0.0000335911
GO label
GO:0044464
GO description
cell part
 

Statistics

Gene family Num genes total Num genes species Num genes cluster Num species
HOM0000017142242125
HOM0000025123122125
HOM0000034618219125
HOM0000044137179124
HOM0000073000143125
HOM0000102542117225
HOM000012217474220
HOM000017190694122
HOM000019178473125
HOM000025169060125
HOM000031162059222
HOM000033148947125
HOM000039131860125
HOM000043125662125
HOM000055103139120
HOM00005997646121
HOM00007089563120
HOM00007486120121
HOM00008676525120
HOM00008975733120
HOM00009075427125
HOM00009275035125
HOM00011060429120
HOM00011359525125
HOM00012056515122
HOM00012356020122
HOM00012455529120
HOM00013552823122
HOM00014947427123
HOM00016144218123
HOM00016343926120
HOM00016842714120
HOM00018640023121
HOM00022833917121
HOM0002383314120
HOM00028129313124
HOM00030227915219
HOM00031826914125
HOM0003442599125
HOM00034925611120
HOM0003522549125
HOM00035525312123
HOM00035825210124
HOM0003622499125
HOM00036624813122
HOM00037024611122
HOM00042422111125
HOM0005261889125
HOM0005421847125
HOM00056617713119
HOM0006121655121
HOM0006271633122
HOM0006741576122
HOM0006781565225
HOM0008091348123
HOM0008121348125
HOM0008441306125
HOM0008561294125
HOM0009431194125
HOM0009851145120
HOM0010231105125
HOM0010341097124
HOM0010441073125
HOM0010891044125
HOM0011191013125
HOM001147994125
HOM001174973125
HOM001287902124
HOM001316885124
HOM001342877120
HOM001363864125
HOM001437822121
HOM001483793125
HOM001587746120
HOM001636723120
HOM001643722125
HOM001741693119
HOM001756692124
HOM001896654124
HOM001923642117
HOM002078602124
HOM002106604120
HOM002190583124
HOM002341542124
HOM002398531121
HOM002465522124
HOM002527512123
HOM002600491118
HOM002645483123
HOM002787463124
HOM002895453118
HOM002926442123
HOM003048431123
HOM003172411125
HOM003369391119
HOM003491381125
HOM003499382116
HOM003516381124
HOM003543374124
HOM003671361124
HOM003676361124
HOM003804351124
HOM003914352218
HOM003969341118
HOM004125331122
HOM004244331125
HOM004340321125
HOM004664301122
HOM004820301123
HOM004844291123
HOM004865291120
HOM004960291120
HOM004977291121
HOM005044281117
HOM005118281120
HOM005963241119
HOM006430211119
HOM006549201116
HOM007123161112
HOM007358141111
HOM0220012112
HOM0314112112
HOM0314152112

Gene information

In cluster Gene id Description Gene type Gene family
V AT5G13220Plants overexpressing At5g13220.3, but not At5g13220.1 showed enhanced insensitivity to MeJa.;jasmonate-zim-domain protein 10Coding geneHOM007358 ORTHO011444
V AT5G13225snoRNA;rna_type=snorna;snoRNARNA gene
X AT5G13230Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT2G27610.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;Tetratricopeptide repeat (TPR)-like superfamily proteinCoding geneHOM000001 ORTHO010852
V AT5G13240transcription regulators; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: negative regulation of transcription from RNA polymerase III promoter; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Maf1 regulator (InterPro:IPR015257), RNA polymerase III transcriptional repressor, MAF1 (InterPro:IPR017152); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;transcription regulatorsCoding geneHOM004820 ORTHO004544
V AT5G13250RING finger protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: RING finger protein (TAIR:AT1G28080.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;RING finger proteinCoding geneHOM003499 ORTHO045051
X AT5G13260unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G48860.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding geneHOM000254 ORTHO016584
X AT5G13270Encodes RARE1 (Required for accD RNA Editing 1), a trans-factor essential for C-to-U editing of the chloroplast accD transcript. RARE1 carries 15 PPR (pentatricopeptide repeat) motifs, an E/E+ and a DYW domain (C-terminal tripeptide).;Pentatricopeptide repeat (PPR) superfamily proteinCoding geneHOM000001 ORTHO014131
V AT5G13280Asp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH).;aspartate kinase 1Coding geneHOM001363 ORTHO000784
V AT5G13290Encodes a protein with predicted Ser/Thr kinase activity and membrane localization that is involved in the CLV3 signaling pathway that represses WUS expression in the meristem. Loss of function of CRN can suppress the phenotype caused by overexpression of CLV3. SOL2 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol2 partially suppresses the short root phenotype caused by CLE19 overexpression. Mutant flowers have extra carpels.;Protein kinase superfamily proteinCoding geneHOM000002 ORTHO011445
V AT5G13300Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin.;ARF GTPase-activating proteinCoding geneHOM000542 ORTHO000314
V AT5G13310unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13970.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).Coding geneHOM003914 ORTHO018856
X AT5G13320Encodes an enzyme capable of conjugating amino acids to 4-substituted benzoates. 4-HBA (4-hydroxybenzoic acid) and pABA (4-aminobenzoate) may be targets of the enzyme in Arabidopsis, leading to the production of pABA-Glu, 4HBA-Glu, or other related compounds. This enzyme is involved in disease-resistance signaling. It is required for the accumulation of salicylic acid, activation of defense responses, and resistance to Pseudomonas syringae. Salicylic acid can decrease this enzyme's activity in vitro and may act as a competitive inhibitor. Expression of PBS3/GH3.12 can be detected in cotyledons, true leaves, hypocotyls, and occasionally in some parts of roots from 10-day-old seedlings. No expression has been detected in root, stem, rosette or cauline leaves of mature 4- to 5-week-old plants.;Auxin-responsive GH3 family proteinCoding geneHOM000291 ORTHO000053
V AT5G13330encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.;related to AP2 6lCoding geneHOM000010 ORTHO003986
V AT5G13340unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10890.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).Coding geneHOM000370 ORTHO045052
X AT5G13350Auxin-responsive GH3 family protein; CONTAINS InterPro DOMAIN/s: GH3 auxin-responsive promoter (InterPro:IPR004993); BEST Arabidopsis thaliana protein match is: Auxin-responsive GH3 family protein (TAIR:AT5G13370.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;Auxin-responsive GH3 family proteinCoding geneHOM000291 ORTHO000053
X AT5G13360Auxin-responsive GH3 family protein; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: GH3 auxin-responsive promoter (InterPro:IPR004993); BEST Arabidopsis thaliana protein match is: Auxin-responsive GH3 family protein (TAIR:AT5G13370.1).;Auxin-responsive GH3 family proteinCoding geneHOM000291 ORTHO000053
X AT5G13370Auxin-responsive GH3 family protein; CONTAINS InterPro DOMAIN/s: GH3 auxin-responsive promoter (InterPro:IPR004993); BEST Arabidopsis thaliana protein match is: Auxin-responsive GH3 family protein (TAIR:AT5G13360.3); Has 1602 Blast hits to 1450 proteins in 238 species: Archae - 0; Bacteria - 565; Metazoa - 54; Fungi - 2; Plants - 675; Viruses - 0; Other Eukaryotes - 306 (source: NCBI BLink).;Auxin-responsive GH3 family proteinCoding geneHOM000291 ORTHO000053
X AT5G13380Auxin-responsive GH3 family protein; CONTAINS InterPro DOMAIN/s: GH3 auxin-responsive promoter (InterPro:IPR004993); BEST Arabidopsis thaliana protein match is: Auxin-responsive GH3 family protein (TAIR:AT5G13370.1); Has 1506 Blast hits to 1424 proteins in 238 species: Archae - 0; Bacteria - 490; Metazoa - 52; Fungi - 2; Plants - 670; Viruses - 0; Other Eukaryotes - 292 (source: NCBI BLink).;Auxin-responsive GH3 family proteinCoding geneHOM000291 ORTHO000053
V AT5G13390Required for normal pollen development and lipid accumulation within the tapetum;no exine formation 1Coding geneHOM004244 ORTHO003542
V AT5G13400Major facilitator superfamily protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PTR2 family proton/oligopeptide symporter, conserved site (InterPro:IPR018456), Oligopeptide transporter (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: peptide transporter 5 (TAIR:AT5G01180.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;Major facilitator superfamily proteinCoding geneHOM000031 ORTHO009498
V AT5G13410FKBP-like peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: FKBP-like peptidyl-prolyl cis-trans isomerase family protein (TAIR:AT4G19830.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;FKBP-like peptidyl-prolyl cis-trans isomerase family proteinCoding geneHOM004340 ORTHO005221
V AT5G13420Aldolase-type TIM barrel family protein; FUNCTIONS IN: catalytic activity, transaldolase activity; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transaldolase subfamily (InterPro:IPR004732), Aldolase-type TIM barrel (InterPro:IPR013785), Transaldolase, active site (InterPro:IPR018225), Transaldolase, bacterial/plant type (InterPro:IPR014634), Transaldolase (InterPro:IPR001585); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;Aldolase-type TIM barrel family proteinCoding geneHOM003369 ORTHO004545
X AT5G13430Ubiquinol-cytochrome C reductase iron-sulfur subunit; FUNCTIONS IN: metal ion binding; INVOLVED IN: oxidation reduction; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: male gametophyte, guard cell, pollen tube, leaf; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome c reductase, iron-sulphur subunit (InterPro:IPR006317), Rieske [2Fe-2S] iron-sulphur domain (InterPro:IPR017941), Rieske iron-sulphur protein, C-terminal (InterPro:IPR005805), Rieske iron-sulphur protein (InterPro:IPR014349), Ubiquinol cytochrome reductase, transmembrane domain (InterPro:IPR004192); BEST Arabidopsis thaliana protein match is: Ubiquinol-cytochrome C reductase iron-sulfur subunit (TAIR:AT5G13440.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Ubiquinol-cytochrome C reductase iron-sulfur subunitCoding geneHOM001001 ORTHO001108
