Functional Clustering  


Cluster information

Cluster overview

Cluster id
CH_ath_98
Cluster type
GO
Species
Arabidopsis thaliana
Chromosome
2
E-value
0.000903183
GO label
GO:0006810
GO description
transport
 

Statistics

Gene family Num genes total Num genes species Num genes cluster Num species
HOM000031162059222
HOM000046115451125
HOM00008776428125
HOM00024133013219
HOM0003852377125
HOM00047220516124
HOM0005131929122
HOM0006301634125
HOM0006951537122
HOM0007641421123
HOM0008231324120
HOM0008591295125
HOM001495795118
HOM001913653119
HOM003512382120
HOM004479311121
HOM0297832112

Gene information

In cluster Gene id Description Gene type Gene family
V AT2G37870Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612), Plant lipid transfer protein/Par allergen (InterPro:IPR000528); BEST Arabidopsis thaliana protein match is: Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (TAIR:AT5G05960.1); Has 479 Blast hits to 479 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 479; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily proteinCoding geneHOM001913 ORTHO013574
X AT2G37880Protein of unknown function, DUF617; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: Protein of unknown function, DUF617 (TAIR:AT1G21050.1); Has 257 Blast hits to 256 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 257; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Protein of unknown function, DUF617Coding geneHOM000442 ORTHO013029
V AT2G37890Mitochondrial substrate carrier family protein; FUNCTIONS IN: binding, transporter activity; INVOLVED IN: transport, mitochondrial transport, transmembrane transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: Mitochondrial substrate carrier family protein (TAIR:AT3G53940.1); Has 31162 Blast hits to 14569 proteins in 465 species: Archae - 0; Bacteria - 2; Metazoa - 13469; Fungi - 9587; Plants - 4863; Viruses - 0; Other Eukaryotes - 3241 (source: NCBI BLink).;Mitochondrial substrate carrier family proteinCoding geneHOM000087 ORTHO043989
V AT2G37900Major facilitator superfamily protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: PTR2 family proton/oligopeptide symporter, conserved site (InterPro:IPR018456), Oligopeptide transporter (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: Major facilitator superfamily protein (TAIR:AT3G53960.1); Has 7031 Blast hits to 6882 proteins in 1319 species: Archae - 0; Bacteria - 3384; Metazoa - 508; Fungi - 445; Plants - 2220; Viruses - 0; Other Eukaryotes - 474 (source: NCBI BLink).;Major facilitator superfamily proteinCoding geneHOM000031 ORTHO001095
V AT2G37910cation/hydrogen exchanger, putative (CHX21); FUNCTIONS IN: monovalent cation:hydrogen antiporter activity; INVOLVED IN: cation transport; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: cell division cycle 48C (TAIR:AT3G01610.1); Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;cation/hydrogen exchanger, putative (CHX21)Coding geneHOM029783 ORTHO043990
X AT2G37920embryo defective 1513 (emb1513); BEST Arabidopsis thaliana protein match is: DEA(D/H)-box RNA helicase family protein (TAIR:AT2G07750.1); Has 60 Blast hits to 60 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;copper ion transmembrane transportersCoding geneHOM005332 ORTHO008625
V AT2G37925encodes a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast;copper transporter 4Coding geneHOM001495 ORTHO015903
X AT2G37930Protein of unknown function (DUF3527); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast envelope; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF3527 (InterPro:IPR021916); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF3527) (TAIR:AT5G01030.2); Has 289 Blast hits to 262 proteins in 54 species: Archae - 0; Bacteria - 9; Metazoa - 59; Fungi - 32; Plants - 123; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).;Protein of unknown function (DUF3527)Coding geneHOM002855 ORTHO043991
X AT2G37940I;Arabidopsis Inositol phosphorylceramide synthase 2Coding geneHOM002445 ORTHO043992
X AT2G37950RING/FYVE/PHD zinc finger superfamily protein; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C3HC4 RING-type (InterPro:IPR018957), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: RING/FYVE/PHD zinc finger superfamily protein (TAIR:AT5G05830.1); Has 598 Blast hits to 594 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 45; Fungi - 4; Plants - 538; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).;RING/FYVE/PHD zinc finger superfamily proteinCoding geneHOM000408 ORTHO043993
