EuGene help page
Organism
Select the appropriate organism from the drop-down list. By specifing the organism, the splice-site predictor and EuGene version trained for that species will be used to do the prediction.
Sequence Input
The query sequence has to be provided in FASTA format (multi-fasta file also allowed!)
A sequence in FASTA format begins with a single-line description, followed by lines of sequence data. The description line is distinguished from the sequence data by a greater-than (">") symbol in the first column. The word following the ">" symbol is the identifier of the sequence, and the rest of the line is the description (description is optional). There should be no space between the ">" and the first letter of the identifier.
A simple example of a sequence in FASTA format:
>My_input_sequence
ATCGCGTAGCTATATGCGGCGATATCGACATCGACTATACGTGGTTGGCTACGTAC
CACTGAGTCTATTATCTGCTATCGAGCTATCGGACGACATCGCTGATTGCTATCTA
TACGTCGAAATTCGCGTATTATCGCGGGTATTCGACTTATATCTGGGATTTCTTAC
ACATCGACGCGTATCGTCGAGTTTATCGGGATCAGCGATCGCTACGAC
You can either upload a fasta file or paste a sequence in the sequence-field.
Make sure that your sequence only contains capital letters!!
Output format parameters
With these parameters you can control the formatting of the output from EuGene. These options however do not determine the sequence/feature format of the prediction. On the result page a list of possible feature format is provided to download the prediction results.
None of these options however have any effect on the actual gene prediciton by EuGene, they are solely used to format the output.
Report Introns
When 'Yes' is selected, also the location (coordinates) of the introns will be reported.
Trim Predicted UTR
When this option is deactivated the predicted UTR is also reported. Default is off, which means that the UTR will be trimmed.
EuGene is natively capable of predicting UTR. If desired however, the UTR prediction of EuGene can be trimmed to be exactly consistent with the transcript evidence available. If no evidence is available, this means that all UTR predictions will be removed from the output.
Truncate name:
In the textual output, each predicted gene element is prefixed by the FASTA sequence id (or the filename if no FASTA id is available). This name is truncated to the number of characters indicated.
Default is 5. If set to 0, the full id is used.
Increase Gene number
This option determines the numbering of the predicted elements. Default is 1, which means that the genes are numbered with an increase of 1 (gene1, gene2, ...). If a value of eg. 10 is specified than the numbers will increase by 10 (gene1, gene11, gene21,...)
|
|