X AT5G13440Ubiquinol-cytochrome C reductase iron-sulfur subunit; FUNCTIONS IN: metal ion binding; INVOLVED IN: oxidation reduction; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome c reductase, iron-sulphur subunit (InterPro:IPR006317), Rieske [2Fe-2S] iron-sulphur domain (InterPro:IPR017941), Rieske iron-sulphur protein, C-terminal (InterPro:IPR005805), Rieske iron-sulphur protein (InterPro:IPR014349), Ubiquinol cytochrome reductase, transmembrane domain (InterPro:IPR004192); BEST Arabidopsis thaliana protein match is: Ubiquinol-cytochrome C reductase iron-sulfur subunit (TAIR:AT5G13430.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;Ubiquinol-cytochrome C reductase iron-sulfur subunitCoding geneHOM001001 ORTHO001108
V AT5G13450delta subunit of Mt ATP synthase (ATP5); FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, cobalt ion binding, zinc ion binding; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: mitochondrion, chloroplast, plasma membrane, membrane, mitochondrial proton-transporting ATP synthase complex, catalytic core F(1); EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, OSCP/delta subunit (InterPro:IPR000711); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;delta subunit of Mt ATP synthaseCoding geneHOM004125 ORTHO003987
V AT5G13460IQ-domain 11 (IQD11); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQ-domain 12 (TAIR:AT5G03960.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;IQ-domain 11Coding geneHOM000228 ORTHO011446
X AT5G13470unknown protein; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).Coding geneHOM001540 ORTHO014132
X AT5G13475non-LTR retrotransposon family (LINE), has a 1.7e-39 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);rna_type=other_rna;transposable element geneTransposon
V AT5G13480Encodes a protein with similarity to yeast Pfs2p, an mRNA processing factor. Involved in regulation of flowering time; affects FCA mRNA processing. Homozygous mutants are late flowering, null alleles are embryo lethal.;Transducin/WD40 repeat-like superfamily proteinCoding geneHOM000090 ORTHO004546
X AT5G13485non-LTR retrotransposon family (LINE), has a 6.7e-12 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);rna_type=other_rna;transposable element geneTransposon
V AT5G13490Encodes mitochondrial ADP/ATP carrier;ADP/ATP carrier 2Coding geneHOM000352 ORTHO000305
V AT5G13500unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25265.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).Coding geneHOM000856 ORTHO001109
V AT5G13510Ribosomal protein L10 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, ribosome, chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: Ribosomal protein L10 family protein (TAIR:AT3G12370.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;Ribosomal protein L10 family proteinCoding geneHOM001896 ORTHO004547
X AT5G13520peptidase M1 family protein; FUNCTIONS IN: metallopeptidase activity, binding, zinc ion binding; INVOLVED IN: proteolysis, leukotriene biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M1, membrane alanine aminopeptidase (InterPro:IPR001930), Peptidase M1, membrane alanine aminopeptidase, N-terminal (InterPro:IPR014782), Peptidase M1, leukotriene A4 hydrolase, aminopeptidase C-terminal (InterPro:IPR015211), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: aminopeptidase M1 (TAIR:AT4G33090.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;peptidase M1 family proteinCoding geneHOM004742 ORTHO006620
X AT5G13530Encodes KEEP ON GOING (KEG), a RING E3 ligase involved in abscisic acid signaling. KEG is essential for Arabidopsis growth and development. ABA promotes KEG degradation via the ubiquitin dependent 26S proteasome pathway.;protein kinases;ubiquitin-protein ligasesCoding geneHOM003786 ORTHO004730
X AT5G13548Pseudogene of AT3G12600; ATNUDT16 (Arabidopsis thaliana Nudix hydrolase homolog 16); hydrolase;pseudogenePseudo gene
V AT5G13550Encodes a sulfate transporter.;sulfate transporter 4.1Coding geneHOM000355 ORTHO004367
V AT5G13560unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37370.1); Has 12055 Blast hits to 8846 proteins in 811 species: Archae - 217; Bacteria - 1046; Metazoa - 6104; Fungi - 1115; Plants - 528; Viruses - 14; Other Eukaryotes - 3031 (source: NCBI BLink).Coding geneHOM001923 ORTHO007326
V AT5G13570Encodes DCP2 with mRNA decapping activity. DCP2 forms a mRNA decapping complex with DCP1 (At1g08370) and VCS (VARICOSE) (At3g13300). Recombinant DCP2 is enzymatically active in vitro, generating from capped mRNAs m7GDP, and 5’-phosphorylated mRNAs. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. The protein was shown by immunoprecipitation not to interact with DCP1.;decapping 2Coding geneHOM003804 ORTHO003988
V AT5G13580ABC-2 type transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: response to nematode; LOCATED IN: membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC-2 type transporter family protein (TAIR:AT3G55090.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;ABC-2 type transporter family proteinCoding geneHOM000033 ORTHO000220
X AT5G13590unknown protein; Has 150 Blast hits to 121 proteins in 42 species: Archae - 0; Bacteria - 8; Metazoa - 80; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink).Coding geneHOM002143 ORTHO045053
V AT5G13600Phototropic-responsive NPH3 family protein; FUNCTIONS IN: signal transducer activity; INVOLVED IN: response to light stimulus; LOCATED IN: membrane; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: NPH3 (InterPro:IPR004249), BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: Phototropic-responsive NPH3 family protein (TAIR:AT5G03250.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;Phototropic-responsive NPH3 family proteinCoding geneHOM000092 ORTHO045054
V AT5G13610Protein of unknown function (DUF155); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF155 (InterPro:IPR003734); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF155) (TAIR:AT1G69380.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;Protein of unknown function (DUF155)Coding geneHOM002527 ORTHO005222
X AT5G13620unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G49290.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).Coding geneHOM001129 ORTHO031751
V AT5G13630Encodes magnesium chelatase involved in plastid-to-nucleus signal transduction.;magnesium-chelatase subunit chlH, chloroplast, putative / Mg-protoporphyrin IX chelatase, putative (CHLH)Coding geneHOM003048 ORTHO001879
V AT5G13640arabidopsis phospholipid:diacylglycerol acyltransferase (PDAT);phospholipid:diacylglycerol acyltransferaseCoding geneHOM002341 ORTHO000682
V AT5G13650elongation factor family protein; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EFG/EF2, C-terminal (InterPro:IPR000640), GTP-binding protein TypA (InterPro:IPR006298), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Elongation factor G/III/V (InterPro:IPR009022), Translation elongation/initiation factor/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor family protein (TAIR:AT2G31060.2); Has 76334 Blast hits to 67578 proteins in 6162 species: Archae - 1271; Bacteria - 47471; Metazoa - 3896; Fungi - 2458; Plants - 1891; Viruses - 1; Other Eukaryotes - 19346 (source: NCBI BLink).;elongation factor family proteinCoding geneHOM001756 ORTHO003989
X AT5G13655similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1); similar to putative AP endonuclease/reverse transcriptase [Brassica napus] (GB:AAM82604.1); contains domain NON-LTR RETROELEMENT REVERSE TRANSCRIPTASE RELATED (PTHR19446:SF34); contains domain REVERSE TRANSCRIPTASES (PTHR19446);rna_type=other_rna;transposable element geneTransposon
X AT5G13660unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59830.2); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding geneHOM002459 ORTHO010853
V AT5G13670nodulin MtN21 /EamA-like transporter family protein; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 /EamA-like transporter family protein (TAIR:AT2G39510.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;nodulin MtN21 /EamA-like transporter family proteinCoding geneHOM000059 ORTHO031752
X AT5G13680A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1–ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate.;IKI3 family proteinCoding geneHOM003143 ORTHO005900
V AT5G13690Encodes an enzyme that is predicted to act as an alpha-N-acetylglucosaminidase (NAGLU). An naglu mutant arrests early in seed development but does not appear to have male or female gametophytic defects. Transcript levels for this gene are increased during reproductive development.;alpha-N-acetylglucosaminidase family / NAGLU familyCoding geneHOM002398 ORTHO002257
V AT5G13700Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants).;polyamine oxidase 1Coding geneHOM002600 ORTHO012160
V AT5G13710SMT1 controls the level of cholesterol in plants;sterol methyltransferase 1Coding geneHOM001119 ORTHO004548
V AT5G13720Uncharacterised protein family (UPF0114); LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0114, plant (InterPro:IPR016804), Uncharacterised protein family UPF0114 (InterPro:IPR005134); BEST Arabidopsis thaliana protein match is: Uncharacterised protein family (UPF0114) (TAIR:AT4G19390.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;Uncharacterised protein family (UPF0114)Coding geneHOM001437 ORTHO008032
V AT5G13730Encodes sigma 4 factor, involved in regulating the activity of the plastid-encoded RNA polymerase PEP. Regulates the overall quantity of NDH complexes and thus influences NDH activity.;sigma factor 4Coding geneHOM001089 ORTHO013634
X AT5G13740Encodes ZIF1 (ZINC-INDUCED FACILITATOR1), a member of the Major Facilitator Superfamily (MFS) of membrane proteins which are found in all organisms and transport a wide range of small, organic molecules. Involved in a mechanism of Zn sequestration, possibly by transport of a Zn ligand or Zn-ligand complex into vacuoles.;zinc induced facilitator 1Coding geneHOM000743 ORTHO045055