X AT2G37960unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G54060.2); Has 418 Blast hits to 247 proteins in 92 species: Archae - 0; Bacteria - 163; Metazoa - 49; Fungi - 80; Plants - 28; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).Coding geneHOM004542 ORTHO008626
X AT2G37970SOUL-1; FUNCTIONS IN: binding; INVOLVED IN: N-terminal protein myristoylation, red or far-red light signaling pathway; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SOUL haem-binding protein (InterPro:IPR006917); BEST Arabidopsis thaliana protein match is: SOUL heme-binding family protein (TAIR:AT3G10130.1); Has 1375 Blast hits to 1375 proteins in 156 species: Archae - 18; Bacteria - 186; Metazoa - 71; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 927 (source: NCBI BLink).;SOUL heme-binding family proteinCoding geneHOM003003 ORTHO005775
X AT2G37975Yos1-like protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Yos1-like (InterPro:IPR013880); BEST Arabidopsis thaliana protein match is: Yos1-like protein (TAIR:AT3G54085.2); Has 211 Blast hits to 211 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 108; Fungi - 40; Plants - 52; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).;Yos1-like proteinCoding geneHOM000088 ORTHO007212
X AT2G37980O-fucosyltransferase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: GDP-fucose protein O-fucosyltransferase (InterPro:IPR019378); BEST Arabidopsis thaliana protein match is: O-fucosyltransferase family protein (TAIR:AT3G54100.1); Has 844 Blast hits to 822 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 842; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;O-fucosyltransferase family proteinCoding geneHOM000088 ORTHO001260
X AT2G37990ribosome biogenesis regulatory protein (RRS1) family protein; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal biogenesis regulatory protein (InterPro:IPR007023); Has 425 Blast hits to 423 proteins in 207 species: Archae - 1; Bacteria - 2; Metazoa - 151; Fungi - 137; Plants - 58; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).;ribosome biogenesis regulatory protein (RRS1) family proteinCoding geneHOM003544 ORTHO002478
X AT2G38000chaperone protein dnaJ-related; Has 1004 Blast hits to 976 proteins in 392 species: Archae - 24; Bacteria - 688; Metazoa - 92; Fungi - 4; Plants - 51; Viruses - 0; Other Eukaryotes - 145 (source: NCBI BLink).;chaperone protein dnaJ-relatedCoding geneHOM005908 ORTHO009373
X AT2G38010Neutral/alkaline non-lysosomal ceramidase; FUNCTIONS IN: ceramidase activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neutral/alkaline nonlysosomal ceramidase (InterPro:IPR006823); BEST Arabidopsis thaliana protein match is: Neutral/alkaline non-lysosomal ceramidase (TAIR:AT1G07380.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).;Neutral/alkaline non-lysosomal ceramidaseCoding geneHOM001863 ORTHO000694
V AT2G38020necessary for proper vacuole formation and morphogenesis in Arabidopsis;vacuoleless1 (VCL1)Coding geneHOM004479 ORTHO005710
X AT2G38025Cysteine proteinases superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Ovarian tumour, otubain (InterPro:IPR003323); BEST Arabidopsis thaliana protein match is: Cysteine proteinases superfamily protein (TAIR:AT3G57810.1); Has 173 Blast hits to 173 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 27; Fungi - 2; Plants - 136; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).;Cysteine proteinases superfamily proteinCoding geneHOM002254 ORTHO007213
X AT2G38030tRNA-Glu (anticodon: CTC);rna_type=pre-trna;pre-tRNARNA gene
X AT2G38040encodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis;acetyl Co-enzyme a carboxylase carboxyltransferase alpha subunitCoding geneHOM004179 ORTHO008627
X AT2G38050Similar to mammalian steroid-5-alpha-reductase. Involved in the brassinolide biosynthetic pathway.;3-oxo-5-alpha-steroid 4-dehydrogenase family proteinCoding geneHOM004049 ORTHO004442
V AT2G38060Encodes an inorganic phosphate transporter (PHT4;2).;phosphate transporter 4;2Coding geneHOM000385 ORTHO010089
X AT2G38070Protein of unknown function (DUF740); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF740 (InterPro:IPR008004); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF740) (TAIR:AT3G09070.1); Has 108 Blast hits to 106 proteins in 27 species: Archae - 0; Bacteria - 3; Metazoa - 6; Fungi - 2; Plants - 76; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).;Protein of unknown function (DUF740)Coding geneHOM001529 ORTHO011947
