TAPIR: target prediction for plant microRNAs

Search using the FASTA engine.

Paste microRNA sequence(s) [Fasta format]


or

Upload microRNA sequence(s) [Fasta format]




Paste target sequence(s) [Fasta format]


or

Upload target sequence(s) [Fasta format]

Score

Free Energy Ratio

Search using the RNAhybrid engine.

Paste microRNA sequence(s) [Fasta format]


or

Upload microRNA sequence(s) [Fasta format]




Paste target sequence(s) [Fasta format]


or

Upload target sequence(s) [Fasta format]

OR

Pre-computer results




Species:
microRNA:

Score

Free Energy Ratio

(with target mimicry search)
(without target mimicry search)

TAPIR webserver manual

The TAPIR webserver predicts targets for plant miRNAs. Two different search modes are possible, corresponding to two different tabs of the web interface. The "Fast" mode is using the FASTA (1) search engine while the "Precise" mode is using the RNAhybrid (2) search engine.

Input data

Both miRNA and target sequence(s) can be pasted in text boxes as data input for the program. The sequences must be in the Fasta format. Alternatively, you can upload Fasta formatted files using the "upload" buttons.

Target search parameters

You can define two parameters for each search: the score and the free energy ratio. The score calculation is based on the results of previous computational and experimental studies (3-5). Mismatches and gaps are scored 1, while G:U pairs are scored 0.5. The region of the miRNA:mRNA duplex defined between the position 2 and 12 of the miRNA sequence (usually called the "seed" or "core" region) was shown to be especially important for target recognition. Mismatches, gaps and G:U pairs scores are doubled within this region. The free energy ratio is also an important parameter, defined by dividing the free energy of the predicted miRNA:mRNA duplex by the free energy of the corresponding duplex having a perfect complementarity. The score cutoff value should be positive, while the free energy ratio cutoff should be equal or greater than 0 and less than or equal to 1. The search will keep all miRNA:mRNA duplexes that have a score less than or equal to the score cutoff and a free energy ratio greater than or equal to the free energy ratio cutoff. The default value for the score cutoff is a conservative 4.0 and the default value for the free energy ratio is 0.7 (70% of the free energy of a miRNA:mRNA duplex having a perfect complementarity).

Submission

Most target searches are time-consuming and will not return results immediately. The TAPIR webserver displays a temporary page showing the progress of the search as long as it is not finished. The progress page can be bookmarked for a later retrieval. When the search is over, the results are displayed directly on the page. The result page can be bookmarked, saved or copy-pasted to a text file. The results page is kept on the server for 24 hours.

Output format

For each miRNA:mRNA duplex retained, the following information is displayed:

miRNA         ath-miR163 
target        AT1G66720.1 
score         2 
mfe_ratio     0.91 
start         333 
seed_gap      0 
seed_mismatch 0 
seed_gu       1 
gap           1 
mismatch      0 
gu            0 
miRNA_seq  3' UAGCUUCAAGGUUCAGGAGAAGUU 
aln           ||||.|||||||o||||||||||| 
target_seq 5' AUCG-AGUUCCAGGUCCUCUUCAA 
// 

miRNA
miRNA name
target
mRNA target name
score
global score value (see above)
mfe_ratio
Free energy ratio f the miRNA:mRNA duplex
start
start position of the alignment on the mRNA sequence
seed_gap
number of gaps in the seed region
seed_mismatch
number of mismatches in the seed region
seed_gu
number of G:U pairs in the seed region
gap
number of gaps outside the seed region
mismatch
number of mismatches outside the seed region
gu
number of G:U pairs outside the seed region

The next three lines display the miRNA:mRNA duplex with the alignment string (‘|‘ indicate complementary bases, ‘.‘ mismatches ‘-‘ gaps and ‘o‘ G:U pairs). The miRNA sequence is shown in reverse orientation, i.e. 3‘ -> 5‘.

Precise search: extra options and features

The "Precise" tab is using RNAhybrid as the search engine, an algorithm conceived to determine miRNA:mRNA duplexes with a very high accuracy (2).

For a target search done using the RNAhybrid search engine, the output has one extra parameter displayed, namely the absolute value of the free energy of the miRNA:mRNA duplex (mfe), expressed in Kcal/Mol.

The RNAhybrid search engine being quite slow, we have pre-computed searches for ten plant genomes and their corresponding sets of annotated miRNAs. The selected plant genomes correspond to fully sequenced genomes and for which a large set of annotated miRNAs is available. The available species on the server are Arabidopsis thaliana (thale cress), Oryza sativa (rice), Zea mays (maize), Populus trichocarpa (poplar), Chlamydomonas reinhardtii (green algae), Physcomitrella patens (moss), Sorghum bicolor, Vitis vinifera (grape vine), Medicago truncatula (barrel medic) and Glycine max (soybean). Whenever possible, cDNA gene sequences were used for the prediction, as plant miRNAs can also bind within UTR regions. All the plant miRNA sequences were extracted from the miRBase repository (6).

