| In cluster |
Gene id |
Description |
Gene type |
Gene family |
| V |
AT3G54640 | Catalyzes the conversion of indole-3-glycerolphosphate to indole, the penultimate reaction in the biosynthesis of tryptophan. Functions as a heterocomplex with tryptophan synthase beta subunit (TSA2).;tryptophan synthase alpha chain | Coding gene | HOM002938 ORTHO003027 |
| V |
AT3G54650 | FBL17; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: generative cell mitosis, seed development, embryo development, ubiquitin-dependent protein catabolic process, pollen development; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810); Has 1738 Blast hits to 1195 proteins in 149 species: Archae - 0; Bacteria - 27; Metazoa - 733; Fungi - 89; Plants - 663; Viruses - 0; Other Eukaryotes - 226 (source: NCBI BLink).;RNI-like superfamily protein | Coding gene | HOM016242 ORTHO017762 |
| V |
AT3G54660 | Encodes glutathione reductase that is most likely localized in the chloroplast.;glutathione reductase | Coding gene | HOM000126 ORTHO000449 |
| V |
AT3G54670 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment.;Structural maintenance of chromosomes (SMC) family protein | Coding gene | HOM002659 ORTHO001620 |
| V |
AT3G54680 | proteophosphoglycan-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; Has 4120 Blast hits to 443 proteins in 120 species: Archae - 2; Bacteria - 57; Metazoa - 120; Fungi - 93; Plants - 84; Viruses - 11; Other Eukaryotes - 3753 (source: NCBI BLink).;proteophosphoglycan-related | Coding gene | singleton |
| X |
AT3G54690 | Sugar isomerase (SIS) family protein; FUNCTIONS IN: isomerase activity, sugar binding; INVOLVED IN: carbohydrate metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: KpsF/GutQ (InterPro:IPR004800), Sugar isomerase (SIS) (InterPro:IPR001347), Cystathionine beta-synthase, core (InterPro:IPR000644); Has 8722 Blast hits to 8719 proteins in 1857 species: Archae - 184; Bacteria - 5776; Metazoa - 15; Fungi - 131; Plants - 43; Viruses - 2; Other Eukaryotes - 2571 (source: NCBI BLink).;Sugar isomerase (SIS) family protein | Coding gene | HOM006409 ORTHO007870 |
| X |
AT3G54700 | Encodes Pht1;7, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).;phosphate transporter 1;7 | Coding gene | HOM000365 ORTHO000376 |
| X |
AT3G54710 | Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division.;homolog of yeast CDT1 B homolog of yeast CDT1 B | Coding gene | HOM005752 ORTHO009154 |
| X |
AT3G54720 | Encodes glutamate carboxypeptidase. Various alleles show-increased cotyledon number and rate of leaf initiation, show transformation of leaves to cotyledons, altered flowering time and photomorphogenesis and an increased level of cytokinin biosynthesis. Involved in ethylene enhanced hypocotyl elongation in the light. Strong genetic interaction between TGH and AMP1.;Peptidase M28 family protein | Coding gene | HOM004305 ORTHO004919 |
| X |
AT3G54730 | BEST Arabidopsis thaliana protein match is: ovate family protein 9 (TAIR:AT4G04030.1); Has 17 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 8; Viruses - 3; Other Eukaryotes - 2 (source: NCBI BLink). | Coding gene | HOM014114 ORTHO017276 |
| X |
AT3G54740 | Protein of unknown function, DUF593; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF593 (InterPro:IPR007656); BEST Arabidopsis thaliana protein match is: Protein of unknown function, DUF593 (TAIR:AT5G06560.1); Has 386 Blast hits to 371 proteins in 36 species: Archae - 3; Bacteria - 4; Metazoa - 10; Fungi - 3; Plants - 346; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).;Protein of unknown function, DUF593 | Coding gene | HOM004130 ORTHO011115 |
| X |
AT3G54750 | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages. | Coding gene | HOM008386 ORTHO006970 |
| V |
AT3G54760 | dentin sialophosphoprotein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: guard cell, cultured cell; BEST Arabidopsis thaliana protein match is: Tudor/PWWP/MBT superfamily protein (TAIR:AT5G02950.1); Has 25330 Blast hits to 15408 proteins in 1388 species: Archae - 237; Bacteria - 6371; Metazoa - 7552; Fungi - 2715; Plants - 1153; Viruses - 230; Other Eukaryotes - 7072 (source: NCBI BLink).;dentin sialophosphoprotein-related | Coding gene | HOM002883 ORTHO098647 |
| X |
AT3G54770 | RNA-binding (RRM/RBD/RNP motifs) family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: root, gynoecium, carpel, stamen; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G76460.1); Has 10710 Blast hits to 8449 proteins in 510 species: Archae - 0; Bacteria - 384; Metazoa - 5849; Fungi - 946; Plants - 2782; Viruses - 0; Other Eukaryotes - 749 (source: NCBI BLink).;RNA-binding (RRM/RBD/RNP motifs) family protein | Coding gene | HOM000016 ORTHO060386 |
| X |
AT3G54780 | Zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957), von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: Zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G38970.1); Has 4339 Blast hits to 4316 proteins in 749 species: Archae - 84; Bacteria - 1602; Metazoa - 1164; Fungi - 180; Plants - 555; Viruses - 5; Other Eukaryotes - 749 (source: NCBI BLink).;Zinc finger (C3HC4-type RING finger) family protein | Coding gene | HOM000758 ORTHO006908 |
| X |
AT3G54790 | ARM repeat superfamily protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U box domain (InterPro:IPR003613), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: RING/U-box superfamily protein with ARM repeat domain (TAIR:AT2G23140.1); Has 7024 Blast hits to 4442 proteins in 284 species: Archae - 0; Bacteria - 30; Metazoa - 1370; Fungi - 570; Plants - 4306; Viruses - 3; Other Eukaryotes - 745 (source: NCBI BLink).;ARM repeat superfamily protein | Coding gene | HOM000042 ORTHO013722 |
| X |
AT3G54800 | Pleckstrin homology (PH) and lipid-binding START domains-containing protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769), Lipid-binding START (InterPro:IPR002913), Pleckstrin homology-type (InterPro:IPR011993), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: Pleckstrin homology (PH) and lipid-binding START domains-containing protein (TAIR:AT2G28320.1); Has 535 Blast hits to 513 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 63; Fungi - 0; Plants - 352; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).;Pleckstrin homology (PH) and lipid-binding START domains-containing protein | Coding gene | HOM000297 ORTHO005555 |
| X |
AT3G54802 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | Coding gene | singleton |
| X |
AT3G54804 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | Coding gene | singleton |
| X |
AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified.;Plant-specific GATA-type zinc finger transcription factor family protein | Coding gene | HOM000218 ORTHO024895 |
| X |
AT3G54820 | plasma membrane intrinsic protein 2;5 (PIP2;5); FUNCTIONS IN: water channel activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Major intrinsic protein, conserved site (InterPro:IPR022357), Aquaporin (InterPro:IPR012269), Major intrinsic protein (InterPro:IPR000425); BEST Arabidopsis thaliana protein match is: plasma membrane intrinsic protein 2 (TAIR:AT2G37170.1); Has 10866 Blast hits to 10851 proteins in 2236 species: Archae - 80; Bacteria - 5189; Metazoa - 1483; Fungi - 451; Plants - 2536; Viruses - 2; Other Eukaryotes - 1125 (source: NCBI BLink).;plasma membrane intrinsic protein 2;5 | Coding gene | HOM000124 ORTHO024414 |
| X |
AT3G54823 | gypsy-like retrotransposon family, has a 4.4e-203 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);rna_type=other_rna;transposable element gene | Transposon | |
| X |
AT3G54826 | Zim17-type zinc finger protein; CONTAINS InterPro DOMAIN/s: Zinc finger, Zim17-type (InterPro:IPR007853); Has 403 Blast hits to 403 proteins in 183 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 127; Plants - 101; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).;Zim17-type zinc finger protein | Coding gene | HOM002329 ORTHO002416 |
| X |
AT3G54830 | Transmembrane amino acid transporter family protein; CONTAINS InterPro DOMAIN/s: Amino acid transporter, transmembrane (InterPro:IPR013057); BEST Arabidopsis thaliana protein match is: Transmembrane amino acid transporter family protein (TAIR:AT2G39130.1); Has 4642 Blast hits to 4638 proteins in 371 species: Archae - 12; Bacteria - 272; Metazoa - 1629; Fungi - 958; Plants - 1130; Viruses - 3; Other Eukaryotes - 638 (source: NCBI BLink).;Transmembrane amino acid transporter family protein | Coding gene | HOM000557 ORTHO002989 |
| V |
AT3G54840 | Encodes a novel Rab-like GTP-ase that is localized to the peripheral membrane of the endosome.;Ras-related small GTP-binding family protein | Coding gene | HOM000018 ORTHO006971 |
| X |
AT3G54850 | Encodes a protein with a typical U-box domain followed by an Armadillo repeat region, a domain organization that is frequently found in plant U-box proteins. Displays ubiquitin ligase activity in vitro.;plant U-box 14 | Coding gene | HOM000042 ORTHO017763 |
| V |
AT3G54860 | Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis.;Sec1/munc18-like (SM) proteins superfamily | Coding gene | HOM003285 ORTHO002826 |
| V |
AT3G54870 | Armadillo-repeat containing kinesin-related protein. Plays a role during transition to root-hair tip growth.Mutants have short, branched root hairs and an excess of endoplasmic microtubles. Phenotype suggests ARK1 plays a role in modulating microtubule depolymerization during root hair tip growth.;Armadillo/beta-catenin repeat family protein / kinesin motor family protein | Coding gene | HOM000009 ORTHO004475 |
| X |
AT3G54880 | unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25360.2); Has 137 Blast hits to 137 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | Coding gene | HOM003698 ORTHO017764 |
| V |
AT3G54890 | Encodes a component of the light harvesting complex associated with photosystem I.;photosystem I light harvesting complex gene 1 | Coding gene | HOM000039 ORTHO003368 |
| V |
AT3G54900 | A.thaliana PICOT protein.It activates CAX1 gene Calcium transport activity.In other organisms, PICOT proteins appear to play a negative regulatory role in cellular stress responses.;CAX interacting protein 1 | Coding gene | HOM000268 ORTHO002421 |
| X |
AT3G54910 | RNI-like superfamily protein; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box/RNI-like/FBD-like domains-containing protein (TAIR:AT4G10400.2); Has 997 Blast hits to 979 proteins in 15 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 993; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;RNI-like superfamily protein | Coding gene | HOM000308 ORTHO000039 |
| X |
AT3G54920 | Powdery mildew resistant mutant encodes a pectate lyase-like protein;Pectin lyase-like superfamily protein | Coding gene | HOM000339 ORTHO024896 |
| X |
AT3G54925 | Plant self-incompatibility protein S1 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: Plant self-incompatibility protein S1 family (TAIR:AT3G55254.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Plant self-incompatibility protein S1 family | Coding gene | HOM002037 ORTHO000976 |
| V |
AT3G54930 | Protein phosphatase 2A regulatory B subunit family protein; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: chloroplast, protein phosphatase type 2A complex; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: Protein phosphatase 2A regulatory B subunit family protein (TAIR:AT5G03470.1); Has 1209 Blast hits to 1201 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 572; Fungi - 149; Plants - 304; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).;Protein phosphatase 2A regulatory B subunit family protein | Coding gene | HOM000751 ORTHO103538 |
| X |
AT3G54940 | Papain family cysteine protease; FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, sepal, carpel; EXPRESSED DURING: 4 anthesis, C globular stage; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: Papain family cysteine protease (TAIR:AT2G21430.1); Has 7716 Blast hits to 7658 proteins in 713 species: Archae - 63; Bacteria - 225; Metazoa - 3256; Fungi - 4; Plants - 1843; Viruses - 138; Other Eukaryotes - 2187 (source: NCBI BLink).;Papain family cysteine protease | Coding gene | HOM000043 ORTHO024897 |
| X |
AT3G54950 | patatin-like protein 6 (PLA IIIA); CONTAINS InterPro DOMAIN/s: Acyl transferase/acyl hydrolase/lysophospholipase (InterPro:IPR016035), Patatin (InterPro:IPR002641); BEST Arabidopsis thaliana protein match is: PATATIN-like protein 6 (TAIR:AT2G39220.1); Has 1058 Blast hits to 1055 proteins in 202 species: Archae - 0; Bacteria - 325; Metazoa - 24; Fungi - 32; Plants - 544; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink).;patatin-like protein 6 | Coding gene | HOM000851 ORTHO009046 |
| V |
AT3G54960 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response.;PDI-like 1-3 | Coding gene | HOM000077 ORTHO003201 |
| X |
AT3G54970 | D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminotransferase, class IV (InterPro:IPR001544); Has 125 Blast hits to 125 proteins in 56 species: Archae - 2; Bacteria - 46; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).;D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein | Coding gene | HOM004140 ORTHO005625 |
| X |
AT3G54980 | Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: LATERAL ORGAN JUNCTION (TAIR:AT2G39230.1); Has 66577 Blast hits to 14412 proteins in 313 species: Archae - 5; Bacteria - 80; Metazoa - 1084; Fungi - 1336; Plants - 61678; Viruses - 0; Other Eukaryotes - 2394 (source: NCBI BLink).;Pentatricopeptide repeat (PPR) superfamily protein | Coding gene | HOM000003 ORTHO017396 |