X AT2G38080Encodes a protein with similarity to putative laccase, a member of laccase family (17 members in Arabidopsis). Might be involved in cell wall biosynthesis. Mutants have a mild irregular xylem phenotype.;Laccase/Diphenol oxidase family proteinCoding geneHOM000096 ORTHO000023
X AT2G38090Duplicated homeodomain-like superfamily protein; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), SANT, eukarya (InterPro:IPR017884), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447), SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-related (InterPro:IPR012287), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930); BEST Arabidopsis thaliana protein match is: Homeodomain-like transcriptional regulator (TAIR:AT5G58900.1); Has 1891 Blast hits to 1883 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 3; Plants - 1444; Viruses - 0; Other Eukaryotes - 217 (source: NCBI BLink).;Duplicated homeodomain-like superfamily proteinCoding geneHOM000103 ORTHO011948
V AT2G38100proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: amino acid transmembrane transporter activity, uracil transmembrane transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.10 ten leaves visible, LP.08 eight leaves visible, LP.12 twelve leaves visible; CONTAINS InterPro DOMAIN/s: Oligopeptide transporter (InterPro:IPR000109); BEST Arabidopsis thaliana protein match is: peptide transporter 5 (TAIR:AT5G01180.1); Has 2766 Blast hits to 2715 proteins in 326 species: Archae - 0; Bacteria - 547; Metazoa - 329; Fungi - 2; Plants - 1871; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).;proton-dependent oligopeptide transport (POT) family proteinCoding geneHOM000031 ORTHO025886
X AT2G38110Encodes a protein with glycerol-3-phosphate acyltransferase activity.;glycerol-3-phosphate acyltransferase 6Coding geneHOM000384 ORTHO008628
V AT2G38120Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning.;Transmembrane amino acid transporter family proteinCoding geneHOM000823 ORTHO000128
X AT2G38130Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes.;Acyl-CoA N-acyltransferases (NAT) superfamily proteinCoding geneHOM002100 ORTHO003070
X AT2G38140plastid-specific ribosomal protein 4 (PSRP4) mRNA, complete;plastid-specific ribosomal protein 4Coding geneHOM006010 ORTHO011949
X AT2G38150alpha 1,4-glycosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, Golgi stack; CONTAINS InterPro DOMAIN/s: Alpha 1,4-glycosyltransferase conserved region (InterPro:IPR007652), Glycosyltransferase, DXD sugar-binding region (InterPro:IPR007577); BEST Arabidopsis thaliana protein match is: alpha 1,4-glycosyltransferase family protein (TAIR:AT5G01250.1); Has 454 Blast hits to 450 proteins in 114 species: Archae - 0; Bacteria - 88; Metazoa - 237; Fungi - 18; Plants - 94; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).;alpha 1,4-glycosyltransferase family proteinCoding geneHOM001375 ORTHO018829
X AT2G38152alpha 1,4-glycosyltransferase family protein; FUNCTIONS IN: galactosyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi stack; CONTAINS InterPro DOMAIN/s: Alpha 1,4-glycosyltransferase conserved region (InterPro:IPR007652), Glycosyltransferase, DXD sugar-binding region (InterPro:IPR007577); BEST Arabidopsis thaliana protein match is: alpha 1,4-glycosyltransferase family protein (TAIR:AT3G09020.1); Has 392 Blast hits to 388 proteins in 73 species: Archae - 0; Bacteria - 23; Metazoa - 248; Fungi - 2; Plants - 96; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).;alpha 1,4-glycosyltransferase family proteinCoding geneHOM001375 ORTHO043994
X AT2G38160unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40070.2); Has 972 Blast hits to 731 proteins in 211 species: Archae - 0; Bacteria - 236; Metazoa - 194; Fungi - 201; Plants - 218; Viruses - 32; Other Eukaryotes - 91 (source: NCBI BLink).Coding geneHOM002968 ORTHO201248
V AT2G38170Encodes a high affinity vacuolar calcium antiporter. The residue His 338 is critical to Ca2+ transport activity. Disruption of CAX1 reduces manganese and zinc of shoot tissue and results in a decrease in the activity of vacuolar V-type proton ATPase.;cation exchanger 1Coding geneHOM000695 ORTHO043995