X AT5G13750zinc induced facilitator-like 1 (ZIFL1); FUNCTIONS IN: tetracycline:hydrogen antiporter activity; INVOLVED IN: response to karrikin; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily (InterPro:IPR020846), Tetracycline resistance protein, TetA (InterPro:IPR001958), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: zinc induced facilitator 1 (TAIR:AT5G13740.1); Has 19294 Blast hits to 18859 proteins in 2587 species: Archae - 361; Bacteria - 14367; Metazoa - 620; Fungi - 2172; Plants - 389; Viruses - 0; Other Eukaryotes - 1385 (source: NCBI BLink).;zinc induced facilitator-like 1Coding geneHOM000743 ORTHO001110
X AT5G13760Plasma-membrane choline transporter family protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF580 (InterPro:IPR007603); BEST Arabidopsis thaliana protein match is: Plasma-membrane choline transporter family protein (TAIR:AT3G04440.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Plasma-membrane choline transporter family proteinCoding geneHOM001450 ORTHO003543
V AT5G13770Pentatricopeptide repeat (PPR-like) superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR-like) superfamily protein (TAIR:AT5G42310.1); Has 28118 Blast hits to 10756 proteins in 260 species: Archae - 2; Bacteria - 14; Metazoa - 159; Fungi - 283; Plants - 26809; Viruses - 0; Other Eukaryotes - 851 (source: NCBI BLink).;Pentatricopeptide repeat (PPR-like) superfamily proteinCoding geneHOM000003 ORTHO009499
V AT5G13780Acyl-CoA N-acyltransferases (NAT) superfamily protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase, C-terminal (InterPro:IPR022610), GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: Acyl-CoA N-acyltransferases (NAT) superfamily protein (TAIR:AT1G03150.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;Acyl-CoA N-acyltransferases (NAT) superfamily proteinCoding geneHOM001643 ORTHO006621
V AT5G13790AGL15 (AGAMOUS-Like 15) is a member of the MADS domain family of regulatory factors. Although AGL15 is preferentially expressed during embryogenesis, AGL15 is also expressed in leaf primordia, shoot apical meristems and young floral buds, suggesting that AGL15 may play a role during post-germinative development. Transgenic plants that ectopically express AGL15 show delays in the transition to flowering, perianth abscission and senescence and fruit and seed maturation. Role in embryogenesis and gibberellic acid catabolism. Targets B3 domain transcription factors that are key regulators of embryogenesis.;AGAMOUS-like 15Coding geneHOM000039 ORTHO013096
V AT5G13800Encodes a pheophytinase that is involved in chlorophyll breakdown.;pheophytinaseCoding geneHOM003676 ORTHO003990
X AT5G13810Glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: Glutaredoxin family protein (TAIR:AT3G57070.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;Glutaredoxin family proteinCoding geneHOM000198 ORTHO008764
V AT5G13820Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding domain in C-terminus that prefers the sequence TTTAGGG.;telomeric DNA binding protein 1Coding geneHOM001587 ORTHO010701
X AT5G13825unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding geneHOM016642 ORTHO031753
X AT5G13830FtsJ-like methyltransferase family protein; FUNCTIONS IN: methyltransferase activity, nucleic acid binding, RNA methyltransferase activity; INVOLVED IN: methylation, rRNA processing, rRNA methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, embryo, root, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: 23S ribosomal RNA methyltransferase (InterPro:IPR016448), Ribosomal RNA methyltransferase J (InterPro:IPR015507), Ribosomal RNA methyltransferase RrmJ/FtsJ (InterPro:IPR002877); BEST Arabidopsis thaliana protein match is: FtsJ-like methyltransferase family protein (TAIR:AT4G25730.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;FtsJ-like methyltransferase family proteinCoding geneHOM006215 ORTHO008033
V AT5G13840FIZZY-related 3 (FZR3); FUNCTIONS IN: signal transducer activity; INVOLVED IN: signal transduction; LOCATED IN: chloroplast, heterotrimeric G-protein complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat 2 (InterPro:IPR019782), WD40 repeat, conserved site (InterPro:IPR019775), WD40-repeat-containing domain (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); BEST Arabidopsis thaliana protein match is: FIZZY-related 2 (TAIR:AT4G22910.1); Has 48305 Blast hits to 24690 proteins in 714 species: Archae - 60; Bacteria - 7363; Metazoa - 18902; Fungi - 10741; Plants - 5341; Viruses - 0; Other Eukaryotes - 5898 (source: NCBI BLink).;FIZZY-related 3Coding geneHOM000526 ORTHO001446
X AT5G13845tRNA-Lys (anticodon: TTT);rna_type=pre-trna;pre-tRNARNA gene
V AT5G13850nascent polypeptide-associated complex subunit alpha-like protein 3 (NACA3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: Nascent polypeptide-associated complex (NAC), alpha subunit family protein (TAIR:AT3G12390.1); Has 1188 Blast hits to 1178 proteins in 289 species: Archae - 43; Bacteria - 0; Metazoa - 512; Fungi - 254; Plants - 155; Viruses - 14; Other Eukaryotes - 210 (source: NCBI BLink).;nascent polypeptide-associated complex subunit alpha-like protein 3Coding geneHOM000001 ORTHO001447
V AT5G13860ELCH-like (ELC-Like); FUNCTIONS IN: small conjugating protein ligase activity; INVOLVED IN: regulation of protein metabolic process, protein modification process, protein transport, post-translational protein modification; LOCATED IN: ESCRT I complex; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Tumour susceptibility gene 101 (InterPro:IPR008883), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608), Steadiness box (InterPro:IPR017916); BEST Arabidopsis thaliana protein match is: Ubiquitin-conjugating enzyme/RWD-like protein (TAIR:AT3G12400.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;ELCH-likeCoding geneHOM002787 ORTHO002442
V AT5G13870EXGT-A4, endoxyloglucan transferase,;xyloglucan endotransglucosylase/hydrolase 5Coding geneHOM000089 ORTHO001723
X AT5G13880unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47920.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding geneHOM003006 ORTHO003135
X AT5G13887Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGACAUGGGACUGCCUAAGCUA;rna_type=mirna;MIR848a; miRNARNA gene
V AT5G13890Family of unknown function (DUF716) ; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF716 (InterPro:IPR006904); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G32120.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;Family of unknown function (DUF716) Coding geneHOM004960 ORTHO005223
V AT5G13900Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (TAIR:AT3G22600.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily proteinCoding geneHOM007123 ORTHO013097
V AT5G13910Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (LEAFY PETIOLE). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and LEAFY PETIOLE. Acts as a positive regulator of gibberellic acid-induced germination.;Integrase-type DNA-binding superfamily proteinCoding geneHOM000010 ORTHO045056
X AT5G13917unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding genesingleton
X AT5G13920GRF zinc finger / Zinc knuckle protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, GRF-type (InterPro:IPR010666); BEST Arabidopsis thaliana protein match is: GRF zinc finger / Zinc knuckle protein (TAIR:AT1G54930.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).;GRF zinc finger / Zinc knuckle proteinCoding geneHOM007309 ORTHO014661
V AT5G13930Encodes chalcone synthase (CHS), a key enzyme involved in the biosynthesis of flavonoids. Required for the accumulation of purple anthocyanins in leaves and stems. Also involved in the regulation of auxin transport and the modulation of root gravitropism.;Chalcone and stilbene synthase family proteinCoding geneHOM000238 ORTHO000100
V AT5G13940aminopeptidases; FUNCTIONS IN: aminopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Peptidase M17, leucyl aminopeptidase, C-terminal (InterPro:IPR000819), Protein of unknown function DUF3754 (InterPro:IPR022227); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF3754) (TAIR:AT3G19340.1); Has 538 Blast hits to 503 proteins in 70 species: Archae - 0; Bacteria - 76; Metazoa - 8; Fungi - 0; Plants - 425; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).;aminopeptidasesCoding geneHOM000844 ORTHO000535
X AT5G13950unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02290.1).Coding geneHOM002100 ORTHO012020
V AT5G13960Encodes a histone 3 lysine 9 specific methyltransferase involved in the maintenance of DNA methylation. SUVH4/KYP is a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. In kyp mutants, there is a loss of CpNpG methylation. The protein was shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the latter two. There is also evidence that KYP/SUVH4 might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres.;SU(VAR)3-9 homolog 4Coding geneHOM000281 ORTHO002040
V AT5G13970unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13310.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).Coding geneHOM003914 ORTHO009500
V AT5G13980Glycosyl hydrolase family 38 protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: mannose metabolic process, carbohydrate metabolic process; LOCATED IN: apoplast, cell wall, plasma membrane, vacuole, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase/deacetylase, beta/alpha-barrel (InterPro:IPR011330), Glycoside hydrolase, family 38, central domain (InterPro:IPR015341), Glycoside hydrolase, family 38, core (InterPro:IPR000602), Glycosyl hydrolases 38, C-terminal (InterPro:IPR011682); BEST Arabidopsis thaliana protein match is: Glycosyl hydrolase family 38 protein (TAIR:AT3G26720.1); Has 1172 Blast hits to 1119 proteins in 194 species: Archae - 7; Bacteria - 147; Metazoa - 695; Fungi - 22; Plants - 164; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink).;Glycosyl hydrolase family 38 proteinCoding geneHOM000678 ORTHO000272