| X |
AT3G54990 | Encodes a AP2 domain transcription factor that can repress flowering. SMZ and its paralogous gene, SNARCHZAPFEN (SNZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering.;Integrase-type DNA-binding superfamily protein | Coding gene | HOM000100 ORTHO024417 |
| V |
AT3G55000 | Encodes a protein of unknown function that is involved in cortical microtubule organization. Mutants exhibit abnormal cell growth and patterns of division. TON1A can functionally complement TON1B and their roles appear to be redundant in plants. Encodes a novel protein that is similar to human FOP and OFD1 centrosomal proteins. Localizes to the preprophase band, cytoplasm and cell cortex where it is probably associated with the cortical cytoskeleton. TON1A associates with plant centrins CEN1 and CEN2.;tonneau family protein | Coding gene | HOM007329 ORTHO007871 |
| X |
AT3G55005 | Encodes a protein of unknown function that is involved in cortical microtubule organization. Mutants exhibit abnormal cell growth and patterns of division. TON1B appears to be redundant with TON1A. Encodes a novel protein that is similar to human FOP and OFD1 centrosomal proteins. Localizes to the preprophase band, cytoplasm and cell cortex where it is probably associated with the cortical cytoskeleton. TON1B associates with plant centrin CEN1.;tonneau 1b (TON1b) | Coding gene | HOM007329 ORTHO007871 |
| V |
AT3G55010 | encoding phosphoribosylformylglycinamidine cyclo-ligase (syn. AIR synthetase)that phosphorylates 5-phosphoribosyl-N-formylglycinamidine (FGAM) to form 5-aminoimidazole ribonucleotide (AIR);phosphoribosylformylglycinamidine cyclo-ligase, chloroplast / phosphoribosyl-aminoimidazole synthetase / AIR synthase (PUR5) | Coding gene | HOM001100 ORTHO000282 |
| V |
AT3G55020 | Ypt/Rab-GAP domain of gyp1p superfamily protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: Ypt/Rab-GAP domain of gyp1p superfamily protein (TAIR:AT2G39280.1); Has 8291 Blast hits to 7654 proteins in 526 species: Archae - 15; Bacteria - 632; Metazoa - 4273; Fungi - 1225; Plants - 609; Viruses - 33; Other Eukaryotes - 1504 (source: NCBI BLink).;Ypt/Rab-GAP domain of gyp1p superfamily protein | Coding gene | HOM000248 ORTHO004146 |
| V |
AT3G55030 | Encodes a phosphatidylglycerolphosphate synthase.;phosphatidylglycerolphosphate synthase 2 | Coding gene | HOM001959 ORTHO001300 |
| V |
AT3G55040 | Encodes a member of the lambda family of glutathione transferases. It has thiol transferase activity and self S-glutathionylation activity in vitro.;glutathione transferase lambda 2 | Coding gene | HOM006615 ORTHO013723 |
| X |
AT3G55050 | Protein phosphatase 2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: Protein phosphatase 2C family protein (TAIR:AT3G12620.2); Has 5454 Blast hits to 5450 proteins in 305 species: Archae - 0; Bacteria - 58; Metazoa - 1459; Fungi - 575; Plants - 2427; Viruses - 0; Other Eukaryotes - 935 (source: NCBI BLink).;Protein phosphatase 2C family protein | Coding gene | HOM000585 ORTHO013626 |
| X |
AT3G55060 | unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G39300.2); Has 61765 Blast hits to 33720 proteins in 2065 species: Archae - 846; Bacteria - 6964; Metazoa - 31967; Fungi - 5247; Plants - 3104; Viruses - 205; Other Eukaryotes - 13432 (source: NCBI BLink). | Coding gene | HOM008563 ORTHO009047 |
| V |
AT3G55070 | LisH/CRA/RING-U-box domains-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ran binding protein, CRA domain (InterPro:IPR019589), CTLH, C-terminal LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), Ran binding protein-like, CRA domain (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: LisH/CRA/RING-U-box domains-containing protein (TAIR:AT4G37880.1); Has 891 Blast hits to 870 proteins in 200 species: Archae - 0; Bacteria - 0; Metazoa - 367; Fungi - 300; Plants - 157; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).;LisH/CRA/RING-U-box domains-containing protein | Coding gene | HOM005085 ORTHO005626 |
| X |
AT3G55080 | SET domain-containing protein; CONTAINS InterPro DOMAIN/s: SET domain (InterPro:IPR001214); BEST Arabidopsis thaliana protein match is: Rubisco methyltransferase family protein (TAIR:AT3G07670.1); Has 1136 Blast hits to 1133 proteins in 187 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 329; Plants - 401; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink).;SET domain-containing protein | Coding gene | HOM001533 ORTHO013724 |
| X |
AT3G55090 | ABC-2 type transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: response to cyclopentenone; LOCATED IN: membrane; EXPRESSED IN: sepal, root, flower, carpel, stamen; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC-2 type transporter family protein (TAIR:AT2G39350.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;ABC-2 type transporter family protein | Coding gene | HOM000017 ORTHO002304 |
| X |
AT3G55100 | ABC-2 type transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: membrane; EXPRESSED IN: petal, leaf whorl, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: white-brown complex homolog 19 (TAIR:AT3G55130.1); Has 392721 Blast hits to 356813 proteins in 4114 species: Archae - 7219; Bacteria - 309703; Metazoa - 8988; Fungi - 6487; Plants - 5627; Viruses - 12; Other Eukaryotes - 54685 (source: NCBI BLink).;ABC-2 type transporter family protein | Coding gene | HOM000017 ORTHO002304 |
| X |
AT3G55110 | ABC-2 type transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: white-brown complex homolog 19 (TAIR:AT3G55130.1); Has 385599 Blast hits to 351876 proteins in 4105 species: Archae - 7169; Bacteria - 305821; Metazoa - 8275; Fungi - 6295; Plants - 5429; Viruses - 12; Other Eukaryotes - 52598 (source: NCBI BLink).;ABC-2 type transporter family protein | Coding gene | HOM000017 ORTHO002304 |
| V |
AT3G55120 | Catalyzes the conversion of chalcones into flavanones. Required for the accumulation of purple anthocyanins in leaves and stems.;Chalcone-flavanone isomerase family protein | Coding gene | HOM009544 ORTHO011178 |
| V |
AT3G55130 | Encodes a vacuole localized protein of the ABC transporter White-Brown Complex (WBC) family. When overexpressed in planta, confers resistance to kanamycin.;white-brown complex homolog 19 | Coding gene | HOM000017 ORTHO002304 |
| X |
AT3G55140 | Pectin lyase-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: Pectin lyase-like superfamily protein (TAIR:AT3G09540.1); Has 1866 Blast hits to 1858 proteins in 295 species: Archae - 2; Bacteria - 979; Metazoa - 0; Fungi - 175; Plants - 677; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).;Pectin lyase-like superfamily protein | Coding gene | HOM000339 ORTHO013611 |
| V |
AT3G55150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.;exocyst subunit exo70 family protein H1 | Coding gene | HOM000210 ORTHO006769 |
| X |
AT3G55160 | unknown protein; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2428, death-receptor-like (InterPro:IPR019442); Has 357 Blast hits to 330 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 144; Fungi - 118; Plants - 50; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). | Coding gene | HOM002304 ORTHO003028 |
| V |
AT3G55170 | Ribosomal L29 family protein ; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, cytosolic large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: Ribosomal L29 family protein (TAIR:AT3G09500.1); Has 1329 Blast hits to 1329 proteins in 532 species: Archae - 155; Bacteria - 387; Metazoa - 302; Fungi - 146; Plants - 143; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).;Ribosomal L29 family protein | Coding gene | HOM001740 ORTHO000964 |
| X |
AT3G55180 | alpha/beta-Hydrolases superfamily protein; BEST Arabidopsis thaliana protein match is: alpha/beta-Hydrolases superfamily protein (TAIR:AT2G39400.1); Has 4129 Blast hits to 4129 proteins in 1315 species: Archae - 32; Bacteria - 2874; Metazoa - 141; Fungi - 140; Plants - 467; Viruses - 36; Other Eukaryotes - 439 (source: NCBI BLink).;alpha/beta-Hydrolases superfamily protein | Coding gene | HOM000234 ORTHO004588 |
| X |
AT3G55190 | alpha/beta-Hydrolases superfamily protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: glycerol biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: petal, leaf whorl, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: alpha/beta-Hydrolases superfamily protein (TAIR:AT2G39420.1); Has 3264 Blast hits to 3262 proteins in 1077 species: Archae - 36; Bacteria - 2164; Metazoa - 108; Fungi - 125; Plants - 448; Viruses - 35; Other Eukaryotes - 348 (source: NCBI BLink).;alpha/beta-Hydrolases superfamily protein | Coding gene | HOM000234 ORTHO004588 |
| V |
AT3G55200 | Cleavage and polyadenylation specificity factor (CPSF) A subunit protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: WD40 repeat (InterPro:IPR001680), Cleavage/polyadenylation specificity factor, A subunit, C-terminal (InterPro:IPR004871); BEST Arabidopsis thaliana protein match is: Cleavage and polyadenylation specificity factor (CPSF) A subunit protein (TAIR:AT3G55220.1); Has 1074 Blast hits to 953 proteins in 223 species: Archae - 0; Bacteria - 2; Metazoa - 406; Fungi - 248; Plants - 228; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink).;Cleavage and polyadenylation specificity factor (CPSF) A subunit protein | Coding gene | HOM002009 ORTHO000874 |
| X |
AT3G55210 | NAC domain containing protein 63 (NAC063); CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 93 (TAIR:AT5G39690.1); Has 2524 Blast hits to 2517 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2522; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).;NAC domain containing protein 63 | Coding gene | HOM000052 ORTHO007674 |
| X |
AT3G55220 | Cleavage and polyadenylation specificity factor (CPSF) A subunit protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: WD40 repeat (InterPro:IPR001680), Cleavage/polyadenylation specificity factor, A subunit, C-terminal (InterPro:IPR004871); BEST Arabidopsis thaliana protein match is: Cleavage and polyadenylation specificity factor (CPSF) A subunit protein (TAIR:AT3G55200.1); Has 1074 Blast hits to 953 proteins in 223 species: Archae - 0; Bacteria - 2; Metazoa - 406; Fungi - 248; Plants - 228; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink).;Cleavage and polyadenylation specificity factor (CPSF) A subunit protein | Coding gene | HOM002009 ORTHO000874 |
| X |
AT3G55230 | Disease resistance-responsive (dirigent-like protein) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: defense response; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant disease resistance response protein (InterPro:IPR004265); BEST Arabidopsis thaliana protein match is: Disease resistance-responsive (dirigent-like protein) family protein (TAIR:AT2G39430.1); Has 704 Blast hits to 703 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 700; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Disease resistance-responsive (dirigent-like protein) family protein | Coding gene | HOM005297 ORTHO013504 |
| X |
AT3G55240 | Overexpression leads to PEL (Pseudo-Etiolation in Light) phenotype.;Plant protein 1589 of unknown function | Coding gene | HOM001166 ORTHO024782 |
| V |
AT3G55250 | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 46 Blast hits to 46 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | HOM008112 ORTHO006972 |
| X |
AT3G55252 | Plant self-incompatibility protein S1 family; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: Plant self-incompatibility protein S1 family (TAIR:AT3G55254.1); Has 256 Blast hits to 245 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 256; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Plant self-incompatibility protein S1 family | Coding gene | HOM002037 ORTHO000976 |
| X |
AT3G55254 | Plant self-incompatibility protein S1 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: Plant self-incompatibility protein S1 family (TAIR:AT3G55252.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Plant self-incompatibility protein S1 family | Coding gene | HOM002037 ORTHO000976 |
| X |
AT3G55258 | pseudogene similar to self-incompatibility;pseudogene | Pseudo gene | |
| V |
AT3G55260 | Encodes a protein with β-hexosaminidase activity (the enzyme is active with p-nitrophenyl-β-N-acetylglucosaminide as substrate but displayed only a minor activity toward p-nitrophenyl-β-N-acetylgalactosaminide). The enzyme displays no distinct preference for a specific terminal GlcNAc residue and indeed cleaved the asialoagalactodabsylglycopeptide GnGn to a mixture of products.;beta-hexosaminidase 1 | Coding gene | HOM001151 ORTHO006001 |
| X |
AT3G55270 | MAP kinase phosphatase (MKP1);mitogen-activated protein kinase phosphatase 1 | Coding gene | HOM000337 ORTHO004198 |
| V |
AT3G55280 | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA;ribosomal protein L23AB | Coding gene | HOM001844 ORTHO000784 |
| V |
AT3G55290 | NAD(P)-binding Rossmann-fold superfamily protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Short-chain dehydrogenase/reductase, conserved site (InterPro:IPR020904), NAD(P)-binding domain (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: NAD(P)-binding Rossmann-fold superfamily protein (TAIR:AT3G55310.1); Has 128769 Blast hits to 128555 proteins in 3647 species: Archae - 1021; Bacteria - 82974; Metazoa - 6760; Fungi - 6996; Plants - 3211; Viruses - 5; Other Eukaryotes - 27802 (source: NCBI BLink).;NAD(P)-binding Rossmann-fold superfamily protein | Coding gene | HOM000028 ORTHO006120 |