X AT2G38180SGNH hydrolase-type esterase superfamily protein; FUNCTIONS IN: hydrolase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Esterase, SGNH hydrolase-type, subgroup (InterPro:IPR013831), Lipase, GDSL (InterPro:IPR001087), Esterase, SGNH hydrolase-type (InterPro:IPR013830); BEST Arabidopsis thaliana protein match is: SGNH hydrolase-type esterase superfamily protein (TAIR:AT3G11210.1); Has 749 Blast hits to 745 proteins in 289 species: Archae - 0; Bacteria - 287; Metazoa - 79; Fungi - 158; Plants - 167; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).;SGNH hydrolase-type esterase superfamily proteinCoding geneHOM000884 ORTHO043996
X AT2G38185RING/U-box superfamily protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: RING/U-box superfamily protein (TAIR:AT2G38220.1).;RING/U-box superfamily proteinCoding geneHOM001883 ORTHO006498
X AT2G38195RING/U-box superfamily protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: RING/U-box superfamily protein (TAIR:AT2G38220.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;RING/U-box superfamily proteinCoding geneHOM001883 ORTHO046749
X AT2G38210putative PDX1-like protein 4 (PDX1L4); INVOLVED IN: response to ethylene stimulus, pyridoxal phosphate biosynthetic process, response to stress; LOCATED IN: plasma membrane; EXPRESSED IN: ovule, male gametophyte, cultured cell; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Vitamin B6 biosynthesis protein (InterPro:IPR001852); BEST Arabidopsis thaliana protein match is: pyridoxine biosynthesis 1.1 (TAIR:AT2G38230.1); Has 2527 Blast hits to 2526 proteins in 1015 species: Archae - 229; Bacteria - 1613; Metazoa - 13; Fungi - 150; Plants - 119; Viruses - 0; Other Eukaryotes - 403 (source: NCBI BLink).;putative PDX1-like protein 4Coding geneHOM001512 ORTHO108843
X AT2G38220RING/U-box superfamily protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: RING/U-box superfamily protein (TAIR:AT2G38195.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;RING/U-box superfamily proteinCoding geneHOM001883 ORTHO046749
X AT2G38230Encodes a protein predicted to function in tandem with PDX2 to form glutamine amidotransferase complex with involved in vitamin B6 biosynthesis.;pyridoxine biosynthesis 1.1Coding geneHOM001512 ORTHO043997
X AT2G382402-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to salt stress; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Oxoglutarate/iron-dependent oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein (TAIR:AT5G05600.1); Has 8819 Blast hits to 8740 proteins in 1012 species: Archae - 0; Bacteria - 1137; Metazoa - 112; Fungi - 1067; Plants - 5036; Viruses - 0; Other Eukaryotes - 1467 (source: NCBI BLink).;2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily proteinCoding geneHOM000011 ORTHO031243
X AT2G38250Homeodomain-like superfamily protein; FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleolus; EXPRESSED IN: stamen; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: Homeodomain-like superfamily protein (TAIR:AT5G01380.1); Has 3356 Blast hits to 2254 proteins in 222 species: Archae - 0; Bacteria - 69; Metazoa - 1338; Fungi - 313; Plants - 554; Viruses - 7; Other Eukaryotes - 1075 (source: NCBI BLink).;Homeodomain-like superfamily proteinCoding geneHOM001258 ORTHO005087
X AT2G38255Protein of Unknown Function (DUF239); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF239, plant (InterPro:IPR004314); BEST Arabidopsis thaliana protein match is: Protein of Unknown Function (DUF239) (TAIR:AT2G27320.1); Has 682 Blast hits to 655 proteins in 27 species: Archae - 0; Bacteria - 13; Metazoa - 0; Fungi - 10; Plants - 659; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Protein of Unknown Function (DUF239)Coding geneHOM000151 ORTHO021191
X AT2G38260pseudogene, similar to carboxyl transferase alpha subunit, similar to GB:U34392, however, a substitution at base 93910 in our sequence causes a stop codon in the coding region. We sequenced four clones in that region which all confirm the substitution.; blastp match of 73% identity and 2.6e-115 P-value to GP|9621818|gb|AAF89548.1|AF165158_1|AF165158 carboxyl transferase alpha subunit {Glycine max};pseudogenePseudo gene
V AT2G38270Encodes protein homologous to CXIP1. CXIP1 is a PICOT domain containing protein interacts with CAX1, a high capacity calcium transporter. However, CXP2 does not interact with CAX1 and only moderately activates another calcium transporter CAX4.;CAX-interacting protein 2Coding geneHOM000859 ORTHO003895
X AT2G38280Encodes a protein with in vitro AMP deaminase activity that is involved in embryogenesis. Homozygous mutant embryos fail to develop past the zygote stage.;AMP deaminase, putative / myoadenylate deaminase, putativeCoding geneHOM002033 ORTHO000897