V AT5G13990A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.;exocyst subunit exo70 family protein C2Coding geneHOM000135 ORTHO005224
X AT5G14000NAC domain containing protein 84 (NAC084); FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 83 (TAIR:AT5G13180.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;NAC domain containing protein 84Coding geneHOM000018 ORTHO045057
V AT5G14010Encodes KNUCKLES (KNU), a C2H2-type zinc finger protein with a conserved transcriptional repression motif. Mediates the repression of WUS in floral meristem determinacy control.;C2H2 and C2HC zinc fingers superfamily proteinCoding geneHOM000168 ORTHO045058
X AT5G14011unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding genesingleton
V AT5G14020Endosomal targeting BRO1-like domain-containing protein; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: vacuole; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: BRO1 (InterPro:IPR004328); BEST Arabidopsis thaliana protein match is: Endosomal targeting BRO1-like domain-containing protein (TAIR:AT1G73390.3); Has 94 Blast hits to 94 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 93; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).;Endosomal targeting BRO1-like domain-containing proteinCoding geneHOM001741 ORTHO010854
V AT5G14030translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;translocon-associated protein beta (TRAPB) family proteinCoding geneHOM005044 ORTHO010201
X AT5G14035tRNA-Lys (anticodon: CTT);rna_type=pre-trna;pre-tRNARNA gene
V AT5G14040phosphate transporter 3;1 (PHT3;1); FUNCTIONS IN: binding; INVOLVED IN: transport, transmembrane transport; LOCATED IN: in 6 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: phosphate transporter 3;2 (TAIR:AT3G48850.1); Has 17134 Blast hits to 11746 proteins in 429 species: Archae - 0; Bacteria - 0; Metazoa - 7375; Fungi - 4841; Plants - 3332; Viruses - 3; Other Eukaryotes - 1583 (source: NCBI BLink).;phosphate transporter 3;1Coding geneHOM001044 ORTHO000568
V AT5G14050Transducin/WD40 repeat-like superfamily protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat, conserved site (InterPro:IPR019775), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD40 repeat, subgroup (InterPro:IPR019781); BEST Arabidopsis thaliana protein match is: TBP-associated factor 5 (TAIR:AT5G25150.1); Has 6115 Blast hits to 4690 proteins in 400 species: Archae - 26; Bacteria - 2036; Metazoa - 1593; Fungi - 1149; Plants - 369; Viruses - 2; Other Eukaryotes - 940 (source: NCBI BLink).;Transducin/WD40 repeat-like superfamily proteinCoding geneHOM003671 ORTHO002258
X AT5G14060lysine-sensitive aspartate kinase;Aspartate kinase family proteinCoding geneHOM001363 ORTHO000784
V AT5G14070Encodes glutaredoxin ROXY2. ROXY2, together with ROXY1 (AT3G02000), controls anther development. roxy1 roxy2 double mutants are sterile and do not produce pollen.;Thioredoxin superfamily proteinCoding geneHOM000149 ORTHO001344
X AT5G14080Tetratricopeptide repeat (TPR)-like superfamily protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT5G64320.1); Has 28709 Blast hits to 10499 proteins in 259 species: Archae - 3; Bacteria - 9; Metazoa - 215; Fungi - 279; Plants - 27316; Viruses - 0; Other Eukaryotes - 887 (source: NCBI BLink).;Tetratricopeptide repeat (TPR)-like superfamily proteinCoding geneHOM000003 ORTHO009501
X AT5G14090unknown protein; Has 56 Blast hits to 56 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 46; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).Coding geneHOM003921 ORTHO013098
V AT5G14100member of NAP subfamily;non-intrinsic ABC protein 14Coding geneHOM004844 ORTHO007327
V AT5G14105unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding geneHOM004865 ORTHO006622
V AT5G14110Protein of unknown function (DUF 3339); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF3339 (InterPro:IPR021775); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF 3339) (TAIR:AT3G01950.1); Has 274 Blast hits to 269 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 274; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Protein of unknown function (DUF 3339)Coding geneHOM000566 ORTHO045059
V AT5G14120Major facilitator superfamily protein; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: Major facilitator superfamily protein (TAIR:AT3G01930.2); Has 2697 Blast hits to 2602 proteins in 809 species: Archae - 24; Bacteria - 1400; Metazoa - 12; Fungi - 267; Plants - 611; Viruses - 0; Other Eukaryotes - 383 (source: NCBI BLink).;Major facilitator superfamily proteinCoding geneHOM000161 ORTHO000745
V AT5G14130Peroxidase superfamily protein; FUNCTIONS IN: peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress, oxidation reduction; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, hypocotyl, fruit, root; EXPRESSED DURING: C globular stage; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Peroxidases heam-ligand binding site (InterPro:IPR019793), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016), Peroxidase, active site (InterPro:IPR019794); BEST Arabidopsis thaliana protein match is: Peroxidase superfamily protein (TAIR:AT4G37530.1); Has 4547 Blast hits to 4517 proteins in 291 species: Archae - 0; Bacteria - 4; Metazoa - 2; Fungi - 177; Plants - 4298; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).;Peroxidase superfamily proteinCoding geneHOM000012 ORTHO003991
V AT5G14140zinc ion binding;nucleic acid binding;zinc ion binding; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); Has 287 Blast hits to 281 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 116; Fungi - 82; Plants - 70; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).;zinc ion binding;nucleic acid binding;zinc ion bindingCoding geneHOM006430 ORTHO009502
V AT5G14150Protein of unknown function, DUF642; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946); BEST Arabidopsis thaliana protein match is: Protein of unknown function, DUF642 (TAIR:AT5G11420.1); Has 313 Blast hits to 252 proteins in 21 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 305; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).;Protein of unknown function, DUF642Coding geneHOM000318 ORTHO017515
X AT5G14160F-box family protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364); BEST Arabidopsis thaliana protein match is: F-box family protein with a domain of unknown function (DUF295) (TAIR:AT2G05970.1); Has 313 Blast hits to 303 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 313; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;F-box family proteinCoding geneHOM001165 ORTHO045060
X AT5G14170CHC1 is predicted to encode a protein that belongs to the chromodomain remodeling complex. Two RNAi knock-down lines have a dwarf phenotype and reduced rates of Agrobacterium-mediated transformation. The low rate of root-mediated transformation rate may result from altered root morphology or reduced root growth rates.;SWIB/MDM2 domain superfamily proteinCoding geneHOM002042 ORTHO000509
V AT5G14180Myzus persicae-induced lipase 1 (MPL1); FUNCTIONS IN: catalytic activity; INVOLVED IN: glycerol biosynthetic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: AB-hydrolase-associated lipase region (InterPro:IPR006693), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: lipase 1 (TAIR:AT2G15230.1); Has 1911 Blast hits to 1879 proteins in 244 species: Archae - 0; Bacteria - 109; Metazoa - 1225; Fungi - 283; Plants - 181; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink).;Myzus persicae-induced lipase 1Coding geneHOM000627 ORTHO006623
V AT5G14200The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. Encodes methylthioalkylmalate dehydrogenase. Involved in glucosinolate biosynthesis, in methionine chain elongation.;isopropylmalate dehydrogenase 1Coding geneHOM003543 ORTHO002385
V AT5G14210Leucine-rich repeat protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: Leucine-rich repeat protein kinase family protein (TAIR:AT3G03770.2); Has 111153 Blast hits to 61478 proteins in 2137 species: Archae - 27; Bacteria - 5463; Metazoa - 27639; Fungi - 2569; Plants - 67603; Viruses - 117; Other Eukaryotes - 7735 (source: NCBI BLink).;Leucine-rich repeat protein kinase family proteinCoding geneHOM000017 ORTHO001378
V AT5G14220Encodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development.;Flavin containing amine oxidoreductase familyCoding geneHOM005963 ORTHO008034
X AT5G14230CONTAINS InterPro DOMAIN/s: Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: XB3 ortholog 2 in Arabidopsis thaliana (TAIR:AT5G57740.1); Has 66374 Blast hits to 25358 proteins in 1201 species: Archae - 121; Bacteria - 8133; Metazoa - 29530; Fungi - 5885; Plants - 3349; Viruses - 785; Other Eukaryotes - 18571 (source: NCBI BLink).Coding geneHOM002204 ORTHO002787
X AT5G14240Thioredoxin superfamily protein; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); Has 1075 Blast hits to 1075 proteins in 388 species: Archae - 0; Bacteria - 2; Metazoa - 646; Fungi - 206; Plants - 103; Viruses - 0; Other Eukaryotes - 118 (source: NCBI BLink).;Thioredoxin superfamily proteinCoding geneHOM005613 ORTHO005225
X AT5G14250Encodes subunit 3 of the COP9 signalosome.;Proteasome component (PCI) domain proteinCoding geneHOM004553 ORTHO005226
V AT5G14260Rubisco methyltransferase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: Rubisco methyltransferase family protein (TAIR:AT3G07670.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).;Rubisco methyltransferase family proteinCoding geneHOM005118 ORTHO006624