| X |
AT3G55300 | copia-like retrotransposon family, has a 4.5e-28 P-value blast match to GB:CAA37924 orf 2 (Ty1_Copia-element) (Arabidopsis thaliana);rna_type=other_rna;transposable element gene | Transposon | |
| X |
AT3G55310 | NAD(P)-binding Rossmann-fold superfamily protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: oxidation reduction, fatty acid elongation, unsaturated fatty acid, metabolic process, fatty acid elongation, saturated fatty acid; LOCATED IN: membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Short-chain dehydrogenase/reductase, conserved site (InterPro:IPR020904), NAD(P)-binding domain (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: NAD(P)-binding Rossmann-fold superfamily protein (TAIR:AT3G55290.2); Has 128636 Blast hits to 128424 proteins in 3690 species: Archae - 1019; Bacteria - 82614; Metazoa - 6888; Fungi - 6972; Plants - 3216; Viruses - 5; Other Eukaryotes - 27922 (source: NCBI BLink).;NAD(P)-binding Rossmann-fold superfamily protein | Coding gene | HOM000028 ORTHO006120 |
| X |
AT3G55320 | P-glycoprotein 20 (PGP20); FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: transport, transmembrane transport; LOCATED IN: nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, transmembrane domain, type 1 (InterPro:IPR011527), ABC transporter integral membrane type 1 (InterPro:IPR017940), ABC transporter, transmembrane domain (InterPro:IPR001140); BEST Arabidopsis thaliana protein match is: P-glycoprotein 6 (TAIR:AT2G39480.1); Has 718468 Blast hits to 361578 proteins in 4093 species: Archae - 12537; Bacteria - 570379; Metazoa - 18035; Fungi - 12093; Plants - 8938; Viruses - 13; Other Eukaryotes - 96473 (source: NCBI BLink).;P-glycoprotein 20 | Coding gene | HOM000020 ORTHO011041 |
| V |
AT3G55330 | PsbP-like protein 1 (PPL1); FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); BEST Arabidopsis thaliana protein match is: PsbP-like protein 2 (TAIR:AT2G39470.2); Has 595 Blast hits to 595 proteins in 103 species: Archae - 0; Bacteria - 112; Metazoa - 0; Fungi - 0; Plants - 355; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).;PsbP-like protein 1 | Coding gene | HOM003830 ORTHO004199 |
| X |
AT3G55340 | Plant-specific protein. Interacts with phragmoplastin, Rop1 and Rop2. Involved in cell plate formation.;phragmoplastin interacting protein 1 | Coding gene | HOM003791 ORTHO003542 |
| X |
AT3G55350 | PIF / Ping-Pong family of plant transposases; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Putative harbinger transposase-derived nuclease (InterPro:IPR006912); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G63270.1); Has 1213 Blast hits to 1213 proteins in 135 species: Archae - 0; Bacteria - 2; Metazoa - 520; Fungi - 50; Plants - 592; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).;PIF / Ping-Pong family of plant transposases | Coding gene | HOM002995 ORTHO024898 |
| V |
AT3G55360 | Enoyl-CoA reductase is involved in all very long chain fatty acids (VLCFA) elongation reactions that are required for cuticular wax, storage lipid and sphingolipid metabolism. The protein is located in the ER, but in contrast to its yeast homolog TSC13 is not particularly enriched in the nuclear envelope-vacuole junction. Mutants in this gene show abnormal organ morphology and stem glossiness. Cells in all tissues are only about 1/3 of the size of wild type cells. The morphological changes are most likely to result from the reduction in the VLCFA content of sphingolipids. Mutants also show abnormalities in the endocytic membrane organization and transport.;3-oxo-5-alpha-steroid 4-dehydrogenase family protein | Coding gene | HOM002710 ORTHO002490 |
| X |
AT3G55370 | Encodes a nuclear localized Dof domain containing transcription factor expressed primarily in roots. Responsive to salicylic acid. Transgenic overexpressors have yellow leaves and short, defective roots.;OBF-binding protein 3 | Coding gene | HOM000153 ORTHO017765 |
| X |
AT3G55380 | ubiquitin-conjugating enzyme 14 (UBC14); CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: ubiquitin carrier protein 7 (TAIR:AT5G59300.1).;ubiquitin-conjugating enzyme 14 | Coding gene | HOM000025 ORTHO035613 |
| X |
AT3G55390 | Uncharacterised protein family (UPF0497); CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0497, trans-membrane plant (InterPro:IPR006702), Uncharacterised protein family UPF0497, trans-membrane plant subgroup (InterPro:IPR006459); BEST Arabidopsis thaliana protein match is: Uncharacterised protein family (UPF0497) (TAIR:AT2G38480.1); Has 361 Blast hits to 361 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 361; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Uncharacterised protein family (UPF0497) | Coding gene | HOM009141 ORTHO011193 |
| V |
AT3G55400 | OVULE ABORTION 1 (OVA1); FUNCTIONS IN: methionine-tRNA ligase activity, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: tRNA aminoacylation for protein translation, ovule development; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Methionyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR014758), Aminoacyl-tRNA synthetase, class I (M) (InterPro:IPR015413), Methionyl-tRNA synthetase, class Ia (InterPro:IPR002304), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: methionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative (TAIR:AT4G13780.1); Has 26528 Blast hits to 25030 proteins in 3018 species: Archae - 991; Bacteria - 17017; Metazoa - 429; Fungi - 593; Plants - 193; Viruses - 3; Other Eukaryotes - 7302 (source: NCBI BLink).;methionyl-tRNA synthetase / methionine--tRNA ligase / MetRS (cpMetRS) | Coding gene | HOM001173 ORTHO004430 |
| V |
AT3G55410 | 2-oxoglutarate dehydrogenase, E1 component; FUNCTIONS IN: oxoglutarate dehydrogenase (succinyl-transferring) activity, cobalt ion binding, zinc ion binding; INVOLVED IN: glycolysis, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxoglutarate dehydrogenase, E1 component (InterPro:IPR011603), Dehydrogenase, E1 component (InterPro:IPR001017), Transketolase-like, pyrimidine-binding domain (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate dehydrogenase, E1 component (TAIR:AT5G65750.1); Has 10999 Blast hits to 10962 proteins in 1954 species: Archae - 31; Bacteria - 4409; Metazoa - 546; Fungi - 299; Plants - 167; Viruses - 0; Other Eukaryotes - 5547 (source: NCBI BLink).;2-oxoglutarate dehydrogenase, E1 component | Coding gene | HOM000716 ORTHO000279 |
| X |
AT3G55420 | unknown protein; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | HOM016361 ORTHO024899 |
| X |
AT3G55430 | O-Glycosyl hydrolases family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 17 protein (TAIR:AT2G39640.1); Has 2877 Blast hits to 2804 proteins in 154 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 42; Plants - 2822; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).;O-Glycosyl hydrolases family 17 protein | Coding gene | HOM000056 ORTHO013506 |
| V |
AT3G55440 | Encodes triosephosphate isomerase.;triosephosphate isomerase | Coding gene | HOM000326 ORTHO011194 |
| X |
AT3G55450 | PBS1-like 1 (PBL1); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); BEST Arabidopsis thaliana protein match is: botrytis-induced kinase1 (TAIR:AT2G39660.1).;PBS1-like 1 | Coding gene | HOM000001 ORTHO024418 |
| X |
AT3G55460 | encodes an SC35-like splicing factor that is localized to nuclear specks.;SC35-like splicing factor 30 | Coding gene | HOM000668 ORTHO013725 |
| X |
AT3G55470 | Calcium-dependent lipid-binding (CaLB domain) family protein; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: Calcium-dependent lipid-binding (CaLB domain) family protein (TAIR:AT1G63220.1); Has 2395 Blast hits to 2293 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 1201; Fungi - 119; Plants - 879; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).;Calcium-dependent lipid-binding (CaLB domain) family protein | Coding gene | HOM000697 ORTHO024900 |
| V |
AT3G55480 | protein affected trafficking 2 (PAT2); FUNCTIONS IN: protein transporter activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: Adaptin family protein (TAIR:AT4G23460.1); Has 2490 Blast hits to 1771 proteins in 223 species: Archae - 0; Bacteria - 20; Metazoa - 1008; Fungi - 721; Plants - 224; Viruses - 0; Other Eukaryotes - 517 (source: NCBI BLink).;protein affected trafficking 2 | Coding gene | HOM000431 ORTHO003955 |
| X |
AT3G55485 | rna_type=other_rna | RNA gene | |
| X |
AT3G55490 | GINS complex protein; CONTAINS InterPro DOMAIN/s: GINS complex, subunit Psf3 (InterPro:IPR010492), GINS complex (InterPro:IPR021151); BEST Arabidopsis thaliana protein match is: GINS complex protein (TAIR:AT1G19080.2); Has 336 Blast hits to 336 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 114; Plants - 49; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).;GINS complex protein | Coding gene | HOM004296 ORTHO004055 |
| X |
AT3G55500 | expansin-like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.;expansin A16 | Coding gene | HOM000113 ORTHO007784 |
| X |
AT3G55510 | REBELOTE (RBL); INVOLVED IN: floral meristem determinacy; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0120 (InterPro:IPR005343); BEST Arabidopsis thaliana protein match is: Noc2p family (TAIR:AT2G18220.1); Has 382 Blast hits to 364 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 131; Plants - 77; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).;Noc2p family | Coding gene | HOM001404 ORTHO024901 |
| X |
AT3G55512 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAG;rna_type=mirna;MIR172D; miRNA | RNA gene | |
| X |
AT3G55515 | ROTUNDIFOLIA like 7 (RTFL7); CONTAINS InterPro DOMAIN/s: DVL (InterPro:IPR012552); BEST Arabidopsis thaliana protein match is: ROTUNDIFOLIA like 8 (TAIR:AT2G39705.1); Has 170 Blast hits to 170 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 170; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;ROTUNDIFOLIA like 7 | Coding gene | HOM007023 ORTHO017401 |
| V |
AT3G55520 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: chloroplast thylakoid lumen; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: FKBP-type peptidyl-prolyl cis-trans isomerase family protein (TAIR:AT5G48570.1); Has 8353 Blast hits to 7666 proteins in 1517 species: Archae - 10; Bacteria - 3980; Metazoa - 1950; Fungi - 483; Plants - 752; Viruses - 0; Other Eukaryotes - 1178 (source: NCBI BLink).;FKBP-like peptidyl-prolyl cis-trans isomerase family protein | Coding gene | HOM000040 ORTHO017766 |
| X |
AT3G55530 | Encodes an intracellular membrane localized protein with E3 ligase activity that is involved in regulation of ABA signaling. Loss of function alleles show decreased sensitivity to ABA. Overexpression results in increased sensitivity to ABA.;RING/U-box superfamily protein | Coding gene | HOM000019 ORTHO006973 |
| X |
AT3G55540 | nuclear transport factor 2 (NTF2) family protein; FUNCTIONS IN: protein transporter activity; INVOLVED IN: transport, protein import into nucleus; LOCATED IN: nucleus, intracellular; CONTAINS InterPro DOMAIN/s: Nuclear transport factor 2 (InterPro:IPR002075), Nuclear transport factor 2, Eukaryote (InterPro:IPR018222); BEST Arabidopsis thaliana protein match is: Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain (TAIR:AT1G69250.1); Has 278 Blast hits to 202 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 22; Plants - 247; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).;nuclear transport factor 2 (NTF2) family protein | Coding gene | HOM001048 ORTHO076386 |
| X |
AT3G55550 | Concanavalin A-like lectin protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Legume lectin, beta chain (InterPro:IPR001220), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: Concanavalin A-like lectin protein kinase family protein (TAIR:AT3G53810.1); Has 119390 Blast hits to 117908 proteins in 4651 species: Archae - 98; Bacteria - 13453; Metazoa - 44108; Fungi - 10128; Plants - 34151; Viruses - 398; Other Eukaryotes - 17054 (source: NCBI BLink).;Concanavalin A-like lectin protein kinase family protein | Coding gene | HOM000001 ORTHO024902 |
| V |
AT3G55560 | AT-hook protein of GA feedback 2 (AGF2); INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: AT-hook motif nuclear-localized protein 20 (TAIR:AT4G14465.1); Has 804 Blast hits to 798 proteins in 45 species: Archae - 0; Bacteria - 14; Metazoa - 18; Fungi - 6; Plants - 758; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).;AT-hook protein of GA feedback 2 | Coding gene | HOM000277 ORTHO056684 |
| X |
AT3G55566 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | Coding gene | singleton |
| X |
AT3G55570 | unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G41761.1); Has 128 Blast hits to 128 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 128; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | HOM005697 ORTHO064135 |
| X |
AT3G55573 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | Coding gene | singleton |
| X |
AT3G55580 | Regulator of chromosome condensation (RCC1) family protein; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: Regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G53830.1); Has 20178 Blast hits to 6212 proteins in 476 species: Archae - 78; Bacteria - 2696; Metazoa - 7040; Fungi - 1181; Plants - 2975; Viruses - 2; Other Eukaryotes - 6206 (source: NCBI BLink).;Regulator of chromosome condensation (RCC1) family protein | Coding gene | HOM000037 ORTHO005623 |
| X |