V AT2G38290encodes a high-affinity ammonium transporter, which is expressed in shoot and root. Expression in root and shoot is under nitrogen and carbon dioxide regulation, respectively.;ammonium transporter 2Coding geneHOM000764 ORTHO000595
X AT2G38300myb-like HTH transcriptional regulator family protein; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: Homeodomain-like superfamily protein (TAIR:AT2G40260.1); Has 1661 Blast hits to 1657 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 4; Plants - 1609; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).;myb-like HTH transcriptional regulator family proteinCoding geneHOM000080 ORTHO011950
X AT2G38304unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding geneHOM032278 ORTHO043998
X AT2G38310Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2.;PYR1-like 4Coding geneHOM000428 ORTHO005776
X AT2G38320Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).;TRICHOME BIREFRINGENCE-LIKE 34Coding geneHOM000050 ORTHO010765
X AT2G38325Encodes a microRNA that targets the TAS3 family of tasiRNA-generating transcripts. Cleavage of TAS3 transcripts by miR390 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AAGCUCAGGAGGGAUAGCGCC;rna_type=mirna;MIR390A; miRNARNA gene
V AT2G38330MATE efflux family protein; FUNCTIONS IN: antiporter activity, drug transmembrane transporter activity, transporter activity; INVOLVED IN: drug transmembrane transport, transmembrane transport; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT4G38380.1); Has 17219 Blast hits to 17166 proteins in 2310 species: Archae - 394; Bacteria - 13798; Metazoa - 83; Fungi - 156; Plants - 607; Viruses - 0; Other Eukaryotes - 2181 (source: NCBI BLink).;MATE efflux family proteinCoding geneHOM000630 ORTHO006167
X AT2G38340encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought.;Integrase-type DNA-binding superfamily proteinCoding geneHOM000010 ORTHO014099
X AT2G38350unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding genesingleton
V AT2G38360prenylated RAB acceptor 1.B4 (PRA1.B4); CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: prenylated RAB acceptor 1.B5 (TAIR:AT5G01640.1); Has 506 Blast hits to 506 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 113; Fungi - 53; Plants - 299; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).;prenylated RAB acceptor 1.B4Coding geneHOM000472 ORTHO000465
X AT2G38365unknown protein; Has 7 Blast hits to 7 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM000672 ORTHO180353
X AT2G38370Plant protein of unknown function (DUF827); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: Plant protein of unknown function (DUF827) (TAIR:AT3G51720.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).;Plant protein of unknown function (DUF827)Coding geneHOM002122 ORTHO010766
X AT2G38380Peroxidase superfamily protein; FUNCTIONS IN: peroxidase activity, heme binding; INVOLVED IN: response to zinc ion, response to salt stress; LOCATED IN: plant-type cell wall; EXPRESSED IN: stem, root; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Peroxidases heam-ligand binding site (InterPro:IPR019793), Peroxidase, active site (InterPro:IPR019794), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: Peroxidase superfamily protein (TAIR:AT2G38390.1); Has 4386 Blast hits to 4361 proteins in 262 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 86; Plants - 4250; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).;Peroxidase superfamily proteinCoding geneHOM000012 ORTHO026029
X AT2G38390Peroxidase superfamily protein; FUNCTIONS IN: peroxidase activity, heme binding; INVOLVED IN: response to salt stress; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Peroxidases heam-ligand binding site (InterPro:IPR019793), Peroxidase, active site (InterPro:IPR019794), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: Peroxidase superfamily protein (TAIR:AT2G38380.1); Has 4338 Blast hits to 4309 proteins in 248 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 52; Plants - 4237; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).;Peroxidase superfamily proteinCoding geneHOM000012 ORTHO044000
X AT2G38400alanine:glyoxylate aminotransferase 2 homolog (AGT3) mRNA,;alanine:glyoxylate aminotransferase 3Coding geneHOM000633 ORTHO000532
