Functional Clustering  


Cluster information

Cluster overview

Cluster id
CH_ath_66
Cluster type
GO
Species
Arabidopsis thaliana
Chromosome
3
E-value
0.0000745537
GO label
GO:0044444
GO description
cytoplasmic part
 

Gene information

In cluster Gene id Description Gene type Gene family
V AT3G54640Catalyzes the conversion of indole-3-glycerolphosphate to indole, the penultimate reaction in the biosynthesis of tryptophan. Functions as a heterocomplex with tryptophan synthase beta subunit (TSA2).;tryptophan synthase alpha chainCoding geneHOM002938 ORTHO003027
V AT3G54650FBL17; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: generative cell mitosis, seed development, embryo development, ubiquitin-dependent protein catabolic process, pollen development; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810); Has 1738 Blast hits to 1195 proteins in 149 species: Archae - 0; Bacteria - 27; Metazoa - 733; Fungi - 89; Plants - 663; Viruses - 0; Other Eukaryotes - 226 (source: NCBI BLink).;RNI-like superfamily proteinCoding geneHOM016242 ORTHO017762
V AT3G54660Encodes glutathione reductase that is most likely localized in the chloroplast.;glutathione reductaseCoding geneHOM000126 ORTHO000449
V AT3G54670Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment.;Structural maintenance of chromosomes (SMC) family proteinCoding geneHOM002659 ORTHO001620
V AT3G54680proteophosphoglycan-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; Has 4120 Blast hits to 443 proteins in 120 species: Archae - 2; Bacteria - 57; Metazoa - 120; Fungi - 93; Plants - 84; Viruses - 11; Other Eukaryotes - 3753 (source: NCBI BLink).;proteophosphoglycan-relatedCoding genesingleton
X AT3G54690Sugar isomerase (SIS) family protein; FUNCTIONS IN: isomerase activity, sugar binding; INVOLVED IN: carbohydrate metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: KpsF/GutQ (InterPro:IPR004800), Sugar isomerase (SIS) (InterPro:IPR001347), Cystathionine beta-synthase, core (InterPro:IPR000644); Has 8722 Blast hits to 8719 proteins in 1857 species: Archae - 184; Bacteria - 5776; Metazoa - 15; Fungi - 131; Plants - 43; Viruses - 2; Other Eukaryotes - 2571 (source: NCBI BLink).;Sugar isomerase (SIS) family proteinCoding geneHOM006409 ORTHO007870
X AT3G54700Encodes Pht1;7, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).;phosphate transporter 1;7Coding geneHOM000365 ORTHO000376
X AT3G54710Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division.;homolog of yeast CDT1 B homolog of yeast CDT1 BCoding geneHOM005752 ORTHO009154
X AT3G54720Encodes glutamate carboxypeptidase. Various alleles show-increased cotyledon number and rate of leaf initiation, show transformation of leaves to cotyledons, altered flowering time and photomorphogenesis and an increased level of cytokinin biosynthesis. Involved in ethylene enhanced hypocotyl elongation in the light. Strong genetic interaction between TGH and AMP1.;Peptidase M28 family proteinCoding geneHOM004305 ORTHO004919
X AT3G54730BEST Arabidopsis thaliana protein match is: ovate family protein 9 (TAIR:AT4G04030.1); Has 17 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 8; Viruses - 3; Other Eukaryotes - 2 (source: NCBI BLink).Coding geneHOM014114 ORTHO017276
X AT3G54740Protein of unknown function, DUF593; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF593 (InterPro:IPR007656); BEST Arabidopsis thaliana protein match is: Protein of unknown function, DUF593 (TAIR:AT5G06560.1); Has 386 Blast hits to 371 proteins in 36 species: Archae - 3; Bacteria - 4; Metazoa - 10; Fungi - 3; Plants - 346; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).;Protein of unknown function, DUF593Coding geneHOM004130 ORTHO011115
X AT3G54750unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages.Coding geneHOM008386 ORTHO006970
V AT3G54760dentin sialophosphoprotein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: guard cell, cultured cell; BEST Arabidopsis thaliana protein match is: Tudor/PWWP/MBT superfamily protein (TAIR:AT5G02950.1); Has 25330 Blast hits to 15408 proteins in 1388 species: Archae - 237; Bacteria - 6371; Metazoa - 7552; Fungi - 2715; Plants - 1153; Viruses - 230; Other Eukaryotes - 7072 (source: NCBI BLink).;dentin sialophosphoprotein-relatedCoding geneHOM002883 ORTHO098647
X AT3G54770RNA-binding (RRM/RBD/RNP motifs) family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: root, gynoecium, carpel, stamen; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G76460.1); Has 10710 Blast hits to 8449 proteins in 510 species: Archae - 0; Bacteria - 384; Metazoa - 5849; Fungi - 946; Plants - 2782; Viruses - 0; Other Eukaryotes - 749 (source: NCBI BLink).;RNA-binding (RRM/RBD/RNP motifs) family proteinCoding geneHOM000016 ORTHO060386
X AT3G54780Zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957), von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: Zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G38970.1); Has 4339 Blast hits to 4316 proteins in 749 species: Archae - 84; Bacteria - 1602; Metazoa - 1164; Fungi - 180; Plants - 555; Viruses - 5; Other Eukaryotes - 749 (source: NCBI BLink).;Zinc finger (C3HC4-type RING finger) family proteinCoding geneHOM000758 ORTHO006908
X AT3G54790ARM repeat superfamily protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U box domain (InterPro:IPR003613), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: RING/U-box superfamily protein with ARM repeat domain (TAIR:AT2G23140.1); Has 7024 Blast hits to 4442 proteins in 284 species: Archae - 0; Bacteria - 30; Metazoa - 1370; Fungi - 570; Plants - 4306; Viruses - 3; Other Eukaryotes - 745 (source: NCBI BLink).;ARM repeat superfamily proteinCoding geneHOM000042 ORTHO013722
X AT3G54800Pleckstrin homology (PH) and lipid-binding START domains-containing protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769), Lipid-binding START (InterPro:IPR002913), Pleckstrin homology-type (InterPro:IPR011993), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: Pleckstrin homology (PH) and lipid-binding START domains-containing protein (TAIR:AT2G28320.1); Has 535 Blast hits to 513 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 63; Fungi - 0; Plants - 352; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).;Pleckstrin homology (PH) and lipid-binding START domains-containing proteinCoding geneHOM000297 ORTHO005555
X AT3G54802unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding genesingleton
X AT3G54804unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding genesingleton
X AT3G54810Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified.;Plant-specific GATA-type zinc finger transcription factor family proteinCoding geneHOM000218 ORTHO024895
X AT3G54820plasma membrane intrinsic protein 2;5 (PIP2;5); FUNCTIONS IN: water channel activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Major intrinsic protein, conserved site (InterPro:IPR022357), Aquaporin (InterPro:IPR012269), Major intrinsic protein (InterPro:IPR000425); BEST Arabidopsis thaliana protein match is: plasma membrane intrinsic protein 2 (TAIR:AT2G37170.1); Has 10866 Blast hits to 10851 proteins in 2236 species: Archae - 80; Bacteria - 5189; Metazoa - 1483; Fungi - 451; Plants - 2536; Viruses - 2; Other Eukaryotes - 1125 (source: NCBI BLink).;plasma membrane intrinsic protein 2;5Coding geneHOM000124 ORTHO024414
X AT3G54823gypsy-like retrotransposon family, has a 4.4e-203 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);rna_type=other_rna;transposable element geneTransposon
X AT3G54826Zim17-type zinc finger protein; CONTAINS InterPro DOMAIN/s: Zinc finger, Zim17-type (InterPro:IPR007853); Has 403 Blast hits to 403 proteins in 183 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 127; Plants - 101; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).;Zim17-type zinc finger proteinCoding geneHOM002329 ORTHO002416
X AT3G54830Transmembrane amino acid transporter family protein; CONTAINS InterPro DOMAIN/s: Amino acid transporter, transmembrane (InterPro:IPR013057); BEST Arabidopsis thaliana protein match is: Transmembrane amino acid transporter family protein (TAIR:AT2G39130.1); Has 4642 Blast hits to 4638 proteins in 371 species: Archae - 12; Bacteria - 272; Metazoa - 1629; Fungi - 958; Plants - 1130; Viruses - 3; Other Eukaryotes - 638 (source: NCBI BLink).;Transmembrane amino acid transporter family proteinCoding geneHOM000557 ORTHO002989
V AT3G54840Encodes a novel Rab-like GTP-ase that is localized to the peripheral membrane of the endosome.;Ras-related small GTP-binding family proteinCoding geneHOM000018 ORTHO006971
X AT3G54850Encodes a protein with a typical U-box domain followed by an Armadillo repeat region, a domain organization that is frequently found in plant U-box proteins. Displays ubiquitin ligase activity in vitro.;plant U-box 14Coding geneHOM000042 ORTHO017763
V AT3G54860Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis.;Sec1/munc18-like (SM) proteins superfamilyCoding geneHOM003285 ORTHO002826
V AT3G54870Armadillo-repeat containing kinesin-related protein. Plays a role during transition to root-hair tip growth.Mutants have short, branched root hairs and an excess of endoplasmic microtubles. Phenotype suggests ARK1 plays a role in modulating microtubule depolymerization during root hair tip growth.;Armadillo/beta-catenin repeat family protein / kinesin motor family proteinCoding geneHOM000009 ORTHO004475
X AT3G54880unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25360.2); Has 137 Blast hits to 137 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).Coding geneHOM003698 ORTHO017764
V AT3G54890Encodes a component of the light harvesting complex associated with photosystem I.;photosystem I light harvesting complex gene 1Coding geneHOM000039 ORTHO003368
V AT3G54900A.thaliana PICOT protein.It activates CAX1 gene Calcium transport activity.In other organisms, PICOT proteins appear to play a negative regulatory role in cellular stress responses.;CAX interacting protein 1Coding geneHOM000268 ORTHO002421
X AT3G54910RNI-like superfamily protein; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box/RNI-like/FBD-like domains-containing protein (TAIR:AT4G10400.2); Has 997 Blast hits to 979 proteins in 15 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 993; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;RNI-like superfamily proteinCoding geneHOM000308 ORTHO000039
X AT3G54920Powdery mildew resistant mutant encodes a pectate lyase-like protein;Pectin lyase-like superfamily proteinCoding geneHOM000339 ORTHO024896
X AT3G54925Plant self-incompatibility protein S1 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: Plant self-incompatibility protein S1 family (TAIR:AT3G55254.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Plant self-incompatibility protein S1 familyCoding geneHOM002037 ORTHO000976
V AT3G54930Protein phosphatase 2A regulatory B subunit family protein; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: chloroplast, protein phosphatase type 2A complex; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: Protein phosphatase 2A regulatory B subunit family protein (TAIR:AT5G03470.1); Has 1209 Blast hits to 1201 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 572; Fungi - 149; Plants - 304; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).;Protein phosphatase 2A regulatory B subunit family proteinCoding geneHOM000751 ORTHO103538
X AT3G54940Papain family cysteine protease; FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, sepal, carpel; EXPRESSED DURING: 4 anthesis, C globular stage; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: Papain family cysteine protease (TAIR:AT2G21430.1); Has 7716 Blast hits to 7658 proteins in 713 species: Archae - 63; Bacteria - 225; Metazoa - 3256; Fungi - 4; Plants - 1843; Viruses - 138; Other Eukaryotes - 2187 (source: NCBI BLink).;Papain family cysteine proteaseCoding geneHOM000043 ORTHO024897
X AT3G54950patatin-like protein 6 (PLA IIIA); CONTAINS InterPro DOMAIN/s: Acyl transferase/acyl hydrolase/lysophospholipase (InterPro:IPR016035), Patatin (InterPro:IPR002641); BEST Arabidopsis thaliana protein match is: PATATIN-like protein 6 (TAIR:AT2G39220.1); Has 1058 Blast hits to 1055 proteins in 202 species: Archae - 0; Bacteria - 325; Metazoa - 24; Fungi - 32; Plants - 544; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink).;patatin-like protein 6Coding geneHOM000851 ORTHO009046
V AT3G54960Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response.;PDI-like 1-3Coding geneHOM000077 ORTHO003201
X AT3G54970D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminotransferase, class IV (InterPro:IPR001544); Has 125 Blast hits to 125 proteins in 56 species: Archae - 2; Bacteria - 46; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).;D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily proteinCoding geneHOM004140 ORTHO005625
X AT3G54980Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: LATERAL ORGAN JUNCTION (TAIR:AT2G39230.1); Has 66577 Blast hits to 14412 proteins in 313 species: Archae - 5; Bacteria - 80; Metazoa - 1084; Fungi - 1336; Plants - 61678; Viruses - 0; Other Eukaryotes - 2394 (source: NCBI BLink).;Pentatricopeptide repeat (PPR) superfamily proteinCoding geneHOM000003 ORTHO017396