AT3G55590 | Glucose-1-phosphate adenylyltransferase family protein; FUNCTIONS IN: transferase activity, nucleotidyltransferase activity; INVOLVED IN: biosynthetic process; EXPRESSED IN: sperm cell, flower; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Trimeric LpxA-like (InterPro:IPR011004), Bacterial transferase hexapeptide repeat (InterPro:IPR001451), Nucleotidyl transferase (InterPro:IPR005835); BEST Arabidopsis thaliana protein match is: Glucose-1-phosphate adenylyltransferase family protein (TAIR:AT2G39770.2); Has 28049 Blast hits to 28039 proteins in 2988 species: Archae - 1027; Bacteria - 19713; Metazoa - 435; Fungi - 343; Plants - 435; Viruses - 2; Other Eukaryotes - 6094 (source: NCBI BLink).;Glucose-1-phosphate adenylyltransferase family protein | Coding gene | HOM002422 ORTHO004589 |
| X |
AT3G55600 | Membrane fusion protein Use1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vesicle transport protein, Use1 (InterPro:IPR019150); BEST Arabidopsis thaliana protein match is: Membrane fusion protein Use1 (TAIR:AT1G54110.1); Has 235 Blast hits to 235 proteins in 85 species: Archae - 1; Bacteria - 13; Metazoa - 90; Fungi - 42; Plants - 82; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).;Membrane fusion protein Use1 | Coding gene | HOM002954 ORTHO002274 |
| V |
AT3G55605 | Mitochondrial glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: Mitochondrial glycoprotein family protein (TAIR:AT2G39795.1); Has 417 Blast hits to 417 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 121; Plants - 221; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).;Mitochondrial glycoprotein family protein | Coding gene | HOM001001 ORTHO011042 |
| V |
AT3G55610 | encodes delta 1-pyrroline-5-carboxylate synthetase B. Gene expression is induced by dehydration, high salt and ABA. Knock-out mutations in P5CS2 are embryo-lethal. P5CS2 appears to be present in different cells and/or different subcellular locations from P5CS1 in a tissue-dependent manner.;delta 1-pyrroline-5-carboxylate synthase 2 | Coding gene | HOM001811 ORTHO000782 |
| X |
AT3G55620 | embryo defective 1624 (emb1624); FUNCTIONS IN: ribosome binding, translation initiation factor activity; INVOLVED IN: translational initiation, embryo development ending in seed dormancy; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor IF6 (InterPro:IPR002769); BEST Arabidopsis thaliana protein match is: Translation initiation factor IF6 (TAIR:AT2G39820.1); Has 941 Blast hits to 941 proteins in 349 species: Archae - 255; Bacteria - 0; Metazoa - 235; Fungi - 146; Plants - 134; Viruses - 0; Other Eukaryotes - 171 (source: NCBI BLink).;Translation initiation factor IF6 | Coding gene | HOM001904 ORTHO001324 |
| V |
AT3G55630 | DHFS-FPGS homolog D (DFD); CONTAINS InterPro DOMAIN/s: Folylpolyglutamate synthetase, conserved site (InterPro:IPR018109), Mur ligase, central (InterPro:IPR013221), Mur ligase, C-terminal (InterPro:IPR004101), Folylpolyglutamate synthetase (InterPro:IPR001645); BEST Arabidopsis thaliana protein match is: DHFS-FPGS homolog B (TAIR:AT5G05980.2); Has 7708 Blast hits to 7704 proteins in 2536 species: Archae - 43; Bacteria - 4842; Metazoa - 167; Fungi - 350; Plants - 132; Viruses - 0; Other Eukaryotes - 2174 (source: NCBI BLink).;DHFS-FPGS homolog D | Coding gene | HOM000743 ORTHO002687 |
| V |
AT3G55640 | Mitochondrial substrate carrier family protein; FUNCTIONS IN: binding, transporter activity; INVOLVED IN: transport, mitochondrial transport, transmembrane transport; LOCATED IN: mitochondrial inner membrane, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: Mitochondrial substrate carrier family protein (TAIR:AT3G53940.1); Has 29480 Blast hits to 14258 proteins in 460 species: Archae - 0; Bacteria - 2; Metazoa - 12173; Fungi - 9267; Plants - 4909; Viruses - 0; Other Eukaryotes - 3129 (source: NCBI BLink).;Mitochondrial substrate carrier family protein | Coding gene | HOM000008 ORTHO002306 |
| V |
AT3G55646 | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G39855.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | Coding gene | HOM022612 ORTHO024422 |
| V |
AT3G55650 | Pyruvate kinase family protein; FUNCTIONS IN: pyruvate kinase activity, potassium ion binding, magnesium ion binding, catalytic activity; INVOLVED IN: glycolysis; LOCATED IN: mitochondrion; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Pyruvate kinase, C-terminal-like (InterPro:IPR015795), Pyruvate kinase, active site (InterPro:IPR018209), Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), Pyruvate kinase, alpha/beta (InterPro:IPR015794), Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate kinase (InterPro:IPR001697), Pyruvate kinase, barrel (InterPro:IPR015793); BEST Arabidopsis thaliana protein match is: Pyruvate kinase family protein (TAIR:AT3G55810.1); Has 10181 Blast hits to 10077 proteins in 2689 species: Archae - 168; Bacteria - 6004; Metazoa - 548; Fungi - 219; Plants - 542; Viruses - 0; Other Eukaryotes - 2700 (source: NCBI BLink).;Pyruvate kinase family protein | Coding gene | HOM000109 ORTHO000085 |
| V |
AT3G55660 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.;ROP (rho of plants) guanine nucleotide exchange factor 6 | Coding gene | HOM000974 ORTHO039771 |
| X |
AT3G55665 | Plant self-incompatibility protein S1 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: Plant self-incompatibility protein S1 family (TAIR:AT3G55672.1); Has 255 Blast hits to 244 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 255; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Plant self-incompatibility protein S1 family | Coding gene | HOM002037 ORTHO000976 |
| X |
AT3G55670 | CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566); BEST Arabidopsis thaliana protein match is: F-box/RNI-like/FBD-like domains-containing protein (TAIR:AT3G52680.2); Has 400 Blast hits to 249 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 400; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | HOM000308 ORTHO000039 |
| X |
AT3G55672 | Plant self-incompatibility protein S1 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: Plant self-incompatibility protein S1 family (TAIR:AT3G55665.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Plant self-incompatibility protein S1 family | Coding gene | HOM002037 ORTHO000976 |
| X |
AT3G55677 | Plant self-incompatibility protein S1 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: Plant self-incompatibility protein S1 family (TAIR:AT3G55672.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).;Plant self-incompatibility protein S1 family | Coding gene | HOM002037 ORTHO000976 |
| X |
AT3G55680 | Plant invertase/pectin methylesterase inhibitor superfamily protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: pedicel, synergid; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: Plant invertase/pectin methylesterase inhibitor superfamily protein (TAIR:AT2G31430.1); Has 30 Blast hits to 30 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Plant invertase/pectin methylesterase inhibitor superfamily protein | Coding gene | HOM011689 ORTHO013463 |
| X |
AT3G55690 | unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G39870.1); Has 76 Blast hits to 69 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 3; Plants - 69; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | HOM022841 ORTHO024423 |
| X |
AT3G55700 | UDP-Glycosyltransferase superfamily protein; FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-Glycosyltransferase superfamily protein (TAIR:AT3G55710.1); Has 7349 Blast hits to 7304 proteins in 405 species: Archae - 0; Bacteria - 293; Metazoa - 1947; Fungi - 30; Plants - 5000; Viruses - 26; Other Eukaryotes - 53 (source: NCBI BLink).;UDP-Glycosyltransferase superfamily protein | Coding gene | HOM000023 ORTHO003740 |
| X |
AT3G55710 | UDP-Glycosyltransferase superfamily protein; FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-Glycosyltransferase superfamily protein (TAIR:AT3G55700.1); Has 7655 Blast hits to 7604 proteins in 455 species: Archae - 0; Bacteria - 332; Metazoa - 2135; Fungi - 27; Plants - 4985; Viruses - 116; Other Eukaryotes - 60 (source: NCBI BLink).;UDP-Glycosyltransferase superfamily protein | Coding gene | HOM000023 ORTHO003740 |
| X |
AT3G55720 | Protein of unknown function (DUF620); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF620 (InterPro:IPR006873); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF620) (TAIR:AT5G05840.1); Has 215 Blast hits to 214 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 215; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Protein of unknown function (DUF620) | Coding gene | HOM002158 ORTHO017767 |
| X |
AT3G55730 | putative transcription factor MYB109 (MYB109) mRNA,;myb domain protein 109 | Coding gene | HOM000014 ORTHO006004 |
| X |
AT3G55734 | Encodes a microRNA that targets several TIR1/AFB family members and one bHLH family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCCAAAGGGAUCGCAUUGAUCC. Targets are: F-box proteins and bHLH transcription factor. Specifically cleaves AFB3 transcripts, controlling AFB3 mRNA accumulation in roots in response to nitrate exposure.;rna_type=mirna;MIR393B; miRNA | RNA gene | |
| X |
AT3G55735 | tRNA-Met (anticodon: CAT);rna_type=pre-trna;pre-tRNA | RNA gene | |
| X |
AT3G55740 | Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed most highly in the roots.;proline transporter 2 | Coding gene | HOM000191 ORTHO007791 |
| V |
AT3G55750 | Ribosomal protein L35Ae family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, ribosome, cytosolic large ribosomal subunit, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: Ribosomal protein L35Ae family protein (TAIR:AT1G41880.1); Has 763 Blast hits to 763 proteins in 256 species: Archae - 23; Bacteria - 0; Metazoa - 322; Fungi - 146; Plants - 149; Viruses - 0; Other Eukaryotes - 123 (source: NCBI BLink).;Ribosomal protein L35Ae family protein | Coding gene | HOM001329 ORTHO000306 |
| V |
AT3G55760 | unknown protein; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G42430.2); Has 176 Blast hits to 125 proteins in 40 species: Archae - 0; Bacteria - 3; Metazoa - 19; Fungi - 9; Plants - 81; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). | Coding gene | HOM001603 ORTHO003761 |
| X |
AT3G55770 | GATA type zinc finger transcription factor family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, LIM-type (InterPro:IPR001781); BEST Arabidopsis thaliana protein match is: GATA type zinc finger transcription factor family protein (TAIR:AT2G39900.1).;GATA type zinc finger transcription factor family protein | Coding gene | HOM002225 ORTHO017404 |
| X |
AT3G55780 | Glycosyl hydrolase superfamily protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: shoot apex, embryo, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: Glycosyl hydrolase family 17 protein (TAIR:AT3G61810.1); Has 2109 Blast hits to 2094 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 4; Plants - 2095; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).;Glycosyl hydrolase superfamily protein | Coding gene | HOM000056 ORTHO062621 |
| X |
AT3G55790 | unknown protein; Has 698 Blast hits to 549 proteins in 106 species: Archae - 0; Bacteria - 92; Metazoa - 317; Fungi - 24; Plants - 183; Viruses - 2; Other Eukaryotes - 80 (source: NCBI BLink). | Coding gene | singleton |
| X |
AT3G55795 | tRNA-Met (anticodon: CAT);rna_type=pre-trna;pre-tRNA | RNA gene | |
| V |
AT3G55800 | Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type.;sedoheptulose-bisphosphatase | Coding gene | HOM000155 ORTHO001583 |
| X |
AT3G55810 | Pyruvate kinase family protein; FUNCTIONS IN: pyruvate kinase activity, potassium ion binding, magnesium ion binding, catalytic activity; INVOLVED IN: glycolysis; CONTAINS InterPro DOMAIN/s: Pyruvate kinase, C-terminal-like (InterPro:IPR015795), Pyruvate kinase, active site (InterPro:IPR018209), Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), Pyruvate kinase, alpha/beta (InterPro:IPR015794), Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate kinase (InterPro:IPR001697), Pyruvate kinase, barrel (InterPro:IPR015793); BEST Arabidopsis thaliana protein match is: Pyruvate kinase family protein (TAIR:AT3G55650.1); Has 9930 Blast hits to 9886 proteins in 2717 species: Archae - 165; Bacteria - 6026; Metazoa - 534; Fungi - 217; Plants - 529; Viruses - 0; Other Eukaryotes - 2459 (source: NCBI BLink).;Pyruvate kinase family protein | Coding gene | HOM000109 ORTHO000085 |
| X |
AT3G55820 | Fasciclin-like arabinogalactan family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAS1 domain (InterPro:IPR000782); Has 34 Blast hits to 34 proteins in 13 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Fasciclin-like arabinogalactan family protein | Coding gene | HOM014579 ORTHO024903 |
| V |
AT3G55830 | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.;Nucleotide-diphospho-sugar transferases superfamily protein | Coding gene | HOM000819 ORTHO000541 |
| X |
AT3G55840 | Hs1pro-1 protein; CONTAINS InterPro DOMAIN/s: Hs1pro-1, C-terminal (InterPro:IPR009743), Hs1pro-1, N-terminal (InterPro:IPR009869); BEST Arabidopsis thaliana protein match is: ortholog of sugar beet HS1 PRO-1 2 (TAIR:AT2G40000.1); Has 60 Blast hits to 60 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Hs1pro-1 protein | Coding gene | HOM005372 ORTHO005568 |
| V |
AT3G55850 | Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids.;Amidohydrolase family | Coding gene | HOM001208 ORTHO002476 |
| X |