X AT5G14270bromodomain and extraterminal domain protein 9 (BET9); FUNCTIONS IN: DNA binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bromodomain (InterPro:IPR001487); BEST Arabidopsis thaliana protein match is: bromodomain and extraterminal domain protein 10 (TAIR:AT3G01770.1).;bromodomain and extraterminal domain protein 9Coding geneHOM000227 ORTHO011392
X AT5G14280DNA-binding storekeeper protein-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF573 (InterPro:IPR007592), TRAM/LAG1/CLN8 homology domain (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein (TAIR:AT3G27270.1); Has 335 Blast hits to 330 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 315; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).;DNA-binding storekeeper protein-relatedCoding geneHOM000227 ORTHO006625
X AT5G14290Mitochondrial ribosomal protein L37; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37, mitochondrial (InterPro:IPR013870); BEST Arabidopsis thaliana protein match is: Mitochondrial ribosomal protein L37 (TAIR:AT3G01740.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Mitochondrial ribosomal protein L37Coding geneHOM005217 ORTHO045061
V AT5G14300prohibitin 5 (PHB5); CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: prohibitin 4 (TAIR:AT3G27280.1); Has 2683 Blast hits to 2683 proteins in 797 species: Archae - 146; Bacteria - 1077; Metazoa - 455; Fungi - 281; Plants - 201; Viruses - 7; Other Eukaryotes - 516 (source: NCBI BLink).;prohibitin 5Coding geneHOM001034 ORTHO045062
V AT5G14310carboxyesterase 16 (CXE16); FUNCTIONS IN: hydrolase activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDXG, active site (InterPro:IPR002168), Alpha/beta hydrolase fold-3 (InterPro:IPR013094); BEST Arabidopsis thaliana protein match is: alpha/beta-Hydrolases superfamily protein (TAIR:AT3G27320.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;carboxyesterase 16Coding geneHOM000074 ORTHO000370
V AT5G14320Ribosomal protein S13/S18 family; FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13, bacterial-type (InterPro:IPR019980), Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: Ribosomal protein S13/S18 family (TAIR:AT1G77750.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Ribosomal protein S13/S18 familyCoding geneHOM002926 ORTHO006116
X AT5G14330unknown protein; Has 8 Blast hits to 8 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding genesingleton
X AT5G14340Member of the R2R3 factor gene family.;myb domain protein 40Coding geneHOM000007 ORTHO012697
V AT5G14345Encodes a Uclacyanin/Basic blue family protein;early nodulin-like protein 21Coding geneHOM000055 ORTHO013721
X AT5G14350Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR-like) superfamily protein (TAIR:AT3G46610.1); Has 4293 Blast hits to 2672 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 18; Plants - 4078; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink).;Pentatricopeptide repeat (PPR) superfamily proteinCoding geneHOM000003 ORTHO225728
X AT5G14360Ubiquitin-like superfamily protein; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626), Ubiquitin supergroup (InterPro:IPR019955); BEST Arabidopsis thaliana protein match is: Ubiquitin-like superfamily protein (TAIR:AT5G40630.1); Has 222 Blast hits to 222 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 6; Plants - 210; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).;Ubiquitin-like superfamily proteinCoding geneHOM000650 ORTHO008036
V AT5G14370CCT motif family protein; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402); BEST Arabidopsis thaliana protein match is: CCT motif family protein (TAIR:AT4G25990.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;CCT motif family proteinCoding geneHOM000809 ORTHO012590
V AT5G14380Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP6 function results in decreased fertility due to defects in pollen tube growth.;arabinogalactan protein 6Coding geneHOM031411 ORTHO200138
V AT5G14390alpha/beta-Hydrolases superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: alpha/beta-Hydrolases superfamily protein (TAIR:AT3G01690.1); Has 3850 Blast hits to 3837 proteins in 836 species: Archae - 3; Bacteria - 1334; Metazoa - 667; Fungi - 199; Plants - 290; Viruses - 6; Other Eukaryotes - 1351 (source: NCBI BLink).;alpha/beta-Hydrolases superfamily proteinCoding geneHOM000424 ORTHO008765
X AT5G14400member of CYP724A;cytochrome P450, family 724, subfamily A, polypeptide 1Coding geneHOM000072 ORTHO013635
X AT5G14410unknown protein; Has 23 Blast hits to 23 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM006736 ORTHO014133
V AT5G14420RING domain ligase2 (RGLG2); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: N-terminal protein myristoylation, cytokinin metabolic process, auxin metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Copine (InterPro:IPR010734), von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: RING domain ligase1 (TAIR:AT3G01650.1); Has 2368 Blast hits to 2301 proteins in 208 species: Archae - 0; Bacteria - 31; Metazoa - 1318; Fungi - 57; Plants - 528; Viruses - 55; Other Eukaryotes - 379 (source: NCBI BLink).;RING domain ligase2Coding geneHOM000612 ORTHO008495
V AT5G14430S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT3G23300.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;S-adenosyl-L-methionine-dependent methyltransferases superfamily proteinCoding geneHOM000110 ORTHO000457
X AT5G14440Surfeit locus protein 2 (SURF2); CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: Surfeit locus protein 2 (SURF2) (TAIR:AT5G40570.1); Has 6258 Blast hits to 4510 proteins in 365 species: Archae - 8; Bacteria - 221; Metazoa - 2197; Fungi - 751; Plants - 330; Viruses - 76; Other Eukaryotes - 2675 (source: NCBI BLink).;Surfeit locus protein 2 (SURF2)Coding geneHOM006465 ORTHO010202
V AT5G14450GDSL-like Lipase/Acylhydrolase superfamily protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: plant-type cell wall; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-like Lipase/Acylhydrolase superfamily protein (TAIR:AT3G26430.1); Has 3217 Blast hits to 3179 proteins in 111 species: Archae - 0; Bacteria - 82; Metazoa - 0; Fungi - 14; Plants - 3119; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).;GDSL-like Lipase/Acylhydrolase superfamily proteinCoding geneHOM000086 ORTHO012592
V AT5G14460Pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity, transporter activity; INVOLVED IN: pseudouridine synthesis, RNA modification, RNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, catalytic domain (InterPro:IPR020103), Pseudouridine synthase II, TruB, N-terminal, bacterial-type (InterPro:IPR014780), Pseudouridine synthase II, TruB, N-terminal (InterPro:IPR002501); BEST Arabidopsis thaliana protein match is: homologue of NAP57 (TAIR:AT3G57150.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Pseudouridine synthase family proteinCoding geneHOM004664 ORTHO008037
V AT5G14470GHMP kinase family protein; FUNCTIONS IN: kinase activity, phosphotransferase activity, alcohol group as acceptor, galactokinase activity, ATP binding; INVOLVED IN: metabolic process, phosphorylation; LOCATED IN: cytoplasm; EXPRESSED IN: inflorescence meristem, flower, carpel, pollen tube; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206), Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568), GHMP kinase (InterPro:IPR006204), Ribosomal protein S5 domain 2-type fold, subgroup (InterPro:IPR014721), GHMP kinase, C-terminal (InterPro:IPR013750); BEST Arabidopsis thaliana protein match is: glucuronokinase G (TAIR:AT3G01640.1); Has 369 Blast hits to 369 proteins in 134 species: Archae - 34; Bacteria - 179; Metazoa - 12; Fungi - 0; Plants - 66; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).;GHMP kinase family proteinCoding geneHOM002190 ORTHO005645
V AT5G14480beta-1,4-N-acetylglucosaminyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: protein amino acid N-linked glycosylation; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 17 (InterPro:IPR006813); BEST Arabidopsis thaliana protein match is: beta-1,4-N-acetylglucosaminyltransferase family protein (TAIR:AT3G27540.1); Has 1093 Blast hits to 1092 proteins in 91 species: Archae - 0; Bacteria - 43; Metazoa - 62; Fungi - 35; Plants - 126; Viruses - 4; Other Eukaryotes - 823 (source: NCBI BLink).;beta-1,4-N-acetylglucosaminyltransferase family proteinCoding geneHOM001342 ORTHO000406
X AT5G14490NAC domain containing protein 85 (NAC085); FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 44 (TAIR:AT3G01600.1); Has 2068 Blast hits to 2065 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2068; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;NAC domain containing protein 85Coding geneHOM000659 ORTHO045064
X AT5G14495tRNA-Asp (anticodon: GTC);rna_type=pre-trna;pre-tRNARNA gene
X AT5G14500aldose 1-epimerase family protein; FUNCTIONS IN: carbohydrate binding, isomerase activity, aldose 1-epimerase activity, catalytic activity; INVOLVED IN: galactose metabolic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Aldose 1-epimerase (InterPro:IPR008183), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718); BEST Arabidopsis thaliana protein match is: Galactose mutarotase-like superfamily protein (TAIR:AT3G01590.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;aldose 1-epimerase family proteinCoding geneHOM000555 ORTHO012981
X AT5G14510ARM repeat superfamily protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: ARM repeat superfamily protein (TAIR:AT4G12710.1); Has 1353 Blast hits to 1188 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 35; Fungi - 195; Plants - 1036; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink).;ARM repeat superfamily proteinCoding geneHOM000047 ORTHO014134