X AT3G54990Encodes a AP2 domain transcription factor that can repress flowering. SMZ and its paralogous gene, SNARCHZAPFEN (SNZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering.;Integrase-type DNA-binding superfamily proteinCoding geneHOM000100 ORTHO024417
V AT3G55000Encodes a protein of unknown function that is involved in cortical microtubule organization. Mutants exhibit abnormal cell growth and patterns of division. TON1A can functionally complement TON1B and their roles appear to be redundant in plants. Encodes a novel protein that is similar to human FOP and OFD1 centrosomal proteins. Localizes to the preprophase band, cytoplasm and cell cortex where it is probably associated with the cortical cytoskeleton. TON1A associates with plant centrins CEN1 and CEN2.;tonneau family proteinCoding geneHOM007329 ORTHO007871
X AT3G55005Encodes a protein of unknown function that is involved in cortical microtubule organization. Mutants exhibit abnormal cell growth and patterns of division. TON1B appears to be redundant with TON1A. Encodes a novel protein that is similar to human FOP and OFD1 centrosomal proteins. Localizes to the preprophase band, cytoplasm and cell cortex where it is probably associated with the cortical cytoskeleton. TON1B associates with plant centrin CEN1.;tonneau 1b (TON1b)Coding geneHOM007329 ORTHO007871
V AT3G55010encoding phosphoribosylformylglycinamidine cyclo-ligase (syn. AIR synthetase)that phosphorylates 5-phosphoribosyl-N-formylglycinamidine (FGAM) to form 5-aminoimidazole ribonucleotide (AIR);phosphoribosylformylglycinamidine cyclo-ligase, chloroplast / phosphoribosyl-aminoimidazole synthetase / AIR synthase (PUR5)Coding geneHOM001100 ORTHO000282
V AT3G55020Ypt/Rab-GAP domain of gyp1p superfamily protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: Ypt/Rab-GAP domain of gyp1p superfamily protein (TAIR:AT2G39280.1); Has 8291 Blast hits to 7654 proteins in 526 species: Archae - 15; Bacteria - 632; Metazoa - 4273; Fungi - 1225; Plants - 609; Viruses - 33; Other Eukaryotes - 1504 (source: NCBI BLink).;Ypt/Rab-GAP domain of gyp1p superfamily proteinCoding geneHOM000248 ORTHO004146
V AT3G55030Encodes a phosphatidylglycerolphosphate synthase.;phosphatidylglycerolphosphate synthase 2Coding geneHOM001959 ORTHO001300
V AT3G55040Encodes a member of the lambda family of glutathione transferases. It has thiol transferase activity and self S-glutathionylation activity in vitro.;glutathione transferase lambda 2Coding geneHOM006615 ORTHO013723
X AT3G55050Protein phosphatase 2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: Protein phosphatase 2C family protein (TAIR:AT3G12620.2); Has 5454 Blast hits to 5450 proteins in 305 species: Archae - 0; Bacteria - 58; Metazoa - 1459; Fungi - 575; Plants - 2427; Viruses - 0; Other Eukaryotes - 935 (source: NCBI BLink).;Protein phosphatase 2C family proteinCoding geneHOM000585 ORTHO013626
X AT3G55060unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G39300.2); Has 61765 Blast hits to 33720 proteins in 2065 species: Archae - 846; Bacteria - 6964; Metazoa - 31967; Fungi - 5247; Plants - 3104; Viruses - 205; Other Eukaryotes - 13432 (source: NCBI BLink).Coding geneHOM008563 ORTHO009047
V AT3G55070LisH/CRA/RING-U-box domains-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ran binding protein, CRA domain (InterPro:IPR019589), CTLH, C-terminal LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), Ran binding protein-like, CRA domain (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: LisH/CRA/RING-U-box domains-containing protein (TAIR:AT4G37880.1); Has 891 Blast hits to 870 proteins in 200 species: Archae - 0; Bacteria - 0; Metazoa - 367; Fungi - 300; Plants - 157; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).;LisH/CRA/RING-U-box domains-containing proteinCoding geneHOM005085 ORTHO005626
X AT3G55080SET domain-containing protein; CONTAINS InterPro DOMAIN/s: SET domain (InterPro:IPR001214); BEST Arabidopsis thaliana protein match is: Rubisco methyltransferase family protein (TAIR:AT3G07670.1); Has 1136 Blast hits to 1133 proteins in 187 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 329; Plants - 401; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink).;SET domain-containing proteinCoding geneHOM001533 ORTHO013724
X AT3G55090ABC-2 type transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: response to cyclopentenone; LOCATED IN: membrane; EXPRESSED IN: sepal, root, flower, carpel, stamen; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC-2 type transporter family protein (TAIR:AT2G39350.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;ABC-2 type transporter family proteinCoding geneHOM000017 ORTHO002304
X AT3G55100ABC-2 type transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: membrane; EXPRESSED IN: petal, leaf whorl, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: white-brown complex homolog 19 (TAIR:AT3G55130.1); Has 392721 Blast hits to 356813 proteins in 4114 species: Archae - 7219; Bacteria - 309703; Metazoa - 8988; Fungi - 6487; Plants - 5627; Viruses - 12; Other Eukaryotes - 54685 (source: NCBI BLink).;ABC-2 type transporter family proteinCoding geneHOM000017 ORTHO002304
X AT3G55110ABC-2 type transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: white-brown complex homolog 19 (TAIR:AT3G55130.1); Has 385599 Blast hits to 351876 proteins in 4105 species: Archae - 7169; Bacteria - 305821; Metazoa - 8275; Fungi - 6295; Plants - 5429; Viruses - 12; Other Eukaryotes - 52598 (source: NCBI BLink).;ABC-2 type transporter family proteinCoding geneHOM000017 ORTHO002304
V AT3G55120Catalyzes the conversion of chalcones into flavanones. Required for the accumulation of purple anthocyanins in leaves and stems.;Chalcone-flavanone isomerase family proteinCoding geneHOM009544 ORTHO011178
V AT3G55130Encodes a vacuole localized protein of the ABC transporter White-Brown Complex (WBC) family. When overexpressed in planta, confers resistance to kanamycin.;white-brown complex homolog 19Coding geneHOM000017 ORTHO002304
X AT3G55140Pectin lyase-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: Pectin lyase-like superfamily protein (TAIR:AT3G09540.1); Has 1866 Blast hits to 1858 proteins in 295 species: Archae - 2; Bacteria - 979; Metazoa - 0; Fungi - 175; Plants - 677; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).;Pectin lyase-like superfamily proteinCoding geneHOM000339 ORTHO013611
V AT3G55150A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.;exocyst subunit exo70 family protein H1Coding geneHOM000210 ORTHO006769
X AT3G55160unknown protein; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2428, death-receptor-like (InterPro:IPR019442); Has 357 Blast hits to 330 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 144; Fungi - 118; Plants - 50; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).Coding geneHOM002304 ORTHO003028
V AT3G55170Ribosomal L29 family protein ; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, cytosolic large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: Ribosomal L29 family protein (TAIR:AT3G09500.1); Has 1329 Blast hits to 1329 proteins in 532 species: Archae - 155; Bacteria - 387; Metazoa - 302; Fungi - 146; Plants - 143; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).;Ribosomal L29 family protein Coding geneHOM001740 ORTHO000964
X AT3G55180alpha/beta-Hydrolases superfamily protein; BEST Arabidopsis thaliana protein match is: alpha/beta-Hydrolases superfamily protein (TAIR:AT2G39400.1); Has 4129 Blast hits to 4129 proteins in 1315 species: Archae - 32; Bacteria - 2874; Metazoa - 141; Fungi - 140; Plants - 467; Viruses - 36; Other Eukaryotes - 439 (source: NCBI BLink).;alpha/beta-Hydrolases superfamily proteinCoding geneHOM000234 ORTHO004588
X AT3G55190alpha/beta-Hydrolases superfamily protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: glycerol biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: petal, leaf whorl, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: alpha/beta-Hydrolases superfamily protein (TAIR:AT2G39420.1); Has 3264 Blast hits to 3262 proteins in 1077 species: Archae - 36; Bacteria - 2164; Metazoa - 108; Fungi - 125; Plants - 448; Viruses - 35; Other Eukaryotes - 348 (source: NCBI BLink).;alpha/beta-Hydrolases superfamily proteinCoding geneHOM000234 ORTHO004588
V AT3G55200Cleavage and polyadenylation specificity factor (CPSF) A subunit protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: WD40 repeat (InterPro:IPR001680), Cleavage/polyadenylation specificity factor, A subunit, C-terminal (InterPro:IPR004871); BEST Arabidopsis thaliana protein match is: Cleavage and polyadenylation specificity factor (CPSF) A subunit protein (TAIR:AT3G55220.1); Has 1074 Blast hits to 953 proteins in 223 species: Archae - 0; Bacteria - 2; Metazoa - 406; Fungi - 248; Plants - 228; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink).;Cleavage and polyadenylation specificity factor (CPSF) A subunit proteinCoding geneHOM002009 ORTHO000874
X AT3G55210NAC domain containing protein 63 (NAC063); CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 93 (TAIR:AT5G39690.1); Has 2524 Blast hits to 2517 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2522; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).;NAC domain containing protein 63Coding geneHOM000052 ORTHO007674
X AT3G55220Cleavage and polyadenylation specificity factor (CPSF) A subunit protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: WD40 repeat (InterPro:IPR001680), Cleavage/polyadenylation specificity factor, A subunit, C-terminal (InterPro:IPR004871); BEST Arabidopsis thaliana protein match is: Cleavage and polyadenylation specificity factor (CPSF) A subunit protein (TAIR:AT3G55200.1); Has 1074 Blast hits to 953 proteins in 223 species: Archae - 0; Bacteria - 2; Metazoa - 406; Fungi - 248; Plants - 228; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink).;Cleavage and polyadenylation specificity factor (CPSF) A subunit proteinCoding geneHOM002009 ORTHO000874
X AT3G55230Disease resistance-responsive (dirigent-like protein) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: defense response; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant disease resistance response protein (InterPro:IPR004265); BEST Arabidopsis thaliana protein match is: Disease resistance-responsive (dirigent-like protein) family protein (TAIR:AT2G39430.1); Has 704 Blast hits to 703 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 700; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Disease resistance-responsive (dirigent-like protein) family proteinCoding geneHOM005297 ORTHO013504
X AT3G55240Overexpression leads to PEL (Pseudo-Etiolation in Light) phenotype.;Plant protein 1589 of unknown functionCoding geneHOM001166 ORTHO024782
V AT3G55250unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 46 Blast hits to 46 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM008112 ORTHO006972
X AT3G55252Plant self-incompatibility protein S1 family; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: Plant self-incompatibility protein S1 family (TAIR:AT3G55254.1); Has 256 Blast hits to 245 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 256; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Plant self-incompatibility protein S1 familyCoding geneHOM002037 ORTHO000976
X AT3G55254Plant self-incompatibility protein S1 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: Plant self-incompatibility protein S1 family (TAIR:AT3G55252.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Plant self-incompatibility protein S1 familyCoding geneHOM002037 ORTHO000976
X AT3G55258pseudogene similar to self-incompatibility;pseudogenePseudo gene
V AT3G55260Encodes a protein with β-hexosaminidase activity (the enzyme is active with p-nitrophenyl-β-N-acetylglucosaminide as substrate but displayed only a minor activity toward p-nitrophenyl-β-N-acetylgalactosaminide). The enzyme displays no distinct preference for a specific terminal GlcNAc residue and indeed cleaved the asialoagalactodabsylglycopeptide GnGn to a mixture of products.;beta-hexosaminidase 1Coding geneHOM001151 ORTHO006001
X AT3G55270MAP kinase phosphatase (MKP1);mitogen-activated protein kinase phosphatase 1Coding geneHOM000337 ORTHO004198
V AT3G5528060S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA;ribosomal protein L23ABCoding geneHOM001844 ORTHO000784
V AT3G55290NAD(P)-binding Rossmann-fold superfamily protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Short-chain dehydrogenase/reductase, conserved site (InterPro:IPR020904), NAD(P)-binding domain (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: NAD(P)-binding Rossmann-fold superfamily protein (TAIR:AT3G55310.1); Has 128769 Blast hits to 128555 proteins in 3647 species: Archae - 1021; Bacteria - 82974; Metazoa - 6760; Fungi - 6996; Plants - 3211; Viruses - 5; Other Eukaryotes - 27802 (source: NCBI BLink).;NAD(P)-binding Rossmann-fold superfamily proteinCoding geneHOM000028 ORTHO006120
X AT3G55300copia-like retrotransposon family, has a 4.5e-28 P-value blast match to GB:CAA37924 orf 2 (Ty1_Copia-element) (Arabidopsis thaliana);rna_type=other_rna;transposable element geneTransposon