AT3G55860 | unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G60660.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | Coding gene | singleton |
| X |
AT3G55870 | ADC synthase superfamily protein; FUNCTIONS IN: oxo-acid-lyase activity, anthranilate synthase activity; INVOLVED IN: tryptophan biosynthetic process, biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: sepal, male gametophyte, flower, carpel, cultured cell; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Anthranilate synthase component I, N-terminal (InterPro:IPR006805), Chorismate binding, C-terminal (InterPro:IPR015890), ADC synthase (InterPro:IPR005801), Anthranilate synthase component I (InterPro:IPR019999), Anthranilate synthase component I, PabB-like (InterPro:IPR005256); BEST Arabidopsis thaliana protein match is: anthranilate synthase alpha subunit 1 (TAIR:AT5G05730.1); Has 15837 Blast hits to 15836 proteins in 2536 species: Archae - 246; Bacteria - 10713; Metazoa - 5; Fungi - 310; Plants - 185; Viruses - 0; Other Eukaryotes - 4378 (source: NCBI BLink).;ADC synthase superfamily protein | Coding gene | HOM000725 ORTHO002639 |
| X |
AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance.;Alpha/beta hydrolase related protein | Coding gene | HOM001773 ORTHO024425 |
| X |
AT3G55890 | Yippee family putative zinc-binding protein; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: Yippee family putative zinc-binding protein (TAIR:AT2G40110.1); Has 985 Blast hits to 985 proteins in 210 species: Archae - 0; Bacteria - 0; Metazoa - 467; Fungi - 205; Plants - 238; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).;Yippee family putative zinc-binding protein | Coding gene | HOM000928 ORTHO003319 |
| X |
AT3G55900 | F-box family protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810); Has 37 Blast hits to 37 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;F-box family protein | Coding gene | singleton |
| X |
AT3G55910 | unknown protein; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | singleton |
| X |
AT3G55920 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type, conserved site (InterPro:IPR020892); BEST Arabidopsis thaliana protein match is: cyclophilin 5 (TAIR:AT2G29960.1); Has 16458 Blast hits to 16421 proteins in 2673 species: Archae - 109; Bacteria - 6881; Metazoa - 2905; Fungi - 1389; Plants - 1283; Viruses - 4; Other Eukaryotes - 3887 (source: NCBI BLink).;Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein | Coding gene | HOM000021 ORTHO002556 |
| X |
AT3G55930 | Pre-mRNA-splicing factor 3; CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); BEST Arabidopsis thaliana protein match is: Pre-mRNA-splicing factor 3 (TAIR:AT1G28060.1); Has 549 Blast hits to 518 proteins in 205 species: Archae - 0; Bacteria - 10; Metazoa - 155; Fungi - 156; Plants - 71; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink).;Pre-mRNA-splicing factor 3 | Coding gene | HOM002418 ORTHO077513 |
| X |
AT3G55940 | Phosphoinositide-specific phospholipase C family protein; FUNCTIONS IN: phosphoinositide phospholipase C activity, phospholipase C activity, phosphoric diester hydrolase activity; INVOLVED IN: signal transduction, intracellular signaling pathway, lipid metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Phospholipase C, phosphoinositol-specific, EF-hand-like (InterPro:IPR015359), Phospholipase C, phosphatidylinositol-specific , X domain (InterPro:IPR000909), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973), Phospholipase C, phosphoinositol-specific (InterPro:IPR001192), Phospholipase C, phosphatidylinositol-specific, Y domain (InterPro:IPR001711), PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946), C2 membrane targeting protein (InterPro:IPR018029), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: phospholipase C 2 (TAIR:AT3G08510.2); Has 7225 Blast hits to 3392 proteins in 352 species: Archae - 10; Bacteria - 635; Metazoa - 3351; Fungi - 1029; Plants - 675; Viruses - 45; Other Eukaryotes - 1480 (source: NCBI BLink).;Phosphoinositide-specific phospholipase C family protein | Coding gene | HOM000683 ORTHO002019 |
| X |
AT3G55950 | CRINKLY4 related 3 (CCR3); FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CRINKLY4 related 4 (TAIR:AT5G47850.1); Has 117697 Blast hits to 115463 proteins in 4296 species: Archae - 105; Bacteria - 13273; Metazoa - 42642; Fungi - 9844; Plants - 33569; Viruses - 607; Other Eukaryotes - 17657 (source: NCBI BLink).;CRINKLY4 related 3 | Coding gene | HOM000001 ORTHO024904 |
| X |
AT3G55960 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: Haloacid dehalogenase-like hydrolase (HAD) superfamily protein (TAIR:AT1G29780.1); Has 2169 Blast hits to 2162 proteins in 238 species: Archae - 0; Bacteria - 0; Metazoa - 723; Fungi - 425; Plants - 384; Viruses - 0; Other Eukaryotes - 637 (source: NCBI BLink).;Haloacid dehalogenase-like hydrolase (HAD) superfamily protein | Coding gene | HOM000187 ORTHO006220 |
| X |
AT3G55970 | jasmonate-regulated gene 21 (JRG21); FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: oxidation reduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), Oxoglutarate/iron-dependent oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein (TAIR:AT5G05600.1); Has 8809 Blast hits to 8750 proteins in 1005 species: Archae - 0; Bacteria - 1115; Metazoa - 109; Fungi - 1073; Plants - 4993; Viruses - 0; Other Eukaryotes - 1519 (source: NCBI BLink).;jasmonate-regulated gene 21 | Coding gene | HOM000029 ORTHO013620 |
| X |
AT3G55980 | salt-inducible zinc finger 1 (SZF1); CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT2G40140.2); Has 1623 Blast hits to 1414 proteins in 181 species: Archae - 2; Bacteria - 49; Metazoa - 777; Fungi - 32; Plants - 465; Viruses - 2; Other Eukaryotes - 296 (source: NCBI BLink).;salt-inducible zinc finger 1 | Coding gene | HOM000410 ORTHO000673 |
| X |
AT3G55990 | Encodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).;Plant protein of unknown function (DUF828) | Coding gene | HOM000108 ORTHO013509 |
| X |
AT3G56000 | encodes a gene similar to cellulose synthase;cellulose synthase like A14 | Coding gene | HOM000460 ORTHO000385 |
| V |
AT3G56010 | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | singleton |
| V |
AT3G56020 | Ribosomal protein L41 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, cytosolic large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 185 Blast hits to 185 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 88; Fungi - 40; Plants - 48; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).;Ribosomal protein L41 family | Coding gene | singleton |
| X |
AT3G56030 | Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT2G40240.1); Has 15146 Blast hits to 5016 proteins in 154 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 20; Plants - 14896; Viruses - 0; Other Eukaryotes - 172 (source: NCBI BLink).;Tetratricopeptide repeat (TPR)-like superfamily protein | Coding gene | HOM000003 ORTHO024427 |
| V |
AT3G56040 | UDP-glucose pyrophosphorylase 3 (UGP3); FUNCTIONS IN: nucleotidyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UTP--glucose-1-phosphate uridylyltransferase (InterPro:IPR002618); Has 215 Blast hits to 211 proteins in 91 species: Archae - 0; Bacteria - 18; Metazoa - 12; Fungi - 60; Plants - 85; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink).;UDP-glucose pyrophosphorylase 3 | Coding gene | HOM004348 ORTHO004636 |
| X |
AT3G56050 | Protein kinase family protein; FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: Protein kinase family protein (TAIR:AT2G40270.1); Has 41170 Blast hits to 40839 proteins in 1653 species: Archae - 20; Bacteria - 2328; Metazoa - 11695; Fungi - 793; Plants - 23080; Viruses - 152; Other Eukaryotes - 3102 (source: NCBI BLink).;Protein kinase family protein | Coding gene | HOM000001 ORTHO024428 |
| X |
AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein; FUNCTIONS IN: aldehyde-lyase activity, oxidoreductase activity, acting on CH-OH group of donors, FAD binding; INVOLVED IN: alcohol metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Glucose-methanol-choline oxidoreductase, N-terminal (InterPro:IPR000172), Glucose-methanol-choline oxidoreductase (InterPro:IPR012132), Glucose-methanol-choline oxidoreductase, C-terminal (InterPro:IPR007867); BEST Arabidopsis thaliana protein match is: Glucose-methanol-choline (GMC) oxidoreductase family protein (TAIR:AT5G51950.1); Has 10629 Blast hits to 10467 proteins in 1108 species: Archae - 4; Bacteria - 3922; Metazoa - 819; Fungi - 1505; Plants - 305; Viruses - 15; Other Eukaryotes - 4059 (source: NCBI BLink).;Glucose-methanol-choline (GMC) oxidoreductase family protein | Coding gene | HOM002480 ORTHO005472 |
| V |
AT3G56070 | rotamase cyclophilin 2 (ROC2) exhibiting peptidyl-prolyl cis-trans isomerase activity involved in signal transduction.;rotamase cyclophilin 2 | Coding gene | HOM000021 ORTHO011195 |
| X |
AT3G56080 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT2G40280.1); Has 1162 Blast hits to 1119 proteins in 165 species: Archae - 0; Bacteria - 246; Metazoa - 1; Fungi - 5; Plants - 904; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).;S-adenosyl-L-methionine-dependent methyltransferases superfamily protein | Coding gene | HOM000290 ORTHO013510 |
| X |
AT3G56085 | tRNA-Lys (anticodon: CTT);rna_type=pre-trna;pre-tRNA | RNA gene | |
| V |
AT3G56090 | Encodes FERRITIN 3, AtFER3. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool.;ferritin 3 | Coding gene | HOM001161 ORTHO001257 |
| X |
AT3G56100 | Protein kinase expressed in meristematic cells. Phosphorylates AGL24.;meristematic receptor-like kinase | Coding gene | HOM000001 ORTHO006784 |
| V |
AT3G56110 | prenylated RAB acceptor 1.B1 (PRA1.B1); CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: prenylated RAB acceptor 1.B2 (TAIR:AT2G40380.1); Has 577 Blast hits to 577 proteins in 157 species: Archae - 0; Bacteria - 0; Metazoa - 115; Fungi - 114; Plants - 309; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).;prenylated RAB acceptor 1.B1 | Coding gene | HOM000664 ORTHO000812 |
| X |
AT3G56120 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function Met10 (InterPro:IPR003402); BEST Arabidopsis thaliana protein match is: Met-10+ like family protein (TAIR:AT4G27340.1); Has 1391 Blast hits to 1232 proteins in 427 species: Archae - 416; Bacteria - 202; Metazoa - 266; Fungi - 150; Plants - 114; Viruses - 0; Other Eukaryotes - 243 (source: NCBI BLink).;S-adenosyl-L-methionine-dependent methyltransferases superfamily protein | Coding gene | HOM000621 ORTHO001123 |
| V |
AT3G56130 | biotin/lipoyl attachment domain-containing protein; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089), Galactose-binding domain-like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: Single hybrid motif superfamily protein (TAIR:AT1G52670.1); Has 2050 Blast hits to 2050 proteins in 795 species: Archae - 23; Bacteria - 1613; Metazoa - 0; Fungi - 2; Plants - 110; Viruses - 0; Other Eukaryotes - 302 (source: NCBI BLink).;biotin/lipoyl attachment domain-containing protein | Coding gene | HOM005369 ORTHO075884 |
| V |
AT3G56140 | Protein of unknown function (DUF399 and DUF3411); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF399 (InterPro:IPR007314), Protein of unknown function DUF3411 (InterPro:IPR021825); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF399 and DUF3411) (TAIR:AT2G40400.2); Has 538 Blast hits to 538 proteins in 131 species: Archae - 0; Bacteria - 182; Metazoa - 33; Fungi - 6; Plants - 279; Viruses - 6; Other Eukaryotes - 32 (source: NCBI BLink).;Protein of unknown function (DUF399 and DUF3411) | Coding gene | HOM000568 ORTHO009048 |
| V |
AT3G56150 | member of eIF3c - eukaryotic initiation factor 3c;eukaryotic translation initiation factor 3C | Coding gene | HOM001310 ORTHO000621 |
| V |
AT3G56160 | Sodium Bile acid symporter family; FUNCTIONS IN: bile acid:sodium symporter activity; INVOLVED IN: sodium ion transport; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bile acid:sodium symporter (InterPro:IPR002657); Has 3096 Blast hits to 3087 proteins in 1049 species: Archae - 42; Bacteria - 2090; Metazoa - 108; Fungi - 101; Plants - 149; Viruses - 0; Other Eukaryotes - 606 (source: NCBI BLink).;Sodium Bile acid symporter family | Coding gene | HOM001790 ORTHO001264 |
| X |
AT3G56170 | Encodes a calcium-dependent nuclease with similarity to staphylococcal nuclease.;Ca-2+ dependent nuclease | Coding gene | HOM004521 ORTHO013513 |
| X |
AT3G56180 | Protein of unknown function (DUF567); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF567 (InterPro:IPR007612); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF567) (TAIR:AT3G10986.1); Has 252 Blast hits to 250 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 250; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Protein of unknown function (DUF567) | Coding gene | HOM002732 ORTHO024625 |
| V |
AT3G56190 | Encodes one of two alpha-SNAPs (soluble NSF attachment protein) in Arabidopsis;alpha-soluble NSF attachment protein 2 | Coding gene | HOM001576 ORTHO000832 |
| X |
AT3G56200 | Encodes a putative amino acid transporter.;Transmembrane amino acid transporter family protein | Coding gene | HOM000970 ORTHO024430 |
| X |
AT3G56210 | ARM repeat superfamily protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024).;ARM repeat superfamily protein | Coding gene | HOM016564 ORTHO017768 |
| X |