V AT5G14520pescadillo-related; FUNCTIONS IN: transcription coactivator activity; INVOLVED IN: cell proliferation; LOCATED IN: nucleolus, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pescadillo, N-terminal (InterPro:IPR010613), BRCT (InterPro:IPR001357); Has 503 Blast hits to 494 proteins in 230 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 168; Plants - 48; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink).;pescadillo-relatedCoding geneHOM003172 ORTHO003136
V AT5G14530Transducin/WD40 repeat-like superfamily protein; CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat, conserved site (InterPro:IPR019775), WD40 repeat (InterPro:IPR001680), G-protein beta WD-40 repeat, region (InterPro:IPR020472), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40-repeat-containing domain (InterPro:IPR017986), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); BEST Arabidopsis thaliana protein match is: Transducin/WD40 repeat-like superfamily protein (TAIR:AT5G66240.1); Has 22372 Blast hits to 13576 proteins in 557 species: Archae - 62; Bacteria - 5277; Metazoa - 7900; Fungi - 4335; Plants - 2143; Viruses - 0; Other Eukaryotes - 2655 (source: NCBI BLink).;Transducin/WD40 repeat-like superfamily proteinCoding geneHOM001316 ORTHO004549
X AT5G14540FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), UBA-like (InterPro:IPR009060), Protein of unknown function DUF1421 (InterPro:IPR010820); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1421) (TAIR:AT3G01560.1); Has 114087 Blast hits to 62694 proteins in 2427 species: Archae - 138; Bacteria - 16154; Metazoa - 45092; Fungi - 21109; Plants - 14949; Viruses - 2278; Other Eukaryotes - 14367 (source: NCBI BLink).;Protein of unknown function (DUF1421)Coding geneHOM002916 ORTHO005227
X AT5G14545Encodes a microRNA that targets both CSD and CytC oxidase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGUGUUCUCAGGUCACCCCUG. Down-regulated by biotic and abiotic stress.;rna_type=mirna;MIR398B; miRNARNA gene
V AT5G14550Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein; CONTAINS InterPro DOMAIN/s: Core-2/I-Branching enzyme (InterPro:IPR021141); BEST Arabidopsis thaliana protein match is: Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein (TAIR:AT1G11940.1); Has 574 Blast hits to 572 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 548; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).;Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family proteinCoding geneHOM000186 ORTHO005228
X AT5G14560unknown protein; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding genesingleton
X AT5G14565Encodes a microRNA that targets both CSD and CytC oxidase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGUGUUCUCAGGUCACCCCUG. Down-regulated by biotic and abiotic stress.;rna_type=mirna;MIR398C; miRNARNA gene
V AT5G14570Encodes ATNRT2.7, a nitrate transporter that controls nitrate content in seeds. Expression is detected in reproductive organs and peaks in seeds. Localized to the vacuolar membrane.;high affinity nitrate transporter 2.7Coding geneHOM000812 ORTHO015240
V AT5G14580polyribonucleotide nucleotidyltransferase, putative; FUNCTIONS IN: polyribonucleotide nucleotidyltransferase activity, 3'-5'-exoribonuclease activity, RNA binding, nucleic acid binding; INVOLVED IN: mRNA catabolic process, RNA processing; LOCATED IN: mitochondrion; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Exoribonuclease, phosphorolytic domain 2 (InterPro:IPR015847), Ribosomal protein S1, RNA-binding domain (InterPro:IPR003029), Polynucleotide phosphorylase, phosphorolytic RNA-binding, bacterial/organelle-type (InterPro:IPR015848), K Homology (InterPro:IPR004087), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Exoribonuclease, phosphorolytic domain 1 (InterPro:IPR001247), Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568), Polyribonucleotide nucleotidyltransferase (InterPro:IPR012162); BEST Arabidopsis thaliana protein match is: polyribonucleotide nucleotidyltransferase, putative (TAIR:AT3G03710.1); Has 30004 Blast hits to 26962 proteins in 2901 species: Archae - 317; Bacteria - 19794; Metazoa - 489; Fungi - 141; Plants - 452; Viruses - 0; Other Eukaryotes - 8811 (source: NCBI BLink).;polyribonucleotide nucleotidyltransferase, putativeCoding geneHOM002078 ORTHO005901
V AT5G14590Isocitrate/isopropylmalate dehydrogenase family protein; FUNCTIONS IN: NAD or NADH binding, isocitrate dehydrogenase (NADP+) activity, magnesium ion binding, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor; INVOLVED IN: oxidation reduction, isocitrate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NADP-dependent, eukaryotic (InterPro:IPR004790), Isocitrate/isopropylmalate dehydrogenase, conserved site (InterPro:IPR019818); BEST Arabidopsis thaliana protein match is: cytosolic NADP+-dependent isocitrate dehydrogenase (TAIR:AT1G65930.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Isocitrate/isopropylmalate dehydrogenase family proteinCoding geneHOM001174 ORTHO000289
X AT5G14600S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; FUNCTIONS IN: tRNA (adenine-N1-)-methyltransferase activity; INVOLVED IN: tRNA methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: tRNA methyltransferase complex GCD14 subunit (InterPro:IPR014816); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;S-adenosyl-L-methionine-dependent methyltransferases superfamily proteinCoding geneHOM004238 ORTHO003992
V AT5G14602FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: Methyltransferase-related protein (TAIR:AT5G18150.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding geneHOM002895 ORTHO010217
X AT5G14610DEAD box RNA helicase family protein; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), WW/Rsp5/WWP (InterPro:IPR001202), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase 1 (TAIR:AT3G01540.1); Has 72370 Blast hits to 57752 proteins in 3325 species: Archae - 968; Bacteria - 36637; Metazoa - 12013; Fungi - 6274; Plants - 5549; Viruses - 294; Other Eukaryotes - 10635 (source: NCBI BLink).;DEAD box RNA helicase family proteinCoding geneHOM000036 ORTHO002420
V AT5G14620A putative DNA methyltransferase with rearranged catalytic domains; similar to mammalian DNMT3 methyltransferases; contains UBA domains. The 3'-end proximal part of the gene coding region is highly methylated at both adenine and cytosine residues.;domains rearranged methyltransferase 2Coding geneHOM001636 ORTHO001724
V AT5G14640shaggy-like kinase 13 (SK13); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: response to salt stress, hyperosmotic response; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: shaggy-related kinase 11 (TAIR:AT5G26751.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;shaggy-like kinase 13Coding geneHOM000019 ORTHO000049
V AT5G14650Pectin lyase-like superfamily protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, LP.02 two leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: Pectin lyase-like superfamily protein (TAIR:AT1G60590.1); Has 4562 Blast hits to 4542 proteins in 626 species: Archae - 6; Bacteria - 1470; Metazoa - 14; Fungi - 1443; Plants - 1493; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink).;Pectin lyase-like superfamily proteinCoding geneHOM000070 ORTHO014135
V AT5G14660Encodes a peptide deformylase PDF1B. The crystal structure has been determined at a resolution of 0.24 nm (Biochem J, 2008, vol 413:417-427).;peptide deformylase 1BCoding geneHOM003516 ORTHO003993
V AT5G14670A member of ARF GTPase family. Arabidopsis has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor DcARF1 (GI:965483) (Daucus carota), other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct.;ADP-ribosylation factor A1BCoding geneHOM000113 ORTHO000298
X AT5G14680Adenine nucleotide alpha hydrolases-like superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: Adenine nucleotide alpha hydrolases-like superfamily protein (TAIR:AT3G01520.1); Has 2663 Blast hits to 2654 proteins in 727 species: Archae - 164; Bacteria - 1702; Metazoa - 92; Fungi - 33; Plants - 646; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).;Adenine nucleotide alpha hydrolases-like superfamily proteinCoding geneHOM004895 ORTHO008766
X AT5G14690unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01516.1); Has 86 Blast hits to 86 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 2; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM007462 ORTHO045065
X AT5G14700NAD(P)-binding Rossmann-fold superfamily protein; FUNCTIONS IN: coenzyme binding, binding, cinnamoyl-CoA reductase activity, catalytic activity; INVOLVED IN: lignin biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding domain (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: NAD(P)-binding Rossmann-fold superfamily protein (TAIR:AT2G23910.1); Has 4116 Blast hits to 4108 proteins in 752 species: Archae - 4; Bacteria - 797; Metazoa - 69; Fungi - 490; Plants - 1968; Viruses - 42; Other Eukaryotes - 746 (source: NCBI BLink).;NAD(P)-binding Rossmann-fold superfamily proteinCoding geneHOM000069 ORTHO005902
X AT5G14710CONTAINS InterPro DOMAIN/s: Proteasome assembly chaperone 3 (InterPro:IPR018788); Has 120 Blast hits to 120 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 62; Fungi - 2; Plants - 49; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).Coding geneHOM005511 ORTHO005903
V AT5G14720Protein kinase superfamily protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: Protein kinase superfamily protein (TAIR:AT1G79640.1); Has 122716 Blast hits to 120970 proteins in 3289 species: Archae - 117; Bacteria - 14305; Metazoa - 44836; Fungi - 12007; Plants - 31268; Viruses - 500; Other Eukaryotes - 19683 (source: NCBI BLink).;Protein kinase superfamily proteinCoding geneHOM000043 ORTHO002041
X AT5G14730unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1645 (InterPro:IPR012442); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01513.1); Has 85 Blast hits to 83 proteins in 14 species: Archae - 0; Bacteria - 9; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM015635 ORTHO045066