X AT3G55310NAD(P)-binding Rossmann-fold superfamily protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: oxidation reduction, fatty acid elongation, unsaturated fatty acid, metabolic process, fatty acid elongation, saturated fatty acid; LOCATED IN: membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Short-chain dehydrogenase/reductase, conserved site (InterPro:IPR020904), NAD(P)-binding domain (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: NAD(P)-binding Rossmann-fold superfamily protein (TAIR:AT3G55290.2); Has 128636 Blast hits to 128424 proteins in 3690 species: Archae - 1019; Bacteria - 82614; Metazoa - 6888; Fungi - 6972; Plants - 3216; Viruses - 5; Other Eukaryotes - 27922 (source: NCBI BLink).;NAD(P)-binding Rossmann-fold superfamily proteinCoding geneHOM000028 ORTHO006120
X AT3G55320P-glycoprotein 20 (PGP20); FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: transport, transmembrane transport; LOCATED IN: nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, transmembrane domain, type 1 (InterPro:IPR011527), ABC transporter integral membrane type 1 (InterPro:IPR017940), ABC transporter, transmembrane domain (InterPro:IPR001140); BEST Arabidopsis thaliana protein match is: P-glycoprotein 6 (TAIR:AT2G39480.1); Has 718468 Blast hits to 361578 proteins in 4093 species: Archae - 12537; Bacteria - 570379; Metazoa - 18035; Fungi - 12093; Plants - 8938; Viruses - 13; Other Eukaryotes - 96473 (source: NCBI BLink).;P-glycoprotein 20Coding geneHOM000020 ORTHO011041
V AT3G55330PsbP-like protein 1 (PPL1); FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); BEST Arabidopsis thaliana protein match is: PsbP-like protein 2 (TAIR:AT2G39470.2); Has 595 Blast hits to 595 proteins in 103 species: Archae - 0; Bacteria - 112; Metazoa - 0; Fungi - 0; Plants - 355; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).;PsbP-like protein 1Coding geneHOM003830 ORTHO004199
X AT3G55340Plant-specific protein. Interacts with phragmoplastin, Rop1 and Rop2. Involved in cell plate formation.;phragmoplastin interacting protein 1Coding geneHOM003791 ORTHO003542
X AT3G55350PIF / Ping-Pong family of plant transposases; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Putative harbinger transposase-derived nuclease (InterPro:IPR006912); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G63270.1); Has 1213 Blast hits to 1213 proteins in 135 species: Archae - 0; Bacteria - 2; Metazoa - 520; Fungi - 50; Plants - 592; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).;PIF / Ping-Pong family of plant transposasesCoding geneHOM002995 ORTHO024898
V AT3G55360Enoyl-CoA reductase is involved in all very long chain fatty acids (VLCFA) elongation reactions that are required for cuticular wax, storage lipid and sphingolipid metabolism. The protein is located in the ER, but in contrast to its yeast homolog TSC13 is not particularly enriched in the nuclear envelope-vacuole junction. Mutants in this gene show abnormal organ morphology and stem glossiness. Cells in all tissues are only about 1/3 of the size of wild type cells. The morphological changes are most likely to result from the reduction in the VLCFA content of sphingolipids. Mutants also show abnormalities in the endocytic membrane organization and transport.;3-oxo-5-alpha-steroid 4-dehydrogenase family proteinCoding geneHOM002710 ORTHO002490
X AT3G55370Encodes a nuclear localized Dof domain containing transcription factor expressed primarily in roots. Responsive to salicylic acid. Transgenic overexpressors have yellow leaves and short, defective roots.;OBF-binding protein 3Coding geneHOM000153 ORTHO017765
X AT3G55380ubiquitin-conjugating enzyme 14 (UBC14); CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: ubiquitin carrier protein 7 (TAIR:AT5G59300.1).;ubiquitin-conjugating enzyme 14Coding geneHOM000025 ORTHO035613
X AT3G55390Uncharacterised protein family (UPF0497); CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0497, trans-membrane plant (InterPro:IPR006702), Uncharacterised protein family UPF0497, trans-membrane plant subgroup (InterPro:IPR006459); BEST Arabidopsis thaliana protein match is: Uncharacterised protein family (UPF0497) (TAIR:AT2G38480.1); Has 361 Blast hits to 361 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 361; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Uncharacterised protein family (UPF0497)Coding geneHOM009141 ORTHO011193
V AT3G55400OVULE ABORTION 1 (OVA1); FUNCTIONS IN: methionine-tRNA ligase activity, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: tRNA aminoacylation for protein translation, ovule development; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Methionyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR014758), Aminoacyl-tRNA synthetase, class I (M) (InterPro:IPR015413), Methionyl-tRNA synthetase, class Ia (InterPro:IPR002304), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: methionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative (TAIR:AT4G13780.1); Has 26528 Blast hits to 25030 proteins in 3018 species: Archae - 991; Bacteria - 17017; Metazoa - 429; Fungi - 593; Plants - 193; Viruses - 3; Other Eukaryotes - 7302 (source: NCBI BLink).;methionyl-tRNA synthetase / methionine--tRNA ligase / MetRS (cpMetRS)Coding geneHOM001173 ORTHO004430
V AT3G554102-oxoglutarate dehydrogenase, E1 component; FUNCTIONS IN: oxoglutarate dehydrogenase (succinyl-transferring) activity, cobalt ion binding, zinc ion binding; INVOLVED IN: glycolysis, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxoglutarate dehydrogenase, E1 component (InterPro:IPR011603), Dehydrogenase, E1 component (InterPro:IPR001017), Transketolase-like, pyrimidine-binding domain (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate dehydrogenase, E1 component (TAIR:AT5G65750.1); Has 10999 Blast hits to 10962 proteins in 1954 species: Archae - 31; Bacteria - 4409; Metazoa - 546; Fungi - 299; Plants - 167; Viruses - 0; Other Eukaryotes - 5547 (source: NCBI BLink).;2-oxoglutarate dehydrogenase, E1 componentCoding geneHOM000716 ORTHO000279
X AT3G55420unknown protein; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM016361 ORTHO024899
X AT3G55430O-Glycosyl hydrolases family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 17 protein (TAIR:AT2G39640.1); Has 2877 Blast hits to 2804 proteins in 154 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 42; Plants - 2822; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).;O-Glycosyl hydrolases family 17 proteinCoding geneHOM000056 ORTHO013506
V AT3G55440Encodes triosephosphate isomerase.;triosephosphate isomeraseCoding geneHOM000326 ORTHO011194
X AT3G55450PBS1-like 1 (PBL1); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); BEST Arabidopsis thaliana protein match is: botrytis-induced kinase1 (TAIR:AT2G39660.1).;PBS1-like 1Coding geneHOM000001 ORTHO024418
X AT3G55460encodes an SC35-like splicing factor that is localized to nuclear specks.;SC35-like splicing factor 30Coding geneHOM000668 ORTHO013725
X AT3G55470Calcium-dependent lipid-binding (CaLB domain) family protein; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: Calcium-dependent lipid-binding (CaLB domain) family protein (TAIR:AT1G63220.1); Has 2395 Blast hits to 2293 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 1201; Fungi - 119; Plants - 879; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).;Calcium-dependent lipid-binding (CaLB domain) family proteinCoding geneHOM000697 ORTHO024900
V AT3G55480protein affected trafficking 2 (PAT2); FUNCTIONS IN: protein transporter activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: Adaptin family protein (TAIR:AT4G23460.1); Has 2490 Blast hits to 1771 proteins in 223 species: Archae - 0; Bacteria - 20; Metazoa - 1008; Fungi - 721; Plants - 224; Viruses - 0; Other Eukaryotes - 517 (source: NCBI BLink).;protein affected trafficking 2Coding geneHOM000431 ORTHO003955
X AT3G55485rna_type=other_rnaRNA gene
X AT3G55490GINS complex protein; CONTAINS InterPro DOMAIN/s: GINS complex, subunit Psf3 (InterPro:IPR010492), GINS complex (InterPro:IPR021151); BEST Arabidopsis thaliana protein match is: GINS complex protein (TAIR:AT1G19080.2); Has 336 Blast hits to 336 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 114; Plants - 49; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).;GINS complex proteinCoding geneHOM004296 ORTHO004055
X AT3G55500expansin-like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.;expansin A16Coding geneHOM000113 ORTHO007784
X AT3G55510REBELOTE (RBL); INVOLVED IN: floral meristem determinacy; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0120 (InterPro:IPR005343); BEST Arabidopsis thaliana protein match is: Noc2p family (TAIR:AT2G18220.1); Has 382 Blast hits to 364 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 131; Plants - 77; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).;Noc2p familyCoding geneHOM001404 ORTHO024901
X AT3G55512Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAG;rna_type=mirna;MIR172D; miRNARNA gene
X AT3G55515ROTUNDIFOLIA like 7 (RTFL7); CONTAINS InterPro DOMAIN/s: DVL (InterPro:IPR012552); BEST Arabidopsis thaliana protein match is: ROTUNDIFOLIA like 8 (TAIR:AT2G39705.1); Has 170 Blast hits to 170 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 170; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;ROTUNDIFOLIA like 7Coding geneHOM007023 ORTHO017401
V AT3G55520FKBP-like peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: chloroplast thylakoid lumen; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: FKBP-type peptidyl-prolyl cis-trans isomerase family protein (TAIR:AT5G48570.1); Has 8353 Blast hits to 7666 proteins in 1517 species: Archae - 10; Bacteria - 3980; Metazoa - 1950; Fungi - 483; Plants - 752; Viruses - 0; Other Eukaryotes - 1178 (source: NCBI BLink).;FKBP-like peptidyl-prolyl cis-trans isomerase family proteinCoding geneHOM000040 ORTHO017766
X AT3G55530Encodes an intracellular membrane localized protein with E3 ligase activity that is involved in regulation of ABA signaling. Loss of function alleles show decreased sensitivity to ABA. Overexpression results in increased sensitivity to ABA.;RING/U-box superfamily proteinCoding geneHOM000019 ORTHO006973
X AT3G55540nuclear transport factor 2 (NTF2) family protein; FUNCTIONS IN: protein transporter activity; INVOLVED IN: transport, protein import into nucleus; LOCATED IN: nucleus, intracellular; CONTAINS InterPro DOMAIN/s: Nuclear transport factor 2 (InterPro:IPR002075), Nuclear transport factor 2, Eukaryote (InterPro:IPR018222); BEST Arabidopsis thaliana protein match is: Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain (TAIR:AT1G69250.1); Has 278 Blast hits to 202 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 22; Plants - 247; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).;nuclear transport factor 2 (NTF2) family proteinCoding geneHOM001048 ORTHO076386
X AT3G55550Concanavalin A-like lectin protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Legume lectin, beta chain (InterPro:IPR001220), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: Concanavalin A-like lectin protein kinase family protein (TAIR:AT3G53810.1); Has 119390 Blast hits to 117908 proteins in 4651 species: Archae - 98; Bacteria - 13453; Metazoa - 44108; Fungi - 10128; Plants - 34151; Viruses - 398; Other Eukaryotes - 17054 (source: NCBI BLink).;Concanavalin A-like lectin protein kinase family proteinCoding geneHOM000001 ORTHO024902
V AT3G55560AT-hook protein of GA feedback 2 (AGF2); INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: AT-hook motif nuclear-localized protein 20 (TAIR:AT4G14465.1); Has 804 Blast hits to 798 proteins in 45 species: Archae - 0; Bacteria - 14; Metazoa - 18; Fungi - 6; Plants - 758; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).;AT-hook protein of GA feedback 2Coding geneHOM000277 ORTHO056684
X AT3G55566unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding genesingleton
X AT3G55570unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G41761.1); Has 128 Blast hits to 128 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 128; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM005697 ORTHO064135
X AT3G55573unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding genesingleton
X AT3G55580Regulator of chromosome condensation (RCC1) family protein; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: Regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G53830.1); Has 20178 Blast hits to 6212 proteins in 476 species: Archae - 78; Bacteria - 2696; Metazoa - 7040; Fungi - 1181; Plants - 2975; Viruses - 2; Other Eukaryotes - 6206 (source: NCBI BLink).;Regulator of chromosome condensation (RCC1) family proteinCoding geneHOM000037 ORTHO005623