AT3G56220 | transcription regulators; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: regulation of transcription; CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40435.1); Has 248 Blast hits to 248 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 248; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;transcription regulators | Coding gene | HOM006297 ORTHO011045 |
| X |
AT3G56230 | BTB/POZ domain-containing protein; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: BTB/POZ domain-containing protein (TAIR:AT1G01640.2); Has 5225 Blast hits to 5141 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 3910; Fungi - 3; Plants - 1048; Viruses - 41; Other Eukaryotes - 223 (source: NCBI BLink).;BTB/POZ domain-containing protein | Coding gene | HOM006586 ORTHO011196 |
| V |
AT3G56240 | CCH protein belongs to a family of eukaryotic proteins that participate in intracellular copper homeostasis by delivering this metal to the secretory pathway; mainly located along the vascular bundles of senescing leaves and petioles as well as in stem sieve elements; hypothesized to have a role in copper mobilization from decaying organs towards reproductive structures, as a result of metalloprotein breakdown. The plant-specific C-terminal domain of the CCH protein forms amyloid-like fibrils in vitro.;copper chaperone | Coding gene | HOM000278 ORTHO084359 |
| X |
AT3G56250 | unknown protein; Has 109 Blast hits to 83 proteins in 41 species: Archae - 0; Bacteria - 6; Metazoa - 18; Fungi - 20; Plants - 21; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink). | Coding gene | singleton |
| X |
AT3G56260 | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40475.1). | Coding gene | singleton |
| X |
AT3G56270 | Plant protein of unknown function (DUF827); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: Plant protein of unknown function (DUF827) (TAIR:AT2G40480.1); Has 221 Blast hits to 221 proteins in 41 species: Archae - 2; Bacteria - 8; Metazoa - 49; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).;Plant protein of unknown function (DUF827) | Coding gene | HOM022377 ORTHO024431 |
| X |
AT3G56275 | pseudogene of unknown protein;pseudogene | Pseudo gene | |
| X |
AT3G56277 | copia-like retrotransposon family, has a 4.6e-16 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);rna_type=other_rna;transposable element gene | Transposon | |
| X |
AT3G56280 | pseudogene, protein kinase family, contains protein kinase domain, Pfam:PF00069; blastp match of 44% identity and 9.2e-11 P-value to GP|3947676|emb|CAA21067.1||AL031652 dJ1119D9.1 (PAK5 (KIAA1264) (P21-Rho-binding domain containing serine/threonine protein kinase)) {Homo sapiens};pseudogene | Pseudo gene | |
| X |
AT3G56290 | unknown protein; Has 39 Blast hits to 39 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | HOM009645 ORTHO006221 |
| X |
AT3G56300 | Cysteinyl-tRNA synthetase, class Ia family protein; FUNCTIONS IN: cysteine-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: cysteinyl-tRNA aminoacylation, translation; LOCATED IN: cytoplasm; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cysteinyl-tRNA synthetase, class Ia (InterPro:IPR002308), Cysteinyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015803), Cysteinyl-tRNA synthetase, class Ia, C-terminal (InterPro:IPR015804); BEST Arabidopsis thaliana protein match is: Cysteinyl-tRNA synthetase, class Ia family protein (TAIR:AT5G38830.1); Has 11222 Blast hits to 10904 proteins in 2870 species: Archae - 213; Bacteria - 6026; Metazoa - 414; Fungi - 276; Plants - 133; Viruses - 3; Other Eukaryotes - 4157 (source: NCBI BLink).;Cysteinyl-tRNA synthetase, class Ia family protein | Coding gene | HOM000547 ORTHO024905 |
| V |
AT3G56310 | Melibiase family protein; FUNCTIONS IN: alpha-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process, lactose catabolic process; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Glycoside hydrolase, family 27 (InterPro:IPR002241), Glycoside hydrolase, clan GH-D (InterPro:IPR000111), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: alpha-galactosidase 2 (TAIR:AT5G08370.1); Has 1574 Blast hits to 1565 proteins in 338 species: Archae - 4; Bacteria - 582; Metazoa - 329; Fungi - 273; Plants - 224; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink).;Melibiase family protein | Coding gene | HOM001215 ORTHO003904 |
| V |
AT3G56320 | PAP/OAS1 substrate-binding domain superfamily; FUNCTIONS IN: nucleotidyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Nucleotidyl transferase domain (InterPro:IPR002934), PAP/25A-associated (InterPro:IPR002058); BEST Arabidopsis thaliana protein match is: Nucleotidyltransferase family protein (TAIR:AT2G40520.4); Has 391 Blast hits to 365 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 57; Fungi - 102; Plants - 177; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).;PAP/OAS1 substrate-binding domain superfamily | Coding gene | HOM001479 ORTHO024432 |
| X |
AT3G56330 | N2,N2-dimethylguanosine tRNA methyltransferase; FUNCTIONS IN: RNA binding, tRNA (guanine-N2-)-methyltransferase activity; INVOLVED IN: tRNA processing; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: N2,N2-dimethylguanosine tRNA methyltransferase (InterPro:IPR002905); BEST Arabidopsis thaliana protein match is: N2,N2-dimethylguanosine tRNA methyltransferase (TAIR:AT5G15810.1); Has 951 Blast hits to 937 proteins in 347 species: Archae - 257; Bacteria - 66; Metazoa - 191; Fungi - 140; Plants - 103; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink).;N2,N2-dimethylguanosine tRNA methyltransferase | Coding gene | HOM004525 ORTHO004637 |
| V |
AT3G56340 | Ribosomal protein S26e family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: Ribosomal protein S26e family protein (TAIR:AT2G40510.1); Has 761 Blast hits to 761 proteins in 271 species: Archae - 53; Bacteria - 0; Metazoa - 311; Fungi - 152; Plants - 116; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink).;Ribosomal protein S26e family protein | Coding gene | HOM001419 ORTHO000507 |
| V |
AT3G56350 | Iron/manganese superoxide dismutase family protein; FUNCTIONS IN: superoxide dismutase activity, metal ion binding; INVOLVED IN: oxidation reduction, superoxide metabolic process, removal of superoxide radicals; LOCATED IN: mitochondrion, endomembrane system; EXPRESSED IN: male gametophyte, seed; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Manganese/iron superoxide dismutase, N-terminal (InterPro:IPR019831), Manganese/iron superoxide dismutase (InterPro:IPR001189), Manganese/iron superoxide dismutase, C-terminal (InterPro:IPR019832), Manganese/iron superoxide dismutase, binding site (InterPro:IPR019833); BEST Arabidopsis thaliana protein match is: manganese superoxide dismutase 1 (TAIR:AT3G10920.1); Has 11272 Blast hits to 11271 proteins in 3338 species: Archae - 194; Bacteria - 7997; Metazoa - 445; Fungi - 707; Plants - 423; Viruses - 1; Other Eukaryotes - 1505 (source: NCBI BLink).;Iron/manganese superoxide dismutase family protein | Coding gene | HOM000363 ORTHO090710 |
| V |
AT3G56360 | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G05250.1); Has 45 Blast hits to 45 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | HOM008581 ORTHO017769 |
| X |
AT3G56370 | Leucine-rich repeat protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: Leucine-rich receptor-like protein kinase family protein (TAIR:AT5G01890.1); Has 218234 Blast hits to 138588 proteins in 4594 species: Archae - 166; Bacteria - 19582; Metazoa - 73931; Fungi - 10568; Plants - 87830; Viruses - 425; Other Eukaryotes - 25732 (source: NCBI BLink).;Leucine-rich repeat protein kinase family protein | Coding gene | HOM000001 ORTHO006204 |
| X |
AT3G56380 | response regulator 17;response regulator 17 | Coding gene | HOM000464 ORTHO024433 |
| X |
AT3G56390 | BEST Arabidopsis thaliana protein match is: WRKY DNA-binding protein 55 (TAIR:AT2G40740.2); Has 12 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | singleton |
| X |
AT3G56400 | member of WRKY Transcription Factor; Group III. Function as activator of SA-dependent defense genes and a repressor of JA-regulated genes. WRKY70-controlled suppression of JA-signaling is partly executed by NPR1.;WRKY DNA-binding protein 70 | Coding gene | HOM000054 ORTHO024435 |
| X |
AT3G56408 | Potential natural antisense gene, locus overlaps with AT3G56410;rna_type=other_rna;other RNA | RNA gene | |
| V |
AT3G56410 | Protein of unknown function (DUF3133); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF3133 (InterPro:IPR021480); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF3133) (TAIR:AT5G05190.1); Has 4873 Blast hits to 3554 proteins in 469 species: Archae - 21; Bacteria - 552; Metazoa - 1496; Fungi - 390; Plants - 373; Viruses - 48; Other Eukaryotes - 1993 (source: NCBI BLink).;Protein of unknown function (DUF3133) | Coding gene | HOM004448 ORTHO083630 |
| X |
AT3G56420 | Thioredoxin superfamily protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin domain (InterPro:IPR013766), Thioredoxin, conserved site (InterPro:IPR017937), Thioredoxin-like subdomain (InterPro:IPR006662), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: C-terminal cysteine residue is changed to a serine 2 (TAIR:AT2G40790.1); Has 16726 Blast hits to 16570 proteins in 2924 species: Archae - 262; Bacteria - 9349; Metazoa - 1819; Fungi - 717; Plants - 1411; Viruses - 13; Other Eukaryotes - 3155 (source: NCBI BLink).;Thioredoxin superfamily protein | Coding gene | HOM000250 ORTHO024436 |
| V |
AT3G56430 | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40800.1); Has 3121 Blast hits to 1477 proteins in 196 species: Archae - 12; Bacteria - 170; Metazoa - 996; Fungi - 324; Plants - 132; Viruses - 59; Other Eukaryotes - 1428 (source: NCBI BLink). | Coding gene | HOM005636 ORTHO004590 |
| X |
AT3G56440 | homolog of yeast autophagy 18 (ATG18) D (ATG18D); CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); BEST Arabidopsis thaliana protein match is: homolog of yeast autophagy 18C (TAIR:AT2G40810.2); Has 1451 Blast hits to 1383 proteins in 243 species: Archae - 0; Bacteria - 34; Metazoa - 579; Fungi - 434; Plants - 212; Viruses - 2; Other Eukaryotes - 190 (source: NCBI BLink).;homolog of yeast autophagy 18 (ATG18) D | Coding gene | HOM000579 ORTHO024437 |
| V |
AT3G56450 | member of alpha-SNAP Gene Family;alpha-soluble NSF attachment protein 1 | Coding gene | HOM001576 ORTHO073641 |
| V |
AT3G56460 | GroES-like zinc-binding alcohol dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding domain (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, C-terminal (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G21580.1); Has 42737 Blast hits to 42567 proteins in 2748 species: Archae - 582; Bacteria - 27121; Metazoa - 1964; Fungi - 3760; Plants - 1452; Viruses - 3; Other Eukaryotes - 7855 (source: NCBI BLink).;GroES-like zinc-binding alcohol dehydrogenase family protein | Coding gene | HOM000860 ORTHO004438 |
| X |
AT3G56470 | F-box family protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G57790.1); Has 460 Blast hits to 453 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 460; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;F-box family protein | Coding gene | HOM005171 ORTHO006107 |
| X |
AT3G56480 | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40820.1); Has 486 Blast hits to 458 proteins in 133 species: Archae - 0; Bacteria - 70; Metazoa - 142; Fungi - 25; Plants - 111; Viruses - 1; Other Eukaryotes - 137 (source: NCBI BLink).;myosin heavy chain-related | Coding gene | HOM004855 ORTHO005551 |
| V |
AT3G56490 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro.;HIS triad family protein 3 | Coding gene | HOM001531 ORTHO000829 |
| X |
AT3G56500 | serine-rich protein-related; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24577.1); Has 135 Blast hits to 133 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 135; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;serine-rich protein-related | Coding gene | singleton |
| X |
AT3G56510 | RNA-binding (RRM/RBD/RNP motifs) family protein; FUNCTIONS IN: TATA-binding protein binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504); Has 528 Blast hits to 522 proteins in 214 species: Archae - 0; Bacteria - 2; Metazoa - 211; Fungi - 183; Plants - 47; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).;RNA-binding (RRM/RBD/RNP motifs) family protein | Coding gene | HOM002244 ORTHO001313 |
| X |
AT3G56520 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein; FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 95 (TAIR:AT5G41090.1); Has 1738 Blast hits to 1735 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1738; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;NAC (No Apical Meristem) domain transcriptional regulator superfamily protein | Coding gene | HOM000052 ORTHO024906 |
| X |
AT3G56530 | NAC domain containing protein 64 (NAC064); CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 93 (TAIR:AT5G39690.1); Has 2590 Blast hits to 2582 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2590; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;NAC domain containing protein 64 | Coding gene | HOM000052 ORTHO007674 |
| X |
AT3G56540 | alpha/beta-Hydrolases superfamily protein; FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: pollen tube; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: serine carboxypeptidase-like 39 (TAIR:AT3G52020.1); Has 3496 Blast hits to 3462 proteins in 393 species: Archae - 0; Bacteria - 271; Metazoa - 619; Fungi - 840; Plants - 1342; Viruses - 0; Other Eukaryotes - 424 (source: NCBI BLink).;alpha/beta-Hydrolases superfamily protein | Coding gene | HOM000060 ORTHO099065 |
