AFLP in SILICO v2
if you used this tool please cite our paper:
"AFLPinSilico, simulating AFLP fingerprints" (2002/3) Stephane Rombauts, Yves Van de Peer, and Pierre RouzÈ Bioinformatics,
Bioinformatics. 2003 Apr 12;19(6):776-7. PMID: 12691992

Thank you.
Stephane

Sequences to submit

    please only submit fasta formated sequences as pure/simple text files, no word documents or other binary things
.

Restriction Site 1

 extended genetic code possible

Restriction Site 2

 extended genetic code possible

Length of adaptor

 use 0 for non

Selective Nucleotide(s) with Site 1

 use N for non

Selective Nucleotide(s) with Site 2

 use N for non

type of analysis

 AFLP
Transcript Profiling, cDNA-AFLP
digest using 1 restriction enzyme

HOW-TO:

   - The sequences should be formatted in FASTA format, all the sequences should be stored one after the other 
     in 1 big pure ASCII text file
   	(word documents are binary files, not pure ASCII text!! and won't work, neither are excel sheets etc)
   		eg.
		>sequence_1
		ACGTAGCGATAAGCAGGACTACAACGCACGAATATCAGCAGCACTCTACAGCAGTA
		ACGATAGACGATACAGATACACTACTACTATAGACGATTCTCTCGACGAGACTACA
		AAACT
		>sequence_2
		ACGATAGACGATACAGATACACTACTACTATAGACGATTCTCTCGACGAGACTACA
		ACGTAGCGATAAGCAGGACTACAACGCACGAACTATAGACGATTCTCTTGACTA
			
   - The motif recognized by the restriction enzyme should be given (see also IUPAC code below). Not the name of the enzyme!
   		= the position of the cut can be given with a '^' (eg R^GATCY), but is only used with the DIGEST option
   		= for TPF (cDNA-AFLP) and AFLP no exact cut is used, but each fragment returned begins and ends with the whole site 
		  as recognized by one of the used enzymes.
		= for the DIGEST exact place of the cut is added, but still the whole site is included
   - The extended genetic code can be used for the restriction sites... The order of the sites is important, especially for cDNA-AFLP
   - For the selective nucleotides N will act as 'no selective nucleotide'
   
   There is no real limit on the size of sequences one can submit (the whole genome (120Mb) of Arabidopsis works fine)
   

  IUPAC = "A" => "A"
	       "C" => "C"
	       "G" => "G"
	       "T" => "T"
	       "U" => "T"
	       "M" => "(A/C)"
	       "R" => "(A/G)"
	       "W" => "(A/T)"
		"S" => "(C/G)"
		"Y" => "(C/T)"
		"K" => "(G/T)"
		"V" => "(A/C/G)"
		"H" => "(A/C/T)"
		"D" => "(A/G/T)"
		"B" => "(C/G/T)"
		"N" => "(A/C/G/T)"
		"X" => "(A/C/G/T)"

BUG REPORT: report to me
26/02/2002 Frank (frbre) reported problem with selective nucleotides (solved)
22/08/2003 bug reported (in new version) about some fragments that still had a restriction site within the fragment (solved)

alternatively you can also visit In-silico.com
for bacterial genomes only.