V AT5G14740Encodes a beta carbonic anhydrase likely to be localized in the cytoplasm. Expression of its mRNA is seen in etiolated seedlings and points to a possible nonphotosynthetic role for this isoform.;carbonic anhydrase 2Coding geneHOM000362 ORTHO007042
V AT5G14750Encodes a MyB-related protein containing R2 and R3 repeats, involved in root and hypocotyl epidermal cell fate determination. Loss of function mutations make extra root hairs. Nuclear localized protein is a positive regulator for expression of CAPRICE (CPC).;myb domain protein 66Coding geneHOM000007 ORTHO010855
V AT5G14760At5g14760 encodes for L-aspartate oxidase involved in the early steps of NAD biosynthesis. In contrary to the EC 1.4.3.16 (l-aspartate oxidase - deaminating) the enzyme catalyzes the reaction L-aspartate + O2 = iminoaspartate (alpha-iminosuccinate) + H2O2;L-aspartate oxidaseCoding geneHOM001483 ORTHO005904
X AT5G14770Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT5G59900.1); Has 76339 Blast hits to 14879 proteins in 308 species: Archae - 3; Bacteria - 87; Metazoa - 1237; Fungi - 1442; Plants - 70832; Viruses - 0; Other Eukaryotes - 2738 (source: NCBI BLink).;Tetratricopeptide repeat (TPR)-like superfamily proteinCoding geneHOM000003 ORTHO008767
V AT5G14780Encodes a NAD-dependent formate dehydrogenase.;formate dehydrogenaseCoding geneHOM003969 ORTHO006626
X AT5G14790ARM repeat superfamily protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: ARM repeat superfamily protein (TAIR:AT3G01450.1); Has 322 Blast hits to 322 proteins in 81 species: Archae - 0; Bacteria - 0; Metazoa - 157; Fungi - 10; Plants - 125; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).;ARM repeat superfamily proteinCoding geneHOM000844 ORTHO005229
V AT5G14800Delta 1-pyrroline-5-carboxylate reductase, catalyzes the final step in proline biosynthesis from glutamate and ornithine.In situ hybridization indicated that under normal growth conditions, the highest concentration of P5CR transcripts occurs in the cortical parenchyma, phloem, vascular cambium and pith parenchyma in the vicinity of the protoxylem. Single gene in Arabidopsis.;pyrroline-5- carboxylate (P5C) reductaseCoding geneHOM003491 ORTHO005905
X AT5G14810retrotransposon family;rna_type=other_rna;transposable element geneTransposon
X AT5G14820Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Pentatricopeptide repeat (PPR) superfamily protein (TAIR:AT3G62540.1); Has 37965 Blast hits to 11999 proteins in 283 species: Archae - 3; Bacteria - 24; Metazoa - 443; Fungi - 549; Plants - 35727; Viruses - 0; Other Eukaryotes - 1219 (source: NCBI BLink).;Pentatricopeptide repeat (PPR) superfamily proteinCoding geneHOM000003 ORTHO009463
X AT5G14830retrotransposon family;rna_type=other_rna;transposable element geneTransposon
X AT5G14840pseudogene of unknown protein;pseudogenePseudo gene
V AT5G14850Alg9-like mannosyltransferase family; FUNCTIONS IN: mannosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process, GPI anchor metabolic process; LOCATED IN: endoplasmic reticulum membrane, intrinsic to endoplasmic reticulum membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Alg9-like mannosyltransferase familyCoding geneHOM004977 ORTHO006627
X AT5G14860UDP-Glycosyltransferase superfamily protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: central cell; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213), Tudor subgroup (InterPro:IPR018351); BEST Arabidopsis thaliana protein match is: UDP-Glycosyltransferase superfamily protein (TAIR:AT2G16890.2); Has 7679 Blast hits to 7613 proteins in 497 species: Archae - 0; Bacteria - 501; Metazoa - 1984; Fungi - 34; Plants - 4971; Viruses - 133; Other Eukaryotes - 56 (source: NCBI BLink).;UDP-Glycosyltransferase superfamily proteinCoding geneHOM000016 ORTHO005722
V AT5G14870Encodes a member of the cyclic nucleotide gated channel family that is asymmetrically localized to the plasma membrane at the growing tip of the pollen tube and is involved in pollen tube growth. It likely directly transduces a cNMP signal into an ion flux that can produce a localized signal capable of regulating the pollen tip-growth machinery.;cyclic nucleotide-gated channel 18Coding geneHOM000123 ORTHO000025
V AT5G14880Potassium transporter family protein; FUNCTIONS IN: potassium ion transmembrane transporter activity; INVOLVED IN: potassium ion transport; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Potassium uptake protein, kup (InterPro:IPR018519), K+ potassium transporter (InterPro:IPR003855); BEST Arabidopsis thaliana protein match is: K+ uptake permease 6 (TAIR:AT1G70300.1); Has 3431 Blast hits to 3392 proteins in 1031 species: Archae - 13; Bacteria - 2398; Metazoa - 1; Fungi - 104; Plants - 790; Viruses - 4; Other Eukaryotes - 121 (source: NCBI BLink).;Potassium transporter family proteinCoding geneHOM000120 ORTHO000022
V AT5G14890NHL domain-containing protein; LOCATED IN: endomembrane system; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL domain-containing protein (TAIR:AT1G70280.2); Has 2211 Blast hits to 1172 proteins in 193 species: Archae - 21; Bacteria - 928; Metazoa - 143; Fungi - 0; Plants - 261; Viruses - 0; Other Eukaryotes - 858 (source: NCBI BLink).;NHL domain-containing proteinCoding geneHOM000985 ORTHO045067
X AT5G14900helicase associated (HA2) domain-containing protein; FUNCTIONS IN: helicase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Helicase-associated domain (InterPro:IPR007502), Domain of unknown function DUF1605 (InterPro:IPR011709); BEST Arabidopsis thaliana protein match is: RNA helicase family protein (TAIR:AT3G62310.1); Has 5771 Blast hits to 5717 proteins in 1127 species: Archae - 0; Bacteria - 1821; Metazoa - 1566; Fungi - 1074; Plants - 520; Viruses - 0; Other Eukaryotes - 790 (source: NCBI BLink).;helicase associated (HA2) domain-containing proteinCoding geneHOM000130 ORTHO045068
V AT5G14910Heavy metal transport/detoxification superfamily protein ; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Heavy metal transport/detoxification superfamily protein Coding geneHOM006549 ORTHO009503
V AT5G14920Gibberellin-regulated family protein; INVOLVED IN: response to gibberellin stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gibberellin regulated protein (InterPro:IPR003854); BEST Arabidopsis thaliana protein match is: GAST1 protein homolog 3 (TAIR:AT4G09600.1); Has 178772 Blast hits to 67361 proteins in 2790 species: Archae - 781; Bacteria - 40130; Metazoa - 64437; Fungi - 23576; Plants - 19463; Viruses - 6498; Other Eukaryotes - 23887 (source: NCBI BLink).;Gibberellin-regulated family proteinCoding geneHOM000302 ORTHO010203
X AT5G14930encodes an acyl hydrolase involved in senescence .;senescence-associated gene 101Coding geneHOM001273 ORTHO009504
V AT5G14940Major facilitator superfamily protein; FUNCTIONS IN: amino acid transmembrane transporter activity, transporter activity; INVOLVED IN: oligopeptide transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Oligopeptide transporter (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: Major facilitator superfamily protein (TAIR:AT3G01350.1); Has 5224 Blast hits to 5039 proteins in 856 species: Archae - 0; Bacteria - 1785; Metazoa - 536; Fungi - 394; Plants - 2164; Viruses - 0; Other Eukaryotes - 345 (source: NCBI BLink).;Major facilitator superfamily proteinCoding geneHOM000031 ORTHO005230
V AT5G14950Encodes a golgi alpha-mannosidase, an enzyme responsible for the formation of major complex-type N-glycans.;golgi alpha-mannosidase IICoding geneHOM000678 ORTHO005906
V AT5G14960DP-E2F-like 2 (DEL2); FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Transcription factor E2F/dimerisation partner (TDP) (InterPro:IPR003316), E2F Family (InterPro:IPR015633); BEST Arabidopsis thaliana protein match is: DP-E2F-like protein 3 (TAIR:AT3G01330.1); Has 936 Blast hits to 860 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 583; Fungi - 5; Plants - 220; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).;DP-E2F-like 2Coding geneHOM002645 ORTHO045069
X AT5G14970unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14910.1); Has 579 Blast hits to 397 proteins in 95 species: Archae - 0; Bacteria - 294; Metazoa - 0; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 199 (source: NCBI BLink).Coding geneHOM003142 ORTHO013636
X AT5G14980alpha/beta-Hydrolases superfamily protein; BEST Arabidopsis thaliana protein match is: alpha/beta-Hydrolases superfamily protein (TAIR:AT5G19290.1); Has 3141 Blast hits to 3138 proteins in 1076 species: Archae - 24; Bacteria - 2044; Metazoa - 145; Fungi - 150; Plants - 435; Viruses - 33; Other Eukaryotes - 310 (source: NCBI BLink).;alpha/beta-Hydrolases superfamily proteinCoding geneHOM000246 ORTHO045070
X AT5G14990BEST Arabidopsis thaliana protein match is: myosin heavy chain-related (TAIR:AT2G34730.1); Has 8284 Blast hits to 6001 proteins in 578 species: Archae - 107; Bacteria - 678; Metazoa - 3983; Fungi - 607; Plants - 315; Viruses - 16; Other Eukaryotes - 2578 (source: NCBI BLink).Coding geneHOM006678 ORTHO010856
X AT5G14995Encodes a ECA1 gametogenesis related family protein;ECA1 gametogenesis related family proteinCoding geneHOM011265 ORTHO143757
X AT5G15000Encodes a ECA1 gametogenesis related family proteinCoding geneHOM011265 ORTHO031404
X AT5G15008unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding genesingleton
X AT5G15010Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G80880.1); Has 37863 Blast hits to 13191 proteins in 288 species: Archae - 3; Bacteria - 35; Metazoa - 443; Fungi - 342; Plants - 35932; Viruses - 0; Other Eukaryotes - 1108 (source: NCBI BLink).;Tetratricopeptide repeat (TPR)-like superfamily proteinCoding geneHOM000003 ORTHO010204