X AT3G55590Glucose-1-phosphate adenylyltransferase family protein; FUNCTIONS IN: transferase activity, nucleotidyltransferase activity; INVOLVED IN: biosynthetic process; EXPRESSED IN: sperm cell, flower; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Trimeric LpxA-like (InterPro:IPR011004), Bacterial transferase hexapeptide repeat (InterPro:IPR001451), Nucleotidyl transferase (InterPro:IPR005835); BEST Arabidopsis thaliana protein match is: Glucose-1-phosphate adenylyltransferase family protein (TAIR:AT2G39770.2); Has 28049 Blast hits to 28039 proteins in 2988 species: Archae - 1027; Bacteria - 19713; Metazoa - 435; Fungi - 343; Plants - 435; Viruses - 2; Other Eukaryotes - 6094 (source: NCBI BLink).;Glucose-1-phosphate adenylyltransferase family proteinCoding geneHOM002422 ORTHO004589
X AT3G55600Membrane fusion protein Use1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vesicle transport protein, Use1 (InterPro:IPR019150); BEST Arabidopsis thaliana protein match is: Membrane fusion protein Use1 (TAIR:AT1G54110.1); Has 235 Blast hits to 235 proteins in 85 species: Archae - 1; Bacteria - 13; Metazoa - 90; Fungi - 42; Plants - 82; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).;Membrane fusion protein Use1Coding geneHOM002954 ORTHO002274
V AT3G55605Mitochondrial glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: Mitochondrial glycoprotein family protein (TAIR:AT2G39795.1); Has 417 Blast hits to 417 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 121; Plants - 221; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).;Mitochondrial glycoprotein family proteinCoding geneHOM001001 ORTHO011042
V AT3G55610encodes delta 1-pyrroline-5-carboxylate synthetase B. Gene expression is induced by dehydration, high salt and ABA. Knock-out mutations in P5CS2 are embryo-lethal. P5CS2 appears to be present in different cells and/or different subcellular locations from P5CS1 in a tissue-dependent manner.;delta 1-pyrroline-5-carboxylate synthase 2Coding geneHOM001811 ORTHO000782
X AT3G55620embryo defective 1624 (emb1624); FUNCTIONS IN: ribosome binding, translation initiation factor activity; INVOLVED IN: translational initiation, embryo development ending in seed dormancy; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor IF6 (InterPro:IPR002769); BEST Arabidopsis thaliana protein match is: Translation initiation factor IF6 (TAIR:AT2G39820.1); Has 941 Blast hits to 941 proteins in 349 species: Archae - 255; Bacteria - 0; Metazoa - 235; Fungi - 146; Plants - 134; Viruses - 0; Other Eukaryotes - 171 (source: NCBI BLink).;Translation initiation factor IF6Coding geneHOM001904 ORTHO001324
V AT3G55630DHFS-FPGS homolog D (DFD); CONTAINS InterPro DOMAIN/s: Folylpolyglutamate synthetase, conserved site (InterPro:IPR018109), Mur ligase, central (InterPro:IPR013221), Mur ligase, C-terminal (InterPro:IPR004101), Folylpolyglutamate synthetase (InterPro:IPR001645); BEST Arabidopsis thaliana protein match is: DHFS-FPGS homolog B (TAIR:AT5G05980.2); Has 7708 Blast hits to 7704 proteins in 2536 species: Archae - 43; Bacteria - 4842; Metazoa - 167; Fungi - 350; Plants - 132; Viruses - 0; Other Eukaryotes - 2174 (source: NCBI BLink).;DHFS-FPGS homolog DCoding geneHOM000743 ORTHO002687
V AT3G55640Mitochondrial substrate carrier family protein; FUNCTIONS IN: binding, transporter activity; INVOLVED IN: transport, mitochondrial transport, transmembrane transport; LOCATED IN: mitochondrial inner membrane, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: Mitochondrial substrate carrier family protein (TAIR:AT3G53940.1); Has 29480 Blast hits to 14258 proteins in 460 species: Archae - 0; Bacteria - 2; Metazoa - 12173; Fungi - 9267; Plants - 4909; Viruses - 0; Other Eukaryotes - 3129 (source: NCBI BLink).;Mitochondrial substrate carrier family proteinCoding geneHOM000008 ORTHO002306
V AT3G55646unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G39855.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).Coding geneHOM022612 ORTHO024422
V AT3G55650Pyruvate kinase family protein; FUNCTIONS IN: pyruvate kinase activity, potassium ion binding, magnesium ion binding, catalytic activity; INVOLVED IN: glycolysis; LOCATED IN: mitochondrion; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Pyruvate kinase, C-terminal-like (InterPro:IPR015795), Pyruvate kinase, active site (InterPro:IPR018209), Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), Pyruvate kinase, alpha/beta (InterPro:IPR015794), Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate kinase (InterPro:IPR001697), Pyruvate kinase, barrel (InterPro:IPR015793); BEST Arabidopsis thaliana protein match is: Pyruvate kinase family protein (TAIR:AT3G55810.1); Has 10181 Blast hits to 10077 proteins in 2689 species: Archae - 168; Bacteria - 6004; Metazoa - 548; Fungi - 219; Plants - 542; Viruses - 0; Other Eukaryotes - 2700 (source: NCBI BLink).;Pyruvate kinase family proteinCoding geneHOM000109 ORTHO000085
V AT3G55660Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.;ROP (rho of plants) guanine nucleotide exchange factor 6Coding geneHOM000974 ORTHO039771
X AT3G55665Plant self-incompatibility protein S1 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: Plant self-incompatibility protein S1 family (TAIR:AT3G55672.1); Has 255 Blast hits to 244 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 255; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Plant self-incompatibility protein S1 familyCoding geneHOM002037 ORTHO000976
X AT3G55670CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566); BEST Arabidopsis thaliana protein match is: F-box/RNI-like/FBD-like domains-containing protein (TAIR:AT3G52680.2); Has 400 Blast hits to 249 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 400; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM000308 ORTHO000039
X AT3G55672Plant self-incompatibility protein S1 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: Plant self-incompatibility protein S1 family (TAIR:AT3G55665.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Plant self-incompatibility protein S1 familyCoding geneHOM002037 ORTHO000976
X AT3G55677Plant self-incompatibility protein S1 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: Plant self-incompatibility protein S1 family (TAIR:AT3G55672.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).;Plant self-incompatibility protein S1 familyCoding geneHOM002037 ORTHO000976
X AT3G55680Plant invertase/pectin methylesterase inhibitor superfamily protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: pedicel, synergid; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: Plant invertase/pectin methylesterase inhibitor superfamily protein (TAIR:AT2G31430.1); Has 30 Blast hits to 30 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Plant invertase/pectin methylesterase inhibitor superfamily proteinCoding geneHOM011689 ORTHO013463
X AT3G55690unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G39870.1); Has 76 Blast hits to 69 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 3; Plants - 69; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM022841 ORTHO024423
X AT3G55700UDP-Glycosyltransferase superfamily protein; FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-Glycosyltransferase superfamily protein (TAIR:AT3G55710.1); Has 7349 Blast hits to 7304 proteins in 405 species: Archae - 0; Bacteria - 293; Metazoa - 1947; Fungi - 30; Plants - 5000; Viruses - 26; Other Eukaryotes - 53 (source: NCBI BLink).;UDP-Glycosyltransferase superfamily proteinCoding geneHOM000023 ORTHO003740
X AT3G55710UDP-Glycosyltransferase superfamily protein; FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-Glycosyltransferase superfamily protein (TAIR:AT3G55700.1); Has 7655 Blast hits to 7604 proteins in 455 species: Archae - 0; Bacteria - 332; Metazoa - 2135; Fungi - 27; Plants - 4985; Viruses - 116; Other Eukaryotes - 60 (source: NCBI BLink).;UDP-Glycosyltransferase superfamily proteinCoding geneHOM000023 ORTHO003740
X AT3G55720Protein of unknown function (DUF620); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF620 (InterPro:IPR006873); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF620) (TAIR:AT5G05840.1); Has 215 Blast hits to 214 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 215; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Protein of unknown function (DUF620)Coding geneHOM002158 ORTHO017767
X AT3G55730putative transcription factor MYB109 (MYB109) mRNA,;myb domain protein 109Coding geneHOM000014 ORTHO006004
X AT3G55734Encodes a microRNA that targets several TIR1/AFB family members and one bHLH family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCCAAAGGGAUCGCAUUGAUCC. Targets are: F-box proteins and bHLH transcription factor. Specifically cleaves AFB3 transcripts, controlling AFB3 mRNA accumulation in roots in response to nitrate exposure.;rna_type=mirna;MIR393B; miRNARNA gene
X AT3G55735tRNA-Met (anticodon: CAT);rna_type=pre-trna;pre-tRNARNA gene
X AT3G55740Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed most highly in the roots.;proline transporter 2Coding geneHOM000191 ORTHO007791
V AT3G55750Ribosomal protein L35Ae family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, ribosome, cytosolic large ribosomal subunit, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: Ribosomal protein L35Ae family protein (TAIR:AT1G41880.1); Has 763 Blast hits to 763 proteins in 256 species: Archae - 23; Bacteria - 0; Metazoa - 322; Fungi - 146; Plants - 149; Viruses - 0; Other Eukaryotes - 123 (source: NCBI BLink).;Ribosomal protein L35Ae family proteinCoding geneHOM001329 ORTHO000306
V AT3G55760unknown protein; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G42430.2); Has 176 Blast hits to 125 proteins in 40 species: Archae - 0; Bacteria - 3; Metazoa - 19; Fungi - 9; Plants - 81; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).Coding geneHOM001603 ORTHO003761
X AT3G55770GATA type zinc finger transcription factor family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, LIM-type (InterPro:IPR001781); BEST Arabidopsis thaliana protein match is: GATA type zinc finger transcription factor family protein (TAIR:AT2G39900.1).;GATA type zinc finger transcription factor family proteinCoding geneHOM002225 ORTHO017404
X AT3G55780Glycosyl hydrolase superfamily protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: shoot apex, embryo, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: Glycosyl hydrolase family 17 protein (TAIR:AT3G61810.1); Has 2109 Blast hits to 2094 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 4; Plants - 2095; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).;Glycosyl hydrolase superfamily proteinCoding geneHOM000056 ORTHO062621
X AT3G55790unknown protein; Has 698 Blast hits to 549 proteins in 106 species: Archae - 0; Bacteria - 92; Metazoa - 317; Fungi - 24; Plants - 183; Viruses - 2; Other Eukaryotes - 80 (source: NCBI BLink).Coding genesingleton
X AT3G55795tRNA-Met (anticodon: CAT);rna_type=pre-trna;pre-tRNARNA gene
V AT3G55800Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type.;sedoheptulose-bisphosphataseCoding geneHOM000155 ORTHO001583
X AT3G55810Pyruvate kinase family protein; FUNCTIONS IN: pyruvate kinase activity, potassium ion binding, magnesium ion binding, catalytic activity; INVOLVED IN: glycolysis; CONTAINS InterPro DOMAIN/s: Pyruvate kinase, C-terminal-like (InterPro:IPR015795), Pyruvate kinase, active site (InterPro:IPR018209), Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), Pyruvate kinase, alpha/beta (InterPro:IPR015794), Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate kinase (InterPro:IPR001697), Pyruvate kinase, barrel (InterPro:IPR015793); BEST Arabidopsis thaliana protein match is: Pyruvate kinase family protein (TAIR:AT3G55650.1); Has 9930 Blast hits to 9886 proteins in 2717 species: Archae - 165; Bacteria - 6026; Metazoa - 534; Fungi - 217; Plants - 529; Viruses - 0; Other Eukaryotes - 2459 (source: NCBI BLink).;Pyruvate kinase family proteinCoding geneHOM000109 ORTHO000085
X AT3G55820Fasciclin-like arabinogalactan family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAS1 domain (InterPro:IPR000782); Has 34 Blast hits to 34 proteins in 13 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Fasciclin-like arabinogalactan family proteinCoding geneHOM014579 ORTHO024903
V AT3G55830A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.;Nucleotide-diphospho-sugar transferases superfamily proteinCoding geneHOM000819 ORTHO000541
X AT3G55840Hs1pro-1 protein; CONTAINS InterPro DOMAIN/s: Hs1pro-1, C-terminal (InterPro:IPR009743), Hs1pro-1, N-terminal (InterPro:IPR009869); BEST Arabidopsis thaliana protein match is: ortholog of sugar beet HS1 PRO-1 2 (TAIR:AT2G40000.1); Has 60 Blast hits to 60 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Hs1pro-1 proteinCoding geneHOM005372 ORTHO005568
V AT3G55850Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids.;Amidohydrolase familyCoding geneHOM001208 ORTHO002476
X AT3G55860unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G60660.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding genesingleton