All the pre-computed results are raw, in the sense that they are not filtered according to any cutoff values. To use pre-computed data, you will have to select the species and the miRNA of your choice (click the corresponding drop-down lists). Then you can set the score and free energy ratio cutoff, or just accept the default values.

The sensitivity of the RNAhybrid search engine allow to search for miRNA target mimicry, which are miRNA:mRNA duplexes having a large bulge around the traditional cleavage site (positions 10 and 11 of the miRNA sequence). Those targets were shown to sequester miRNAs, therefore inhibiting miRNA activity (7). To search for miRNA target mimicry, you just have to check the box "Target mimicry search". The input data remains the same as for target search (paste and upload miRNA and target sequences, pre-computed data). The algorithm is selecting miRNA:mRNA duplexes having a bulge of 3 nucleotides between positions 10 and 11 of the miRNA sequences. The positions 10 and 11 should also be paired (Watson-crick or G:U pairs) and the free energy ratio should be greater than or equal to the free energy ratio cutoff value. The default value for the cutoff is 0.7. As there is no score defined for miRNA target mimicry search, this parameter is not available.

List of plant genomes used for pre-computed results

Organism Common name Database link Version
Arabidopsis thaliana Thale cress http://www.arabidopsis.org TAIR9
Oryza sativa Rice http://rice.plantbiology.msu.edu/ Version 6.1
Chlamydomonas reinhardtii   http://genome.jgi-psf.org/Chlre4/Chlre4.home.html Version 4.0
Physcomitrella patens moss http://genome.jgi-psf.org/Phypa1_1/Phypa1_1.home.html Version 1.1
Populus trichocarpa Poplar http://genome.jgi-psf.org/Poptr1_1/Poptr1_1.home.html Version 1.1
Sorghum bicolor Sorghum http://genome.jgi-psf.org/Sorbi1/Sorbi1.home.html Version 1.0
Zea mays Maize http://www.maizesequence.org/index.html Version 4a.53
Glycine max soybean http://www.phytozome.net/soybean.php Version 1.0
Medicago truncatula Barrel medic http://www.medicago.org/ Version 3.0
Vitis vinifera Grape vine http://www.genoscope.cns.fr/spip/Vitis-vinifera-whole-genome.html Version 1.0

Standalone version

We provide here a standalone version of the TAPIR software for Linux systems. The tool is released under the terms of the GNU GPL version 2 and is free of charge for academics and nonprofit organizations. See the file readme.txt for details.

Download

References

  1. Pearson, W. (2004) Finding protein and nucleotide similarities with FASTA. Curr Protoc Bioinformatics, Chapter 3, Unit3 9.
  2. Kruger, J. and Rehmsmeier, M. (2006) RNAhybrid: microRNA target prediction easy, fast and flexible. Nucleic Acids Res, 34, W451-454.
  3. Allen, E., Xie, Z., Gustafson, A.M. and Carrington, J.C. (2005) microRNA-directed phasing during trans-acting siRNA biogenesis in plants. Cell, 121, 207-221.
  4. Schwab, R., Palatnik, J.F., Riester, M., Schommer, C., Schmid, M. and Weigel, D. (2005) Specific effects of microRNAs on the plant transcriptome. Dev Cell, 8, 517-527.
  5. Rhoades, M.W., Reinhart, B.J., Lim, L.P., Burge, C.B., Bartel, B. and Bartel, D.P. (2002) Prediction of plant microRNA targets. Cell, 110, 513-520.
  6. Griffiths-Jones, S., Saini, H.K., van Dongen, S. and Enright, A.J. (2008) miRBase: tools for microRNA genomics. Nucleic Acids Res, 36, D154-158.
  7. Franco-Zorrilla, J.M., Valli, A., Todesco, M., Mateos, I., Puga, M.I., Rubio-Somoza, I., Leyva, A., Weigel, D., Garcia, J.A. and Paz-Ares, J. (2007) Target mimicry provides a new mechanism for regulation of microRNA activity. Nat Genet, 39, 1033-1037.

Contact:
VIB / UGent
Bioinformatics & Evolutionary Genomics
Technologiepark 927
B-9052 Gent
BELGIUM
+32 (0) 9 33 13807 (phone)
+32 (0) 9 33 13809 (fax)

Don't hesitate to contact the in case of problems with the website!