V AT2G38410ENTH/VHS/GAT family protein; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: ENTH/VHS/GAT family protein (TAIR:AT5G01760.1); Has 42231 Blast hits to 23362 proteins in 1216 species: Archae - 12; Bacteria - 2643; Metazoa - 15006; Fungi - 7319; Plants - 4169; Viruses - 367; Other Eukaryotes - 12715 (source: NCBI BLink).;ENTH/VHS/GAT family proteinCoding geneHOM000513 ORTHO007214
X AT2G38420Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT1G63130.1); Has 26299 Blast hits to 8886 proteins in 261 species: Archae - 3; Bacteria - 26; Metazoa - 362; Fungi - 517; Plants - 24480; Viruses - 0; Other Eukaryotes - 911 (source: NCBI BLink).;Pentatricopeptide repeat (PPR) superfamily proteinCoding geneHOM000003 ORTHO013575
X AT2G38430unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G54310.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).Coding geneHOM004368 ORTHO007215
X AT2G38440Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. Mutations cause defects in both the actin and microtubule cytoskeletons that result in aberrant epidermal cell expansion. itb1 mutants showed irregularities in trichome branch positioning and expansion. The SHD domain of this protein binds to BRK1 and overexpression of the SHD domain results in a dominant negative phenotype.;SCAR homolog 2Coding geneHOM001505 ORTHO005088
X AT2G38450CONTAINS InterPro DOMAIN/s: Sel1-like (InterPro:IPR006597); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G05360.1); Has 88 Blast hits to 88 proteins in 25 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).Coding geneHOM002805 ORTHO003071
V AT2G38460Encodes IRON REGULATED1 (IREG1/FPN1), one of the Arabidopsis orthologs (AT2G38460/IREG1/FPN1 and AT5G03570/IREG2/FPN2) the iron efflux transporter ferroportin (FPN) identified in animals.;iron regulated 1Coding geneHOM003512 ORTHO004443
X AT2G38465unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; Has 16 Blast hits to 16 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM007621 ORTHO014630
X AT2G38470Member of the plant WRKY transcription factor family. Regulates the antagonistic relationship between defense pathways mediating responses to P. syringae and necrotrophic fungal pathogens. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress.;WRKY DNA-binding protein 33Coding geneHOM000028 ORTHO013030
X AT2G38480Uncharacterised protein family (UPF0497); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0497, trans-membrane plant (InterPro:IPR006702); BEST Arabidopsis thaliana protein match is: Uncharacterised protein family (UPF0497) (TAIR:AT2G36330.1); Has 221 Blast hits to 221 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 221; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Uncharacterised protein family (UPF0497)Coding geneHOM003192 ORTHO008629
X AT2G38490member of AtCIPKs;CBL-interacting protein kinase 22Coding geneHOM000044 ORTHO044002
X AT2G385002-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein; Has 51 Blast hits to 51 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily proteinCoding geneHOM007432 ORTHO013031
V AT2G38510MATE efflux family protein; FUNCTIONS IN: antiporter activity, drug transmembrane transporter activity, transporter activity; INVOLVED IN: drug transmembrane transport, transmembrane transport; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G58340.1); Has 11945 Blast hits to 11897 proteins in 2040 species: Archae - 292; Bacteria - 8615; Metazoa - 143; Fungi - 328; Plants - 1321; Viruses - 0; Other Eukaryotes - 1246 (source: NCBI BLink).;MATE efflux family proteinCoding geneHOM000046 ORTHO008630
X AT2G38520copia-like retrotransposon family, has a 8.4e-60 P-value blast match to dbj|BAA78427.1| polyprotein (AtRE2-2) (Arabidopsis thaliana) (Ty1_Copia-element);rna_type=other_rna;transposable element geneTransposon
V AT2G38530Involved in lipid transfer between membranes. Belongs to a family of Lipid transfer proteins. Sequence similarity to other plant/Arabidopsis LPT genes but highest similarity to LPT1. Stress and pathogen-inducible motifs found in the upstream region. Expressed in flower, leaves and siliques but absent in roots. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15.;lipid transfer protein 2Coding geneHOM000241 ORTHO000761
V AT2G38540Non-specific lipid transfer protein. Binds calmodulin in a Ca2+-independent manner. Localized to the cell wall. Specifically expressed in L1 epidermal layer. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15.;lipid transfer protein 1Coding geneHOM000241 ORTHO003388