X AT3G55870ADC synthase superfamily protein; FUNCTIONS IN: oxo-acid-lyase activity, anthranilate synthase activity; INVOLVED IN: tryptophan biosynthetic process, biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: sepal, male gametophyte, flower, carpel, cultured cell; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Anthranilate synthase component I, N-terminal (InterPro:IPR006805), Chorismate binding, C-terminal (InterPro:IPR015890), ADC synthase (InterPro:IPR005801), Anthranilate synthase component I (InterPro:IPR019999), Anthranilate synthase component I, PabB-like (InterPro:IPR005256); BEST Arabidopsis thaliana protein match is: anthranilate synthase alpha subunit 1 (TAIR:AT5G05730.1); Has 15837 Blast hits to 15836 proteins in 2536 species: Archae - 246; Bacteria - 10713; Metazoa - 5; Fungi - 310; Plants - 185; Viruses - 0; Other Eukaryotes - 4378 (source: NCBI BLink).;ADC synthase superfamily proteinCoding geneHOM000725 ORTHO002639
X AT3G55880A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance.;Alpha/beta hydrolase related proteinCoding geneHOM001773 ORTHO024425
X AT3G55890Yippee family putative zinc-binding protein; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: Yippee family putative zinc-binding protein (TAIR:AT2G40110.1); Has 985 Blast hits to 985 proteins in 210 species: Archae - 0; Bacteria - 0; Metazoa - 467; Fungi - 205; Plants - 238; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).;Yippee family putative zinc-binding proteinCoding geneHOM000928 ORTHO003319
X AT3G55900F-box family protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810); Has 37 Blast hits to 37 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;F-box family proteinCoding genesingleton
X AT3G55910unknown protein; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding genesingleton
X AT3G55920Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type, conserved site (InterPro:IPR020892); BEST Arabidopsis thaliana protein match is: cyclophilin 5 (TAIR:AT2G29960.1); Has 16458 Blast hits to 16421 proteins in 2673 species: Archae - 109; Bacteria - 6881; Metazoa - 2905; Fungi - 1389; Plants - 1283; Viruses - 4; Other Eukaryotes - 3887 (source: NCBI BLink).;Cyclophilin-like peptidyl-prolyl cis-trans isomerase family proteinCoding geneHOM000021 ORTHO002556
X AT3G55930Pre-mRNA-splicing factor 3; CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); BEST Arabidopsis thaliana protein match is: Pre-mRNA-splicing factor 3 (TAIR:AT1G28060.1); Has 549 Blast hits to 518 proteins in 205 species: Archae - 0; Bacteria - 10; Metazoa - 155; Fungi - 156; Plants - 71; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink).;Pre-mRNA-splicing factor 3Coding geneHOM002418 ORTHO077513
X AT3G55940Phosphoinositide-specific phospholipase C family protein; FUNCTIONS IN: phosphoinositide phospholipase C activity, phospholipase C activity, phosphoric diester hydrolase activity; INVOLVED IN: signal transduction, intracellular signaling pathway, lipid metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Phospholipase C, phosphoinositol-specific, EF-hand-like (InterPro:IPR015359), Phospholipase C, phosphatidylinositol-specific , X domain (InterPro:IPR000909), C2 calcium/lipid-binding domain, CaLB (InterPro:IPR008973), Phospholipase C, phosphoinositol-specific (InterPro:IPR001192), Phospholipase C, phosphatidylinositol-specific, Y domain (InterPro:IPR001711), PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946), C2 membrane targeting protein (InterPro:IPR018029), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: phospholipase C 2 (TAIR:AT3G08510.2); Has 7225 Blast hits to 3392 proteins in 352 species: Archae - 10; Bacteria - 635; Metazoa - 3351; Fungi - 1029; Plants - 675; Viruses - 45; Other Eukaryotes - 1480 (source: NCBI BLink).;Phosphoinositide-specific phospholipase C family proteinCoding geneHOM000683 ORTHO002019
X AT3G55950CRINKLY4 related 3 (CCR3); FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CRINKLY4 related 4 (TAIR:AT5G47850.1); Has 117697 Blast hits to 115463 proteins in 4296 species: Archae - 105; Bacteria - 13273; Metazoa - 42642; Fungi - 9844; Plants - 33569; Viruses - 607; Other Eukaryotes - 17657 (source: NCBI BLink).;CRINKLY4 related 3Coding geneHOM000001 ORTHO024904
X AT3G55960Haloacid dehalogenase-like hydrolase (HAD) superfamily protein; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: Haloacid dehalogenase-like hydrolase (HAD) superfamily protein (TAIR:AT1G29780.1); Has 2169 Blast hits to 2162 proteins in 238 species: Archae - 0; Bacteria - 0; Metazoa - 723; Fungi - 425; Plants - 384; Viruses - 0; Other Eukaryotes - 637 (source: NCBI BLink).;Haloacid dehalogenase-like hydrolase (HAD) superfamily proteinCoding geneHOM000187 ORTHO006220
X AT3G55970jasmonate-regulated gene 21 (JRG21); FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: oxidation reduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), Oxoglutarate/iron-dependent oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein (TAIR:AT5G05600.1); Has 8809 Blast hits to 8750 proteins in 1005 species: Archae - 0; Bacteria - 1115; Metazoa - 109; Fungi - 1073; Plants - 4993; Viruses - 0; Other Eukaryotes - 1519 (source: NCBI BLink).;jasmonate-regulated gene 21Coding geneHOM000029 ORTHO013620
X AT3G55980salt-inducible zinc finger 1 (SZF1); CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Ankyrin repeat-containing domain (InterPro:IPR020683), Ankyrin repeat (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT2G40140.2); Has 1623 Blast hits to 1414 proteins in 181 species: Archae - 2; Bacteria - 49; Metazoa - 777; Fungi - 32; Plants - 465; Viruses - 2; Other Eukaryotes - 296 (source: NCBI BLink).;salt-inducible zinc finger 1Coding geneHOM000410 ORTHO000673
X AT3G55990Encodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).;Plant protein of unknown function (DUF828)Coding geneHOM000108 ORTHO013509
X AT3G56000encodes a gene similar to cellulose synthase;cellulose synthase like A14Coding geneHOM000460 ORTHO000385
V AT3G56010unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding genesingleton
V AT3G56020Ribosomal protein L41 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, cytosolic large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 185 Blast hits to 185 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 88; Fungi - 40; Plants - 48; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).;Ribosomal protein L41 familyCoding genesingleton
X AT3G56030Tetratricopeptide repeat (TPR)-like superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT2G40240.1); Has 15146 Blast hits to 5016 proteins in 154 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 20; Plants - 14896; Viruses - 0; Other Eukaryotes - 172 (source: NCBI BLink).;Tetratricopeptide repeat (TPR)-like superfamily proteinCoding geneHOM000003 ORTHO024427
V AT3G56040UDP-glucose pyrophosphorylase 3 (UGP3); FUNCTIONS IN: nucleotidyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UTP--glucose-1-phosphate uridylyltransferase (InterPro:IPR002618); Has 215 Blast hits to 211 proteins in 91 species: Archae - 0; Bacteria - 18; Metazoa - 12; Fungi - 60; Plants - 85; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink).;UDP-glucose pyrophosphorylase 3Coding geneHOM004348 ORTHO004636
X AT3G56050Protein kinase family protein; FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: Protein kinase family protein (TAIR:AT2G40270.1); Has 41170 Blast hits to 40839 proteins in 1653 species: Archae - 20; Bacteria - 2328; Metazoa - 11695; Fungi - 793; Plants - 23080; Viruses - 152; Other Eukaryotes - 3102 (source: NCBI BLink).;Protein kinase family proteinCoding geneHOM000001 ORTHO024428
X AT3G56060Glucose-methanol-choline (GMC) oxidoreductase family protein; FUNCTIONS IN: aldehyde-lyase activity, oxidoreductase activity, acting on CH-OH group of donors, FAD binding; INVOLVED IN: alcohol metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Glucose-methanol-choline oxidoreductase, N-terminal (InterPro:IPR000172), Glucose-methanol-choline oxidoreductase (InterPro:IPR012132), Glucose-methanol-choline oxidoreductase, C-terminal (InterPro:IPR007867); BEST Arabidopsis thaliana protein match is: Glucose-methanol-choline (GMC) oxidoreductase family protein (TAIR:AT5G51950.1); Has 10629 Blast hits to 10467 proteins in 1108 species: Archae - 4; Bacteria - 3922; Metazoa - 819; Fungi - 1505; Plants - 305; Viruses - 15; Other Eukaryotes - 4059 (source: NCBI BLink).;Glucose-methanol-choline (GMC) oxidoreductase family proteinCoding geneHOM002480 ORTHO005472
V AT3G56070rotamase cyclophilin 2 (ROC2) exhibiting peptidyl-prolyl cis-trans isomerase activity involved in signal transduction.;rotamase cyclophilin 2Coding geneHOM000021 ORTHO011195
X AT3G56080S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT2G40280.1); Has 1162 Blast hits to 1119 proteins in 165 species: Archae - 0; Bacteria - 246; Metazoa - 1; Fungi - 5; Plants - 904; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).;S-adenosyl-L-methionine-dependent methyltransferases superfamily proteinCoding geneHOM000290 ORTHO013510
X AT3G56085tRNA-Lys (anticodon: CTT);rna_type=pre-trna;pre-tRNARNA gene
V AT3G56090Encodes FERRITIN 3, AtFER3. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool.;ferritin 3Coding geneHOM001161 ORTHO001257
X AT3G56100Protein kinase expressed in meristematic cells. Phosphorylates AGL24.;meristematic receptor-like kinaseCoding geneHOM000001 ORTHO006784
V AT3G56110prenylated RAB acceptor 1.B1 (PRA1.B1); CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: prenylated RAB acceptor 1.B2 (TAIR:AT2G40380.1); Has 577 Blast hits to 577 proteins in 157 species: Archae - 0; Bacteria - 0; Metazoa - 115; Fungi - 114; Plants - 309; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).;prenylated RAB acceptor 1.B1Coding geneHOM000664 ORTHO000812
X AT3G56120S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function Met10 (InterPro:IPR003402); BEST Arabidopsis thaliana protein match is: Met-10+ like family protein (TAIR:AT4G27340.1); Has 1391 Blast hits to 1232 proteins in 427 species: Archae - 416; Bacteria - 202; Metazoa - 266; Fungi - 150; Plants - 114; Viruses - 0; Other Eukaryotes - 243 (source: NCBI BLink).;S-adenosyl-L-methionine-dependent methyltransferases superfamily proteinCoding geneHOM000621 ORTHO001123
V AT3G56130biotin/lipoyl attachment domain-containing protein; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089), Galactose-binding domain-like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: Single hybrid motif superfamily protein (TAIR:AT1G52670.1); Has 2050 Blast hits to 2050 proteins in 795 species: Archae - 23; Bacteria - 1613; Metazoa - 0; Fungi - 2; Plants - 110; Viruses - 0; Other Eukaryotes - 302 (source: NCBI BLink).;biotin/lipoyl attachment domain-containing proteinCoding geneHOM005369 ORTHO075884
V AT3G56140Protein of unknown function (DUF399 and DUF3411); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF399 (InterPro:IPR007314), Protein of unknown function DUF3411 (InterPro:IPR021825); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF399 and DUF3411) (TAIR:AT2G40400.2); Has 538 Blast hits to 538 proteins in 131 species: Archae - 0; Bacteria - 182; Metazoa - 33; Fungi - 6; Plants - 279; Viruses - 6; Other Eukaryotes - 32 (source: NCBI BLink).;Protein of unknown function (DUF399 and DUF3411)Coding geneHOM000568 ORTHO009048
V AT3G56150member of eIF3c - eukaryotic initiation factor 3c;eukaryotic translation initiation factor 3CCoding geneHOM001310 ORTHO000621
V AT3G56160Sodium Bile acid symporter family; FUNCTIONS IN: bile acid:sodium symporter activity; INVOLVED IN: sodium ion transport; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bile acid:sodium symporter (InterPro:IPR002657); Has 3096 Blast hits to 3087 proteins in 1049 species: Archae - 42; Bacteria - 2090; Metazoa - 108; Fungi - 101; Plants - 149; Viruses - 0; Other Eukaryotes - 606 (source: NCBI BLink).;Sodium Bile acid symporter familyCoding geneHOM001790 ORTHO001264
X AT3G56170Encodes a calcium-dependent nuclease with similarity to staphylococcal nuclease.;Ca-2+ dependent nucleaseCoding geneHOM004521 ORTHO013513
X AT3G56180Protein of unknown function (DUF567); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF567 (InterPro:IPR007612); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF567) (TAIR:AT3G10986.1); Has 252 Blast hits to 250 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 250; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Protein of unknown function (DUF567)Coding geneHOM002732 ORTHO024625
V AT3G56190Encodes one of two alpha-SNAPs (soluble NSF attachment protein) in Arabidopsis;alpha-soluble NSF attachment protein 2Coding geneHOM001576 ORTHO000832
X AT3G56200Encodes a putative amino acid transporter.;Transmembrane amino acid transporter family proteinCoding geneHOM000970 ORTHO024430
X AT3G56210ARM repeat superfamily protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024).;ARM repeat superfamily proteinCoding geneHOM016564 ORTHO017768
X AT3G56220transcription regulators; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: regulation of transcription; CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40435.1); Has 248 Blast hits to 248 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 248; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;transcription regulatorsCoding geneHOM006297 ORTHO011045