| X |
AT3G56550 | Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT4G21065.1); Has 30639 Blast hits to 12981 proteins in 201 species: Archae - 0; Bacteria - 4; Metazoa - 34; Fungi - 22; Plants - 30256; Viruses - 0; Other Eukaryotes - 323 (source: NCBI BLink).;Pentatricopeptide repeat (PPR) superfamily protein | Coding gene | HOM000003 ORTHO059438 |
| X |
AT3G56560 | NAC domain containing protein 65 (NAC065); FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 63 (TAIR:AT3G55210.1); Has 1722 Blast hits to 1720 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1722; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;NAC domain containing protein 65 | Coding gene | HOM018442 ORTHO007674 |
| X |
AT3G56570 | SET domain-containing protein; CONTAINS InterPro DOMAIN/s: RuBisCO-cytochrome methylase, RMS1 (InterPro:IPR011383); BEST Arabidopsis thaliana protein match is: Rubisco methyltransferase family protein (TAIR:AT1G14030.1); Has 25210 Blast hits to 12491 proteins in 636 species: Archae - 52; Bacteria - 1284; Metazoa - 10981; Fungi - 2786; Plants - 1267; Viruses - 743; Other Eukaryotes - 8097 (source: NCBI BLink).;SET domain-containing protein | Coding gene | HOM001769 ORTHO003369 |
| X |
AT3G56580 | RING/U-box superfamily protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); BEST Arabidopsis thaliana protein match is: RING-H2 finger C1A (TAIR:AT2G40830.3); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).;RING/U-box superfamily protein | Coding gene | HOM000141 ORTHO013514 |
| X |
AT3G56590 | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G10810.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;hydroxyproline-rich glycoprotein family protein | Coding gene | HOM007306 ORTHO013618 |
| X |
AT3G56600 | Protein kinase superfamily protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: biological_process unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3-/4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphoinositide 4-kinase gamma 1 (TAIR:AT2G40850.1); Has 560 Blast hits to 550 proteins in 149 species: Archae - 0; Bacteria - 2; Metazoa - 131; Fungi - 73; Plants - 265; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink).;Protein kinase superfamily protein | Coding gene | HOM000670 ORTHO024438 |
| X |
AT3G56610 | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, sperm cell, sepal, pedicel, synergid; EXPRESSED DURING: 4 anthesis, C globular stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF784, Arabidopsis thaliana (InterPro:IPR008502); Has 5 Blast hits to 5 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | singleton |
| X |
AT3G56620 | nodulin MtN21 /EamA-like transporter family protein; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 /EamA-like transporter family protein (TAIR:AT2G40900.1); Has 3973 Blast hits to 3961 proteins in 822 species: Archae - 18; Bacteria - 2149; Metazoa - 8; Fungi - 0; Plants - 1241; Viruses - 0; Other Eukaryotes - 557 (source: NCBI BLink).;nodulin MtN21 /EamA-like transporter family protein | Coding gene | HOM000127 ORTHO024439 |
| X |
AT3G56630 | member of CYP94D;cytochrome P450, family 94, subfamily D, polypeptide 2 | Coding gene | HOM000174 ORTHO013194 |
| V |
AT3G56640 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion.;exocyst complex component sec15A | Coding gene | HOM003497 ORTHO004200 |
| V |
AT3G56650 | Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid lumen, chloroplast stroma, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); BEST Arabidopsis thaliana protein match is: Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein (TAIR:AT1G77090.1); Has 131 Blast hits to 131 proteins in 35 species: Archae - 0; Bacteria - 29; Metazoa - 0; Fungi - 0; Plants - 100; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).;Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein | Coding gene | HOM004437 ORTHO004638 |
| X |
AT3G56660 | basic region/leucine zipper motif protein 49 (BZIP49); FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: Basic-leucine zipper (bZIP) transcription factor family protein (TAIR:AT2G40950.1); Has 954 Blast hits to 954 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 362; Fungi - 142; Plants - 326; Viruses - 0; Other Eukaryotes - 124 (source: NCBI BLink).;basic region/leucine zipper motif protein 49 | Coding gene | HOM004906 ORTHO005570 |
| X |
AT3G56670 | BEST Arabidopsis thaliana protein match is: F-box and associated interaction domains-containing protein (TAIR:AT1G32420.1); Has 58 Blast hits to 47 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | HOM000136 ORTHO000012 |
| X |
AT3G56680 | Single-stranded nucleic acid binding R3H protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Single-stranded nucleic acid binding R3H (InterPro:IPR001374); BEST Arabidopsis thaliana protein match is: Single-stranded nucleic acid binding R3H protein (TAIR:AT2G40960.1); Has 389 Blast hits to 389 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 196; Fungi - 53; Plants - 134; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).;Single-stranded nucleic acid binding R3H protein | Coding gene | HOM005801 ORTHO006911 |
| V |
AT3G56690 | encodes a protein similar to ATPases and binds to calmodulin in vitro. This is a single-copy gene and is expressed in all tissues examined.;Cam interacting protein 111 | Coding gene | HOM000006 ORTHO004201 |
| V |
AT3G56700 | fatty acid reductase 6 (FAR6); FUNCTIONS IN: fatty-acyl-CoA reductase (alcohol-forming) activity, oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor; INVOLVED IN: microsporogenesis, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: inflorescence meristem, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Male sterility (InterPro:IPR004262), NAD(P)-binding domain (InterPro:IPR016040), Male sterility, NAD-binding (InterPro:IPR013120); BEST Arabidopsis thaliana protein match is: Jojoba acyl CoA reductase-related male sterility protein (TAIR:AT3G11980.1); Has 2302 Blast hits to 2276 proteins in 434 species: Archae - 2; Bacteria - 606; Metazoa - 984; Fungi - 228; Plants - 282; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink).;fatty acid reductase 6 | Coding gene | HOM001140 ORTHO088713 |
| X |
AT3G56705 | gi|17665|emb|X52312.1|ATU26 Arabidopsis thaliana U2.6 snRNA gene for U2 snRNA;rna_type=snrna;U2.6; snRNA | RNA gene | |
| V |
AT3G56710 | Sig1 binding protein; interacts with Sig1R4. As well as Sig1, SibI is imported into chloroplasts and its expression is light-dependent in mature chloroplasts.;sigma factor binding protein 1 | Coding gene | HOM022364 ORTHO024443 |
| X |
AT3G56720 | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages. | Coding gene | singleton |
| X |
AT3G56730 | Putative endonuclease or glycosyl hydrolase; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: Putative endonuclease or glycosyl hydrolase (TAIR:AT3G62050.1).;Putative endonuclease or glycosyl hydrolase | Coding gene | HOM001842 ORTHO065660 |
| X |
AT3G56740 | Ubiquitin-associated (UBA) protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Der1-like (InterPro:IPR007599), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: Ubiquitin-associated (UBA) protein (TAIR:AT2G41160.1); Has 305 Blast hits to 304 proteins in 119 species: Archae - 6; Bacteria - 5; Metazoa - 77; Fungi - 99; Plants - 90; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).;Ubiquitin-associated (UBA) protein | Coding gene | HOM002746 ORTHO003322 |
| V |
AT3G56750 | unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41150.2); Has 128 Blast hits to 128 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). | Coding gene | HOM009726 ORTHO009051 |
| X |
AT3G56760 | Protein kinase superfamily protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium-dependent protein kinase (InterPro:IPR020642), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636); BEST Arabidopsis thaliana protein match is: CDPK-related kinase 1 (TAIR:AT2G41140.1); Has 115971 Blast hits to 114244 proteins in 3013 species: Archae - 152; Bacteria - 14469; Metazoa - 43130; Fungi - 12702; Plants - 24192; Viruses - 490; Other Eukaryotes - 20836 (source: NCBI BLink).;Protein kinase superfamily protein | Coding gene | HOM000002 ORTHO002266 |
| X |
AT3G56770 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein; FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: response to chitin, regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT2G41130.1); Has 549 Blast hits to 549 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 8; Plants - 532; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).;basic helix-loop-helix (bHLH) DNA-binding superfamily protein | Coding gene | HOM003847 ORTHO024442 |
| X |
AT3G56780 | FBD, F-box and Leucine Rich Repeat domains containing protein; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box/RNI-like/FBD-like domains-containing protein (TAIR:AT5G56420.2); Has 1624 Blast hits to 1516 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 44; Fungi - 2; Plants - 1574; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).;FBD, F-box and Leucine Rich Repeat domains containing protein | Coding gene | HOM000308 ORTHO000039 |
| X |
AT3G56790 | RNA splicing factor-related; CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); BEST Arabidopsis thaliana protein match is: Pre-mRNA-splicing factor 3 (TAIR:AT3G55930.1); Has 356 Blast hits to 326 proteins in 158 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 116; Plants - 74; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).;RNA splicing factor-related | Coding gene | HOM002418 ORTHO061565 |
| V |
AT3G56800 | encodes a calmodulin;calmodulin 3 | Coding gene | HOM000031 ORTHO000300 |
| V |
AT3G56810 | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | singleton |
| X |
AT3G56820 | unknown protein; Has 34 Blast hits to 34 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). | Coding gene | HOM011699 ORTHO013726 |
| X |
AT3G56825 | gi|17663|emb|X06475.1|ATU24 Arabidopsis thaliana U2 RNA gene (U2.4);rna_type=snrna;U2.4; snRNA | RNA gene | |
| V |
AT3G56830 | Similar in sequence to NPQ6 and NPQ7, but loss of function mutant does not exhibit a nonphotochemical quenching phenotype.;Protein of unknown function (DUF565) | Coding gene | HOM008686 ORTHO024907 |
| X |
AT3G56840 | FAD-dependent oxidoreductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD dependent oxidoreductase (InterPro:IPR006076); Has 4748 Blast hits to 4741 proteins in 1463 species: Archae - 76; Bacteria - 3210; Metazoa - 112; Fungi - 136; Plants - 47; Viruses - 1; Other Eukaryotes - 1166 (source: NCBI BLink).;FAD-dependent oxidoreductase family protein | Coding gene | HOM002797 ORTHO003370 |
| X |
AT3G56850 | Encodes an ABA-responsive element binding protein with a bZIP domain. Located in the nucleus and expressed in the embryo during seed maturation.;ABA-responsive element binding protein 3 | Coding gene | HOM001314 ORTHO013515 |
| X |
AT3G56860 | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.;UBP1-associated protein 2A | Coding gene | HOM000016 ORTHO011047 |
| X |
AT3G56870 | unknown protein; Has 204 Blast hits to 201 proteins in 58 species: Archae - 0; Bacteria - 10; Metazoa - 72; Fungi - 8; Plants - 41; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). | Coding gene | HOM022805 ORTHO024908 |
| X |
AT3G56880 | VQ motif-containing protein; CONTAINS InterPro DOMAIN/s: VQ (InterPro:IPR008889); BEST Arabidopsis thaliana protein match is: calmodulin (CAM)-binding protein of 25 kDa (TAIR:AT2G41010.1); Has 109 Blast hits to 109 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 106; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;VQ motif-containing protein | Coding gene | HOM018431 ORTHO024440 |
| X |
AT3G56890 | F-box associated ubiquitination effector family protein; CONTAINS InterPro DOMAIN/s: F-box associated domain, type 3 (InterPro:IPR013187), F-box associated interaction domain (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box and associated interaction domains-containing protein (TAIR:AT3G57580.1); Has 494 Blast hits to 482 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 494; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;F-box associated ubiquitination effector family protein | Coding gene | HOM000136 ORTHO000012 |
| X |
AT3G56891 | Heavy metal transport/detoxification superfamily protein ; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121), Heavy-metal-associated, conserved site (InterPro:IPR017969); BEST Arabidopsis thaliana protein match is: Heavy metal transport/detoxification superfamily protein (TAIR:AT2G18196.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Heavy metal transport/detoxification superfamily protein | Coding gene | HOM000278 ORTHO024909 |
| X |
AT3G56900 | Transducin/WD40 repeat-like superfamily protein; CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); Has 4015 Blast hits to 2516 proteins in 309 species: Archae - 52; Bacteria - 1176; Metazoa - 1329; Fungi - 813; Plants - 363; Viruses - 0; Other Eukaryotes - 282 (source: NCBI BLink).;Transducin/WD40 repeat-like superfamily protein | Coding gene | HOM005302 ORTHO004202 |
| V |
AT3G56910 | plastid-specific 50S ribosomal protein 5 (PSRP5); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 42 Blast hits to 42 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;plastid-specific 50S ribosomal protein 5 | Coding gene | singleton |
| X |