X AT5G15020Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190).;SIN3-like 2Coding geneHOM000191 ORTHO000354
X AT5G15022Potential natural antisense gene, locus overlaps with AT5G15030;rna_type=other_rnaRNA gene
X AT5G15030Paired amphipathic helix (PAH2) superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cytosol, nucleus; CONTAINS InterPro DOMAIN/s: Paired amphipathic helix (InterPro:IPR003822); BEST Arabidopsis thaliana protein match is: SIN3-like 1 (TAIR:AT3G01320.2).;Paired amphipathic helix (PAH2) superfamily proteinCoding geneHOM000191 ORTHO144594
X AT5G15040Paired amphipathic helix (PAH2) superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Paired amphipathic helix (InterPro:IPR003822); BEST Arabidopsis thaliana protein match is: SIN3-like 2 (TAIR:AT5G15020.1); Has 562 Blast hits to 542 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 194; Fungi - 132; Plants - 211; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).;Paired amphipathic helix (PAH2) superfamily proteinCoding geneHOM000191 ORTHO045071
V AT5G15050Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 14 (InterPro:IPR003406), Core-2/I-Branching enzyme (InterPro:IPR021141); BEST Arabidopsis thaliana protein match is: Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein (TAIR:AT5G39990.1); Has 926 Blast hits to 925 proteins in 118 species: Archae - 0; Bacteria - 49; Metazoa - 525; Fungi - 0; Plants - 316; Viruses - 14; Other Eukaryotes - 22 (source: NCBI BLink).;Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family proteinCoding geneHOM000349 ORTHO005231
X AT5G15060Lateral organ boundaries (LOB) domain family protein; CONTAINS InterPro DOMAIN/s: Lateral organ boundaries, LOB (InterPro:IPR004883); BEST Arabidopsis thaliana protein match is: LOB domain-containing protein 22 (TAIR:AT3G13850.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Lateral organ boundaries (LOB) domain family proteinCoding geneHOM000098 ORTHO045072
V AT5G15070Phosphoglycerate mutase-like family protein; FUNCTIONS IN: oxidoreductase activity, transition metal ion binding, acid phosphatase activity; INVOLVED IN: oxidation reduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: petal, embryo, leaf whorl, flower, seed; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Histidine phosphatase superfamily, clade-2 (InterPro:IPR000560), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078); BEST Arabidopsis thaliana protein match is: Phosphoglycerate mutase-like family protein (TAIR:AT3G01310.2).;Phosphoglycerate mutase-like family proteinCoding geneHOM002465 ORTHO001154
V AT5G15080Protein kinase superfamily protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: Protein kinase superfamily protein (TAIR:AT3G01300.1); Has 114476 Blast hits to 113108 proteins in 3886 species: Archae - 103; Bacteria - 13473; Metazoa - 41986; Fungi - 9512; Plants - 32487; Viruses - 375; Other Eukaryotes - 16540 (source: NCBI BLink).;Protein kinase superfamily proteinCoding geneHOM000004 ORTHO000498
V AT5G15090Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol.;voltage dependent anion channel 3Coding geneHOM000674 ORTHO031754
V AT5G15100PIN-FORMED 8 (PIN8); FUNCTIONS IN: auxin:hydrogen symporter activity, transporter activity; INVOLVED IN: auxin polar transport, transmembrane transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier, subgroup (InterPro:IPR014024), Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: Auxin efflux carrier family protein (TAIR:AT5G16530.1); Has 2836 Blast hits to 2583 proteins in 784 species: Archae - 43; Bacteria - 1603; Metazoa - 103; Fungi - 0; Plants - 634; Viruses - 0; Other Eukaryotes - 453 (source: NCBI BLink).;Auxin efflux carrier family proteinCoding geneHOM000344 ORTHO008768
V AT5G15110Pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectate lyase, N-terminal (InterPro:IPR007524), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: Pectate lyase family protein (TAIR:AT3G01270.1); Has 1602 Blast hits to 1594 proteins in 273 species: Archae - 0; Bacteria - 694; Metazoa - 0; Fungi - 171; Plants - 721; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).;Pectate lyase family proteinCoding geneHOM000163 ORTHO021151
X AT5G15120Protein of unknown function (DUF1637); FUNCTIONS IN: cysteamine dioxygenase activity; INVOLVED IN: anaerobic respiration; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1637 (InterPro:IPR012864); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1637) (TAIR:AT5G39890.1); Has 363 Blast hits to 363 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 0; Plants - 225; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).;Protein of unknown function (DUF1637)Coding geneHOM000605 ORTHO031755
X AT5G15130member of WRKY Transcription Factor; Group II-b; contribute to basal immunity.;WRKY DNA-binding protein 72Coding geneHOM000028 ORTHO012021
V AT5G15140Galactose mutarotase-like superfamily protein; FUNCTIONS IN: aldose 1-epimerase activity; INVOLVED IN: galactose metabolic process, hexose metabolic process, carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Aldose 1-epimerase (InterPro:IPR008183), Aldose 1-epimerase, subgroup (InterPro:IPR015443), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718); BEST Arabidopsis thaliana protein match is: Galactose mutarotase-like superfamily protein (TAIR:AT3G01260.1); Has 86054 Blast hits to 36023 proteins in 2379 species: Archae - 275; Bacteria - 25650; Metazoa - 19137; Fungi - 9557; Plants - 4507; Viruses - 809; Other Eukaryotes - 26119 (source: NCBI BLink).;Galactose mutarotase-like superfamily proteinCoding geneHOM000943 ORTHO003544
V AT5G15150homeobox-containing gene with an unusual feature: a leucine zipper motif adjacent to the carboxyl-terminal of the homeodomain structure. This gene is expressed primarily in the cortex of the root and the stem.;homeobox 3Coding geneHOM000124 ORTHO045073
V AT5G15160BNQ2 belongs to a family of atypical non-DNA binding basic helix-loop-helix (bHLH) proteins that heterodimerize with and negatively regulate bHLH transcription factors. Directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time.;BANQUO 2Coding geneHOM000366 ORTHO045074
V AT5G15170tyrosyl-DNA phosphodiesterase-related; FUNCTIONS IN: 3'-tyrosyl-DNA phosphodiesterase activity; INVOLVED IN: DNA repair; LOCATED IN: nucleus; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tyrosyl-DNA phosphodiesterase (InterPro:IPR010347), SMAD/FHA domain (InterPro:IPR008984); BEST Arabidopsis thaliana protein match is: forkhead-associated domain-containing protein / FHA domain-containing protein (TAIR:AT5G07400.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;tyrosyl-DNA phosphodiesterase-relatedCoding geneHOM001023 ORTHO007328
X AT5G15175tRNA-Val (anticodon: CAC);rna_type=pre-trna;pre-tRNARNA gene
V AT5G15180Peroxidase superfamily protein; FUNCTIONS IN: peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress, oxidation reduction; LOCATED IN: endomembrane system; EXPRESSED IN: root, flower, carpel; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Peroxidases heam-ligand binding site (InterPro:IPR019793), Peroxidase, active site (InterPro:IPR019794), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: Peroxidase superfamily protein (TAIR:AT3G01190.1); Has 4357 Blast hits to 4326 proteins in 247 species: Archae - 0; Bacteria - 4; Metazoa - 2; Fungi - 78; Plants - 4238; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).;Peroxidase superfamily proteinCoding geneHOM000012 ORTHO008347
V AT5G15190unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM022001 ORTHO045075
V AT5G15200Ribosomal protein S4; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: Ribosomal protein S4 (TAIR:AT5G39850.1); Has 5786 Blast hits to 5783 proteins in 2880 species: Archae - 264; Bacteria - 571; Metazoa - 422; Fungi - 281; Plants - 3526; Viruses - 0; Other Eukaryotes - 722 (source: NCBI BLink).;Ribosomal protein S4Coding geneHOM001287 ORTHO000402
X AT5G15210Encodes ZFHD3, a member of the zinc finger homeodomain transcriptional factor family.;homeobox protein 30Coding geneHOM000216 ORTHO045076
V AT5G15220Ribosomal protein L27 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27 (InterPro:IPR001684), Ribosomal protein L27, conserved site (InterPro:IPR018261); BEST Arabidopsis thaliana protein match is: Ribosomal protein L27 family protein (TAIR:AT2G16930.3); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Ribosomal protein L27 family proteinCoding geneHOM001147 ORTHO002788
V AT5G15230gibberellin-regulated (GASA4);GAST1 protein homolog 4Coding geneHOM000302 ORTHO014136
V AT5G15240Transmembrane amino acid transporter family protein; CONTAINS InterPro DOMAIN/s: Amino acid transporter, transmembrane (InterPro:IPR013057); BEST Arabidopsis thaliana protein match is: Transmembrane amino acid transporter family protein (TAIR:AT3G28960.1); Has 5045 Blast hits to 4985 proteins in 317 species: Archae - 15; Bacteria - 153; Metazoa - 1796; Fungi - 1055; Plants - 1275; Viruses - 9; Other Eukaryotes - 742 (source: NCBI BLink).;Transmembrane amino acid transporter family proteinCoding geneHOM000358 ORTHO018857
V AT5G15250Encodes an FtsH protease that is localized to the chloroplast. AtFtsH6 is involved in the degradation of both Lhcb3 and Lhcb1 during senescence and high-light acclimation.;FTSH protease 6Coding geneHOM000025 ORTHO000353
X AT5G15254unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding genesingleton
V AT5G15260Ribosomal protein L34e superfamily protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: Ribosomal protein L34e superfamily protein (TAIR:AT3G01170.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Ribosomal protein L34e superfamily proteinCoding geneHOM002106 ORTHO045077
V AT5G15265unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 5 Blast hits to 5 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM031415 ORTHO045078