X AT3G56230BTB/POZ domain-containing protein; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: BTB/POZ domain-containing protein (TAIR:AT1G01640.2); Has 5225 Blast hits to 5141 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 3910; Fungi - 3; Plants - 1048; Viruses - 41; Other Eukaryotes - 223 (source: NCBI BLink).;BTB/POZ domain-containing proteinCoding geneHOM006586 ORTHO011196
V AT3G56240CCH protein belongs to a family of eukaryotic proteins that participate in intracellular copper homeostasis by delivering this metal to the secretory pathway; mainly located along the vascular bundles of senescing leaves and petioles as well as in stem sieve elements; hypothesized to have a role in copper mobilization from decaying organs towards reproductive structures, as a result of metalloprotein breakdown. The plant-specific C-terminal domain of the CCH protein forms amyloid-like fibrils in vitro.;copper chaperoneCoding geneHOM000278 ORTHO084359
X AT3G56250unknown protein; Has 109 Blast hits to 83 proteins in 41 species: Archae - 0; Bacteria - 6; Metazoa - 18; Fungi - 20; Plants - 21; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink).Coding genesingleton
X AT3G56260unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40475.1).Coding genesingleton
X AT3G56270Plant protein of unknown function (DUF827); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: Plant protein of unknown function (DUF827) (TAIR:AT2G40480.1); Has 221 Blast hits to 221 proteins in 41 species: Archae - 2; Bacteria - 8; Metazoa - 49; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).;Plant protein of unknown function (DUF827)Coding geneHOM022377 ORTHO024431
X AT3G56275pseudogene of unknown protein;pseudogenePseudo gene
X AT3G56277copia-like retrotransposon family, has a 4.6e-16 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);rna_type=other_rna;transposable element geneTransposon
X AT3G56280pseudogene, protein kinase family, contains protein kinase domain, Pfam:PF00069; blastp match of 44% identity and 9.2e-11 P-value to GP|3947676|emb|CAA21067.1||AL031652 dJ1119D9.1 (PAK5 (KIAA1264) (P21-Rho-binding domain containing serine/threonine protein kinase)) {Homo sapiens};pseudogenePseudo gene
X AT3G56290unknown protein; Has 39 Blast hits to 39 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM009645 ORTHO006221
X AT3G56300Cysteinyl-tRNA synthetase, class Ia family protein; FUNCTIONS IN: cysteine-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: cysteinyl-tRNA aminoacylation, translation; LOCATED IN: cytoplasm; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cysteinyl-tRNA synthetase, class Ia (InterPro:IPR002308), Cysteinyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015803), Cysteinyl-tRNA synthetase, class Ia, C-terminal (InterPro:IPR015804); BEST Arabidopsis thaliana protein match is: Cysteinyl-tRNA synthetase, class Ia family protein (TAIR:AT5G38830.1); Has 11222 Blast hits to 10904 proteins in 2870 species: Archae - 213; Bacteria - 6026; Metazoa - 414; Fungi - 276; Plants - 133; Viruses - 3; Other Eukaryotes - 4157 (source: NCBI BLink).;Cysteinyl-tRNA synthetase, class Ia family proteinCoding geneHOM000547 ORTHO024905
V AT3G56310Melibiase family protein; FUNCTIONS IN: alpha-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process, lactose catabolic process; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Glycoside hydrolase, family 27 (InterPro:IPR002241), Glycoside hydrolase, clan GH-D (InterPro:IPR000111), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: alpha-galactosidase 2 (TAIR:AT5G08370.1); Has 1574 Blast hits to 1565 proteins in 338 species: Archae - 4; Bacteria - 582; Metazoa - 329; Fungi - 273; Plants - 224; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink).;Melibiase family proteinCoding geneHOM001215 ORTHO003904
V AT3G56320PAP/OAS1 substrate-binding domain superfamily; FUNCTIONS IN: nucleotidyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Nucleotidyl transferase domain (InterPro:IPR002934), PAP/25A-associated (InterPro:IPR002058); BEST Arabidopsis thaliana protein match is: Nucleotidyltransferase family protein (TAIR:AT2G40520.4); Has 391 Blast hits to 365 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 57; Fungi - 102; Plants - 177; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).;PAP/OAS1 substrate-binding domain superfamilyCoding geneHOM001479 ORTHO024432
X AT3G56330N2,N2-dimethylguanosine tRNA methyltransferase; FUNCTIONS IN: RNA binding, tRNA (guanine-N2-)-methyltransferase activity; INVOLVED IN: tRNA processing; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: N2,N2-dimethylguanosine tRNA methyltransferase (InterPro:IPR002905); BEST Arabidopsis thaliana protein match is: N2,N2-dimethylguanosine tRNA methyltransferase (TAIR:AT5G15810.1); Has 951 Blast hits to 937 proteins in 347 species: Archae - 257; Bacteria - 66; Metazoa - 191; Fungi - 140; Plants - 103; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink).;N2,N2-dimethylguanosine tRNA methyltransferaseCoding geneHOM004525 ORTHO004637
V AT3G56340Ribosomal protein S26e family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: Ribosomal protein S26e family protein (TAIR:AT2G40510.1); Has 761 Blast hits to 761 proteins in 271 species: Archae - 53; Bacteria - 0; Metazoa - 311; Fungi - 152; Plants - 116; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink).;Ribosomal protein S26e family proteinCoding geneHOM001419 ORTHO000507
V AT3G56350Iron/manganese superoxide dismutase family protein; FUNCTIONS IN: superoxide dismutase activity, metal ion binding; INVOLVED IN: oxidation reduction, superoxide metabolic process, removal of superoxide radicals; LOCATED IN: mitochondrion, endomembrane system; EXPRESSED IN: male gametophyte, seed; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Manganese/iron superoxide dismutase, N-terminal (InterPro:IPR019831), Manganese/iron superoxide dismutase (InterPro:IPR001189), Manganese/iron superoxide dismutase, C-terminal (InterPro:IPR019832), Manganese/iron superoxide dismutase, binding site (InterPro:IPR019833); BEST Arabidopsis thaliana protein match is: manganese superoxide dismutase 1 (TAIR:AT3G10920.1); Has 11272 Blast hits to 11271 proteins in 3338 species: Archae - 194; Bacteria - 7997; Metazoa - 445; Fungi - 707; Plants - 423; Viruses - 1; Other Eukaryotes - 1505 (source: NCBI BLink).;Iron/manganese superoxide dismutase family proteinCoding geneHOM000363 ORTHO090710
V AT3G56360unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G05250.1); Has 45 Blast hits to 45 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM008581 ORTHO017769
X AT3G56370Leucine-rich repeat protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, catalytic domain (InterPro:IPR000719), Leucine-rich repeat-containing N-terminal domain, type 2 (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine-threonine/tyrosine-protein kinase (InterPro:IPR001245), Protein kinase-like domain (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: Leucine-rich receptor-like protein kinase family protein (TAIR:AT5G01890.1); Has 218234 Blast hits to 138588 proteins in 4594 species: Archae - 166; Bacteria - 19582; Metazoa - 73931; Fungi - 10568; Plants - 87830; Viruses - 425; Other Eukaryotes - 25732 (source: NCBI BLink).;Leucine-rich repeat protein kinase family proteinCoding geneHOM000001 ORTHO006204
X AT3G56380response regulator 17;response regulator 17Coding geneHOM000464 ORTHO024433
X AT3G56390BEST Arabidopsis thaliana protein match is: WRKY DNA-binding protein 55 (TAIR:AT2G40740.2); Has 12 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding genesingleton
X AT3G56400member of WRKY Transcription Factor; Group III. Function as activator of SA-dependent defense genes and a repressor of JA-regulated genes. WRKY70-controlled suppression of JA-signaling is partly executed by NPR1.;WRKY DNA-binding protein 70Coding geneHOM000054 ORTHO024435
X AT3G56408Potential natural antisense gene, locus overlaps with AT3G56410;rna_type=other_rna;other RNARNA gene
V AT3G56410Protein of unknown function (DUF3133); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF3133 (InterPro:IPR021480); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF3133) (TAIR:AT5G05190.1); Has 4873 Blast hits to 3554 proteins in 469 species: Archae - 21; Bacteria - 552; Metazoa - 1496; Fungi - 390; Plants - 373; Viruses - 48; Other Eukaryotes - 1993 (source: NCBI BLink).;Protein of unknown function (DUF3133)Coding geneHOM004448 ORTHO083630
X AT3G56420Thioredoxin superfamily protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin domain (InterPro:IPR013766), Thioredoxin, conserved site (InterPro:IPR017937), Thioredoxin-like subdomain (InterPro:IPR006662), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: C-terminal cysteine residue is changed to a serine 2 (TAIR:AT2G40790.1); Has 16726 Blast hits to 16570 proteins in 2924 species: Archae - 262; Bacteria - 9349; Metazoa - 1819; Fungi - 717; Plants - 1411; Viruses - 13; Other Eukaryotes - 3155 (source: NCBI BLink).;Thioredoxin superfamily proteinCoding geneHOM000250 ORTHO024436
V AT3G56430unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40800.1); Has 3121 Blast hits to 1477 proteins in 196 species: Archae - 12; Bacteria - 170; Metazoa - 996; Fungi - 324; Plants - 132; Viruses - 59; Other Eukaryotes - 1428 (source: NCBI BLink).Coding geneHOM005636 ORTHO004590
X AT3G56440homolog of yeast autophagy 18 (ATG18) D (ATG18D); CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); BEST Arabidopsis thaliana protein match is: homolog of yeast autophagy 18C (TAIR:AT2G40810.2); Has 1451 Blast hits to 1383 proteins in 243 species: Archae - 0; Bacteria - 34; Metazoa - 579; Fungi - 434; Plants - 212; Viruses - 2; Other Eukaryotes - 190 (source: NCBI BLink).;homolog of yeast autophagy 18 (ATG18) DCoding geneHOM000579 ORTHO024437
V AT3G56450member of alpha-SNAP Gene Family;alpha-soluble NSF attachment protein 1Coding geneHOM001576 ORTHO073641
V AT3G56460GroES-like zinc-binding alcohol dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding domain (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, C-terminal (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G21580.1); Has 42737 Blast hits to 42567 proteins in 2748 species: Archae - 582; Bacteria - 27121; Metazoa - 1964; Fungi - 3760; Plants - 1452; Viruses - 3; Other Eukaryotes - 7855 (source: NCBI BLink).;GroES-like zinc-binding alcohol dehydrogenase family proteinCoding geneHOM000860 ORTHO004438
X AT3G56470F-box family protein; CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G57790.1); Has 460 Blast hits to 453 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 460; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;F-box family proteinCoding geneHOM005171 ORTHO006107
X AT3G56480myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40820.1); Has 486 Blast hits to 458 proteins in 133 species: Archae - 0; Bacteria - 70; Metazoa - 142; Fungi - 25; Plants - 111; Viruses - 1; Other Eukaryotes - 137 (source: NCBI BLink).;myosin heavy chain-relatedCoding geneHOM004855 ORTHO005551
V AT3G56490Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro.;HIS triad family protein 3Coding geneHOM001531 ORTHO000829
X AT3G56500serine-rich protein-related; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24577.1); Has 135 Blast hits to 133 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 135; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;serine-rich protein-relatedCoding genesingleton
X AT3G56510RNA-binding (RRM/RBD/RNP motifs) family protein; FUNCTIONS IN: TATA-binding protein binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504); Has 528 Blast hits to 522 proteins in 214 species: Archae - 0; Bacteria - 2; Metazoa - 211; Fungi - 183; Plants - 47; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).;RNA-binding (RRM/RBD/RNP motifs) family proteinCoding geneHOM002244 ORTHO001313
X AT3G56520NAC (No Apical Meristem) domain transcriptional regulator superfamily protein; FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 95 (TAIR:AT5G41090.1); Has 1738 Blast hits to 1735 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1738; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;NAC (No Apical Meristem) domain transcriptional regulator superfamily proteinCoding geneHOM000052 ORTHO024906
X AT3G56530NAC domain containing protein 64 (NAC064); CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 93 (TAIR:AT5G39690.1); Has 2590 Blast hits to 2582 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2590; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;NAC domain containing protein 64Coding geneHOM000052 ORTHO007674
X AT3G56540alpha/beta-Hydrolases superfamily protein; FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: pollen tube; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: serine carboxypeptidase-like 39 (TAIR:AT3G52020.1); Has 3496 Blast hits to 3462 proteins in 393 species: Archae - 0; Bacteria - 271; Metazoa - 619; Fungi - 840; Plants - 1342; Viruses - 0; Other Eukaryotes - 424 (source: NCBI BLink).;alpha/beta-Hydrolases superfamily proteinCoding geneHOM000060 ORTHO099065