AT3G56920 | DHHC-type zinc finger family protein; FUNCTIONS IN: zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: DHHC-type zinc finger family protein (TAIR:AT2G40990.1); Has 5096 Blast hits to 5086 proteins in 252 species: Archae - 0; Bacteria - 0; Metazoa - 2197; Fungi - 759; Plants - 834; Viruses - 0; Other Eukaryotes - 1306 (source: NCBI BLink).;DHHC-type zinc finger family protein | Coding gene | HOM000058 ORTHO017416 |
| X |
AT3G56930 | DHHC-type zinc finger family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: DHHC-type zinc finger family protein (TAIR:AT5G05070.1); Has 5165 Blast hits to 5156 proteins in 254 species: Archae - 0; Bacteria - 0; Metazoa - 2209; Fungi - 768; Plants - 846; Viruses - 2; Other Eukaryotes - 1340 (source: NCBI BLink).;DHHC-type zinc finger family protein | Coding gene | HOM000058 ORTHO010559 |
| V |
AT3G56940 | Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site.;dicarboxylate diiron protein, putative (Crd1) | Coding gene | HOM002326 ORTHO003029 |
| V |
AT3G56950 | One of the Major Intrinsic Proteins(MIPs) which facilitate the passive transport of small molecules across membranes.Belongs to a family of plant aquaporins.Similar to yeast and radish aquaporins. Located on ER.;small and basic intrinsic protein 2;1 | Coding gene | HOM006873 ORTHO024910 |
| V |
AT3G56960 | Encodes a protein with phosphatidylinositol-4-phosphate 5-kinase activity that plays a role in pollen tip growth. The enzyme localizes to the apical plasma membrane and adjacent cytosolic region of pollen tubes. Overexpression of this gene leads to increased deposition of pectin in the cell wall at the tip of the pollen tube and causes altered pollen tube morphology.;phosphatidyl inositol monophosphate 5 kinase 4 | Coding gene | HOM000059 ORTHO002465 |
| X |
AT3G56970 | Encodes a member of the basic helix-loop-helix transcription factor family protein.;basic helix-loop-helix (bHLH) DNA-binding superfamily protein | Coding gene | HOM009864 ORTHO011048 |
| X |
AT3G56980 | Encodes a member of the basic helix-loop-helix transcription factor protein.;basic helix-loop-helix (bHLH) DNA-binding superfamily protein | Coding gene | HOM009864 ORTHO011048 |
| X |
AT3G56990 | embryo sac development arrest 7 (EDA7); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: megagametogenesis; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), NUC153 (InterPro:IPR012580), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;embryo sac development arrest 7 | Coding gene | HOM002584 ORTHO001804 |
| X |
AT3G57000 | nucleolar essential protein-related; CONTAINS InterPro DOMAIN/s: Ribosomal biogenesis, methyltransferase, EMG1/NEP1 (InterPro:IPR005304); Has 1079 Blast hits to 938 proteins in 280 species: Archae - 143; Bacteria - 12; Metazoa - 353; Fungi - 181; Plants - 69; Viruses - 2; Other Eukaryotes - 319 (source: NCBI BLink).;nucleolar essential protein-related | Coding gene | HOM002696 ORTHO001853 |
| V |
AT3G57010 | Calcium-dependent phosphotriesterase superfamily protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Strictosidine synthase (InterPro:IPR004141), Strictosidine synthase, conserved region (InterPro:IPR018119), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: Calcium-dependent phosphotriesterase superfamily protein (TAIR:AT3G57020.1); Has 984 Blast hits to 970 proteins in 187 species: Archae - 1; Bacteria - 187; Metazoa - 221; Fungi - 0; Plants - 480; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).;Calcium-dependent phosphotriesterase superfamily protein | Coding gene | HOM000425 ORTHO017419 |
| V |
AT3G57020 | Calcium-dependent phosphotriesterase superfamily protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum, vacuole; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: Calcium-dependent phosphotriesterase superfamily protein (TAIR:AT3G57010.1); Has 1029 Blast hits to 1017 proteins in 197 species: Archae - 1; Bacteria - 199; Metazoa - 238; Fungi - 6; Plants - 476; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink).;Calcium-dependent phosphotriesterase superfamily protein | Coding gene | HOM000425 ORTHO017419 |
| V |
AT3G57030 | Calcium-dependent phosphotriesterase superfamily protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: Calcium-dependent phosphotriesterase superfamily protein (TAIR:AT5G22020.1); Has 1145 Blast hits to 1130 proteins in 241 species: Archae - 1; Bacteria - 292; Metazoa - 224; Fungi - 14; Plants - 486; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).;Calcium-dependent phosphotriesterase superfamily protein | Coding gene | HOM000425 ORTHO005990 |
| X |
AT3G57040 | response regulator ARR9, A two-component response regulator-like protein with a receiver domain with a conserved aspartate residue and a possible phosphorylation site and at the N-terminal half. Appears to interact with histidine kinase like genes ATHP3 and ATHP2;response regulator 9 | Coding gene | HOM000464 ORTHO002246 |
| V |
AT3G57050 | Encodes second enzyme in the methionine biosynthetic pathway;cystathionine beta-lyase | Coding gene | HOM000249 ORTHO002032 |
| X |
AT3G57060 | binding; FUNCTIONS IN: binding; INVOLVED IN: mitosis, chromosome condensation; LOCATED IN: nucleus, condensin complex; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Non-SMC condensin subunit, XCAP-D2/Cnd1 (InterPro:IPR007673), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT4G15890.1).;binding | Coding gene | HOM002313 ORTHO001455 |
| X |
AT3G57062 | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | Coding gene | singleton |
| V |
AT3G57070 | Glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: N-terminal protein myristoylation, cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: Glutaredoxin family protein (TAIR:AT2G41330.1); Has 1224 Blast hits to 656 proteins in 101 species: Archae - 0; Bacteria - 41; Metazoa - 125; Fungi - 4; Plants - 389; Viruses - 0; Other Eukaryotes - 665 (source: NCBI BLink).;Glutaredoxin family protein | Coding gene | HOM000773 ORTHO002261 |
| X |
AT3G57072 | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | Coding gene | singleton |
| X |
AT3G57080 | Non-catalytic subunit unique to Nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB5.;Eukaryotic rpb5 RNA polymerase subunit family protein | Coding gene | HOM000944 ORTHO013517 |
| V |
AT3G57090 | Encodes a protein with similarity to yeast FIS proteins. These membrane anchored proteins bind DRP proteins and function during organelle division. FIS1B is expressed ubiquitously and appears to be involved in peroxisome division.;Tetratricopeptide repeat (TPR)-like superfamily protein | Coding gene | HOM004208 ORTHO004203 |
| X |
AT3G57100 | Protein of unknown function (DUF677); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF677 (InterPro:IPR007749); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF677) (TAIR:AT4G34320.1); Has 123 Blast hits to 123 proteins in 12 species: Archae - 2; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 116; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).;Protein of unknown function (DUF677) | Coding gene | HOM003976 ORTHO085535 |
| V |
AT3G57110 | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G60370.1); Has 16 Blast hits to 16 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | HOM008975 ORTHO078531 |
| X |
AT3G57120 | Protein kinase superfamily protein; FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein / peptidoglycan-binding LysM domain-containing protein (TAIR:AT1G51940.1); Has 39405 Blast hits to 37293 proteins in 1762 species: Archae - 14; Bacteria - 4560; Metazoa - 7143; Fungi - 1468; Plants - 21966; Viruses - 110; Other Eukaryotes - 4144 (source: NCBI BLink).;Protein kinase superfamily protein | Coding gene | HOM000001 ORTHO024911 |
| X |
AT3G57130 | Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1.;Ankyrin repeat family protein / BTB/POZ domain-containing protein | Coding gene | HOM003329 ORTHO009052 |
| X |
AT3G57140 | sugar-dependent 1-like (SDP1-LIKE); FUNCTIONS IN: GTP binding; INVOLVED IN: metabolic process, lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Acyl transferase/acyl hydrolase/lysophospholipase (InterPro:IPR016035), Protein of unknown function DUF3336 (InterPro:IPR021771), ARF/SAR superfamily (InterPro:IPR006689), Patatin (InterPro:IPR002641); BEST Arabidopsis thaliana protein match is: Patatin-like phospholipase family protein (TAIR:AT5G04040.1); Has 1079 Blast hits to 1061 proteins in 366 species: Archae - 0; Bacteria - 487; Metazoa - 11; Fungi - 361; Plants - 73; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink).;sugar-dependent 1-like | Coding gene | HOM000734 ORTHO001584 |
| V |
AT3G57150 | Encodes a putative pseudouridine synthase (NAP57).;homologue of NAP57 | Coding gene | HOM001849 ORTHO001081 |
| X |
AT3G57157 | rna_type=other_rna;other RNA | RNA gene | |
| X |
AT3G57160 | unknown protein; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | Coding gene | singleton |
| X |
AT3G57170 | N-acetylglucosaminyl transferase component family protein / Gpi1 family protein; FUNCTIONS IN: transferase activity, phosphatidylinositol N-acetylglucosaminyltransferase activity; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: N-acetylglucosaminyl transferase component (InterPro:IPR007720); Has 334 Blast hits to 333 proteins in 180 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 132; Plants - 32; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).;N-acetylglucosaminyl transferase component family protein / Gpi1 family protein | Coding gene | HOM015044 ORTHO009155 |
| V |
AT3G57180 | BRASSINAZOLE(BRZ) INSENSITIVE PALE GREEN 2 (BPG2); FUNCTIONS IN: GTP binding; INVOLVED IN: brassinosteroid mediated signaling pathway, developmental process; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT4G10620.1); Has 5185 Blast hits to 4152 proteins in 947 species: Archae - 97; Bacteria - 1334; Metazoa - 1316; Fungi - 649; Plants - 254; Viruses - 94; Other Eukaryotes - 1441 (source: NCBI BLink).;P-loop containing nucleoside triphosphate hydrolases superfamily protein | Coding gene | HOM002042 ORTHO001585 |
| X |
AT3G57190 | peptide chain release factor, putative; FUNCTIONS IN: translation release factor activity, codon specific, translation release factor activity; INVOLVED IN: translational termination; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352), Peptide chain release factor (InterPro:IPR005139); BEST Arabidopsis thaliana protein match is: high chlorophyll fluorescent 109 (TAIR:AT5G36170.2); Has 13500 Blast hits to 13496 proteins in 2706 species: Archae - 0; Bacteria - 9313; Metazoa - 113; Fungi - 108; Plants - 181; Viruses - 0; Other Eukaryotes - 3785 (source: NCBI BLink).;peptide chain release factor, putative | Coding gene | HOM000318 ORTHO024912 |
| X |
AT3G57200 | unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41451.1); Has 94 Blast hits to 94 proteins in 31 species: Archae - 0; Bacteria - 12; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). | Coding gene | HOM003124 ORTHO024445 |
| X |
AT3G57210 | Protein of unknown function (DUF626); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF626) (TAIR:AT1G22090.1); Has 148 Blast hits to 147 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Protein of unknown function (DUF626) | Coding gene | HOM001729 ORTHO000790 |
| V |
AT3G57220 | Glycosyl transferase family 4 protein; FUNCTIONS IN: UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity; INVOLVED IN: polysaccharide biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 4, conserved region (InterPro:IPR018481); BEST Arabidopsis thaliana protein match is: UDP-glcnac-adolichol phosphate glcnac-1-p-transferase (TAIR:AT2G41490.1); Has 6923 Blast hits to 6922 proteins in 2293 species: Archae - 137; Bacteria - 5522; Metazoa - 126; Fungi - 129; Plants - 61; Viruses - 0; Other Eukaryotes - 948 (source: NCBI BLink).;Glycosyl transferase family 4 protein | Coding gene | HOM002197 ORTHO001475 |
| X |
AT3G57230 | MADS-box transcription factor. Expressed in leaf, root and stem, with higher RNA accumulation in guard cells and trichomes.;AGAMOUS-like 16 | Coding gene | HOM000099 ORTHO024913 |
| X |
AT3G57240 | encodes a member of glycosyl hydrolase family 17;beta-1,3-glucanase 3 | Coding gene | HOM000056 ORTHO000817 |
| X |
AT3G57250 | Emsy N Terminus (ENT) domain-containing protein; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491); Has 6 Blast hits to 6 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).;Emsy N Terminus (ENT) domain-containing protein | Coding gene | singleton |
| V |
AT3G57260 | beta 1,3-glucanase;beta-1,3-glucanase 2 | Coding gene | HOM000056 ORTHO000817 |
| X |
AT3G57270 | encodes a member of glycosyl hydrolase family 17;beta-1,3-glucanase 1 | Coding gene | HOM000056 ORTHO000817 |
| V |
AT3G57280 | Transmembrane proteins 14C; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: Transmembrane proteins 14C (TAIR:AT3G20510.1); Has 169 Blast hits to 169 proteins in 36 species: Archae - 0; Bacteria - 2; Metazoa - 27; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).;Transmembrane proteins 14C | Coding gene | HOM002247 ORTHO004639 |
| V |
AT3G57290 | Encodes a protein that is found in not only the eif3 complex but also in association with subunits of the COP9 signalosome. eIF3e appears to be subjected to proteasome-dependent degradation that requires the PCI domain of eIF3e. The level of eIF3e present in cells appears to affect the rate of translation.;eukaryotic translation initiation factor 3E | Coding gene | HOM002011 ORTHO000835 |