X AT3G56550Pentatricopeptide repeat (PPR) superfamily protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT4G21065.1); Has 30639 Blast hits to 12981 proteins in 201 species: Archae - 0; Bacteria - 4; Metazoa - 34; Fungi - 22; Plants - 30256; Viruses - 0; Other Eukaryotes - 323 (source: NCBI BLink).;Pentatricopeptide repeat (PPR) superfamily proteinCoding geneHOM000003 ORTHO059438
X AT3G56560NAC domain containing protein 65 (NAC065); FUNCTIONS IN: sequence-specific DNA binding transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC domain containing protein 63 (TAIR:AT3G55210.1); Has 1722 Blast hits to 1720 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1722; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;NAC domain containing protein 65Coding geneHOM018442 ORTHO007674
X AT3G56570SET domain-containing protein; CONTAINS InterPro DOMAIN/s: RuBisCO-cytochrome methylase, RMS1 (InterPro:IPR011383); BEST Arabidopsis thaliana protein match is: Rubisco methyltransferase family protein (TAIR:AT1G14030.1); Has 25210 Blast hits to 12491 proteins in 636 species: Archae - 52; Bacteria - 1284; Metazoa - 10981; Fungi - 2786; Plants - 1267; Viruses - 743; Other Eukaryotes - 8097 (source: NCBI BLink).;SET domain-containing proteinCoding geneHOM001769 ORTHO003369
X AT3G56580RING/U-box superfamily protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4 RING-type (InterPro:IPR018957); BEST Arabidopsis thaliana protein match is: RING-H2 finger C1A (TAIR:AT2G40830.3); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink).;RING/U-box superfamily proteinCoding geneHOM000141 ORTHO013514
X AT3G56590hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G10810.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;hydroxyproline-rich glycoprotein family proteinCoding geneHOM007306 ORTHO013618
X AT3G56600Protein kinase superfamily protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: biological_process unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3-/4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphoinositide 4-kinase gamma 1 (TAIR:AT2G40850.1); Has 560 Blast hits to 550 proteins in 149 species: Archae - 0; Bacteria - 2; Metazoa - 131; Fungi - 73; Plants - 265; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink).;Protein kinase superfamily proteinCoding geneHOM000670 ORTHO024438
X AT3G56610unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, sperm cell, sepal, pedicel, synergid; EXPRESSED DURING: 4 anthesis, C globular stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF784, Arabidopsis thaliana (InterPro:IPR008502); Has 5 Blast hits to 5 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding genesingleton
X AT3G56620nodulin MtN21 /EamA-like transporter family protein; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 /EamA-like transporter family protein (TAIR:AT2G40900.1); Has 3973 Blast hits to 3961 proteins in 822 species: Archae - 18; Bacteria - 2149; Metazoa - 8; Fungi - 0; Plants - 1241; Viruses - 0; Other Eukaryotes - 557 (source: NCBI BLink).;nodulin MtN21 /EamA-like transporter family proteinCoding geneHOM000127 ORTHO024439
X AT3G56630member of CYP94D;cytochrome P450, family 94, subfamily D, polypeptide 2Coding geneHOM000174 ORTHO013194
V AT3G56640Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion.;exocyst complex component sec15ACoding geneHOM003497 ORTHO004200
V AT3G56650Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid lumen, chloroplast stroma, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); BEST Arabidopsis thaliana protein match is: Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein (TAIR:AT1G77090.1); Has 131 Blast hits to 131 proteins in 35 species: Archae - 0; Bacteria - 29; Metazoa - 0; Fungi - 0; Plants - 100; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).;Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family proteinCoding geneHOM004437 ORTHO004638
X AT3G56660basic region/leucine zipper motif protein 49 (BZIP49); FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: Basic-leucine zipper (bZIP) transcription factor family protein (TAIR:AT2G40950.1); Has 954 Blast hits to 954 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 362; Fungi - 142; Plants - 326; Viruses - 0; Other Eukaryotes - 124 (source: NCBI BLink).;basic region/leucine zipper motif protein 49Coding geneHOM004906 ORTHO005570
X AT3G56670BEST Arabidopsis thaliana protein match is: F-box and associated interaction domains-containing protein (TAIR:AT1G32420.1); Has 58 Blast hits to 47 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM000136 ORTHO000012
X AT3G56680Single-stranded nucleic acid binding R3H protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Single-stranded nucleic acid binding R3H (InterPro:IPR001374); BEST Arabidopsis thaliana protein match is: Single-stranded nucleic acid binding R3H protein (TAIR:AT2G40960.1); Has 389 Blast hits to 389 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 196; Fungi - 53; Plants - 134; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).;Single-stranded nucleic acid binding R3H proteinCoding geneHOM005801 ORTHO006911
V AT3G56690encodes a protein similar to ATPases and binds to calmodulin in vitro. This is a single-copy gene and is expressed in all tissues examined.;Cam interacting protein 111Coding geneHOM000006 ORTHO004201
V AT3G56700fatty acid reductase 6 (FAR6); FUNCTIONS IN: fatty-acyl-CoA reductase (alcohol-forming) activity, oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor; INVOLVED IN: microsporogenesis, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: inflorescence meristem, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Male sterility (InterPro:IPR004262), NAD(P)-binding domain (InterPro:IPR016040), Male sterility, NAD-binding (InterPro:IPR013120); BEST Arabidopsis thaliana protein match is: Jojoba acyl CoA reductase-related male sterility protein (TAIR:AT3G11980.1); Has 2302 Blast hits to 2276 proteins in 434 species: Archae - 2; Bacteria - 606; Metazoa - 984; Fungi - 228; Plants - 282; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink).;fatty acid reductase 6Coding geneHOM001140 ORTHO088713
X AT3G56705gi|17665|emb|X52312.1|ATU26 Arabidopsis thaliana U2.6 snRNA gene for U2 snRNA;rna_type=snrna;U2.6; snRNARNA gene
V AT3G56710Sig1 binding protein; interacts with Sig1R4. As well as Sig1, SibI is imported into chloroplasts and its expression is light-dependent in mature chloroplasts.;sigma factor binding protein 1Coding geneHOM022364 ORTHO024443
X AT3G56720unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages.Coding genesingleton
X AT3G56730Putative endonuclease or glycosyl hydrolase; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: Putative endonuclease or glycosyl hydrolase (TAIR:AT3G62050.1).;Putative endonuclease or glycosyl hydrolaseCoding geneHOM001842 ORTHO065660
X AT3G56740Ubiquitin-associated (UBA) protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Der1-like (InterPro:IPR007599), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: Ubiquitin-associated (UBA) protein (TAIR:AT2G41160.1); Has 305 Blast hits to 304 proteins in 119 species: Archae - 6; Bacteria - 5; Metazoa - 77; Fungi - 99; Plants - 90; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).;Ubiquitin-associated (UBA) proteinCoding geneHOM002746 ORTHO003322
V AT3G56750unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41150.2); Has 128 Blast hits to 128 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).Coding geneHOM009726 ORTHO009051
X AT3G56760Protein kinase superfamily protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium-dependent protein kinase (InterPro:IPR020642), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636); BEST Arabidopsis thaliana protein match is: CDPK-related kinase 1 (TAIR:AT2G41140.1); Has 115971 Blast hits to 114244 proteins in 3013 species: Archae - 152; Bacteria - 14469; Metazoa - 43130; Fungi - 12702; Plants - 24192; Viruses - 490; Other Eukaryotes - 20836 (source: NCBI BLink).;Protein kinase superfamily proteinCoding geneHOM000002 ORTHO002266
X AT3G56770basic helix-loop-helix (bHLH) DNA-binding superfamily protein; FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: response to chitin, regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) DNA-binding superfamily protein (TAIR:AT2G41130.1); Has 549 Blast hits to 549 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 8; Plants - 532; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).;basic helix-loop-helix (bHLH) DNA-binding superfamily proteinCoding geneHOM003847 ORTHO024442
X AT3G56780FBD, F-box and Leucine Rich Repeat domains containing protein; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), F-box domain, cyclin-like (InterPro:IPR001810), F-box domain, Skp2-like (InterPro:IPR022364), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box/RNI-like/FBD-like domains-containing protein (TAIR:AT5G56420.2); Has 1624 Blast hits to 1516 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 44; Fungi - 2; Plants - 1574; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).;FBD, F-box and Leucine Rich Repeat domains containing proteinCoding geneHOM000308 ORTHO000039
X AT3G56790RNA splicing factor-related; CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); BEST Arabidopsis thaliana protein match is: Pre-mRNA-splicing factor 3 (TAIR:AT3G55930.1); Has 356 Blast hits to 326 proteins in 158 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 116; Plants - 74; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).;RNA splicing factor-relatedCoding geneHOM002418 ORTHO061565
V AT3G56800encodes a calmodulin;calmodulin 3Coding geneHOM000031 ORTHO000300
V AT3G56810unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding genesingleton
X AT3G56820unknown protein; Has 34 Blast hits to 34 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).Coding geneHOM011699 ORTHO013726
X AT3G56825gi|17663|emb|X06475.1|ATU24 Arabidopsis thaliana U2 RNA gene (U2.4);rna_type=snrna;U2.4; snRNARNA gene
V AT3G56830Similar in sequence to NPQ6 and NPQ7, but loss of function mutant does not exhibit a nonphotochemical quenching phenotype.;Protein of unknown function (DUF565)Coding geneHOM008686 ORTHO024907
X AT3G56840FAD-dependent oxidoreductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD dependent oxidoreductase (InterPro:IPR006076); Has 4748 Blast hits to 4741 proteins in 1463 species: Archae - 76; Bacteria - 3210; Metazoa - 112; Fungi - 136; Plants - 47; Viruses - 1; Other Eukaryotes - 1166 (source: NCBI BLink).;FAD-dependent oxidoreductase family proteinCoding geneHOM002797 ORTHO003370
X AT3G56850Encodes an ABA-responsive element binding protein with a bZIP domain. Located in the nucleus and expressed in the embryo during seed maturation.;ABA-responsive element binding protein 3Coding geneHOM001314 ORTHO013515
X AT3G56860encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.;UBP1-associated protein 2ACoding geneHOM000016 ORTHO011047
X AT3G56870unknown protein; Has 204 Blast hits to 201 proteins in 58 species: Archae - 0; Bacteria - 10; Metazoa - 72; Fungi - 8; Plants - 41; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).Coding geneHOM022805 ORTHO024908
X AT3G56880VQ motif-containing protein; CONTAINS InterPro DOMAIN/s: VQ (InterPro:IPR008889); BEST Arabidopsis thaliana protein match is: calmodulin (CAM)-binding protein of 25 kDa (TAIR:AT2G41010.1); Has 109 Blast hits to 109 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 106; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;VQ motif-containing proteinCoding geneHOM018431 ORTHO024440
X AT3G56890F-box associated ubiquitination effector family protein; CONTAINS InterPro DOMAIN/s: F-box associated domain, type 3 (InterPro:IPR013187), F-box associated interaction domain (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box and associated interaction domains-containing protein (TAIR:AT3G57580.1); Has 494 Blast hits to 482 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 494; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;F-box associated ubiquitination effector family proteinCoding geneHOM000136 ORTHO000012
X AT3G56891Heavy metal transport/detoxification superfamily protein ; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121), Heavy-metal-associated, conserved site (InterPro:IPR017969); BEST Arabidopsis thaliana protein match is: Heavy metal transport/detoxification superfamily protein (TAIR:AT2G18196.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;Heavy metal transport/detoxification superfamily protein Coding geneHOM000278 ORTHO024909
X AT3G56900Transducin/WD40 repeat-like superfamily protein; CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943), WD40 repeat, subgroup (InterPro:IPR019781); Has 4015 Blast hits to 2516 proteins in 309 species: Archae - 52; Bacteria - 1176; Metazoa - 1329; Fungi - 813; Plants - 363; Viruses - 0; Other Eukaryotes - 282 (source: NCBI BLink).;Transducin/WD40 repeat-like superfamily proteinCoding geneHOM005302 ORTHO004202
V AT3G56910plastid-specific 50S ribosomal protein 5 (PSRP5); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 42 Blast hits to 42 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;plastid-specific 50S ribosomal protein 5Coding genesingleton
X AT3G56920DHHC-type zinc finger family protein; FUNCTIONS IN: zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: DHHC-type zinc finger family protein (TAIR:AT2G40990.1); Has 5096 Blast hits to 5086 proteins in 252 species: Archae - 0; Bacteria - 0; Metazoa - 2197; Fungi - 759; Plants - 834; Viruses - 0; Other Eukaryotes - 1306 (source: NCBI BLink).;DHHC-type zinc finger family proteinCoding geneHOM000058 ORTHO017416
X AT3G56930DHHC-type zinc finger family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: DHHC-type zinc finger family protein (TAIR:AT5G05070.1); Has 5165 Blast hits to 5156 proteins in 254 species: Archae - 0; Bacteria - 0; Metazoa - 2209; Fungi - 768; Plants - 846; Viruses - 2; Other Eukaryotes - 1340 (source: NCBI BLink).;DHHC-type zinc finger family proteinCoding geneHOM000058 ORTHO010559
V AT3G56940Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site.;dicarboxylate diiron protein, putative (Crd1)Coding geneHOM002326 ORTHO003029
V AT3G56950One of the Major Intrinsic Proteins(MIPs) which facilitate the passive transport of small molecules across membranes.Belongs to a family of plant aquaporins.Similar to yeast and radish aquaporins. Located on ER.;small and basic intrinsic protein 2;1Coding geneHOM006873 ORTHO024910
V AT3G56960Encodes a protein with phosphatidylinositol-4-phosphate 5-kinase activity that plays a role in pollen tip growth. The enzyme localizes to the apical plasma membrane and adjacent cytosolic region of pollen tubes. Overexpression of this gene leads to increased deposition of pectin in the cell wall at the tip of the pollen tube and causes altered pollen tube morphology.;phosphatidyl inositol monophosphate 5 kinase 4Coding geneHOM000059 ORTHO002465
X AT3G56970Encodes a member of the basic helix-loop-helix transcription factor family protein.;basic helix-loop-helix (bHLH) DNA-binding superfamily proteinCoding geneHOM009864 ORTHO011048
X AT3G56980Encodes a member of the basic helix-loop-helix transcription factor protein.;basic helix-loop-helix (bHLH) DNA-binding superfamily proteinCoding geneHOM009864 ORTHO011048
X AT3G56990embryo sac development arrest 7 (EDA7); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: megagametogenesis; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like-containing domain (InterPro:IPR011046), NUC153 (InterPro:IPR012580), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like-containing domain (InterPro:IPR015943); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).;embryo sac development arrest 7Coding geneHOM002584 ORTHO001804
X AT3G57000nucleolar essential protein-related; CONTAINS InterPro DOMAIN/s: Ribosomal biogenesis, methyltransferase, EMG1/NEP1 (InterPro:IPR005304); Has 1079 Blast hits to 938 proteins in 280 species: Archae - 143; Bacteria - 12; Metazoa - 353; Fungi - 181; Plants - 69; Viruses - 2; Other Eukaryotes - 319 (source: NCBI BLink).;nucleolar essential protein-relatedCoding geneHOM002696 ORTHO001853
V AT3G57010Calcium-dependent phosphotriesterase superfamily protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Strictosidine synthase (InterPro:IPR004141), Strictosidine synthase, conserved region (InterPro:IPR018119), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: Calcium-dependent phosphotriesterase superfamily protein (TAIR:AT3G57020.1); Has 984 Blast hits to 970 proteins in 187 species: Archae - 1; Bacteria - 187; Metazoa - 221; Fungi - 0; Plants - 480; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).;Calcium-dependent phosphotriesterase superfamily proteinCoding geneHOM000425 ORTHO017419
V AT3G57020Calcium-dependent phosphotriesterase superfamily protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum, vacuole; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: Calcium-dependent phosphotriesterase superfamily protein (TAIR:AT3G57010.1); Has 1029 Blast hits to 1017 proteins in 197 species: Archae - 1; Bacteria - 199; Metazoa - 238; Fungi - 6; Plants - 476; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink).;Calcium-dependent phosphotriesterase superfamily proteinCoding geneHOM000425 ORTHO017419
V AT3G57030Calcium-dependent phosphotriesterase superfamily protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: Calcium-dependent phosphotriesterase superfamily protein (TAIR:AT5G22020.1); Has 1145 Blast hits to 1130 proteins in 241 species: Archae - 1; Bacteria - 292; Metazoa - 224; Fungi - 14; Plants - 486; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).;Calcium-dependent phosphotriesterase superfamily proteinCoding geneHOM000425 ORTHO005990
X AT3G57040response regulator ARR9, A two-component response regulator-like protein with a receiver domain with a conserved aspartate residue and a possible phosphorylation site and at the N-terminal half. Appears to interact with histidine kinase like genes ATHP3 and ATHP2;response regulator 9Coding geneHOM000464 ORTHO002246
V AT3G57050Encodes second enzyme in the methionine biosynthetic pathway;cystathionine beta-lyaseCoding geneHOM000249 ORTHO002032
X AT3G57060binding; FUNCTIONS IN: binding; INVOLVED IN: mitosis, chromosome condensation; LOCATED IN: nucleus, condensin complex; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Non-SMC condensin subunit, XCAP-D2/Cnd1 (InterPro:IPR007673), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT4G15890.1).;bindingCoding geneHOM002313 ORTHO001455
X AT3G57062unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding genesingleton
V AT3G57070Glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: N-terminal protein myristoylation, cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: Glutaredoxin family protein (TAIR:AT2G41330.1); Has 1224 Blast hits to 656 proteins in 101 species: Archae - 0; Bacteria - 41; Metazoa - 125; Fungi - 4; Plants - 389; Viruses - 0; Other Eukaryotes - 665 (source: NCBI BLink).;Glutaredoxin family proteinCoding geneHOM000773 ORTHO002261
X AT3G57072unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink).Coding genesingleton
X AT3G57080Non-catalytic subunit unique to Nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB5.;Eukaryotic rpb5 RNA polymerase subunit family proteinCoding geneHOM000944 ORTHO013517
V AT3G57090Encodes a protein with similarity to yeast FIS proteins. These membrane anchored proteins bind DRP proteins and function during organelle division. FIS1B is expressed ubiquitously and appears to be involved in peroxisome division.;Tetratricopeptide repeat (TPR)-like superfamily proteinCoding geneHOM004208 ORTHO004203
X AT3G57100Protein of unknown function (DUF677); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF677 (InterPro:IPR007749); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF677) (TAIR:AT4G34320.1); Has 123 Blast hits to 123 proteins in 12 species: Archae - 2; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 116; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).;Protein of unknown function (DUF677)Coding geneHOM003976 ORTHO085535
V AT3G57110unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G60370.1); Has 16 Blast hits to 16 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding geneHOM008975 ORTHO078531
X AT3G57120Protein kinase superfamily protein; FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, catalytic domain (InterPro:IPR000719), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein / peptidoglycan-binding LysM domain-containing protein (TAIR:AT1G51940.1); Has 39405 Blast hits to 37293 proteins in 1762 species: Archae - 14; Bacteria - 4560; Metazoa - 7143; Fungi - 1468; Plants - 21966; Viruses - 110; Other Eukaryotes - 4144 (source: NCBI BLink).;Protein kinase superfamily proteinCoding geneHOM000001 ORTHO024911
X AT3G57130Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1.;Ankyrin repeat family protein / BTB/POZ domain-containing proteinCoding geneHOM003329 ORTHO009052
X AT3G57140sugar-dependent 1-like (SDP1-LIKE); FUNCTIONS IN: GTP binding; INVOLVED IN: metabolic process, lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Acyl transferase/acyl hydrolase/lysophospholipase (InterPro:IPR016035), Protein of unknown function DUF3336 (InterPro:IPR021771), ARF/SAR superfamily (InterPro:IPR006689), Patatin (InterPro:IPR002641); BEST Arabidopsis thaliana protein match is: Patatin-like phospholipase family protein (TAIR:AT5G04040.1); Has 1079 Blast hits to 1061 proteins in 366 species: Archae - 0; Bacteria - 487; Metazoa - 11; Fungi - 361; Plants - 73; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink).;sugar-dependent 1-likeCoding geneHOM000734 ORTHO001584
V AT3G57150Encodes a putative pseudouridine synthase (NAP57).;homologue of NAP57Coding geneHOM001849 ORTHO001081
X AT3G57157rna_type=other_rna;other RNARNA gene
X AT3G57160unknown protein; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).Coding genesingleton
X AT3G57170N-acetylglucosaminyl transferase component family protein / Gpi1 family protein; FUNCTIONS IN: transferase activity, phosphatidylinositol N-acetylglucosaminyltransferase activity; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: N-acetylglucosaminyl transferase component (InterPro:IPR007720); Has 334 Blast hits to 333 proteins in 180 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 132; Plants - 32; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).;N-acetylglucosaminyl transferase component family protein / Gpi1 family proteinCoding geneHOM015044 ORTHO009155
V AT3G57180BRASSINAZOLE(BRZ) INSENSITIVE PALE GREEN 2 (BPG2); FUNCTIONS IN: GTP binding; INVOLVED IN: brassinosteroid mediated signaling pathway, developmental process; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: P-loop containing nucleoside triphosphate hydrolases superfamily protein (TAIR:AT4G10620.1); Has 5185 Blast hits to 4152 proteins in 947 species: Archae - 97; Bacteria - 1334; Metazoa - 1316; Fungi - 649; Plants - 254; Viruses - 94; Other Eukaryotes - 1441 (source: NCBI BLink).;P-loop containing nucleoside triphosphate hydrolases superfamily proteinCoding geneHOM002042 ORTHO001585
X AT3G57190peptide chain release factor, putative; FUNCTIONS IN: translation release factor activity, codon specific, translation release factor activity; INVOLVED IN: translational termination; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352), Peptide chain release factor (InterPro:IPR005139); BEST Arabidopsis thaliana protein match is: high chlorophyll fluorescent 109 (TAIR:AT5G36170.2); Has 13500 Blast hits to 13496 proteins in 2706 species: Archae - 0; Bacteria - 9313; Metazoa - 113; Fungi - 108; Plants - 181; Viruses - 0; Other Eukaryotes - 3785 (source: NCBI BLink).;peptide chain release factor, putativeCoding geneHOM000318 ORTHO024912
X AT3G57200unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41451.1); Has 94 Blast hits to 94 proteins in 31 species: Archae - 0; Bacteria - 12; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).Coding geneHOM003124 ORTHO024445
X AT3G57210Protein of unknown function (DUF626); CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF626) (TAIR:AT1G22090.1); Has 148 Blast hits to 147 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).;Protein of unknown function (DUF626)Coding geneHOM001729 ORTHO000790
V AT3G57220Glycosyl transferase family 4 protein; FUNCTIONS IN: UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity; INVOLVED IN: polysaccharide biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 4, conserved region (InterPro:IPR018481); BEST Arabidopsis thaliana protein match is: UDP-glcnac-adolichol phosphate glcnac-1-p-transferase (TAIR:AT2G41490.1); Has 6923 Blast hits to 6922 proteins in 2293 species: Archae - 137; Bacteria - 5522; Metazoa - 126; Fungi - 129; Plants - 61; Viruses - 0; Other Eukaryotes - 948 (source: NCBI BLink).;Glycosyl transferase family 4 proteinCoding geneHOM002197 ORTHO001475
X AT3G57230MADS-box transcription factor. Expressed in leaf, root and stem, with higher RNA accumulation in guard cells and trichomes.;AGAMOUS-like 16Coding geneHOM000099 ORTHO024913
X AT3G57240encodes a member of glycosyl hydrolase family 17;beta-1,3-glucanase 3Coding geneHOM000056 ORTHO000817
X AT3G57250Emsy N Terminus (ENT) domain-containing protein; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491); Has 6 Blast hits to 6 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).;Emsy N Terminus (ENT) domain-containing proteinCoding genesingleton
V AT3G57260beta 1,3-glucanase;beta-1,3-glucanase 2Coding geneHOM000056 ORTHO000817
X AT3G57270encodes a member of glycosyl hydrolase family 17;beta-1,3-glucanase 1Coding geneHOM000056 ORTHO000817
V AT3G57280Transmembrane proteins 14C; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: Transmembrane proteins 14C (TAIR:AT3G20510.1); Has 169 Blast hits to 169 proteins in 36 species: Archae - 0; Bacteria - 2; Metazoa - 27; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).;Transmembrane proteins 14CCoding geneHOM002247 ORTHO004639
V AT3G57290Encodes a protein that is found in not only the eif3 complex but also in association with subunits of the COP9 signalosome. eIF3e appears to be subjected to proteasome-dependent degradation that requires the PCI domain of eIF3e. The level of eIF3e present in cells appears to affect the rate of translation.;eukaryotic translation initiation factor 3ECoding geneHOM002011 ORTHO000835